Valyl-tRNA synthetase gene of Escherichia coli K12: Molecular genetic characterization and homology within a family of aminoacyl-tRNA synthetases

International Nuclear Information System (INIS)

Heck, J.D. III.

1988-01-01

This work reports the subcloning and characterization of the molecular elements necessary for the expression of the Escherichia coli valS gene encoding valyl-tRNA synthetase. The valS gene was subcloned from plasmid pLC26-22 by genetic complementation of a valS ts strain. The DNA region encoding the valS structural gene was determined by in vitro coupled transcription-translation assays. Cells transformed with a plasmid containing a full length copy of the valS gene enhanced in vivo valyl-tRNA synthetase specific activity twelve-fold. DNA sequences flanking the valS structural gene are presented. The transcription initiation sites of the valS gene were determined, in vivo and in vitro, by S1 nuclease protection studies, primer-extension analysis and both [α- 32 P]labeled and [γ- 32 P]end-labeled in vitro transcription assays. The DNA sequence of the valS gene of Escherichia coli has been determined. Significant similarity at the primary sequence level was detected between valyl-tRNA synthetase of E. coli and other known branched-chain aminoacyl-tRNA synthetases. An extended open reading frame (ORF) encoded on the DNA strand opposite the valS structural gene is described

Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

International Nuclear Information System (INIS)

Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin

2006-01-01

Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues

OpenAIRE

Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

2014-01-01

microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents ...

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

Darwinian Evolution of Mutualistic RNA Replicators with Different Genes

Science.gov (United States)

Mizuuchi, R.; Ichihashi, N.

2017-07-01

We report a sustainable long-term replication and evolution of two distinct cooperative RNA replicators encoding different genes. One of the RNAs evolved to maintain or increase the cooperativity, despite selective advantage of selfish mutations.

A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.

Science.gov (United States)

Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L

2017-07-15

Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.

RNA-seq reveals more consistent reference genes for gene expression studies in human non-melanoma skin cancers

Directory of Open Access Journals (Sweden)

Van L.T. Hoang

2017-08-01

Full Text Available Identification of appropriate reference genes (RGs is critical to accurate data interpretation in quantitative real-time PCR (qPCR experiments. In this study, we have utilised next generation RNA sequencing (RNA-seq to analyse the transcriptome of a panel of non-melanoma skin cancer lesions, identifying genes that are consistently expressed across all samples. Genes encoding ribosomal proteins were amongst the most stable in this dataset. Validation of this RNA-seq data was examined using qPCR to confirm the suitability of a set of highly stable genes for use as qPCR RGs. These genes will provide a valuable resource for the normalisation of qPCR data for the analysis of non-melanoma skin cancer.

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

Science.gov (United States)

Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

2013-12-01

Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

BIOLOGICAL FUNCTION OF TOMBUSVIRUS-ENCODED SUPPRESSOR OF RNA SILENCING IN PLANTS

Directory of Open Access Journals (Sweden)

Omarov R.T.

2012-08-01

Full Text Available RNA interference (RNAi plays multiple biological roles in eukaryotic organisms to regulate gene expression. RNAi also operates as a conserved adaptive molecular immune mechanism against invading viruses. The antiviral RNAi pathway is initiated with the generation of virus-derived short-interfering RNAs (siRNAs that are used for subsequent sequence-specific recognition and degradation of the cognate viral RNA molecules. As an efficient counter-defensive strategy, most plant viruses evolved the ability to encode specific proteins capable of interfering with RNAi, and this process is commonly known as RNA silencing suppression. Virus-encoded suppressors of RNAi (VSRs operate at different steps in the RNAi pathway and display distinct biochemical properties that enable these proteins to efficiently interfere with the host-defense system. Tombusvirus-encoded P19 is an important pathogenicity factor, required for symptom development and elicitation of a hypersensitive response in a host-dependent manner. Protein plays a crucial role of TBSV P19 in protecting viral RNA during systemic infection on Nicotiana benthamiana. The X-ray crystallographic studies conducted by two independent groups revealed the existence of a P19-siRNA complex; a conformation whereby caliper tryptophan residues on two subunits of P19 dimers measure and bind 21-nt siRNA duplexes. These structural studies provided the first details on the possible molecular mechanism of any viral suppressor to block RNAi. The association between P19 and siRNAs was also shown to occur in infected plants These and related studies revealed that in general the ability of P19 to efficiently sequester siRNAs influences symptom severity, however this is not a strict correlation in all hosts.The current working model is that during TBSV infection of plants, P19 appropriates abundantly circulating Tombusvirus-derived siRNAs thereby rendering these unavailable to program RISC, to prevent degradation of

Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

NARCIS (Netherlands)

L.M. 't Hart (Leen); H.A.P. Pols (Huib); T. Hansen (Torben); I. Rietveld (Ingrid); J.M. Dekker (Jacqueline); J.A. Maassen (Johannes); M.G.A.A.M. Nijpels (Giel); G.M.C. Janssen (George); P.P. Arp (Pascal); R.J. Heine (Robert); A.G. Uitterlinden (André); T. Jorgensen (Torben); C.M. van Duijn (Cornelia); K. Borch-Johnsen; O. Pedersen (Oluf)

2005-01-01

textabstractPreviously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Transcription Profiling of Bacillus subtilis Cells Infected with AR9, a Giant Phage Encoding Two Multisubunit RNA Polymerases.

Science.gov (United States)

Lavysh, Daria; Sokolova, Maria; Slashcheva, Marina; Förstner, Konrad U; Severinov, Konstantin

2017-02-14

Bacteriophage AR9 is a recently sequenced jumbo phage that encodes two multisubunit RNA polymerases. Here we investigated the AR9 transcription strategy and the effect of AR9 infection on the transcription of its host, Bacillus subtilis Analysis of whole-genome transcription revealed early, late, and continuously expressed AR9 genes. Alignment of sequences upstream of the 5' ends of AR9 transcripts revealed consensus sequences that define early and late phage promoters. Continuously expressed AR9 genes have both early and late promoters in front of them. Early AR9 transcription is independent of protein synthesis and must be determined by virion RNA polymerase injected together with viral DNA. During infection, the overall amount of host mRNAs is significantly decreased. Analysis of relative amounts of host transcripts revealed notable differences in the levels of some mRNAs. The physiological significance of up- or downregulation of host genes for AR9 phage infection remains to be established. AR9 infection is significantly affected by rifampin, an inhibitor of host RNA polymerase transcription. The effect is likely caused by the antibiotic-induced killing of host cells, while phage genome transcription is solely performed by viral RNA polymerases. IMPORTANCE Phages regulate the timing of the expression of their own genes to coordinate processes in the infected cell and maximize the release of viral progeny. Phages also alter the levels of host transcripts. Here we present the results of a temporal analysis of the host and viral transcriptomes of Bacillus subtilis infected with a giant phage, AR9. We identify viral promoters recognized by two virus-encoded RNA polymerases that are a unique feature of the phiKZ-related group of phages to which AR9 belongs. Our results set the stage for future analyses of highly unusual RNA polymerases encoded by AR9 and other phiKZ-related phages. Copyright © 2017 Lavysh et al.

Identification of Aquifex aeolicus tRNA (m2(2G26) methyltransferase gene.

Science.gov (United States)

Takeda, Hiroshi; Hori, Hiroyuki; Endo, Yaeta

2002-01-01

The modifications of N2,N2-dimethylguanine (m2(2)G) are found in tRNAs and rRNAs from eukarya and archaea. In tRNAs, modification at position G26 is generated by tRNA (m2(2)G26) methyltransferase, which is encoded by the corresponding gene, trm1. This enzyme catalyzes the methyl-transfer from S-adenosyl-L-methionine to the semi-conserved residue, G26, via the intermediate modified base, m2G26. Recent genome sequencing project has been reported that the putative trm1 is encoded in the genome of Aquifex aeolicus, a hyper-thermophilic eubacterium as only one exception among eubacteria. In order to confirm whether this bacterial trm1 gene product is a real tRNA (m2(2)G26) methyltransferase or not, we expressed this protein by wheat germ in vitro cell-free translation system. Our biochemical analysis clearly showed that this gene product possessed tRNA (m2(2)G26) methyltransferase activity.

Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes.

Science.gov (United States)

Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Qiu, Shuqing; Rollins, Meaghen; Datla, Raju; Gupta, Vidya S; Kadoo, Narendra Y

2013-04-01

MicroRNAs (miRNAs) are small (20-24 nucleotide long) endogenous regulatory RNAs that play important roles in plant growth and development. They regulate gene expression at the post-transcriptional level by translational repression or target degradation and gene silencing. In this study, we identified 116 conserved miRNAs belonging to 23 families from the flax (Linum usitatissimum L.) genome using a computational approach. The precursor miRNAs varied in length; while most of the mature miRNAs were 21 nucleotide long, intergenic and showed conserved signatures of RNA polymerase II transcripts in their upstream regions. Promoter region analysis of the flax miRNA genes indicated prevalence of MYB transcription factor binding sites. Four miRNA gene clusters containing members of three phylogenetic groups were identified. Further, 142 target genes were predicted for these miRNAs and most of these represent transcriptional regulators. The miRNA encoding genes were expressed in diverse tissues as determined by digital expression analysis as well as real-time PCR. The expression of fourteen miRNAs and nine target genes was independently validated using the quantitative reverse transcription PCR (qRT-PCR). This study suggests that a large number of conserved plant miRNAs are also found in flax and these may play important roles in growth and development of flax.

pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A Sequences

Directory of Open Access Journals (Sweden)

Alexandra E Grier

2016-01-01

Full Text Available Increasing demand for large-scale synthesis of in vitro transcribed (IVT mRNA is being driven by the increasing use of mRNA for transient gene expression in cell engineering and therapeutic applications. An important determinant of IVT mRNA potency is the 3′ polyadenosine (poly(A tail, the length of which correlates with translational efficiency. However, present methods for generation of IVT mRNA rely on templates derived from circular plasmids or PCR products, in which homopolymeric tracts are unstable, thus limiting encoded poly(A tail lengths to ≃120 base pairs (bp. Here, we have developed a novel method for generation of extended poly(A tracts using a previously described linear plasmid system, pJazz. We find that linear plasmids can successfully propagate poly(A tracts up to ≃500 bp in length for IVT mRNA production. We then modified pJazz by removing extraneous restriction sites, adding a T7 promoter sequence upstream from an extended multiple cloning site, and adding a unique type-IIS restriction site downstream from the encoded poly(A tract to facilitate generation of IVT mRNA with precisely defined encoded poly(A tracts and 3′ termini. The resulting plasmid, designated pEVL, can be used to generate IVT mRNA with consistent defined lengths and terminal residue(s.

Extreme heterogeneity of polyadenylation sites in mRNAs encoding chloroplast RNA-binding proteins in Nicotiana plumbaginifolia.

Science.gov (United States)

Klahre, U; Hemmings-Mieszczak, M; Filipowicz, W

1995-06-01

We have previously characterized nuclear cDNA clones encoding two RNA binding proteins, CP-RBP30 and CP-RBP-31, which are targeted to chloroplasts in Nicotiana plumbaginifolia. In this report we describe the analysis of the 3'-untranslated regions (3'-UTRs) in 22 CP-RBP30 and 8 CP-RBP31 clones which reveals that mRNAs encoding both proteins have a very complex polyadenylation pattern. Fourteen distinct poly(A) sites were identified among CP-RBP30 clones and four sites among the CP-RBP31 clones. The authenticity of the sites was confirmed by RNase A/T1 mapping of N. plumbaginifolia RNA. CP-RBP30 provides an extreme example of the heterogeneity known to be a feature of mRNA polyadenylation in higher plants. Using PCR we have demonstrated that CP-RBP genes in N. plumbaginifolia and N. sylvestris, in addition to the previously described introns interrupting the coding region, contain an intron located in the 3' non-coding part of the gene. In the case of the CP-RBP31, we have identified one polyadenylation event occurring in this intron.

Common changes in global gene expression induced by RNA polymerase inhibitors in Shigella flexneri.

Directory of Open Access Journals (Sweden)

Hua Fu

Full Text Available Characterization of expression profile of organisms in response to antimicrobials provides important information on the potential mechanism of action of the drugs. The special expression signature can be used to predict whether other drugs act on the same target. Here, the common response of Shigella flexneri to two inhibitors of RNA polymerase was examined using gene expression profiling. Consistent with similar effects of the two drugs, the gene expression profiles indicated that responses of the bacteria to these drugs were roughly the same, with 225 genes affected commonly. Of them, 88 were induced and 137 were repressed. Real-time PCR was performed for selected genes to verify the microarray results. Analysis of the expression data revealed that more than 30% of the plasmid-encoded genes on the array were up-regulated by the antibiotics including virF regulon, other virulence-related genes, and genes responsible for plasmid replication, maintenance, and transfer. In addition, some chromosome-encoded genes involved in virulence and genes acquired from horizontal transfer were also significantly up-regulated. However, the expression of genes encoding the beta-subunit of RNA polymerase was increased moderately. The repressed genes include those that code for products associated with the ribosome, citrate cycle, glycolysis, thiamine biosynthesis, purine metabolism, fructose metabolism, mannose metabolism, and cold shock proteins. This study demonstrates that the two antibiotics induce rapid cessation of RNA synthesis resulting in inhibition of translation components. It also indicates that the production of virulence factors involved in intercellular dissemination, tissue invasion and inflammatory destruction may be enhanced through derepressing horizontal transfer genes by the drugs.

Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

OpenAIRE

Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

1993-01-01

CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

[Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

Science.gov (United States)

Shpakovskiĭ, G V; Lebedenko, E N

1997-05-01

The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

Diversity of 23S rRNA genes within individual prokaryotic genomes.

Directory of Open Access Journals (Sweden)

Anna Pei

Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

Polymorphisms in miRNA genes and their involvement in autoimmune diseases susceptibility.

Science.gov (United States)

Latini, Andrea; Ciccacci, Cinzia; Novelli, Giuseppe; Borgiani, Paola

2017-08-01

MicroRNAs (miRNAs) are small non-coding RNA molecules that negatively regulate the expression of multiple protein-encoding genes at the post-transcriptional level. MicroRNAs are involved in different pathways, such as cellular proliferation and differentiation, signal transduction and inflammation, and play crucial roles in the development of several diseases, such as cancer, diabetes, and cardiovascular diseases. They have recently been recognized to play a role also in the pathogenesis of autoimmune diseases. Although the majority of studies are focused on miRNA expression profiles investigation, a growing number of studies have been investigating the role of polymorphisms in miRNA genes in the autoimmune diseases development. Indeed, polymorphisms affecting the miRNA genes can modify the set of targets they regulate or the maturation efficiency. This review is aimed to give an overview about the available studies that have investigated the association of miRNA gene polymorphisms with the susceptibility to various autoimmune diseases and to their clinical phenotypes.

Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

Rift Valley fever virus NSS gene expression correlates with a defect in nuclear mRNA export.

Science.gov (United States)

Copeland, Anna Maria; Van Deusen, Nicole M; Schmaljohn, Connie S

2015-12-01

We investigated the localization of host mRNA during Rift Valley fever virus (RVFV) infection. Fluorescence in situ hybridization revealed that infection with RVFV altered the localization of host mRNA. mRNA accumulated in the nuclei of RVFV-infected but not mock-infected cells. Further, overexpression of the NSS gene, but not the N, GN or NSM genes correlated with mRNA nuclear accumulation. Nuclear accumulation of host mRNA was not observed in cells infected with a strain of RVFV lacking the gene encoding NSS, confirming that expression of NSS is likely responsible for this phenomenon. Published by Elsevier Inc.

Suppressors of RNA silencing encoded by tomato leaf curl ...

Indian Academy of Sciences (India)

2013-01-06

Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

Use of bacterially expressed dsRNA to downregulate Entamoeba histolytica gene expression.

Directory of Open Access Journals (Sweden)

Carlos F Solis

Full Text Available BACKGROUND: Modern RNA interference (RNAi methodologies using small interfering RNA (siRNA oligonucleotide duplexes or episomally synthesized hairpin RNA are valuable tools for the analysis of gene function in the protozoan parasite Entamoeba histolytica. However, these approaches still require time-consuming procedures including transfection and drug selection, or costly synthetic molecules. PRINCIPAL FINDINGS: Here we report an efficient and handy alternative for E. histolytica gene down-regulation mediated by bacterial double-stranded RNA (dsRNA targeting parasite genes. The Escherichia coli strain HT115 which is unable to degrade dsRNA, was genetically engineered to produce high quantities of long dsRNA segments targeting the genes that encode E. histolytica beta-tubulin and virulence factor KERP1. Trophozoites cultured in vitro were directly fed with dsRNA-expressing bacteria or soaked with purified dsRNA. Both dsRNA delivery methods resulted in significant reduction of protein expression. In vitro host cell-parasite assays showed that efficient downregulation of kerp1 gene expression mediated by bacterial dsRNA resulted in significant reduction of parasite adhesion and lytic capabilities, thus supporting a major role for KERP1 in the pathogenic process. Furthermore, treatment of trophozoites cultured in microtiter plates, with a repertoire of eighty-five distinct bacterial dsRNA segments targeting E. histolytica genes with unknown function, led to the identification of three genes potentially involved in the growth of the parasite. CONCLUSIONS: Our results showed that the use of bacterial dsRNA is a powerful method for the study of gene function in E. histolytica. This dsRNA delivery method is also technically suitable for the study of a large number of genes, thus opening interesting perspectives for the identification of novel drug and vaccine targets.

Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

DEFF Research Database (Denmark)

Durkin, M E; Jäger, A C; Khurana, T S

1999-01-01

The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

Directory of Open Access Journals (Sweden)

Mariza M. Coêlho

2011-01-01

Full Text Available Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla, were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species.

Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

Directory of Open Access Journals (Sweden)

Jie Chen

2014-03-01

Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

Organization and transient expression of the gene for human U11 snRNA

Science.gov (United States)

Clemens, Suter-Crazzolara; Walter, Keller

1991-01-01

The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214

Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

Directory of Open Access Journals (Sweden)

Patrick O McGowan

Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

Directory of Open Access Journals (Sweden)

Jacqueline Schmuckli-Maurer

Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

Science.gov (United States)

Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

2014-01-01

microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

Improvement of In Vivo Expression of Genes Delivered by Self-Amplifying RNA Using Vaccinia Virus Immune Evasion Proteins

Science.gov (United States)

Beissert, Tim; Koste, Lars; Perkovic, Mario; Walzer, Kerstin C.; Erbar, Stephanie; Selmi, Abderraouf; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

2017-01-01

Among nucleic acid–based delivery platforms, self-amplifying RNA (saRNA) vectors are of increasing interest for applications such as transient expression of recombinant proteins and vaccination. saRNA is safe and, due to its capability to amplify intracellularly, high protein levels can be produced from even minute amounts of transfected templates. However, it is an obstacle to full exploitation of this platform that saRNA induces a strong innate host immune response. In transfected cells, pattern recognition receptors sense double-stranded RNA intermediates and via activation of protein kinase R (PKR) and interferon signaling initiate host defense measures including a translational shutdown. To reduce pattern recognition receptor stimulation and unleash suppressed saRNA translation, this study co-delivered non-replicating mRNA encoding vaccinia virus immune evasion proteins E3, K3, and B18. It was shown that E3 is far superior to K3 or B18 as a highly potent blocker of PKR activation and of interferon (IFN)-β upregulation. B18, in contrast, is superior in controlling OAS1, a key IFN-inducible gene involved in viral RNA degradation. By combining all three vaccinia proteins, the study achieved significant suppression of PKR and IFN pathway activation in vitro and enhanced expression of saRNA-encoded genes of interest both in vitro and in vivo. This approach promises to overcome key hurdles of saRNA gene delivery. Its application may improve the bioavailability of the encoded protein, and reduce the effective dose and correspondingly the cost of goods of manufacture in the various fields where saRNA utilization is envisioned. PMID:28877647

RNA-Seq-based analysis of cold shock response in Thermoanaerobacter tengcongensis, a bacterium harboring a single cold shock protein encoding gene.

Directory of Open Access Journals (Sweden)

Bo Liu

Full Text Available BACKGROUND: Although cold shock responses and the roles of cold shock proteins in microorganisms containing multiple cold shock protein genes have been well characterized, related studies on bacteria possessing a single cold shock protein gene have not been reported. Thermoanaerobacter tengcongensis MB4, a thermophile harboring only one known cold shock protein gene (TtescpC, can survive from 50° to 80 °C, but has poor natural competence under cold shock at 50 °C. We therefore examined cold shock responses and their effect on natural competence in this bacterium. RESULTS: The transcriptomes of T. tengcongensis before and after cold shock were analyzed by RNA-seq and over 1200 differentially expressed genes were successfully identified. These genes were involved in a wide range of biological processes, including modulation of DNA replication, recombination, and repair; energy metabolism; production of cold shock protein; synthesis of branched amino acids and branched-chain fatty acids; and sporulation. RNA-seq analysis also suggested that T. tengcongensis initiates cell wall and membrane remodeling processes, flagellar assembly, and sporulation in response to low temperature. Expression profiles of TtecspC and failed attempts to produce a TtecspC knockout strain confirmed the essential role of TteCspC in the cold shock response, and also suggested a role of this protein in survival at optimum growth temperature. Repression of genes encoding ComEA and ComEC and low energy metabolism levels in cold-shocked cells are the likely basis of poor natural competence at low temperature. CONCLUSION: Our study demonstrated changes in global gene expression under cold shock and identified several candidate genes related to cold shock in T. tengcongensis. At the same time, the relationship between cold shock response and poor natural competence at low temperature was preliminarily elucidated. These findings provide a foundation for future studies on genetic

Evolution of RLSB, a nuclear-encoded S1 domain RNA binding protein associated with post-transcriptional regulation of plastid-encoded rbcL mRNA in vascular plants.

Science.gov (United States)

Yerramsetty, Pradeep; Stata, Matt; Siford, Rebecca; Sage, Tammy L; Sage, Rowan F; Wong, Gane Ka-Shu; Albert, Victor A; Berry, James O

2016-06-29

RLSB, an S-1 domain RNA binding protein of Arabidopsis, selectively binds rbcL mRNA and co-localizes with Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) within chloroplasts of C3 and C4 plants. Previous studies using both Arabidopsis (C3) and maize (C4) suggest RLSB homologs are post-transcriptional regulators of plastid-encoded rbcL mRNA. While RLSB accumulates in all Arabidopsis leaf chlorenchyma cells, in C4 leaves RLSB-like proteins accumulate only within Rubisco-containing bundle sheath chloroplasts of Kranz-type species, and only within central compartment chloroplasts in the single cell C4 plant Bienertia. Our recent evidence implicates this mRNA binding protein as a primary determinant of rbcL expression, cellular localization/compartmentalization, and photosynthetic function in all multicellular green plants. This study addresses the hypothesis that RLSB is a highly conserved Rubisco regulatory factor that occurs in the chloroplasts all higher plants. Phylogenetic analysis has identified RLSB orthologs and paralogs in all major plant groups, from ancient liverworts to recent angiosperms. RLSB homologs were also identified in algae of the division Charophyta, a lineage closely related to land plants. RLSB-like sequences were not identified in any other algae, suggesting that it may be specific to the evolutionary line leading to land plants. The RLSB family occurs in single copy across most angiosperms, although a few species with two copies were identified, seemingly randomly distributed throughout the various taxa, although perhaps correlating in some cases with known ancient whole genome duplications. Monocots of the order Poales (Poaceae and Cyperaceae) were found to contain two copies, designated here as RLSB-a and RLSB-b, with only RLSB-a implicated in the regulation of rbcL across the maize developmental gradient. Analysis of microsynteny in angiosperms revealed high levels of conservation across eudicot species and for both paralogs in

RNA decay by messenger RNA interferases

DEFF Research Database (Denmark)

Christensen-Dalsgaard, Mikkel; Overgaard, Martin; Winther, Kristoffer Skovbo

2008-01-01

Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mR...... cleaving enzymes such as RelE of Escherichia coli and the corresponding antitoxin RelB. In particular, we describe a set of plasmid vectors useful for the detailed analysis of cleavage sites in model mRNAs.......Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mRNA...

Structure of the gene encoding VGF, a nervous system-specific mRNA that is rapidly and selectively induced by nerve growth factor in PC12 cells.

Science.gov (United States)

Salton, S R; Fischberg, D J; Dong, K W

1991-05-01

Nerve growth factor (NGF) plays a critical role in the development and survival of neurons in the peripheral nervous system. Following treatment with NGF but not epidermal growth factor, rat pheochromocytoma (PC12) cells undergo neural differentiation. We have cloned a nervous system-specific mRNA, NGF33.1, that is rapidly and relatively selectively induced by treatment of PC12 cells with NGF and basic fibroblast growth factor in comparison with epidermal growth factor. Analysis of the nucleic acid and predicted amino acid sequences of the NGF33.1 cDNA clone suggested that this clone corresponded to the NGF-inducible mRNA called VGF (A. Levi, J. D. Eldridge, and B. M. Paterson, Science 229:393-395, 1985; R. Possenti, J. D. Eldridge, B. M. Paterson, A. Grasso, and A. Levi, EMBO J. 8:2217-2223, 1989). We have used the NGF33.1 cDNA clone to isolate and characterize the VGF gene, and in this paper we report the complete sequence of the VGF gene, including 853 bases of 5' flank revealed TATAA and CCAAT elements, several GC boxes, and a consensus cyclic AMP response element-binding protein binding site. The VGF promoter contains sequences homologous to other NGF-inducible, neuronal promoters. We further show that VGF mRNA is induced in PC12 cells to a greater extent by depolarization and by phorbol-12-myristate-13-acetate treatment than by 8-bromo-cyclic AMP treatment. By Northern (RNA) and RNase protection analysis, VGF mRNA is detectable in embryonic and postnatal central and peripheral nervous tissues but not in a number of nonneural tissues. In the cascade of events which ultimately leads to the neural differentiation of NGF-treated PC12 cells, the VGF gene encodes the most rapidly and selectively regulated, nervous-system specific mRNA yet identified.

Species-independent MicroRNA Gene Discovery

KAUST Repository

Kamanu, Timothy K.

2012-12-01

MicroRNA (miRNA) are a class of small endogenous non-coding RNA that are mainly negative transcriptional and post-transcriptional regulators in both plants and animals. Recent studies have shown that miRNA are involved in different types of cancer and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. miRNA genes are classified into different groups (miRNA families). This study reports about 19,000 unknown miRNA genes in nine species whereby approximately 15,300 predictions were computationally validated to contain at least one experimentally verified functional miRNA product. The predictions are based on a novel computational strategy which relies on miRNA family groupings and exploits the physics and geometry of miRNA genes to unveil the hidden palindromic signals and symmetries in miRNA gene sequences. Unlike conventional computational miRNA gene discovery methods, the algorithm developed here is species-independent: it allows prediction at higher accuracy and resolution from arbitrary RNA/DNA sequences in any species and thus enables examination of repeat-prone genomic regions which are thought to be non-informative or ’junk’ sequences. The information non-redundancy of uni-directional RNA sequences compared to information redundancy of bi-directional DNA is demonstrated, a fact that is overlooked by most pattern discovery algorithms. A novel method for computing upstream and downstream miRNA gene boundaries based on mathematical/statistical functions is suggested, as well as cutoffs for annotation of miRNA genes in different miRNA families. Another tool is proposed to allow hypotheses generation and visualization of data matrices, intra- and inter-species chromosomal distribution of miRNA genes or miRNA families. Our results indicate that: miRNA and miRNA

Maternally expressed gene 3, an imprinted noncoding RNA gene, is associated with meningioma pathogenesis and progression.

Science.gov (United States)

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N; Klibanski, Anne

2010-03-15

Meningiomas are common tumors, representing 15% to 25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. The chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore, it has been proposed that an as yet unidentified tumor suppressor is present at this locus. Maternally expressed gene 3 (MEG3) is an imprinted gene located at 14q32 which encodes a noncoding RNA with an antiproliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in bromodeoxyuridine incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a noncoding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism.

Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

Directory of Open Access Journals (Sweden)

Stern David B

2010-09-01

Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

A Regulatory RNA Inducing Transgenerationally Inherited Phenotypes

DEFF Research Database (Denmark)

Jensen, Lea Møller

. The variation in Arabidopsis enables different regulatory networks and mechanisms to shape the phenotypic characteristics. The thesis describes the identification of regulatory RNA encoded by an enzyme encoding gene. The RNA regulates by inducing transgenerationally inherited phenotypes. The function of the RNA...... is dependent on the genetic background illustrating that polymorphisms are found in either interactors or target genes of the RNA. Furthermore, the RNA provides a mechanistic link between accumulation of glucosinolate and onset of flowering....

MicroRNA-target binding structures mimic microRNA duplex structures in humans.

Directory of Open Access Journals (Sweden)

Xi Chen

Full Text Available Traditionally, researchers match a microRNA guide strand to mRNA sequences using sequence comparisons to predict its potential target genes. However, many of the predictions can be false positives due to limitations in sequence comparison alone. In this work, we consider the association of two related RNA structures that share a common guide strand: the microRNA duplex and the microRNA-target binding structure. We have analyzed thousands of such structure pairs and found many of them share high structural similarity. Therefore, we conclude that when predicting microRNA target genes, considering just the microRNA guide strand matches to gene sequences may not be sufficient--the microRNA duplex structure formed by the guide strand and its companion passenger strand must also be considered. We have developed software to translate RNA binding structure into encoded representations, and we have also created novel automatic comparison methods utilizing such encoded representations to determine RNA structure similarity. Our software and methods can be utilized in the other RNA secondary structure comparisons as well.

The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.

Science.gov (United States)

Fujii, Yoichi Robertus

2013-01-01

MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.

The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

Directory of Open Access Journals (Sweden)

Lukasz Michal Szafron

Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

You Wanhui

2012-04-01

Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

A deep learning method for lincRNA detection using auto-encoder algorithm.

Science.gov (United States)

Yu, Ning; Yu, Zeng; Pan, Yi

2017-12-06

RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly

In Vivo Testing of MicroRNA-Mediated Gene Knockdown in Zebrafish

Directory of Open Access Journals (Sweden)

Ivone Un San Leong

2012-01-01

Full Text Available The zebrafish (Danio rerio has become an attractive model for human disease modeling as there are a large number of orthologous genes that encode similar proteins to those found in humans. The number of tools available to manipulate the zebrafish genome is limited and many currently used techniques are only effective during early development (such as morpholino-based antisense technology or it is phenotypically driven and does not offer targeted gene knockdown (such as chemical mutagenesis. The use of RNA interference has been met with controversy as off-target effects can make interpreting phenotypic outcomes difficult; however, this has been resolved by creating zebrafish lines that contain stably integrated miRNA constructs that target the desired gene of interest. In this study, we show that a commercially available miRNA vector system with a mouse-derived miRNA backbone is functional in zebrafish and is effective in causing eGFP knockdown in a transient in vivo eGFP sensor assay system. We chose to apply this system to the knockdown of transcripts that are implicated in the human cardiac disorder, Long QT syndrome.

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

The distribution, diversity, and importance of 16S rRNA gene introns in the order Thermoproteales.

Science.gov (United States)

Jay, Zackary J; Inskeep, William P

2015-07-09

Intron sequences are common in 16S rRNA genes of specific thermophilic lineages of Archaea, specifically the Thermoproteales (phylum Crenarchaeota). Environmental sequencing (16S rRNA gene and metagenome) from geothermal habitats in Yellowstone National Park (YNP) has expanded the available datasets for investigating 16S rRNA gene introns. The objectives of this study were to characterize and curate archaeal 16S rRNA gene introns from high-temperature habitats, evaluate the conservation and distribution of archaeal 16S rRNA introns in geothermal systems, and determine which "universal" archaeal 16S rRNA gene primers are impacted by the presence of intron sequences. Several new introns were identified and their insertion loci were constrained to thirteen locations across the 16S rRNA gene. Many of these introns encode homing endonucleases, although some introns were short or partial sequences. Pyrobaculum, Thermoproteus, and Caldivirga 16S rRNA genes contained the most abundant and diverse intron sequences. Phylogenetic analysis of introns revealed that sequences within the same locus are distributed biogeographically. The most diverse set of introns were observed in a high-temperature, circumneutral (pH 6) sulfur sediment environment, which also contained the greatest diversity of different Thermoproteales phylotypes. The widespread presence of introns in the Thermoproteales indicates a high probability of misalignments using different "universal" 16S rRNA primers employed in environmental microbial community analysis.

Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

Science.gov (United States)

Howe, J G; Shu, M D

1988-08-01

Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.

Genome wide identification of cotton (Gossypium hirsutum)-encoded microRNA targets against Cotton leaf curl Burewala virus.

Science.gov (United States)

Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad

2018-01-05

Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Maternally Expressed Gene 3, an imprinted non-coding RNA gene, is associated with meningioma pathogenesis and progression

Science.gov (United States)

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne

2010-01-01

Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190

Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

DEFF Research Database (Denmark)

hart, Leen M; Hansen, Torben; Rietveld, Ingrid

2005-01-01

Previously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA synthetase...... gene (LARS2), involved in aminoacylation of tRNA(Leu(UUR)), associate with type 2 diabetes. Direct sequencing of LARS2 cDNA from 25 type 2 diabetic subjects revealed eight single nucleotide polymorphisms. Two of the variants were examined in 7,836 subjects from four independent populations...... in the Netherlands and Denmark. A -109 g/a variant was not associated with type 2 diabetes. Allele frequencies for the other variant, H324Q, were 3.5% in type 2 diabetic and 2.7% in control subjects, respectively. The common odds ratio across all four studies was 1.40 (95% CI 1.12-1.76), P = 0.004. There were...

A human torque teno virus encodes a microRNA that inhibits interferon signaling.

Directory of Open Access Journals (Sweden)

Rodney P Kincaid

Full Text Available Torque teno viruses (TTVs are a group of viruses with small, circular DNA genomes. Members of this family are thought to ubiquitously infect humans, although causal disease associations are currently lacking. At present, there is no understanding of how infection with this diverse group of viruses is so prevalent. Using a combined computational and synthetic approach, we predict and identify miRNA-coding regions in diverse human TTVs and provide evidence for TTV miRNA production in vivo. The TTV miRNAs are transcribed by RNA polymerase II, processed by Drosha and Dicer, and are active in RISC. A TTV mutant defective for miRNA production replicates as well as wild type virus genome; demonstrating that the TTV miRNA is dispensable for genome replication in a cell culture model. We demonstrate that a recombinant TTV genome is capable of expressing an exogenous miRNA, indicating the potential utility of TTV as a small RNA vector. Gene expression profiling of host cells identifies N-myc (and STAT interactor (NMI as a target of a TTV miRNA. NMI transcripts are directly regulated through a binding site in the 3'UTR. SiRNA knockdown of NMI contributes to a decreased response to interferon signaling. Consistent with this, we show that a TTV miRNA mediates a decreased response to IFN and increased cellular proliferation in the presence of IFN. Thus, we add Annelloviridae to the growing list of virus families that encode miRNAs, and suggest that miRNA-mediated immune evasion can contribute to the pervasiveness associated with some of these viruses.

Methylation of miRNA genes and oncogenesis.

Science.gov (United States)

Loginov, V I; Rykov, S V; Fridman, M V; Braga, E A

2015-02-01

Interaction between microRNA (miRNA) and messenger RNA of target genes at the posttranscriptional level provides fine-tuned dynamic regulation of cell signaling pathways. Each miRNA can be involved in regulating hundreds of protein-coding genes, and, conversely, a number of different miRNAs usually target a structural gene. Epigenetic gene inactivation associated with methylation of promoter CpG-islands is common to both protein-coding genes and miRNA genes. Here, data on functions of miRNAs in development of tumor-cell phenotype are reviewed. Genomic organization of promoter CpG-islands of the miRNA genes located in inter- and intragenic areas is discussed. The literature and our own results on frequency of CpG-island methylation in miRNA genes from tumors are summarized, and data regarding a link between such modification and changed activity of miRNA genes and, consequently, protein-coding target genes are presented. Moreover, the impact of miRNA gene methylation on key oncogenetic processes as well as affected signaling pathways is discussed.

Rift Valley fever virus NS{sub S} gene expression correlates with a defect in nuclear mRNA export

Energy Technology Data Exchange (ETDEWEB)

Copeland, Anna Maria; Van Deusen, Nicole M.; Schmaljohn, Connie S., E-mail: Connie.s.schmaljohn.civ@mail.mil

2015-12-15

We investigated the localization of host mRNA during Rift Valley fever virus (RVFV) infection. Fluorescence in situ hybridization revealed that infection with RVFV altered the localization of host mRNA. mRNA accumulated in the nuclei of RVFV-infected but not mock-infected cells. Further, overexpression of the NS{sub S} gene, but not the N, G{sub N} or NS{sub M} genes correlated with mRNA nuclear accumulation. Nuclear accumulation of host mRNA was not observed in cells infected with a strain of RVFV lacking the gene encoding NS{sub S}, confirming that expression of NS{sub S} is likely responsible for this phenomenon. - Highlights: • Rift Valley fever virus (RVFV) infection alters the localization of host mRNA. • mRNA accumulates in the nuclei of RVFV-infected but not mock-infected cells. • NS{sub S} is likely responsible for mRNA relocalization to the nucleus.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

Science.gov (United States)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

Directory of Open Access Journals (Sweden)

Giao Ngoc Nguyen

2017-08-01

Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

The noncoding RNA taurine upregulated gene 1 is required for differentiation of the murine retina.

Science.gov (United States)

Young, T L; Matsuda, T; Cepko, C L

2005-03-29

With the advent of genome-wide analyses, it is becoming evident that a large number of noncoding RNAs (ncRNAs) are expressed in vertebrates. However, of the thousands of ncRNAs identified, the functions of relatively few have been established. In a screen for genes upregulated by taurine in developing retinal cells, we identified a gene that appears to be a ncRNA. Taurine Upregulated Gene 1 (TUG1) is a spliced, polyadenylated RNA that does not encode any open reading frame greater than 82 amino acids in its full-length, 6.7 kilobase (kb) RNA sequence. Analyses of Northern blots and in situ hybridization revealed that TUG1 is expressed in the developing retina and brain, as well as in adult tissues. In the newborn retina, knockdown of TUG1 with RNA interference (RNAi) resulted in malformed or nonexistent outer segments of transfected photoreceptors. Immunofluorescent staining and microarray analyses suggested that this loss of proper photoreceptor differentiation is a result of the disregulation of photoreceptor gene expression. A function for a newly identified ncRNA, TUG1, has been established. TUG1 is necessary for the proper formation of photoreceptors in the developing rodent retina.

Characterization of the ptr5+ gene involved in nuclear mRNA export in fission yeast

International Nuclear Information System (INIS)

Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka; Tani, Tokio

2012-01-01

Highlights: ► We cloned the ptr5 + gene involved in nuclear mRNA export in fission yeast. ► The ptr5 + gene was found to encode nucleoporin 85 (Nup85). ► Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. ► Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. ► Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A) + RNA transport] 1 to 11, which accumulate poly(A) + RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5–1 mutant shows dots- or a ring-like accumulation of poly(A) + RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5 + gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5–1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5–1 mutation. In addition, we found that the ptr5–1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5–1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.

Influenza polymerase encoding mRNAs utilize atypical mRNA nuclear export.

Science.gov (United States)

Larsen, Sean; Bui, Steven; Perez, Veronica; Mohammad, Adeba; Medina-Ramirez, Hilario; Newcomb, Laura L

2014-08-28

Influenza is a segmented negative strand RNA virus. Each RNA segment is encapsulated by influenza nucleoprotein and bound by the viral RNA dependent RNA polymerase (RdRP) to form viral ribonucleoproteins responsible for RNA synthesis in the nucleus of the host cell. Influenza transcription results in spliced mRNAs (M2 and NS2), intron-containing mRNAs (M1 and NS1), and intron-less mRNAs (HA, NA, NP, PB1, PB2, and PA), all of which undergo nuclear export into the cytoplasm for translation. Most cellular mRNA nuclear export is Nxf1-mediated, while select mRNAs utilize Crm1. Here we inhibited Nxf1 and Crm1 nuclear export prior to infection with influenza A/Udorn/307/1972(H3N2) virus and analyzed influenza intron-less mRNAs using cellular fractionation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR). We examined direct interaction between Nxf1 and influenza intron-less mRNAs using immuno purification of Nxf1 and RT-PCR of associated RNA. Inhibition of Nxf1 resulted in less influenza intron-less mRNA export into the cytoplasm for HA and NA influenza mRNAs in both human embryonic kidney cell line (293 T) and human lung adenocarcinoma epithelial cell line (A549). However, in 293 T cells no change was observed for mRNAs encoding the components of the viral ribonucleoproteins; NP, PA, PB1, and PB2, while in A549 cells, only PA, PB1, and PB2 mRNAs, encoding the RdRP, remained unaffected; NP mRNA was reduced in the cytoplasm. In A549 cells NP, NA, HA, mRNAs were found associated with Nxf1 but PA, PB1, and PB2 mRNAs were not. Crm1 inhibition also resulted in no significant difference in PA, PB1, and PB2 mRNA nuclear export. These results further confirm Nxf1-mediated nuclear export is functional during the influenza life cycle and hijacked for select influenza mRNA nuclear export. We reveal a cell type difference for Nxf1-mediated nuclear export of influenza NP mRNA, a reminder that cell type can influence molecular mechanisms. Importantly, we

Expansion of genes encoding piRNA-associated argonaute proteins in the pea aphid: diversification of expression profiles in different plastic morphs.

Directory of Open Access Journals (Sweden)

Hsiao-Ling Lu

Full Text Available Piwi-interacting RNAs (piRNAs are known to regulate transposon activity in germ cells of several animal models that propagate sexually. However, the role of piRNAs during asexual reproduction remains almost unknown. Aphids that can alternate sexual and asexual reproduction cycles in response to seasonal changes of photoperiod provide a unique opportunity to study piRNAs and the piRNA pathway in both reproductive modes. Taking advantage of the recently sequenced genome of the pea aphid Acyrthosiphon pisum, we found an unusually large lineage-specific expansion of genes encoding the Piwi sub-clade of Argonaute proteins. In situ hybridisation showed differential expressions between the duplicated piwi copies: while Api-piwi2 and Api-piwi6 are "specialised" in germ cells their most closely related copy, respectively Api-piwi5 and Api-piwi3, are expressed in the somatic cells. The differential expression was also identified in duplicated ago3: Api-ago3a in germ cells and Api-ago3b in somatic cells. Moreover, analyses of expression profiles of the expanded piwi and ago3 genes by semi-quantitative RT-PCR showed that expressions varied according to the reproductive types. These specific expression patterns suggest that expanded aphid piwi and ago3 genes have distinct roles in asexual and sexual reproduction.

RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells

Science.gov (United States)

Diener, Yvonne; Jurk, Marion; Kandil, Britta; Choi, Yeong-Hoon; Wild, Stefan; Bissels, Ute; Bosio, Andreas

2015-01-01

Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable gene modification by viral vectors that are burdensome when translating protocols into clinical settings. Our study aimed at exploring new ways to transiently modify HSPC gene expression using non-integrating, RNA-based molecules. First, we tested different methods to deliver these molecules into HSPCs. The delivery of siRNAs with chemical transfection methods such as lipofection or cationic polymers did not lead to target knockdown, although we observed more than 90% fluorescent cells using a fluorochrome-coupled siRNA. Confocal microscopic analysis revealed that despite extensive washing, siRNA stuck to or in the cell surface, thereby mimicking a transfection event. In contrast, electroporation resulted in efficient, siRNA-mediated protein knockdown. For transient overexpression of proteins, we used optimised mRNA molecules with modified 5′- and 3′-UTRs. Electroporation of mRNA encoding GFP resulted in fast, efficient and persistent protein expression for at least seven days. Our data provide a broad-ranging comparison of transfection methods for hard-to-transfect cells and offer new opportunities for DNA-free, non-integrating gene modulation in HSPCs. PMID:26599627

A Simple Laboratory Practical to Illustrate RNA Mediated Gene Interference Using Drosophila Cell Culture

Science.gov (United States)

Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak

2010-01-01

RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Impact of haloperidol and quetiapine on the expression of genes encoding antioxidant enzymes in human neuroblastoma SH-SY5Y cells.

Science.gov (United States)

Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip

2009-05-01

Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.

Replication of alfalfa mosaic virus RNA 3 with movement and coat protein genes replaced by corresponding genes of Prunus necrotic ringspot ilarvirus.

Science.gov (United States)

Sánchez-Navarro, J A; Reusken, C B; Bol, J F; Pallás, V

1997-12-01

Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) are tripartite positive-strand RNA plant viruses that encode functionally similar translation products. Although the two viruses are phylogenetically closely related, they infect a very different range of natural hosts. The coat protein (CP) gene, the movement protein (MP) gene or both genes in AMV RNA 3 were replaced by the corresponding genes of PNRSV. The chimeric viruses were tested for heterologous encapsidation, replication in protoplasts from plants transformed with AMV replicase genes P1 and P2 (P12 plants) and for cell-to-cell transport in P12 plants. The chimeric viruses exhibited basic competence for encapsidation and replication in P12 protoplasts and for a low level of cell-to-cell movement in P12 plants. The potential involvement of the MP gene in determining host specificity in ilarviruses is discussed.

Genetic selection and DNA sequences of 4.5S RNA homologs

DEFF Research Database (Denmark)

Brown, S; Thon, G; Tolentino, E

1989-01-01

A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

Critical role of the virus-encoded microRNA-155 ortholog in the induction of Marek's disease lymphomas.

Directory of Open Access Journals (Sweden)

Yuguang Zhao

2011-02-01

Full Text Available Notwithstanding the well-characterised roles of a number of oncogenes in neoplastic transformation, microRNAs (miRNAs are increasingly implicated in several human cancers. Discovery of miRNAs in several oncogenic herpesviruses such as KSHV has further highlighted the potential of virus-encoded miRNAs to contribute to their oncogenic capabilities. Nevertheless, despite the identification of several possible cancer-related genes as their targets, the direct in vivo role of virus-encoded miRNAs in neoplastic diseases such as those induced by KSHV is difficult to demonstrate in the absence of suitable models. However, excellent natural disease models of rapid-onset Marek's disease (MD lymphomas in chickens allow examination of the oncogenic potential of virus-encoded miRNAs. Using viruses modified by reverse genetics of the infectious BAC clone of the oncogenic RB-1B strain of MDV, we show that the deletion of the six-miRNA cluster 1 from the viral genome abolished the oncogenicity of the virus. This loss of oncogenicity appeared to be primarily due to the single miRNA within the cluster, miR-M4, the ortholog of cellular miR-155, since its deletion or a 2-nucleotide mutation within its seed region was sufficient to inhibit the induction of lymphomas. The definitive role of this miR-155 ortholog in oncogenicity was further confirmed by the rescue of oncogenic phenotype by revertant viruses that expressed either the miR-M4 or the cellular homolog gga-miR-155. This is the first demonstration of the direct in vivo role of a virus-encoded miRNA in inducing tumors in a natural infection model. Furthermore, the use of viruses deleted in miRNAs as effective vaccines against virulent MDV challenge, enables the prospects of generating genetically defined attenuated vaccines.

Efficacy of double-stranded RNA against white spot syndrome virus (WSSV non-structural (orf89, wsv191 and structural (vp28, vp26 genes in the Pacific white shrimp Litopenaeus vannamei

Directory of Open Access Journals (Sweden)

César M. Escobedo-Bonilla

2015-04-01

Full Text Available White spot syndrome virus (WSSV is a major pathogen in shrimp aquaculture. RNA interference (RNAi is a promising tool against viral infections. Previous works with RNAi showed different antiviral efficacies depending on the silenced gene. This work evaluated the antiviral efficacy of double-stranded (ds RNA against two non-structural (orf89, wsv191 WSSV genes compared to structural (vp26, vp28 genes to inhibit an experimental WSSV infection. Gene orf89 encodes a putative regulatory protein and gene white spot virus (wsv191 encodes a nonspecific nuclease; whereas genes vp26 and vp28 encode envelope proteins, respectively. Molecules of dsRNA against each of the WSSV genes were intramuscularly injected (4 μg per shrimp into a group of shrimp 48 h before a WSSV challenge. The highest antiviral activity occurred with dsRNA against orf89, vp28 and vp26 (cumulative mortalities 10%, 10% and 21%, respectively. In contrast, the least effective treatment was wsv191 dsRNA (cumulative mortality 83%. All dead animals were WSSV-positive by one-step PCR, whereas reverse-transcription PCR of all surviving shrimp confirmed inhibition of virus replication. This study showed that dsRNA against WSSV genes orf89, vp28 and vp26 were highly effective to inhibit virus replication and suggest an essential role in WSSV infection. Non-structural WSSV genes such as orf89 can be used as novel targets to design therapeutic RNAi molecules against WSSV infection.

A novel TBP-TAF complex on RNA polymerase II-transcribed snRNA genes.

Science.gov (United States)

Zaborowska, Justyna; Taylor, Alice; Roeder, Robert G; Murphy, Shona

2012-01-01

Initiation of transcription of most human genes transcribed by RNA polymerase II (RNAP II) requires the formation of a preinitiation complex comprising TFIIA, B, D, E, F, H and RNAP II. The general transcription factor TFIID is composed of the TATA-binding protein and up to 13 TBP-associated factors. During transcription of snRNA genes, RNAP II does not appear to make the transition to long-range productive elongation, as happens during transcription of protein-coding genes. In addition, recognition of the snRNA gene-type specific 3' box RNA processing element requires initiation from an snRNA gene promoter. These characteristics may, at least in part, be driven by factors recruited to the promoter. For example, differences in the complement of TAFs might result in differential recruitment of elongation and RNA processing factors. As precedent, it already has been shown that the promoters of some protein-coding genes do not recruit all the TAFs found in TFIID. Although TAF5 has been shown to be associated with RNAP II-transcribed snRNA genes, the full complement of TAFs associated with these genes has remained unclear. Here we show, using a ChIP and siRNA-mediated approach, that the TBP/TAF complex on snRNA genes differs from that found on protein-coding genes. Interestingly, the largest TAF, TAF1, and the core TAFs, TAF10 and TAF4, are not detected on snRNA genes. We propose that this snRNA gene-specific TAF subset plays a key role in gene type-specific control of expression.

A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

Science.gov (United States)

Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

2014-01-01

The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

Directory of Open Access Journals (Sweden)

Fangquan Wang

2016-05-01

Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

Science.gov (United States)

Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

2016-05-11

Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

Directory of Open Access Journals (Sweden)

Ying Wang

Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

ELFN1-AS1: A Novel Primate Gene with Possible MicroRNA Function Expressed Predominantly in Human Tumors

Directory of Open Access Journals (Sweden)

Dmitrii E. Polev

2014-01-01

Full Text Available Human gene LOC100505644 uncharacterized LOC100505644 [Homo sapiens] (Entrez Gene ID 100505644 is abundantly expressed in tumors but weakly expressed in few normal tissues. Till now the function of this gene remains unknown. Here we identified the chromosomal borders of the transcribed region and the major splice form of the LOC100505644-specific transcript. We characterised the major regulatory motifs of the gene and its splice sites. Analysis of the secondary structure of the major transcript variant revealed a hairpin-like structure characteristic for precursor microRNAs. Comparative genomic analysis of the locus showed that it originated in primates de novo. Taken together, our data indicate that human gene LOC100505644 encodes some non-protein coding RNA, likely a microRNA. It was assigned a gene symbol ELFN1-AS1 (ELFN1 antisense RNA 1 (non-protein coding. This gene combines features of evolutionary novelty and predominant expression in tumors.

Characterization of the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast

Energy Technology Data Exchange (ETDEWEB)

Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan); Tani, Tokio, E-mail: ttani@sci.kumamoto-u.ac.jp [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan)

2012-02-03

Highlights: Black-Right-Pointing-Pointer We cloned the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast. Black-Right-Pointing-Pointer The ptr5{sup +} gene was found to encode nucleoporin 85 (Nup85). Black-Right-Pointing-Pointer Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. Black-Right-Pointing-Pointer Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. Black-Right-Pointing-Pointer Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A){sup +} RNA transport] 1 to 11, which accumulate poly(A){sup +} RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5-1 mutant shows dots- or a ring-like accumulation of poly(A){sup +} RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5{sup +} gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5-1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5-1 mutation. In addition, we found that the ptr5-1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5-1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.

Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

Directory of Open Access Journals (Sweden)

Arthur K Tugume

Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

Recruitment of PfSET2 by RNA polymerase II to variant antigen encoding loci contributes to antigenic variation in P. falciparum.

Directory of Open Access Journals (Sweden)

Uchechi E Ukaegbu

2014-01-01

Full Text Available Histone modifications are important regulators of gene expression in all eukaryotes. In Plasmodium falciparum, these epigenetic marks regulate expression of genes involved in several aspects of host-parasite interactions, including antigenic variation. While the identities and genomic positions of many histone modifications have now been cataloged, how they are targeted to defined genomic regions remains poorly understood. For example, how variant antigen encoding loci (var are targeted for deposition of unique histone marks is a mystery that continues to perplex the field. Here we describe the recruitment of an ortholog of the histone modifier SET2 to var genes through direct interactions with the C-terminal domain (CTD of RNA polymerase II. In higher eukaryotes, SET2 is a histone methyltransferase recruited by RNA pol II during mRNA transcription; however, the ortholog in P. falciparum (PfSET2 has an atypical architecture and its role in regulating transcription is unknown. Here we show that PfSET2 binds to the unphosphorylated form of the CTD, a property inconsistent with its recruitment during mRNA synthesis. Further, we show that H3K36me3, the epigenetic mark deposited by PfSET2, is enriched at both active and silent var gene loci, providing additional evidence that its recruitment is not associated with mRNA production. Over-expression of a dominant negative form of PfSET2 designed to disrupt binding to RNA pol II induced rapid var gene expression switching, confirming both the importance of PfSET2 in var gene regulation and a role for RNA pol II in its recruitment. RNA pol II is known to transcribe non-coding RNAs from both active and silent var genes, providing a possible mechanism by which it could recruit PfSET2 to var loci. This work unifies previous reports of histone modifications, the production of ncRNAs, and the promoter activity of var introns into a mechanism that contributes to antigenic variation by malaria parasites.

Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.

Science.gov (United States)

Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A

1997-07-01

Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells

Directory of Open Access Journals (Sweden)

Giuseppe Fiume

2016-11-01

Full Text Available The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03% of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7% and 698 downregulated (54.3% RNAs. In K562 cells, 1959 (3.1% of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7% and 906 downregulated (46.3%. Only 137 transcripts (0.22% were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.

Science.gov (United States)

Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

2016-11-07

The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

RNA Sequencing Reveals that Kaposi Sarcoma-Associated Herpesvirus Infection Mimics Hypoxia Gene Expression Signature

Science.gov (United States)

Viollet, Coralie; Davis, David A.; Tekeste, Shewit S.; Reczko, Martin; Pezzella, Francesco; Ragoussis, Jiannis

2017-01-01

Kaposi sarcoma-associated herpesvirus (KSHV) causes several tumors and hyperproliferative disorders. Hypoxia and hypoxia-inducible factors (HIFs) activate latent and lytic KSHV genes, and several KSHV proteins increase the cellular levels of HIF. Here, we used RNA sequencing, qRT-PCR, Taqman assays, and pathway analysis to explore the miRNA and mRNA response of uninfected and KSHV-infected cells to hypoxia, to compare this with the genetic changes seen in chronic latent KSHV infection, and to explore the degree to which hypoxia and KSHV infection interact in modulating mRNA and miRNA expression. We found that the gene expression signatures for KSHV infection and hypoxia have a 34% overlap. Moreover, there were considerable similarities between the genes up-regulated by hypoxia in uninfected (SLK) and in KSHV-infected (SLKK) cells. hsa-miR-210, a HIF-target known to have pro-angiogenic and anti-apoptotic properties, was significantly up-regulated by both KSHV infection and hypoxia using Taqman assays. Interestingly, expression of KSHV-encoded miRNAs was not affected by hypoxia. These results demonstrate that KSHV harnesses a part of the hypoxic cellular response and that a substantial portion of hypoxia-induced changes in cellular gene expression are induced by KSHV infection. Therefore, targeting hypoxic pathways may be a useful way to develop therapeutic strategies for KSHV-related diseases. PMID:28046107

A deep auto-encoder model for gene expression prediction.

Science.gov (United States)

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

Roles of Prolyl Isomerases in RNA-Mediated Gene Expression

Directory of Open Access Journals (Sweden)

Roopa Thapar

2015-05-01

Full Text Available The peptidyl-prolyl cis-trans isomerases (PPIases that include immunophilins (cyclophilins and FKBPs and parvulins (Pin1, Par14, Par17 participate in cell signaling, transcription, pre-mRNA processing and mRNA decay. The human genome encodes 19 cyclophilins, 18 FKBPs and three parvulins. Immunophilins are receptors for the immunosuppressive drugs cyclosporin A, FK506, and rapamycin that are used in organ transplantation. Pin1 has also been targeted in the treatment of Alzheimer’s disease, asthma, and a number of cancers. While these PPIases are characterized as molecular chaperones, they also act in a nonchaperone manner to promote protein-protein interactions using surfaces outside their active sites. The immunosuppressive drugs act by a gain-of-function mechanism by promoting protein-protein interactions in vivo. Several immunophilins have been identified as components of the spliceosome and are essential for alternative splicing. Pin1 plays roles in transcription and RNA processing by catalyzing conformational changes in the RNA Pol II C-terminal domain. Pin1 also binds several RNA binding proteins such as AUF1, KSRP, HuR, and SLBP that regulate mRNA decay by remodeling mRNP complexes. The functions of ribonucleoprotein associated PPIases are largely unknown. This review highlights PPIases that play roles in RNA-mediated gene expression, providing insight into their structures, functions and mechanisms of action in mRNP remodeling in vivo.

Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

International Nuclear Information System (INIS)

Chisholm, G.E.; Summers, W.C.

1986-01-01

The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

Unravelling the complexity of microRNA-mediated gene regulation in black pepper (Piper nigrum L.) using high-throughput small RNA profiling.

Science.gov (United States)

Asha, Srinivasan; Sreekumar, Sweda; Soniya, E V

2016-01-01

Analysis of high-throughput small RNA deep sequencing data, in combination with black pepper transcriptome sequences revealed microRNA-mediated gene regulation in black pepper ( Piper nigrum L.). Black pepper is an important spice crop and its berries are used worldwide as a natural food additive that contributes unique flavour to foods. In the present study to characterize microRNAs from black pepper, we generated a small RNA library from black pepper leaf and sequenced it by Illumina high-throughput sequencing technology. MicroRNAs belonging to a total of 303 conserved miRNA families were identified from the sRNAome data. Subsequent analysis from recently sequenced black pepper transcriptome confirmed precursor sequences of 50 conserved miRNAs and four potential novel miRNA candidates. Stem-loop qRT-PCR experiments demonstrated differential expression of eight conserved miRNAs in black pepper. Computational analysis of targets of the miRNAs showed 223 potential black pepper unigene targets that encode diverse transcription factors and enzymes involved in plant development, disease resistance, metabolic and signalling pathways. RLM-RACE experiments further mapped miRNA-mediated cleavage at five of the mRNA targets. In addition, miRNA isoforms corresponding to 18 miRNA families were also identified from black pepper. This study presents the first large-scale identification of microRNAs from black pepper and provides the foundation for the future studies of miRNA-mediated gene regulation of stress responses and diverse metabolic processes in black pepper.

Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

OpenAIRE

Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

2017-01-01

Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

Identification and Characterization of Cyprinid Herpesvirus-3 (CyHV-3 Encoded MicroRNAs.

Directory of Open Access Journals (Sweden)

Owen H Donohoe

Full Text Available MicroRNAs (miRNAs are a class of small non-coding RNAs involved in post-transcriptional gene regulation. Some viruses encode their own miRNAs and these are increasingly being recognized as important modulators of viral and host gene expression. Cyprinid herpesvirus 3 (CyHV-3 is a highly pathogenic agent that causes acute mass mortalities in carp (Cyprinus carpio carpio and koi (Cyprinus carpio koi worldwide. Here, bioinformatic analyses of the CyHV-3 genome suggested the presence of non-conserved precursor miRNA (pre-miRNA genes. Deep sequencing of small RNA fractions prepared from in vitro CyHV-3 infections led to the identification of potential miRNAs and miRNA-offset RNAs (moRNAs derived from some bioinformatically predicted pre-miRNAs. DNA microarray hybridization analysis, Northern blotting and stem-loop RT-qPCR were then used to definitively confirm that CyHV-3 expresses two pre-miRNAs during infection in vitro. The evidence also suggested the presence of an additional four high-probability and two putative viral pre-miRNAs. MiRNAs from the two confirmed pre-miRNAs were also detected in gill tissue from CyHV-3-infected carp. We also present evidence that one confirmed miRNA can regulate the expression of a putative CyHV-3-encoded dUTPase. Candidate homologues of some CyHV-3 pre-miRNAs were identified in CyHV-1 and CyHV-2. This is the first report of miRNA and moRNA genes encoded by members of the Alloherpesviridae family, a group distantly related to the Herpesviridae family. The discovery of these novel CyHV-3 genes may help further our understanding of the biology of this economically important virus and their encoded miRNAs may have potential as biomarkers for the diagnosis of latent CyHV-3.

Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia.

Science.gov (United States)

Kojima, Kenji K; Jurka, Jerzy

2015-01-01

Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an "archaeal" RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Intrinsic noise of microRNA-regulated genes and the ceRNA hypothesis.

Directory of Open Access Journals (Sweden)

Javad Noorbakhsh

Full Text Available MicroRNAs are small noncoding RNAs that regulate genes post-transciptionally by binding and degrading target eukaryotic mRNAs. We use a quantitative model to study gene regulation by inhibitory microRNAs and compare it to gene regulation by prokaryotic small non-coding RNAs (sRNAs. Our model uses a combination of analytic techniques as well as computational simulations to calculate the mean-expression and noise profiles of genes regulated by both microRNAs and sRNAs. We find that despite very different molecular machinery and modes of action (catalytic vs stoichiometric, the mean expression levels and noise profiles of microRNA-regulated genes are almost identical to genes regulated by prokaryotic sRNAs. This behavior is extremely robust and persists across a wide range of biologically relevant parameters. We extend our model to study crosstalk between multiple mRNAs that are regulated by a single microRNA and show that noise is a sensitive measure of microRNA-mediated interaction between mRNAs. We conclude by discussing possible experimental strategies for uncovering the microRNA-mRNA interactions and testing the competing endogenous RNA (ceRNA hypothesis.

Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage

International Nuclear Information System (INIS)

Morgan, E.A.; Nomura, M.

1979-01-01

Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA 1 /sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA 1 /sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA 1 /sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage

Identification and validation of human papillomavirus encoded microRNAs.

Directory of Open Access Journals (Sweden)

Kui Qian

Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Mutations in 23S rRNA gene associated with decreased susceptibility to tiamulin and valnemulin in Mycoplasma gallisepticum.

Science.gov (United States)

Li, Bei-Bei; Shen, Jian-Zhong; Cao, Xing-Yuan; Wang, Yang; Dai, Lei; Huang, Si-Yang; Wu, Cong-Ming

2010-07-01

Mycoplasma gallisepticum is a major etiological agent of chronic respiratory disease (CRD) in chickens and sinusitis in turkeys. The pleuromutilin antibiotics tiamulin and valnemulin are currently used in the treatment of M. gallisepticum infection. We studied the in vitro development of pleuromutilin resistance in M. gallisepticum and investigated the molecular mechanisms involved in this process. Pleuromutilin-resistant mutants were selected by serial passages of M. gallisepticum strains PG31 and S6 in broth medium containing subinhibitory concentrations of tiamulin or valnemulin. A portion of the gene encoding 23S rRNA gene (domain V) and the gene encoding ribosome protein L3 were amplified and sequenced. No mutation could be detected in ribosome protein L3. Mutations were found at nucleotide positions 2058, 2059, 2061, 2447 and 2503 of 23S rRNA gene (Escherichia coli numbering). Although a single mutation could cause elevation of tiamulin and valnemulin MICs, combinations of two or three mutations were necessary to produce high-level resistance. All the mutants were cross-resistant to lincomycin, chloramphenicol and florfenicol. Mutants with the A2058G or the A2059G mutation exhibited cross-resistance to macrolide antibiotics erythromycin, tilmicosin and tylosin.

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

DEFF Research Database (Denmark)

Ronander, Elena; Bengtsson, Dominique C; Joergensen, Louise

2012-01-01

Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has...... been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors...... fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE(1). Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human...

Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

Directory of Open Access Journals (Sweden)

Andrea D McCue

2012-02-01

Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

Identification and Characterization of Cyprinid Herpesvirus-3 (CyHV-3) Encoded MicroRNAs

Science.gov (United States)

Donohoe, Owen H.; Henshilwood, Kathy; Way, Keith; Hakimjavadi, Roya; Stone, David M.; Walls, Dermot

2015-01-01

MicroRNAs (miRNAs) are a class of small non-coding RNAs involved in post-transcriptional gene regulation. Some viruses encode their own miRNAs and these are increasingly being recognized as important modulators of viral and host gene expression. Cyprinid herpesvirus 3 (CyHV-3) is a highly pathogenic agent that causes acute mass mortalities in carp (Cyprinus carpio carpio) and koi (Cyprinus carpio koi) worldwide. Here, bioinformatic analyses of the CyHV-3 genome suggested the presence of non-conserved precursor miRNA (pre-miRNA) genes. Deep sequencing of small RNA fractions prepared from in vitro CyHV-3 infections led to the identification of potential miRNAs and miRNA–offset RNAs (moRNAs) derived from some bioinformatically predicted pre-miRNAs. DNA microarray hybridization analysis, Northern blotting and stem-loop RT-qPCR were then used to definitively confirm that CyHV-3 expresses two pre-miRNAs during infection in vitro. The evidence also suggested the presence of an additional four high-probability and two putative viral pre-miRNAs. MiRNAs from the two confirmed pre-miRNAs were also detected in gill tissue from CyHV-3-infected carp. We also present evidence that one confirmed miRNA can regulate the expression of a putative CyHV-3-encoded dUTPase. Candidate homologues of some CyHV-3 pre-miRNAs were identified in CyHV-1 and CyHV-2. This is the first report of miRNA and moRNA genes encoded by members of the Alloherpesviridae family, a group distantly related to the Herpesviridae family. The discovery of these novel CyHV-3 genes may help further our understanding of the biology of this economically important virus and their encoded miRNAs may have potential as biomarkers for the diagnosis of latent CyHV-3. PMID:25928140

Chimeras taking shape: Potential functions of proteins encoded by chimeric RNA transcripts

Science.gov (United States)

Frenkel-Morgenstern, Milana; Lacroix, Vincent; Ezkurdia, Iakes; Levin, Yishai; Gabashvili, Alexandra; Prilusky, Jaime; del Pozo, Angela; Tress, Michael; Johnson, Rory; Guigo, Roderic; Valencia, Alfonso

2012-01-01

Chimeric RNAs comprise exons from two or more different genes and have the potential to encode novel proteins that alter cellular phenotypes. To date, numerous putative chimeric transcripts have been identified among the ESTs isolated from several organisms and using high throughput RNA sequencing. The few corresponding protein products that have been characterized mostly result from chromosomal translocations and are associated with cancer. Here, we systematically establish that some of the putative chimeric transcripts are genuinely expressed in human cells. Using high throughput RNA sequencing, mass spectrometry experimental data, and functional annotation, we studied 7424 putative human chimeric RNAs. We confirmed the expression of 175 chimeric RNAs in 16 human tissues, with an abundance varying from 0.06 to 17 RPKM (Reads Per Kilobase per Million mapped reads). We show that these chimeric RNAs are significantly more tissue-specific than non-chimeric transcripts. Moreover, we present evidence that chimeras tend to incorporate highly expressed genes. Despite the low expression level of most chimeric RNAs, we show that 12 novel chimeras are translated into proteins detectable in multiple shotgun mass spectrometry experiments. Furthermore, we confirm the expression of three novel chimeric proteins using targeted mass spectrometry. Finally, based on our functional annotation of exon organization and preserved domains, we discuss the potential features of chimeric proteins with illustrative examples and suggest that chimeras significantly exploit signal peptides and transmembrane domains, which can alter the cellular localization of cognate proteins. Taken together, these findings establish that some chimeric RNAs are translated into potentially functional proteins in humans. PMID:22588898

Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

Directory of Open Access Journals (Sweden)

Michelle S Lewis

2007-08-01

Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

Directory of Open Access Journals (Sweden)

Ghaffari Novin M.

2015-06-01

Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

Science.gov (United States)

Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

1994-02-01

We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

The microRNA machinery regulates fasting-induced changes in gene expression and longevity in Caenorhabditis elegans.

Science.gov (United States)

Kogure, Akiko; Uno, Masaharu; Ikeda, Takako; Nishida, Eisuke

2017-07-07

Intermittent fasting (IF) is a dietary restriction regimen that extends the lifespans of Caenorhabditis elegans and mammals by inducing changes in gene expression. However, how IF induces these changes and promotes longevity remains unclear. One proposed mechanism involves gene regulation by microRNAs (miRNAs), small non-coding RNAs (∼22 nucleotides) that repress gene expression and whose expression can be altered by fasting. To test this proposition, we examined the role of the miRNA machinery in fasting-induced transcriptional changes and longevity in C. elegans We revealed that fasting up-regulated the expression of the miRNA-induced silencing complex (miRISC) components, including Argonaute and GW182, and the miRNA-processing enzyme DRSH-1 (the ortholog of the Drosophila Drosha enzyme). Our lifespan measurements demonstrated that IF-induced longevity was suppressed by knock-out or knockdown of miRISC components and was completely inhibited by drsh-1 ablation. Remarkably, drsh-1 ablation inhibited the fasting-induced changes in the expression of the target genes of DAF-16, the insulin/IGF-1 signaling effector in C. elegans Fasting-induced transcriptome alterations were substantially and modestly suppressed in the drsh-1 null mutant and the null mutant of ain-1 , a gene encoding GW182, respectively. Moreover, miRNA array analyses revealed that the expression levels of numerous miRNAs changed after 2 days of fasting. These results indicate that components of the miRNA machinery, especially the miRNA-processing enzyme DRSH-1, play an important role in mediating IF-induced longevity via the regulation of fasting-induced changes in gene expression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: Evidence for differential gene expression

International Nuclear Information System (INIS)

Kim, Sunyoung; Baltimore, D.; Byrn, R.; Groopman, J.

1989-01-01

The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4 + lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes

Species-independent MicroRNA Gene Discovery

KAUST Repository

Kamanu, Timothy K.

2012-01-01

and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. mi

Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Shuhua Zhan

Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

RNA-Seq for gene identification and transcript profiling of three Stevia rebaudiana genotypes.

Science.gov (United States)

Chen, Junwen; Hou, Kai; Qin, Peng; Liu, Hongchang; Yi, Bin; Yang, Wenting; Wu, Wei

2014-07-07

Stevia (Stevia rebaudiana) is an important medicinal plant that yields diterpenoid steviol glycosides (SGs). SGs are currently used in the preparation of medicines, food products and neutraceuticals because of its sweetening property (zero calories and about 300 times sweeter than sugar). Recently, some progress has been made in understanding the biosynthesis of SGs in Stevia, but little is known about the molecular mechanisms underlying this process. Additionally, the genomics of Stevia, a non-model species, remains uncharacterized. The recent advent of RNA-Seq, a next generation sequencing technology, provides an opportunity to expand the identification of Stevia genes through in-depth transcript profiling. We present a comprehensive landscape of the transcriptome profiles of three genotypes of Stevia with divergent SG compositions characterized using RNA-seq. 191,590,282 high-quality reads were generated and then assembled into 171,837 transcripts with an average sequence length of 969 base pairs. A total of 80,160 unigenes were annotated, and 14,211 of the unique sequences were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes. Gene sequences of all enzymes known to be involved in SG synthesis were examined. A total of 143 UDP-glucosyltransferase (UGT) unigenes were identified, some of which might be involved in SG biosynthesis. The expression patterns of eight of these genes were further confirmed by RT-QPCR. RNA-seq analysis identified candidate genes encoding enzymes responsible for the biosynthesis of SGs in Stevia, a non-model plant without a reference genome. The transcriptome data from this study yielded new insights into the process of SG accumulation in Stevia. Our results demonstrate that RNA-Seq can be successfully used for gene identification and transcript profiling in a non-model species.

Identification of active methanotrophs in a landfill cover soil through detection of expression of 16S rRNA and functional genes.

Science.gov (United States)

Chen, Yin; Dumont, Marc G; Cébron, Aurélie; Murrell, J Colin

2007-11-01

Active methanotrophs in a landfill soil were revealed by detecting the 16S rRNA of methanotrophs and the mRNA transcripts of key genes involved in methane oxidation. New 16S rRNA primers targeting type I and type II methanotrophs were designed and optimized for analysis by denaturing gradient gel electrophoresis. Direct extraction of RNA from soil enabled the analysis of the expression of the functional genes: mmoX, pmoA and mxaF, which encode subunits of soluble methane monooxygenase, particulate methane monooxygenase and methanol dehydrogenase respectively. The 16S rRNA polymerase chain reaction (PCR) primers for type I methanotrophs detected Methylomonas, Methylosarcina and Methylobacter sequences from both soil DNA and cDNA which was generated from RNA extracted directly from the landfill cover soil. The 16S rRNA primers for type II methanotrophs detected primarily Methylocella and some Methylocystis 16S rRNA genes. Phylogenetic analysis of mRNA recovered from the soil indicated that Methylobacter, Methylosarcina, Methylomonas, Methylocystis and Methylocella were actively expressing genes involved in methane and methanol oxidation. Transcripts of pmoA but not mmoX were readily detected by reverse transcription polymerase chain reaction (RT-PCR), indicating that particulate methane monooxygenase may be largely responsible for methane oxidation in situ.

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

Science.gov (United States)

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

Directory of Open Access Journals (Sweden)

Nathan D. Olson

2015-03-01

Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

RNomics and Modomics in the halophilic archaea Haloferax volcanii: identification of RNA modification genes

Directory of Open Access Journals (Sweden)

Decatur Wayne A

2008-10-01

Full Text Available Abstract Background Naturally occurring RNAs contain numerous enzymatically altered nucleosides. Differences in RNA populations (RNomics and pattern of RNA modifications (Modomics depends on the organism analyzed and are two of the criteria that distinguish the three kingdoms of life. If the genomic sequences of the RNA molecules can be derived from whole genome sequence information, the modification profile cannot and requires or direct sequencing of the RNAs or predictive methods base on the presence or absence of the modifications genes. Results By employing a comparative genomics approach, we predicted almost all of the genes coding for the t+rRNA modification enzymes in the mesophilic moderate halophile Haloferax volcanii. These encode both guide RNAs and enzymes. Some are orthologous to previously identified genes in Archaea, Bacteria or in Saccharomyces cerevisiae, but several are original predictions. Conclusion The number of modifications in t+rRNAs in the halophilic archaeon is surprisingly low when compared with other Archaea or Bacteria, particularly the hyperthermophilic organisms. This may result from the specific lifestyle of halophiles that require high intracellular salt concentration for survival. This salt content could allow RNA to maintain its functional structural integrity with fewer modifications. We predict that the few modifications present must be particularly important for decoding, accuracy of translation or are modifications that cannot be functionally replaced by the electrostatic interactions provided by the surrounding salt-ions. This analysis also guides future experimental validation work aiming to complete the understanding of the function of RNA modifications in Archaeal translation.

Identification of cytokinin-responsive genes using microarray meta-analysis and RNA-Seq in Arabidopsis.

Science.gov (United States)

Bhargava, Apurva; Clabaugh, Ivory; To, Jenn P; Maxwell, Bridey B; Chiang, Yi-Hsuan; Schaller, G Eric; Loraine, Ann; Kieber, Joseph J

2013-05-01

Cytokinins are N(6)-substituted adenine derivatives that play diverse roles in plant growth and development. We sought to define a robust set of genes regulated by cytokinin as well as to query the response of genes not represented on microarrays. To this end, we performed a meta-analysis of microarray data from a variety of cytokinin-treated samples and used RNA-seq to examine cytokinin-regulated gene expression in Arabidopsis (Arabidopsis thaliana). Microarray meta-analysis using 13 microarray experiments combined with empirically defined filtering criteria identified a set of 226 genes differentially regulated by cytokinin, a subset of which has previously been validated by other methods. RNA-seq validated about 73% of the up-regulated genes identified by this meta-analysis. In silico promoter analysis indicated an overrepresentation of type-B Arabidopsis response regulator binding elements, consistent with the role of type-B Arabidopsis response regulators as primary mediators of cytokinin-responsive gene expression. RNA-seq analysis identified 73 cytokinin-regulated genes that were not represented on the ATH1 microarray. Representative genes were verified using quantitative reverse transcription-polymerase chain reaction and NanoString analysis. Analysis of the genes identified reveals a substantial effect of cytokinin on genes encoding proteins involved in secondary metabolism, particularly those acting in flavonoid and phenylpropanoid biosynthesis, as well as in the regulation of redox state of the cell, particularly a set of glutaredoxin genes. Novel splicing events were found in members of some gene families that are known to play a role in cytokinin signaling or metabolism. The genes identified in this analysis represent a robust set of cytokinin-responsive genes that are useful in the analysis of cytokinin function in plants.

Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli.

Science.gov (United States)

Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada

2002-07-01

Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.

Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

Directory of Open Access Journals (Sweden)

Mignon A Keaton

2011-03-01

Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

MicroRNA Dysregulation, Gene Networks, and Risk for Schizophrenia in 22q11.2 Deletion Syndrome

OpenAIRE

Merico, Daniele; Costain, Gregory; Butcher, Nancy J.; Warnica, William; Ogura, Lucas; Alfred, Simon E.; Brzustowicz, Linda M.; Bassett, Anne S.

2014-01-01

The role of microRNAs (miRNAs) in the etiology of schizophrenia is increasingly recognized. Microdeletions at chromosome 22q11.2 are recurrent structural variants that impart a high risk for schizophrenia and are found in up to 1% of all patients with schizophrenia. The 22q11.2 deletion region overlaps gene DGCR8, encoding a subunit of the miRNA microprocessor complex. We identified miRNAs overlapped by the 22q11.2 microdeletion and for the first time investigated their predicted target genes...

Detecting microRNA activity from gene expression data

LENUS (Irish Health Repository)

Madden, Stephen F

2010-05-18

Abstract Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

Detecting microRNA activity from gene expression data.

LENUS (Irish Health Repository)

Madden, Stephen F

2010-01-01

BACKGROUND: MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. RESULTS: Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. CONCLUSIONS: We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

Science.gov (United States)

Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

2014-06-01

Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

Developmental regulation of Xenopus 5S RNA genes

International Nuclear Information System (INIS)

Wormington, W.M.; Schlissel, M.; Brown, D.D.

1983-01-01

In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

Pan-Cancer Analysis of lncRNA Regulation Supports Their Targeting of Cancer Genes in Each Tumor Context

Directory of Open Access Journals (Sweden)

Hua-Sheng Chiu

2018-04-01

Full Text Available Summary: Long noncoding RNAs (lncRNAs are commonly dysregulated in tumors, but only a handful are known to play pathophysiological roles in cancer. We inferred lncRNAs that dysregulate cancer pathways, oncogenes, and tumor suppressors (cancer genes by modeling their effects on the activity of transcription factors, RNA-binding proteins, and microRNAs in 5,185 TCGA tumors and 1,019 ENCODE assays. Our predictions included hundreds of candidate onco- and tumor-suppressor lncRNAs (cancer lncRNAs whose somatic alterations account for the dysregulation of dozens of cancer genes and pathways in each of 14 tumor contexts. To demonstrate proof of concept, we showed that perturbations targeting OIP5-AS1 (an inferred tumor suppressor and TUG1 and WT1-AS (inferred onco-lncRNAs dysregulated cancer genes and altered proliferation of breast and gynecologic cancer cells. Our analysis indicates that, although most lncRNAs are dysregulated in a tumor-specific manner, some, including OIP5-AS1, TUG1, NEAT1, MEG3, and TSIX, synergistically dysregulate cancer pathways in multiple tumor contexts. : Chiu et al. present a pan-cancer analysis of lncRNA regulatory interactions. They suggest that the dysregulation of hundreds of lncRNAs target and alter the expression of cancer genes and pathways in each tumor context. This implies that hundreds of lncRNAs can alter tumor phenotypes in each tumor context. Keywords: lncRNA, regulation, modulation, cancer gene, pan-cancer, noncoding RNA, microRNA, RNA-binding proteins, interactome

Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

Science.gov (United States)

Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

2013-01-30

Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Water deficit modulates gene expression in growing zones of soybean seedlings. Analysis of differentially expressed cDNAs, a new beta-tubulin gene, and expression of genes encoding cell wall proteins.

Science.gov (United States)

Creelman, R A; Mullet, J E

1991-10-01

Transfer of soybean seedlings to low-water-potential vermiculite (psi w = -0.3 MPa) results in a reversible decrease in hypocotyl growth and modulation of several polysomal mRNAs (Plant Physiol 92: 205-214). We report here the isolation of two cDNA clones (pGE16 and pGE95) which correspond to genes whose mRNA levels are increased, and one cDNA clone (pGE23) which corresponds to a gene whose mRNA level is decreased in the hypocotyl zone of cell elongation by water deficit. In well-watered seedlings mRNAs hybridizing to pGE16 and pGE95 are most abundant in mature regions of the seedling, but in water-deficient seedlings mRNA levels are reduced in mature regions and enhanced in elongating regions. RNA corresponding to soybean proline-rich protein 1 (sbPRP1) shows a similar tissue distribution and response to water deficit. In contrast, in well-watered seedlings, the gene corresponding to pGE23 was highly expressed in the hypocotyl and root growing zones. Transfer of seedlings to low-water-potential vermiculite caused a rapid decrease in mRNA hybridizing to pGE23. Sequence analysis revealed that pGE23 has high homology with beta-tubulin. Water deficit also reduced the level of mRNA hybridizing to JCW1, an auxin-modulated gene, although with different kinetics. Furthermore, mRNA encoding actin, glycine-rich proteins (GRPs), and hydroxyproline-rich glycoproteins (HRGPs) were down-regulated in the hypocotyl zone of elongation of seedlings exposed to water deficit. No effect of water deficit was observed on the expression of chalcone synthase. Decreased expression of beta-tubulin, actin, JCW1, HRGP and GRP and increased expression of sbPRP1, pGE95 and pGE16 in the hypocotyl zone of cell elongation could participate in the reversible growth inhibition observed in water-deficient soybean seedlings.

Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

Science.gov (United States)

Garcia, S; Kovařík, A

2013-07-01

In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

A Caenorhabditis elegans RNA polymerase II gene, ama-1 IV, and nearby essential genes.

Science.gov (United States)

Rogalski, T M; Riddle, D L

1988-01-01

The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20 degrees but are arrested as larvae at 25 degrees, and two others are fertile at 20 degrees and sterile at 25 degrees. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25 degrees is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four gamma-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development.

miRNA-mediated 'tug-of-war' model reveals ceRNA propensity of genes in cancers.

Science.gov (United States)

Swain, Arpit Chandan; Mallick, Bibekanand

2018-06-01

Competing endogenous RNA (ceRNA) are transcripts that cross-regulate each other at the post-transcriptional level by competing for shared microRNA response elements (MREs). These have been implicated in various biological processes impacting cell-fate decisions and diseases including cancer. There are several studies that predict possible ceRNA pairs by adopting various machine-learning and mathematical approaches; however, there is no method that enables us to gauge as well as compare the propensity of the ceRNA of a gene and precisely envisages which among a pair exerts a stronger pull on the shared miRNA pool. In this study, we developed a method that uses the 'tug of war of genes' concept to predict and quantify ceRNA potential of a gene for the shared miRNA pool in cancers based on a score represented by SoCeR (score of competing endogenous RNA). The method was executed on the RNA-Seq transcriptional profiles of genes and miRNA available at TCGA along with CLIP-supported miRNA-target sites to predict ceRNA in 32 cancer types which were validated with already reported cases. The proposed method can be used to determine the sequestering capability of the gene of interest as well as in ranking the probable ceRNA candidates of a gene. Finally, we developed standalone applications (SoCeR tool) to aid researchers in easier implementation of the method in analysing different data sets or diseases. © 2018 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.

Nucleotide sequence of a human tRNA gene heterocluster

International Nuclear Information System (INIS)

Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

1986-01-01

Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

mRNA/microRNA gene expression profile in microsatellite unstable colorectal cancer

Directory of Open Access Journals (Sweden)

Calin George A

2007-08-01

Full Text Available Abstract Background Colorectal cancer develops through two main genetic instability pathways characterized by distinct pathologic features and clinical outcome. Results We investigated colon cancer samples (23 characterized by microsatellite stability, MSS, and 16 by high microsatellite instability, MSI-H for genome-wide expression of microRNA (miRNA and mRNA. Based on combined miRNA and mRNA gene expression, a molecular signature consisting of twenty seven differentially expressed genes, inclusive of 8 miRNAs, could correctly distinguish MSI-H versus MSS colon cancer samples. Among the differentially expressed miRNAs, various members of the oncogenic miR-17-92 family were significantly up-regulated in MSS cancers. The majority of protein coding genes were also up-regulated in MSS cancers. Their functional classification revealed that they were most frequently associated with cell cycle, DNA replication, recombination, repair, gastrointestinal disease and immune response. Conclusion This is the first report that indicates the existence of differences in miRNA expression between MSS versus MSI-H colorectal cancers. In addition, the work suggests that the combination of mRNA/miRNA expression signatures may represent a general approach for improving bio-molecular classification of human cancer.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

Science.gov (United States)

Tornow, J; Santangelo, G M

1994-06-01

A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

Drosha regulates gene expression independently of RNA cleavage function

DEFF Research Database (Denmark)

Gromak, Natalia; Dienstbier, Martin; Macias, Sara

2013-01-01

Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-dependent manner. This binding is not associated with miRNA production or RNA cleavage. Drosha knockdown in HeLa cells downregulated nascent gene transcription, resulting in a reduction of polyadenylated mRNA produced from these gene regions. Furthermore, we show that this function of Drosha is dependent on its N......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....

Characterization of TRZ1, a yeast homolog of the human candidate prostate cancer susceptibility gene ELAC2 encoding tRNase Z

Directory of Open Access Journals (Sweden)

Chen Yuan

2005-05-01

Full Text Available Abstract Background In humans, mutation of ELAC2 is associated with an increased risk of prostate cancer. ELAC2 has been shown to have tRNase Z activity and is associated with the γ-tubulin complex. Results In this work, we show that the yeast homolog of ELAC2, encoded by TRZ1 (tRNase Z 1, is involved genetically in RNA processing. The temperature sensitivity of a trz1 mutant can be rescued by multiple copies of REX2, which encodes a protein with RNA 3' processing activity, suggesting a role of Trz1p in RNA processing in vivo. Trz1p has two putative nucleotide triphosphate-binding motifs (P-loop and a conserved histidine motif. The histidine motif and the putative nucleotide binding motif at the C-domain are important for Trz1p function because mutant proteins bearing changes to the critical residues in these motifs are unable to rescue deletion of TRZ1. The growth defect exhibited by trz1 yeast is not complemented by the heterologous ELAC2, suggesting that Trz1p may have additional functions in yeast. Conclusion Our results provide genetic evidence that prostate cancer susceptibility gene ELAC2 may be involved in RNA processing, especially rRNA processing and mitochondrial function.

Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

Science.gov (United States)

Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

2013-01-01

Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

Poly-dipeptides encoded by the C9orf72 repeats bind nucleoli, impede RNA biogenesis, and kill cells.

Science.gov (United States)

Kwon, Ilmin; Xiang, Siheng; Kato, Masato; Wu, Leeju; Theodoropoulos, Pano; Wang, Tao; Kim, Jiwoong; Yun, Jonghyun; Xie, Yang; McKnight, Steven L

2014-09-05

Many RNA regulatory proteins controlling pre-messenger RNA splicing contain serine:arginine (SR) repeats. Here, we found that these SR domains bound hydrogel droplets composed of fibrous polymers of the low-complexity domain of heterogeneous ribonucleoprotein A2 (hnRNPA2). Hydrogel binding was reversed upon phosphorylation of the SR domain by CDC2-like kinases 1 and 2 (CLK1/2). Mutated variants of the SR domains changing serine to glycine (SR-to-GR variants) also bound to hnRNPA2 hydrogels but were not affected by CLK1/2. When expressed in mammalian cells, these variants bound nucleoli. The translation products of the sense and antisense transcripts of the expansion repeats associated with the C9orf72 gene altered in neurodegenerative disease encode GRn and PRn repeat polypeptides. Both peptides bound to hnRNPA2 hydrogels independent of CLK1/2 activity. When applied to cultured cells, both peptides entered cells, migrated to the nucleus, bound nucleoli, and poisoned RNA biogenesis, which caused cell death. Copyright © 2014, American Association for the Advancement of Science.

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

Genes involved in translation of Mycoplasma hyopneumoniae and Mycoplasma synoviae

Directory of Open Access Journals (Sweden)

Mônica de Oliveira Santos

2007-01-01

Full Text Available This is a report on the analysis of genes involved in translation of the complete genomes of Mycoplasma hyopneumoniae strain J and 7448 and Mycoplasma synoviae. In both genomes 31 ORFs encoding large ribosomal subunit proteins and 19 ORFs encoding small ribosomal subunit proteins were found. Ten ribosomal protein gene clusters encoding 42 ribosomal proteins were found in M. synoviae, while 8 clusters encoding 39 ribosomal proteins were found in both M. hyopneumoniae strains. The L33 gene of the M. hyopneumoniae strain 7448 presented two copies in different locations. The genes encoding initiation factors (IF-1, IF-2 and IF-3, elongation factors (EF-G, EF-Tu, EF-Ts and EF-P, and the genes encoding the ribosome recycling factor (frr and one polypeptide release factor (prfA were present in the genomes of M. hyopneumoniae and M. synoviae. Nineteen aminoacyl-tRNA synthases had been previously identified in both mycoplasmas. In the two strains of M. hyopneumoniae, J and 7448, only one set of 5S, 16S and 23S rRNAs had been identified. Two sets of 16S and 23S rRNA genes and three sets of 5S rRNA genes had been identified in the M. synoviae genome.

Global investigation of RNA 3'end processing and transcription termination pathways

DEFF Research Database (Denmark)

Molska, Ewa

2018-01-01

. For example, contrary to prediction, a subset of protein-coding genes utilise the machinery used by genes encoding U snRNAs. This same machinery is predominantly used by a class of lncRNA genes, encoding so-called PROMPTs, despite the presence of sequence elements predicted to guide the usage of the pathway......RNA polymerases transcribe diverse classes of genes and the produced RNAs need to be targeted to their appropriate cognate biochemical maturation pathways. The vast majority of the human transcriptome consists of long non-coding RNAs (lncRNAs), which is a heterogeneous group of RNAs...... that is inadequately divided into classes based e.g. on length, stability and association with protein-coding genes. We reasoned that further classification based on biochemical properties, in this case transcription termination and the mechanistically coupled RNA 3’-end processing, would enable a better understanding...

RNA-Generated and Gene-Edited Induced Pluripotent Stem Cells for Disease Modeling and Therapy.

Science.gov (United States)

Kehler, James; Greco, Marianna; Martino, Valentina; Pachiappan, Manickam; Yokoe, Hiroko; Chen, Alice; Yang, Miranda; Auerbach, Jonathan; Jessee, Joel; Gotte, Martin; Milanesi, Luciano; Albertini, Alberto; Bellipanni, Gianfranco; Zucchi, Ileana; Reinbold, Rolland A; Giordano, Antonio

2017-06-01

Cellular reprogramming by epigenomic remodeling of chromatin holds great promise in the field of human regenerative medicine. As an example, human-induced Pluripotent Stem Cells (iPSCs) obtained by reprograming of patient somatic cells are sufficiently similar to embryonic stem cells (ESCs) and can generate all cell types of the human body. Clinical use of iPSCs is dependent on methods that do not utilize genome altering transgenic technologies that are potentially unsafe and ethically unacceptable. Transient delivery of exogenous RNA into cells provides a safer reprogramming system to transgenic approaches that rely on exogenous DNA or viral vectors. RNA reprogramming may prove to be more suitable for clinical applications and provide stable starting cell lines for gene-editing, isolation, and characterization of patient iPSC lines. The introduction and rapid evolution of CRISPR/Cas9 gene-editing systems has provided a readily accessible research tool to perform functional human genetic experiments. Similar to RNA reprogramming, transient delivery of mRNA encoding Cas9 in combination with guide RNA sequences to target specific points in the genome eliminates the risk of potential integration of Cas9 plasmid constructs. We present optimized RNA-based laboratory procedure for making and editing iPSCs. In the near-term these two powerful technologies are being harnessed to dissect mechanisms of human development and disease in vitro, supporting both basic, and translational research. J. Cell. Physiol. 232: 1262-1269, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

Directory of Open Access Journals (Sweden)

Melanie Brunsch

Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

A site-specific endonuclease encoded by a typical archaeal intron

DEFF Research Database (Denmark)

Dalgaard, Jacob; Garrett, Roger Antony; Belfort, Malene

1993-01-01

The protein encoded by the archaeal intron in the 23S rRNA gene of the hyperthermophile Desulfurococcus mobilis is a double-strand DNase that, like group I intron homing endonucleases, is capable of cleaving an intronless allele of the gene. This enzyme, I-Dmo I, is unusual among the intron...

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

Diversity of 16S rRNA and dioxygenase genes detected in coal-tar-contaminated site undergoing active bioremediation

Energy Technology Data Exchange (ETDEWEB)

Kumar, M; Khanna, S [NIIT Univ, Neemrana (India). Dept. of Biotechnology & Bioinformation

2010-04-15

In order to develop effective bioremediation strategies for polyaromatic hydrocarbons (PAHs) degradation, the composition and metabolic potential of microbial communities need to be better understood, especially in highly PAH contaminated sites in which little information on the cultivation-independent communities is available. Coal-tar-contaminated soil was collected, which consisted of 122-122.5 mg g{sup -1} total extractable PAH compounds. Biodegradation studies with this soil indicated the presence of microbial community that is capable of degrading the model PAH compounds viz naphthalene, phenanthrene and pyrene at 50 ppm each. PCR clone libraries were established from the DNA of the coal-tar-contaminated soil, targeting the 16S rRNA to characterize (I) the microbial communities, (ii) partial gene fragment encoding the Rieske iron sulfur center {alpha}-subunit) common to all PAH dioxygenase enzymes and (iii) {beta}-subunit of dioxygenase. Phylotypes related to Proteobacteria ({Alpha}-, {Epsilon}- and Gammaproteobacteria), Acidobacteria, Actinobacteria, Firmicutes, Gemmatimonadetes and Deinococci were detected in 16S rRNA derived clone libraries. Many of the gene fragment sequences of alpha-subunit and beta-subunit of dioxygenase obtained from the respective clone libraries fell into clades that are distinct from the reference dioxygenase gene sequences. Presence of consensus sequence of the Rieske type (2Fe2S) cluster binding site suggested that these gene fragments encode for {alpha}-subunit of dioxygenase gene. Sequencing of the cloned libraries representing {alpha}-subunit gene fragments (Rf1) and beta-subunit of dioxygenase showed the presence of hitherto unidentified dioxygenase in coal-tar-contaminated soil.

MicroRNA Dysregulation, Gene Networks, and Risk for Schizophrenia in 22q11.2 Deletion Syndrome

Science.gov (United States)

Merico, Daniele; Costain, Gregory; Butcher, Nancy J.; Warnica, William; Ogura, Lucas; Alfred, Simon E.; Brzustowicz, Linda M.; Bassett, Anne S.

2014-01-01

The role of microRNAs (miRNAs) in the etiology of schizophrenia is increasingly recognized. Microdeletions at chromosome 22q11.2 are recurrent structural variants that impart a high risk for schizophrenia and are found in up to 1% of all patients with schizophrenia. The 22q11.2 deletion region overlaps gene DGCR8, encoding a subunit of the miRNA microprocessor complex. We identified miRNAs overlapped by the 22q11.2 microdeletion and for the first time investigated their predicted target genes, and those implicated by DGCR8, to identify targets that may be involved in the risk for schizophrenia. The 22q11.2 region encompasses seven validated or putative miRNA genes. Employing two standard prediction tools, we generated sets of predicted target genes. Functional enrichment profiles of the 22q11.2 region miRNA target genes suggested a role in neuronal processes and broader developmental pathways. We then constructed a protein interaction network of schizophrenia candidate genes and interaction partners relevant to brain function, independent of the 22q11.2 region miRNA mechanisms. We found that the predicted gene targets of the 22q11.2 deletion miRNAs, and targets of the genome-wide miRNAs predicted to be dysregulated by DGCR8 hemizygosity, were significantly represented in this schizophrenia network. The findings provide new insights into the pathway from 22q11.2 deletion to expression of schizophrenia, and suggest that hemizygosity of the 22q11.2 region may have downstream effects implicating genes elsewhere in the genome that are relevant to the general schizophrenia population. These data also provide further support for the notion that robust genetic findings in schizophrenia may converge on a reasonable number of final pathways. PMID:25484875

Thermodynamic control of small RNA-mediated gene silencing

Directory of Open Access Journals (Sweden)

Kumiko eUi-Tei

2012-06-01

Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

A viral microRNA down-regulates multiple cell cycle genes through mRNA 5'UTRs.

Directory of Open Access Journals (Sweden)

Finn Grey

2010-06-01

Full Text Available Global gene expression data combined with bioinformatic analysis provides strong evidence that mammalian miRNAs mediate repression of gene expression primarily through binding sites within the 3' untranslated region (UTR. Using RNA induced silencing complex immunoprecipitation (RISC-IP techniques we have identified multiple cellular targets for a human cytomegalovirus (HCMV miRNA, miR-US25-1. Strikingly, this miRNA binds target sites primarily within 5'UTRs, mediating significant reduction in gene expression. Intriguingly, many of the genes targeted by miR-US25-1 are associated with cell cycle control, including cyclin E2, BRCC3, EID1, MAPRE2, and CD147, suggesting that miR-US25-1 is targeting genes within a related pathway. Deletion of miR-US25-1 from HCMV results in over expression of cyclin E2 in the context of viral infection. Our studies demonstrate that a viral miRNA mediates translational repression of multiple cellular genes by targeting mRNA 5'UTRs.

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.

Science.gov (United States)

Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj

2014-12-01

Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.

A genome-wide characterization of microRNA genes in maize.

Directory of Open Access Journals (Sweden)

Lifang Zhang

2009-11-01

Full Text Available MicroRNAs (miRNAs are small, non-coding RNAs that play essential roles in plant growth, development, and stress response. We conducted a genome-wide survey of maize miRNA genes, characterizing their structure, expression, and evolution. Computational approaches based on homology and secondary structure modeling identified 150 high-confidence genes within 26 miRNA families. For 25 families, expression was verified by deep-sequencing of small RNA libraries that were prepared from an assortment of maize tissues. PCR-RACE amplification of 68 miRNA transcript precursors, representing 18 families conserved across several plant species, showed that splice variation and the use of alternative transcriptional start and stop sites is common within this class of genes. Comparison of sequence variation data from diverse maize inbred lines versus teosinte accessions suggest that the mature miRNAs are under strong purifying selection while the flanking sequences evolve equivalently to other genes. Since maize is derived from an ancient tetraploid, the effect of whole-genome duplication on miRNA evolution was examined. We found that, like protein-coding genes, duplicated miRNA genes underwent extensive gene-loss, with approximately 35% of ancestral sites retained as duplicate homoeologous miRNA genes. This number is higher than that observed with protein-coding genes. A search for putative miRNA targets indicated bias towards genes in regulatory and metabolic pathways. As maize is one of the principal models for plant growth and development, this study will serve as a foundation for future research into the functional roles of miRNA genes.

In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

Science.gov (United States)

Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

2018-01-01

The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

Science.gov (United States)

Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

2011-01-01

Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

A highly divergent gene cluster in honey bees encodes a novel silk family.

Science.gov (United States)

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

Evolutionary relationships between miRNA genes and their activity.

Science.gov (United States)

Zhu, Yan; Skogerbø, Geir; Ning, Qianqian; Wang, Zhen; Li, Biqing; Yang, Shuang; Sun, Hong; Li, Yixue

2012-12-22

The emergence of vertebrates is characterized by a strong increase in miRNA families. MicroRNAs interact broadly with many transcripts, and the evolution of such a system is intriguing. However, evolutionary questions concerning the origin of miRNA genes and their subsequent evolution remain unexplained. In order to systematically understand the evolutionary relationship between miRNAs gene and their function, we classified human known miRNAs into eight groups based on their evolutionary ages estimated by maximum parsimony method. New miRNA genes with new functional sequences accumulated more dynamically in vertebrates than that observed in Drosophila. Different levels of evolutionary selection were observed over miRNA gene sequences with different time of origin. Most genic miRNAs differ from their host genes in time of origin, there is no particular relationship between the age of a miRNA and the age of its host genes, genic miRNAs are mostly younger than the corresponding host genes. MicroRNAs originated over different time-scales are often predicted/verified to target the same or overlapping sets of genes, opening the possibility of substantial functional redundancy among miRNAs of different ages. Higher degree of tissue specificity and lower expression level was found in young miRNAs. Our data showed that compared with protein coding genes, miRNA genes are more dynamic in terms of emergence and decay. Evolution patterns are quite different between miRNAs of different ages. MicroRNAs activity is under tight control with well-regulated expression increased and targeting decreased over time. Our work calls attention to the study of miRNA activity with a consideration of their origin time.

Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

Directory of Open Access Journals (Sweden)

Saki Kondo

Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.

Science.gov (United States)

Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM

1992-01-01

Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632

Transcription factor trapping by RNA in gene regulatory elements.

Science.gov (United States)

Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

2015-11-20

Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

Isolation and expression analysis of four HD-ZIP III family genes targeted by microRNA166 in peach.

Science.gov (United States)

Zhang, C H; Zhang, B B; Ma, R J; Yu, M L; Guo, S L; Guo, L

2015-10-30

MicroRNA166 (miR166) is known to have highly conserved targets that encode proteins of the class III homeodomain-leucine zipper (HD-ZIP III) family, in a broad range of plant species. To further understand the relationship between HD-ZIP III genes and miR166, four HD-ZIP III family genes (PpHB14, PpHB15, PpHB8, and PpREV) were isolated from peach (Prunus persica) tissue and characterized. Spatio-temporal expression profiles of the genes were analyzed. Genes of the peach HD-ZIP III family were predicted to encode five conserved domains. Deduced amino acid sequences and tertiary structures of the four peach HD-ZIP III genes were highly conserved, with corresponding genes in Arabidopsis thaliana. The expression level of four targets displayed the opposite trend to that of miR166 throughout fruit development, with the exception of PpHB14 from 35 to 55 days after full bloom (DAFB). This finding indicates that miR166 may negatively regulate its four targets throughout fruit development. As for leaf and phloem, the same trend in expression level was observed between four targets and miR166 from 75 to 105 DAFB. However, the opposite trend was observed for the transcript level between four targets and miR166 from 35 to 55 DAFB. miRNA166 may negatively regulate four targets in some but not all developmental stages for a given tissue. The four genes studied were observed to have, exactly or generally, the same change tendency as individual tissue development, a finding that suggests genes of the HD-ZIP III family in peach may have complementary or cooperative functions in various tissues.

Functional gene silencing mediated by chitosan/siRNA nanocomplexes

Energy Technology Data Exchange (ETDEWEB)

Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F [Department of Pharmaceutical Science, Zhujiang Hospital, Southern Medical University, Guangzhou 510282 (China); Yang, B, E-mail: andrewfxu1998@gmail.co [Department of Chemistry, Indiana University-Bloomington, Bloomington, IN 47405 (United States)

2009-10-07

Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

Functional gene silencing mediated by chitosan/siRNA nanocomplexes

International Nuclear Information System (INIS)

Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F; Yang, B

2009-01-01

Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

Directory of Open Access Journals (Sweden)

Michele Gusberti

Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

tRNA gene diversity in the three domains of life

Directory of Open Access Journals (Sweden)

Kosuke eFujishima

2014-05-01

Full Text Available Transfer RNA (tRNA is widely known for its key role in decoding mRNA into protein. Despite their necessity and relatively short nucleotide sequences, a large diversity of gene structures and RNA secondary structures of pre-tRNAs and mature tRNAs have recently been discovered in the three domains of life. Growing evidences of disrupted tRNA genes in the genomes of Archaea reveals unique gene structures such as, intron-containing tRNA, split tRNA, and permuted tRNA. Coding sequence for these tRNAs are either separated with introns, fragmented, or permuted at the genome level. Although evolutionary scenario behind the tRNA gene disruption is still unclear, diversity of tRNA structure seems to be co-evolved with their processing enzyme, so-called RNA splicing endonuclease. Metazoan mitochondrial tRNAs (mtRNAs are known for their unique lack of either one or two arms from the typical tRNA cloverleaf structure, while still maintaining functionality. Recently identified nematode-specific V-arm containing tRNAs (nev-tRNAs possess long variable arms that are specific to eukaryotic class II tRNASer and tRNALeu but also decode class I tRNA codons. Moreover, many tRNA-like sequences have been found in the genomes of different organisms and viruses. Thus this review is aimed to cover the latest knowledge on tRNA gene diversity and further recapitulate the evolutionary and biological aspects that caused such uniqueness.

Transgenic Expression of the piRNA-Resistant Masculinizer Gene Induces Female-Specific Lethality and Partial Female-to-Male Sex Reversal in the Silkworm, Bombyx mori.

Science.gov (United States)

Sakai, Hiroki; Sumitani, Megumi; Chikami, Yasuhiko; Yahata, Kensuke; Uchino, Keiro; Kiuchi, Takashi; Katsuma, Susumu; Aoki, Fugaku; Sezutsu, Hideki; Suzuki, Masataka G

2016-08-01

In Bombyx mori (B. mori), Fem piRNA originates from the W chromosome and is responsible for femaleness. The Fem piRNA-PIWI complex targets and cleaves mRNAs transcribed from the Masc gene. Masc encodes a novel CCCH type zinc-finger protein and is required for male-specific splicing of B. mori doublesex (Bmdsx) transcripts. In the present study, several silkworm strains carrying a transgene, which encodes a Fem piRNA-resistant Masc mRNA (Masc-R), were generated. Forced expression of the Masc-R transgene caused female-specific lethality during the larval stages. One of the Masc-R strains weakly expressed Masc-R in various tissues. Females heterozygous for the transgene expressed male-specific isoform of the Bombyx homolog of insulin-like growth factor II mRNA-binding protein (ImpM) and Bmdsx. All examined females showed a lower inducibility of vitellogenin synthesis and exhibited abnormalities in the ovaries. Testis-like tissues were observed in abnormal ovaries and, notably, the tissues contained considerable numbers of sperm bundles. Homozygous expression of the transgene resulted in formation of the male-specific abdominal segment in adult females and caused partial male differentiation in female genitalia. These results strongly suggest that Masc is an important regulatory gene of maleness in B. mori.

Electroporated Antigen-Encoding mRNA Is Not a Danger Signal to Human Mature Monocyte-Derived Dendritic Cells

Directory of Open Access Journals (Sweden)

Stefanie Hoyer

2015-01-01

Full Text Available For therapeutic cancer vaccination, the adoptive transfer of mRNA-electroporated dendritic cells (DCs is frequently performed, usually with monocyte-derived, cytokine-matured DCs (moDCs. However, DCs are rich in danger-sensing receptors which could recognize the exogenously delivered mRNA and induce DC activation, hence influencing the DCs’ immunogenicity. Therefore, we examined whether electroporation of mRNA with a proper cap and a poly-A tail of at least 64 adenosines had any influence on cocktail-matured moDCs. We used 16 different RNAs, encoding tumor antigens (MelanA, NRAS, BRAF, GNAQ, GNA11, and WT1, and variants thereof. None of those RNAs induced changes in the expression of CD25, CD40, CD83, CD86, and CD70 or the secretion of the cytokines IL-8, IL-6, and TNFα of more than 1.5-fold compared to the control condition, while an mRNA encoding an NF-κB-activation protein as positive control induced massive secretion of the cytokines. To determine whether mRNA electroporation had any effect on the whole transcriptome of the DCs, we performed microarray analyses of DCs of 6 different donors. None of 60,000 probes was significantly different between mock-electroporated DCs and MelanA-transfected DCs. Hence, we conclude that no transcriptional programs were induced within cocktail-matured DCs by electroporation of single tumor-antigen-encoding mRNAs.

Pseudogenes regulate parental gene expression via ceRNA network.

Science.gov (United States)

An, Yang; Furber, Kendra L; Ji, Shaoping

2017-01-01

The concept of competitive endogenous RNA (ceRNA) was first proposed by Salmena and colleagues. Evidence suggests that pseudogene RNAs can act as a 'sponge' through competitive binding of common miRNA, releasing or attenuating repression through sequestering miRNAs away from parental mRNA. In theory, ceRNAs refer to all transcripts such as mRNA, tRNA, rRNA, long non-coding RNA, pseudogene RNA and circular RNA, because all of them may become the targets of miRNA depending on spatiotemporal situation. As binding of miRNA to the target RNA is not 100% complementary, it is possible that one miRNA can bind to multiple target RNAs and vice versa. All RNAs crosstalk through competitively binding to miRNAvia miRNA response elements (MREs) contained within the RNA sequences, thus forming a complex regulatory network. The ratio of a subset of miRNAs to the corresponding number of MREs determines repression strength on a given mRNA translation or stability. An increase in pseudogene RNA level can sequester miRNA and release repression on the parental gene, leading to an increase in parental gene expression. A massive number of transcripts constitute a complicated network that regulates each other through this proposed mechanism, though some regulatory significance may be mild or even undetectable. It is possible that the regulation of gene and pseudogene expression occurring in this manor involves all RNAs bearing common MREs. In this review, we will primarily discuss how pseudogene transcripts regulate expression of parental genes via ceRNA network and biological significance of regulation. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

Science.gov (United States)

Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

2003-08-01

ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

Human intronless genes: Functional groups, associated diseases, evolution, and mRNA processing in absence of splicing

International Nuclear Information System (INIS)

Grzybowska, Ewa A.

2012-01-01

Highlights: ► Functional characteristics of intronless genes (IGs). ► Diseases associated with IGs. ► Origin and evolution of IGs. ► mRNA processing without splicing. -- Abstract: Intronless genes (IGs) constitute approximately 3% of the human genome. Human IGs are essentially different in evolution and functionality from the IGs of unicellular eukaryotes, which represent the majority in their genomes. Functional analysis of IGs has revealed a massive over-representation of signal transduction genes and genes encoding regulatory proteins important for growth, proliferation, and development. IGs also often display tissue-specific expression, usually in the nervous system and testis. These characteristics translate into IG-associated diseases, mainly neuropathies, developmental disorders, and cancer. IGs represent recent additions to the genome, created mostly by retroposition of processed mRNAs with retained functionality. Processing, nuclear export, and translation of these mRNAs should be hampered dramatically by the lack of splice factors, which normally tightly cover mature transcripts and govern their fate. However, natural IGs manage to maintain satisfactory expression levels. Different mechanisms by which IGs solve the problem of mRNA processing and nuclear export are discussed here, along with their possible impact on reporter studies.

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

Science.gov (United States)

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

DEFF Research Database (Denmark)

Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

RNA-Seq of Bacillus licheniformis: active regulatory RNA features expressed within a productive fermentation

Science.gov (United States)

2013-01-01

Background The production of enzymes by an industrial strain requires a complex adaption of the bacterial metabolism to the conditions within the fermenter. Regulatory events within the process result in a dynamic change of the transcriptional activity of the genome. This complex network of genes is orchestrated by proteins as well as regulatory RNA elements. Here we present an RNA-Seq based study considering selected phases of an industry-oriented fermentation of Bacillus licheniformis. Results A detailed analysis of 20 strand-specific RNA-Seq datasets revealed a multitude of transcriptionally active genomic regions. 3314 RNA features encoded by such active loci have been identified and sorted into ten functional classes. The identified sequences include the expected RNA features like housekeeping sRNAs, metabolic riboswitches and RNA switches well known from studies on Bacillus subtilis as well as a multitude of completely new candidates for regulatory RNAs. An unexpectedly high number of 855 RNA features are encoded antisense to annotated protein and RNA genes, in addition to 461 independently transcribed small RNAs. These antisense transcripts contain molecules with a remarkable size range variation from 38 to 6348 base pairs in length. The genome of the type strain B. licheniformis DSM13 was completely reannotated using data obtained from RNA-Seq analyses and from public databases. Conclusion The hereby generated data-sets represent a solid amount of knowledge on the dynamic transcriptional activities during the investigated fermentation stages. The identified regulatory elements enable research on the understanding and the optimization of crucial metabolic activities during a productive fermentation of Bacillus licheniformis strains. PMID:24079885

RNA-Seq of Bacillus licheniformis: active regulatory RNA features expressed within a productive fermentation.

Science.gov (United States)

Wiegand, Sandra; Dietrich, Sascha; Hertel, Robert; Bongaerts, Johannes; Evers, Stefan; Volland, Sonja; Daniel, Rolf; Liesegang, Heiko

2013-10-01

The production of enzymes by an industrial strain requires a complex adaption of the bacterial metabolism to the conditions within the fermenter. Regulatory events within the process result in a dynamic change of the transcriptional activity of the genome. This complex network of genes is orchestrated by proteins as well as regulatory RNA elements. Here we present an RNA-Seq based study considering selected phases of an industry-oriented fermentation of Bacillus licheniformis. A detailed analysis of 20 strand-specific RNA-Seq datasets revealed a multitude of transcriptionally active genomic regions. 3314 RNA features encoded by such active loci have been identified and sorted into ten functional classes. The identified sequences include the expected RNA features like housekeeping sRNAs, metabolic riboswitches and RNA switches well known from studies on Bacillus subtilis as well as a multitude of completely new candidates for regulatory RNAs. An unexpectedly high number of 855 RNA features are encoded antisense to annotated protein and RNA genes, in addition to 461 independently transcribed small RNAs. These antisense transcripts contain molecules with a remarkable size range variation from 38 to 6348 base pairs in length. The genome of the type strain B. licheniformis DSM13 was completely reannotated using data obtained from RNA-Seq analyses and from public databases. The hereby generated data-sets represent a solid amount of knowledge on the dynamic transcriptional activities during the investigated fermentation stages. The identified regulatory elements enable research on the understanding and the optimization of crucial metabolic activities during a productive fermentation of Bacillus licheniformis strains.

Reconstruction of ribosomal RNA genes from metagenomic data.

Directory of Open Access Journals (Sweden)

Lu Fan

Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Identification of functional elements and regulatory circuits by Drosophila modENCODE

Energy Technology Data Exchange (ETDEWEB)

Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

2010-12-22

To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

MicroRNA Polymorphisms in Cancer: A Literature Analysis

International Nuclear Information System (INIS)

Pipan, Veronika; Zorc, Minja; Kunej, Tanja

2015-01-01

Single nucleotide polymorphisms (SNPs) located in microRNA (miRNA) genes (miR-SNPs) have attracted increasing attention in recent years due to their involvement in the development of various types of cancer. Therefore, a systematic review on this topic was needed. From 55 scientific publications we collected 20 SNPs, which are located within 18 miRNA encoding genes and have been associated with 16 types of cancer. Among 20 miRNA gene polymorphisms 13 are located within the premature miRNA region, five within mature, and two within mature seed miRNA region. We graphically visualized a network of miRNA-cancer associations which revealed miRNA genes and cancer types with the highest number of connections. Our study showed that, despite a large number of variations currently known to be located within miRNA genes in humans, most of them have not yet been tested for association with cancer. MicroRNA SNPs collected in this study represent only 0.43% of known miRNA gene variations (20/4687). Results of the present study will be useful to researchers investigating the clinical use of miRNAs, such as the roles of miRNAs as diagnostic markers and therapeutic targets

MicroRNA Polymorphisms in Cancer: A Literature Analysis

Energy Technology Data Exchange (ETDEWEB)

Pipan, Veronika; Zorc, Minja; Kunej, Tanja, E-mail: tanja.kunej@bf.uni-lj.si [Department of Animal Science, Biotechnical Faculty, University of Ljubljana, Groblje 3, SI-1230 Domzale (Slovenia)

2015-09-09

Single nucleotide polymorphisms (SNPs) located in microRNA (miRNA) genes (miR-SNPs) have attracted increasing attention in recent years due to their involvement in the development of various types of cancer. Therefore, a systematic review on this topic was needed. From 55 scientific publications we collected 20 SNPs, which are located within 18 miRNA encoding genes and have been associated with 16 types of cancer. Among 20 miRNA gene polymorphisms 13 are located within the premature miRNA region, five within mature, and two within mature seed miRNA region. We graphically visualized a network of miRNA-cancer associations which revealed miRNA genes and cancer types with the highest number of connections. Our study showed that, despite a large number of variations currently known to be located within miRNA genes in humans, most of them have not yet been tested for association with cancer. MicroRNA SNPs collected in this study represent only 0.43% of known miRNA gene variations (20/4687). Results of the present study will be useful to researchers investigating the clinical use of miRNAs, such as the roles of miRNAs as diagnostic markers and therapeutic targets.

Muscle-specific splicing factors ASD-2 and SUP-12 cooperatively switch alternative pre-mRNA processing patterns of the ADF/cofilin gene in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Genta Ohno

Full Text Available Pre-mRNAs are often processed in complex patterns in tissue-specific manners to produce a variety of protein isoforms from single genes. However, mechanisms orchestrating the processing of the entire transcript are not well understood. Muscle-specific alternative pre-mRNA processing of the unc-60 gene in Caenorhabditis elegans, encoding two tissue-specific isoforms of ADF/cofilin with distinct biochemical properties in regulating actin organization, provides an excellent in vivo model of complex and tissue-specific pre-mRNA processing; it consists of a single first exon and two separate series of downstream exons. Here we visualize the complex muscle-specific processing pattern of the unc-60 pre-mRNA with asymmetric fluorescence reporter minigenes. By disrupting juxtaposed CUAAC repeats and UGUGUG stretch in intron 1A, we demonstrate that these elements are required for retaining intron 1A, as well as for switching the processing patterns of the entire pre-mRNA from non-muscle-type to muscle-type. Mutations in genes encoding muscle-specific RNA-binding proteins ASD-2 and SUP-12 turned the colour of the unc-60 reporter worms. ASD-2 and SUP-12 proteins specifically and cooperatively bind to CUAAC repeats and UGUGUG stretch in intron 1A, respectively, to form a ternary complex in vitro. Immunohistochemical staining and RT-PCR analyses demonstrate that ASD-2 and SUP-12 are also required for switching the processing patterns of the endogenous unc-60 pre-mRNA from UNC-60A to UNC-60B in muscles. Furthermore, systematic analyses of partially spliced RNAs reveal the actual orders of intron removal for distinct mRNA isoforms. Taken together, our results demonstrate that muscle-specific splicing factors ASD-2 and SUP-12 cooperatively promote muscle-specific processing of the unc-60 gene, and provide insight into the mechanisms of complex pre-mRNA processing; combinatorial regulation of a single splice site by two tissue-specific splicing regulators

Identification of the gene encoding a type 1 RNase H with an N-terminal double-stranded RNA binding domain from a psychrotrophic bacterium.

Science.gov (United States)

Tadokoro, Takashi; Chon, Hyongi; Koga, Yuichi; Takano, Kazufumi; Kanaya, Shigenori

2007-07-01

The gene encoding a bacterial type 1 RNase H, termed RBD-RNase HI, was cloned from the psychrotrophic bacterium Shewanella sp. SIB1, overproduced in Escherichia coli, and the recombinant protein was purified and biochemically characterized. SIB1 RBD-RNase HI consists of 262 amino acid residues and shows amino acid sequence identities of 26% to SIB1 RNase HI, 17% to E. coli RNase HI, and 32% to human RNase H1. SIB1 RBD-RNase HI has a double-stranded RNA binding domain (RBD) at the N-terminus, which is commonly present at the N-termini of eukaryotic type 1 RNases H. Gel mobility shift assay indicated that this domain binds to an RNA/DNA hybrid in an isolated form, suggesting that this domain is involved in substrate binding. SIB1 RBD-RNase HI exhibited the enzymatic activity both in vitro and in vivo. Its optimum pH and metal ion requirement were similar to those of SIB1 RNase HI, E. coli RNase HI, and human RNase H1. The specific activity of SIB1 RBD-RNase HI was comparable to that of E. coli RNase HI and was much higher than those of SIB1 RNase HI and human RNase H1. SIB1 RBD-RNase HI showed poor cleavage-site specificity for oligomeric substrates. SIB1 RBD-RNase HI was less stable than E. coli RNase HI but was as stable as human RNase H1. Database searches indicate that several bacteria and archaea contain an RBD-RNase HI. This is the first report on the biochemical characterization of RBD-RNase HI.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Mitochondrial tRNA gene translocations in highly eusocial bees

Directory of Open Access Journals (Sweden)

Daniela Silvestre

2006-01-01

Full Text Available Mitochondrial gene rearrangement events, especially involving tRNA genes, have been described more frequently as more complete mitochondrial genome sequences are becoming available. In the present work, we analyzed mitochondrial tRNA gene rearrangements between two bee species belonging to the tribes Apini and Meliponini within the "corbiculate Apidae". Eleven tRNA genes are in different genome positions or strands. The molecular events responsible for each translocation are explained. Considering the high number of rearrangements observed, the data presented here contradict the general rule of high gene order conservation among closely related organisms, and also represent a powerful molecular tool to help solve questions about phylogeny and evolution in bees.

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

Analysis of the complement and molecular evolution of tRNA genes in cow

Directory of Open Access Journals (Sweden)

Barris Wesley C

2009-04-01

Full Text Available Abstract Background Detailed information regarding the number and organization of transfer RNA (tRNA genes at the genome level is becoming readily available with the increase of DNA sequencing of whole genomes. However the identification of functional tRNA genes is challenging for species that have large numbers of repetitive elements containing tRNA derived sequences, such as Bos taurus. Reliable identification and annotation of entire sets of tRNA genes allows the evolution of tRNA genes to be understood on a genomic scale. Results In this study, we explored the B. taurus genome using bioinformatics and comparative genomics approaches to catalogue and analyze cow tRNA genes. The initial analysis of the cow genome using tRNAscan-SE identified 31,868 putative tRNA genes and 189,183 pseudogenes, where 28,830 of the 31,868 predicted tRNA genes were classified as repetitive elements by the RepeatMasker program. We then used comparative genomics to further discriminate between functional tRNA genes and tRNA-derived sequences for the remaining set of 3,038 putative tRNA genes. For our analysis, we used the human, chimpanzee, mouse, rat, horse, dog, chicken and fugu genomes to predict that the number of active tRNA genes in cow lies in the vicinity of 439. Of this set, 150 tRNA genes were 100% identical in their sequences across all nine vertebrate genomes studied. Using clustering analyses, we identified a new tRNA-GlyCCC subfamily present in all analyzed mammalian genomes. We suggest that this subfamily originated from an ancestral tRNA-GlyGCC gene via a point mutation prior to the radiation of the mammalian lineages. Lastly, in a separate analysis we created phylogenetic profiles for each putative cow tRNA gene using a representative set of genomes to gain an overview of common evolutionary histories of tRNA genes. Conclusion The use of a combination of bioinformatics and comparative genomics approaches has allowed the confident identification of a

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Methods and compositions for controlling gene expression by RNA processing

Science.gov (United States)

Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

2017-08-29

The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

Domestication of transposable elements into MicroRNA genes in plants.

Directory of Open Access Journals (Sweden)

Yang Li

Full Text Available Transposable elements (TE usually take up a substantial portion of eukaryotic genome. Activities of TEs can cause genome instability or gene mutations that are harmful or even disastrous to the host. TEs also contribute to gene and genome evolution at many aspects. Part of miRNA genes in mammals have been found to derive from transposons while convincing evidences are absent for plants. We found that a considerable number of previously annotated plant miRNAs are identical or homologous to transposons (TE-MIR, which include a small number of bona fide miRNA genes that conform to generally accepted plant miRNA annotation rules, and hairpin derived siRNAs likely to be pre-evolved miRNAs. Analysis of these TE-MIRs indicate that transitions from the medium to high copy TEs into miRNA genes may undergo steps such as inverted repeat formation, sequence speciation and adaptation to miRNA biogenesis. We also identified initial target genes of the TE-MIRs, which contain homologous sequences in their CDS as consequence of cognate TE insertions. About one-third of the initial target mRNAs are supported by publicly available degradome sequencing data for TE-MIR sRNA induced cleavages. Targets of the TE-MIRs are biased to non-TE related genes indicating their penchant to acquire cellular functions during evolution. Interestingly, most of these TE insertions span boundaries between coding and non-coding sequences indicating their incorporation into CDS through alteration of splicing or translation start or stop signals. Taken together, our findings suggest that TEs in gene rich regions can form foldbacks in non-coding part of transcripts that may eventually evolve into miRNA genes or be integrated into protein coding sequences to form potential targets in a "temperate" manner. Thus, transposons may supply as resources for the evolution of miRNA-target interactions in plants.

Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

Science.gov (United States)

Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

2017-12-01

Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.

Science.gov (United States)

Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J

2010-11-01

MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.

Divergence of RNA polymerase ? subunits in angiosperm plastid genomes is mediated by genomic rearrangement

OpenAIRE

Blazier, J. Chris; Ruhlman, Tracey A.; Weng, Mao-Lun; Rehman, Sumaiyah K.; Sabir, Jamal S. M.; Jansen, Robert K.

2016-01-01

Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP ? subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled an...

Deletion of the Sm1 encoding motif in the lsm gene results in distinct changes in the transcriptome and enhanced swarming activity of Haloferax cells.

Science.gov (United States)

Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita

2015-10-01

Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

A retinoic acid-inducible mRNA from F9 teratocarcinoma cells encodes a novel protease inhibitor homologue.

Science.gov (United States)

Wang, S Y; Gudas, L J

1990-09-15

We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.

Diversity of antisense and other non-coding RNAs in Archaea revealed by comparative small RNA sequencing in four Pyrobaculum species

Directory of Open Access Journals (Sweden)

David L Bernick

2012-07-01

Full Text Available A great diversity of small, non-coding RNA molecules with roles in gene regulation and RNA processing have been intensely studied in eukaryotic and bacterial model organisms, yet our knowledge of possible parallel roles for small RNAs in archaea is limited. We employed RNA-seq to identify novel small RNA across multiple species of the hyperthermophilic genus Pyrobaculum, known for unusual RNA gene characteristics. By comparing transcriptional data collected in parallel among four species, we were able to identify conserved RNA genes fitting into known and novel families. Among our findings, we highlight three novel cis-antisense small RNAs encoded opposite to key regulatory (ferric uptake regulator, metabolic (triose-phosphate isomerase, and core transcriptional apparatus genes (transcription factor B. We also found a large increase in the number of conserved C/D box small RNA genes over what had been previously recognized; many of these genes are encoded antisense to protein coding genes. The conserved opposition to orthologous genes across the Pyrobaculum genus suggests similarities to other cis-antisense regulatory systems. Furthermore, the genus-specific nature of these small RNAs indicates they are relatively recent, stable adaptations.

Condition-specific RNA editing in the coral symbiont Symbiodinium microadriaticum

KAUST Repository

Liew, Yi Jin

2017-03-01

RNA editing is a rare post-transcriptional event that provides cells with an additional level of gene expression regulation. It has been implicated in various processes including adaptation, viral defence and RNA interference; however, its potential role as a mechanism in acclimatization has just recently been recognised. Here, we show that RNA editing occurs in 1.6% of all nuclear-encoded genes of Symbiodinium microadriaticum, a dinoflagellate symbiont of reef-building corals. All base-substitution edit types were present, and statistically significant motifs were associated with three edit types. Strikingly, a subset of genes exhibited condition-specific editing patterns in response to different stressors that resulted in significant increases of non-synonymous changes. We posit that this previously unrecognised mechanism extends this organism’s capability to respond to stress beyond what is encoded by the genome. This in turn may provide further acclimatization capacity to these organisms, and by extension, their coral hosts.

Condition-specific RNA editing in the coral symbiont Symbiodinium microadriaticum

KAUST Repository

Liew, Yi Jin; Li, Yong; Baumgarten, Sebastian; Voolstra, Christian R.; Aranda, Manuel

2017-01-01

RNA editing is a rare post-transcriptional event that provides cells with an additional level of gene expression regulation. It has been implicated in various processes including adaptation, viral defence and RNA interference; however, its potential role as a mechanism in acclimatization has just recently been recognised. Here, we show that RNA editing occurs in 1.6% of all nuclear-encoded genes of Symbiodinium microadriaticum, a dinoflagellate symbiont of reef-building corals. All base-substitution edit types were present, and statistically significant motifs were associated with three edit types. Strikingly, a subset of genes exhibited condition-specific editing patterns in response to different stressors that resulted in significant increases of non-synonymous changes. We posit that this previously unrecognised mechanism extends this organism’s capability to respond to stress beyond what is encoded by the genome. This in turn may provide further acclimatization capacity to these organisms, and by extension, their coral hosts.

miRNA-Processing Gene Methylation and Cancer Risk.

Science.gov (United States)

Joyce, Brian T; Zheng, Yinan; Zhang, Zhou; Liu, Lei; Kocherginsky, Masha; Murphy, Robert; Achenbach, Chad J; Musa, Jonah; Wehbe, Firas; Just, Allan; Shen, Jincheng; Vokonas, Pantel; Schwartz, Joel; Baccarelli, Andrea A; Hou, Lifang

2018-05-01

Background: Dysregulation of miRNA and methylation levels are epigenetic hallmarks of cancer, potentially linked via miRNA-processing genes. Studies have found genetic alterations to miRNA-processing genes in cancer cells and human population studies. Our objective was to prospectively examine changes in DNA methylation of miRNA-processing genes and their associations with cancer risk. Methods: We examined cohort data from the Department of Veterans' Affairs Normative Aging Study. Participants were assessed every 3 to 5 years starting in 1999 through 2013 including questionnaires, medical record review, and blood collection. Blood from 686 consenting participants was analyzed using the Illumina 450K BeadChip array to measure methylation at CpG sites throughout the genome. We selected 19 genes based on a literature review, with 519 corresponding CpG sites. We then used Cox proportional hazards models to examine associations with cancer incidence, and generalized estimating equations to examine associations with cancer prevalence. Associations at false discovery rate time to cancer development (positively for cg06751583, inversely for cg23230564 and cg21034183), whereas methylation of one CpG site ( DROSHA : cg16131300) was positively associated with cancer prevalence. Conclusions: DNA methylation of DROSHA , a key miRNA-processing gene, and TNRC6B may play a role in early carcinogenesis. Impact: Changes in miRNA processing may exert multiple effects on cancer development, including protecting against it via altered global miRNAs, and may be a useful early detection biomarker of cancer. Cancer Epidemiol Biomarkers Prev; 27(5); 550-7. ©2018 AACR . ©2018 American Association for Cancer Research.

Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

Science.gov (United States)

Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

2018-03-19

To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

VIRmiRNA: a comprehensive resource for experimentally validated viral miRNAs and their targets.

Science.gov (United States)

Qureshi, Abid; Thakur, Nishant; Monga, Isha; Thakur, Anamika; Kumar, Manoj

2014-01-01

Viral microRNAs (miRNAs) regulate gene expression of viral and/or host genes to benefit the virus. Hence, miRNAs play a key role in host-virus interactions and pathogenesis of viral diseases. Lately, miRNAs have also shown potential as important targets for the development of novel antiviral therapeutics. Although several miRNA and their target repositories are available for human and other organisms in literature, but a dedicated resource on viral miRNAs and their targets are lacking. Therefore, we have developed a comprehensive viral miRNA resource harboring information of 9133 entries in three subdatabases. This includes 1308 experimentally validated miRNA sequences with their isomiRs encoded by 44 viruses in viral miRNA ' VIRMIRNA: ' and 7283 of their target genes in ' VIRMIRTAR': . Additionally, there is information of 542 antiviral miRNAs encoded by the host against 24 viruses in antiviral miRNA ' AVIRMIR': . The web interface was developed using Linux-Apache-MySQL-PHP (LAMP) software bundle. User-friendly browse, search, advanced search and useful analysis tools are also provided on the web interface. VIRmiRNA is the first specialized resource of experimentally proven virus-encoded miRNAs and their associated targets. This database would enhance the understanding of viral/host gene regulation and may also prove beneficial in the development of antiviral therapeutics. Database URL: http://crdd.osdd.net/servers/virmirna. © The Author(s) 2014. Published by Oxford University Press.

OmniSearch: a semantic search system based on the Ontology for MIcroRNA Target (OMIT) for microRNA-target gene interaction data.

Science.gov (United States)

Huang, Jingshan; Gutierrez, Fernando; Strachan, Harrison J; Dou, Dejing; Huang, Weili; Smith, Barry; Blake, Judith A; Eilbeck, Karen; Natale, Darren A; Lin, Yu; Wu, Bin; Silva, Nisansa de; Wang, Xiaowei; Liu, Zixing; Borchert, Glen M; Tan, Ming; Ruttenberg, Alan

2016-01-01

As a special class of non-coding RNAs (ncRNAs), microRNAs (miRNAs) perform important roles in numerous biological and pathological processes. The realization of miRNA functions depends largely on how miRNAs regulate specific target genes. It is therefore critical to identify, analyze, and cross-reference miRNA-target interactions to better explore and delineate miRNA functions. Semantic technologies can help in this regard. We previously developed a miRNA domain-specific application ontology, Ontology for MIcroRNA Target (OMIT), whose goal was to serve as a foundation for semantic annotation, data integration, and semantic search in the miRNA field. In this paper we describe our continuing effort to develop the OMIT, and demonstrate its use within a semantic search system, OmniSearch, designed to facilitate knowledge capture of miRNA-target interaction data. Important changes in the current version OMIT are summarized as: (1) following a modularized ontology design (with 2559 terms imported from the NCRO ontology); (2) encoding all 1884 human miRNAs (vs. 300 in previous versions); and (3) setting up a GitHub project site along with an issue tracker for more effective community collaboration on the ontology development. The OMIT ontology is free and open to all users, accessible at: http://purl.obolibrary.org/obo/omit.owl. The OmniSearch system is also free and open to all users, accessible at: http://omnisearch.soc.southalabama.edu/index.php/Software.

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Avian reovirus L2 genome segment sequences and predicted structure/function of the encoded RNA-dependent RNA polymerase protein

Directory of Open Access Journals (Sweden)

Xu Wanhong

2008-12-01

Full Text Available Abstract Background The orthoreoviruses are infectious agents that possess a genome comprised of 10 double-stranded RNA segments encased in two concentric protein capsids. Like virtually all RNA viruses, an RNA-dependent RNA polymerase (RdRp enzyme is required for viral propagation. RdRp sequences have been determined for the prototype mammalian orthoreoviruses and for several other closely-related reoviruses, including aquareoviruses, but have not yet been reported for any avian orthoreoviruses. Results We determined the L2 genome segment nucleotide sequences, which encode the RdRp proteins, of two different avian reoviruses, strains ARV138 and ARV176 in order to define conserved and variable regions within reovirus RdRp proteins and to better delineate structure/function of this important enzyme. The ARV138 L2 genome segment was 3829 base pairs long, whereas the ARV176 L2 segment was 3830 nucleotides long. Both segments were predicted to encode λB RdRp proteins 1259 amino acids in length. Alignments of these newly-determined ARV genome segments, and their corresponding proteins, were performed with all currently available homologous mammalian reovirus (MRV and aquareovirus (AqRV genome segment and protein sequences. There was ~55% amino acid identity between ARV λB and MRV λ3 proteins, making the RdRp protein the most highly conserved of currently known orthoreovirus proteins, and there was ~28% identity between ARV λB and homologous MRV and AqRV RdRp proteins. Predictive structure/function mapping of identical and conserved residues within the known MRV λ3 atomic structure indicated most identical amino acids and conservative substitutions were located near and within predicted catalytic domains and lining RdRp channels, whereas non-identical amino acids were generally located on the molecule's surfaces. Conclusion The ARV λB and MRV λ3 proteins showed the highest ARV:MRV identity values (~55% amongst all currently known ARV and MRV

RNA-DNA sequence differences spell genetic code ambiguities

DEFF Research Database (Denmark)

Bentin, Thomas; Nielsen, Michael L

2013-01-01

A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Directory of Open Access Journals (Sweden)

Olga Fernández-Miragall

Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Science.gov (United States)

Fernández-Miragall, Olga; Hernández, Carmen

2011-01-01

Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

The imprinted SNRPN gene is associated with a polycistronic mRNA and an imprinting control element

Energy Technology Data Exchange (ETDEWEB)

Saitoh, S.; Nicholls, R.D. [Case Western Reserve Univ., Cleveland, OH (United States); Seip, J. [Pennsylvania State Univ., Hershey, PA (United States)] [and others

1994-09-01

The small nuclear ribonucleoprotein-associated protein SmN (SNRPN) gene is located in the Prader-Willi syndrome (PWS) critical region in chromosome 15q11-q13. We have previously shown that it is functionally imprinted in humans, being only expressed from the paternal allele and differentially methylated on parental alleles. Therefore, SNRPN may have a role in PWS, although genetic studies suggest that at least two genes may be necessary for the classical PWS phenotype. We have characterized the SNRPN genomic structure, and shown that it comprises ten exons. Surprisingly, we identified an open reading frame (ORF) in the first three exons, 190-bp 5{prime} to the SmN ORF. Notably, the majority of base substitutions bewteen human and rodents in the upstream ORF occurred in the wobble position of codons, suggesting selection for a protein coding function. This ORF, which we name SNURF (SNRPN upstream reading frame) encodes a putative polypeptide of 71 amino acids. By analogy to prokaryotic operons that encode proteins with related functions, it is possible that SNURF may have a role in pre-mRNA splicing.

Functional diversification upon leader protease domain duplication in the Citrus tristeza virus genome: Role of RNA sequences and the encoded proteins.

Science.gov (United States)

Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y

2018-01-15

Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

Directory of Open Access Journals (Sweden)

Masfique Mehedi

Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

Science.gov (United States)

Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

2013-01-01

Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

Science.gov (United States)

Drouin, Guy; Tsang, Corey

2012-06-01

Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

Functional characterization of endogenous siRNA target genes in Caenorhabditis elegans

Directory of Open Access Journals (Sweden)

Heikkinen Liisa

2008-06-01

Full Text Available Abstract Background Small interfering RNA (siRNA molecules mediate sequence specific silencing in RNA interference (RNAi, a gene regulatory phenomenon observed in almost all organisms. Large scale sequencing of small RNA libraries obtained from C. elegans has revealed that a broad spectrum of siRNAs is endogenously transcribed from genomic sequences. The biological role and molecular diversity of C. elegans endogenous siRNA (endo-siRNA molecules, nonetheless, remain poorly understood. In order to gain insight into their biological function, we annotated two large libraries of endo-siRNA sequences, identified their cognate targets, and performed gene ontology analysis to identify enriched functional categories. Results Systematic trends in categorization of target genes according to the specific length of siRNA sequences were observed: 18- to 22-mer siRNAs were associated with genes required for embryonic development; 23-mers were associated uniquely with post-embryonic development; 24–26-mers were associated with phosphorus metabolism or protein modification. Moreover, we observe that some argonaute related genes associate with siRNAs with multiple reads. Sequence frequency graphs suggest that different lengths of siRNAs share similarities in overall sequence structure: the 5' end begins with G, while the body predominates with U and C. Conclusion These results suggest that the lengths of endogenous siRNA molecules are consequential to their biological functions since the gene ontology categories for their cognate mRNA targets vary depending upon their lengths.

A Systematic Genetic Screen to Dissect the MicroRNA Pathway in Drosophila.

Science.gov (United States)

Pressman, Sigal; Reinke, Catherine A; Wang, Xiaohong; Carthew, Richard W

2012-04-01

A central goal of microRNA biology is to elucidate the genetic program of miRNA function and regulation. However, relatively few of the effectors that execute miRNA repression have been identified. Because such genes may function in many developmental processes, mutations in them are expected to be pleiotropic and thus are discarded in most standard genetic screens. Here, we describe a systematic screen designed to identify all Drosophila genes in ∼40% of the genome that function in the miRNA pathway. To identify potentially pleiotropic genes, the screen analyzed clones of homozygous mutant cells in heterozygous animals. We identified 45 mutations representing 24 genes, and we molecularly characterized 9 genes. These include 4 previously known genes that encode core components of the miRNA pathway, including Drosha, Pasha, Dicer-1, and Ago1. The rest are new genes that function through chromatin remodeling, signaling, and mRNA decapping. The results suggest genetic screens that use clonal analysis can elucidate the miRNA program and that ∼100 genes are required to execute the miRNA program.

Functional characterization of the proteolytic activity of the tomato black ring nepovirus RNA-1-encoded polyprotein.

Science.gov (United States)

Hemmer, O; Greif, C; Dufourcq, P; Reinbolt, J; Fritsch, C

1995-01-10

Translation of tomato black ring virus (TBRV) RNA-1 in a rabbit reticulocyte lysate leads to the synthesis of a 250K polyprotein which cleaves itself into smaller proteins of 50, 60, 120, and 190K. Polypeptides synthesized from synthetic transcripts corresponding to different regions of TBRV RNA-1 are processed only when they encode the 23K protein delimited earlier by sequence homology with the cowpea mosaic virus 24K protease. The proteolytic activity of this protein is completely lost by mutating residues C170 (to I) or L188 (to H), residues which align with conserved residues of the viral serine-like proteases. The 120K protein is generated by cleavage of the dipeptide K/A localized in front of the VPg but is not further cleaved in vitro at the K/S site (at the C terminus of the VPg) or between the protease and polymerase domains. However, both the protein VPgProPol (120K) and the protein ProPol (117K) produced in vitro from synthetic transcripts can cleave in trans the RNA-2-encoded 150K polyprotein, but they cannot cleave in trans polypeptides containing a cleavage site expressed from RNA-1 transcripts in which the protease cistron is absent or modified.

Molecular characterization of rpoB gene encoding the RNA ...

African Journals Online (AJOL)

Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

Dicer and Argonaute Genes Involved in RNA Interference in the Entomopathogenic Fungus Metarhizium robertsii.

Science.gov (United States)

Meng, Huimin; Wang, Zhangxun; Wang, Yulong; Zhu, Hong; Huang, Bo

2017-04-01

RNA interference (RNAi) is a gene-silencing mechanism that plays an important role in gene regulation in a number of eukaryotic organisms. Two core components, Dicer and Argonaute, are central in the RNAi machinery. However, the physiological roles of Dicer and Argonaute in the entomopathogenic fungus Metarhizium robertsii have remained unclear. Here, the roles of genes encoding Dicer ( M. robertsii dcl1 [ Mrdcl1 ] and Mrdcl2 ) and Argonaute ( Mrago1 and Mrago2 ) proteins in M. robertsii were investigated. The results showed that the Dicer-like protein MrDCL2 and Argonaute protein MrAGO1 are the major components of the RNAi process occurring in M. robertsii The Dicer and Argonaute genes were not involved in the regulation of growth and diverse abiotic stress response in M. robertsii under the tested conditions. Moreover, our results showed that the Dicer and Argonaute gene mutants demonstrated reduced abilities to produce conidia, compared to the wild type (WT) and the gene-rescued mutant. In particular, the conidial yields in the Δ dcl2 and Δ ago1 mutants were reduced by 55.8% and 59.3%, respectively, compared with those from the control strains. Subsequently, for the WT and Δ dcl2 mutant strains, digital gene expression (DGE) profiling analysis of the stage of mycelium growth and conidiogenesis revealed that modest changes occur in development or metabolism processes, which may explain the reduction in conidiation in the Δ dcl2 mutant. In addition, we further applied high-throughput sequencing technology to identify small RNAs (sRNAs) that are differentially expressed in the WT and the Δ dcl2 mutant and found that 4 known microRNA-like small RNAs (milRNAs) and 8 novel milRNAs were Mrdcl2 dependent in M. robertsii IMPORTANCE The identification and characterization of components in RNAi have contributed significantly to our understanding of the mechanism and functions of RNAi in eukaryotes. Here, we found that Dicer and Argonaute genes play an important role

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

Science.gov (United States)

Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

2015-12-01

In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Computational fitness landscape for all gene-order permutations of an RNA virus.

Directory of Open Access Journals (Sweden)

Kwang-il Lim

2009-02-01

Full Text Available How does the growth of a virus depend on the linear arrangement of genes in its genome? Answering this question may enhance our basic understanding of virus evolution and advance applications of viruses as live attenuated vaccines, gene-therapy vectors, or anti-tumor therapeutics. We used a mathematical model for vesicular stomatitis virus (VSV, a prototype RNA virus that encodes five genes (N-P-M-G-L, to simulate the intracellular growth of all 120 possible gene-order variants. Simulated yields of virus infection varied by 6,000-fold and were found to be most sensitive to gene-order permutations that increased levels of the L gene transcript or reduced levels of the N gene transcript, the lowest and highest expressed genes of the wild-type virus, respectively. Effects of gene order on virus growth also depended upon the host-cell environment, reflecting different resources for protein synthesis and different cell susceptibilities to infection. Moreover, by computationally deleting intergenic attenuations, which define a key mechanism of transcriptional regulation in VSV, the variation in growth associated with the 120 gene-order variants was drastically narrowed from 6,000- to 20-fold, and many variants produced higher progeny yields than wild-type. These results suggest that regulation by intergenic attenuation preceded or co-evolved with the fixation of the wild type gene order in the evolution of VSV. In summary, our models have begun to reveal how gene functions, gene regulation, and genomic organization of viruses interact with their host environments to define processes of viral growth and evolution.

Non-functional genes repaired at the RNA level.

Science.gov (United States)

Burger, Gertraud

2016-01-01

Genomes and genes continuously evolve. Gene sequences undergo substitutions, deletions or nucleotide insertions; mobile genetic elements invade genomes and interleave in genes; chromosomes break, even within genes, and pieces reseal in reshuffled order. To maintain functional gene products and assure an organism's survival, two principal strategies are used - either repair of the gene itself or of its product. I will introduce common types of gene aberrations and how gene function is restored secondarily, and then focus on systematically fragmented genes found in a poorly studied protist group, the diplonemids. Expression of their broken genes involves restitching of pieces at the RNA-level, and substantial RNA editing, to compensate for point mutations. I will conclude with thoughts on how such a grotesquely unorthodox system may have evolved, and why this group of organisms persists and thrives since tens of millions of years. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

Directory of Open Access Journals (Sweden)

Tiane Martin de Moura

2012-10-01

Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

Science.gov (United States)

Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

2014-01-13

Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

mRNA and microRNA transcriptomics analyses in a murine model of dystrophin loss and therapeutic restoration

Directory of Open Access Journals (Sweden)

Thomas C. Roberts

2016-03-01

Full Text Available Duchenne muscular dystrophy (DMD is a pediatric, X-linked, progressive muscle-wasting disorder caused by loss of function mutations affecting the gene encoding the dystrophin protein. While the primary genetic insult in DMD is well described, many details of the molecular and cellular pathologies that follow dystrophin loss are incompletely understood. To investigate gene expression in dystrophic muscle we have applied mRNA and microRNA (miRNA microarray technology to the mdx mouse model of DMD. This study was designed to generate a complete description of gene expression changes associated with dystrophic pathology and the response to an experimental therapy which restores dystrophin protein function. These datasets have enabled (1 the determination of gene expression changes associated with dystrophic pathology, (2 identification of differentially expressed genes that are restored towards wild-type levels after therapeutic dystrophin rescue, (3 investigation of the correlation between mRNA and protein expression (determined by parallel mass spectrometry proteomics analysis, and (4 prediction of pathology associated miRNA-target interactions. Here we describe in detail how the data were generated including the basic analysis as contained in the manuscript published in Human Molecular Genetics with PMID 26385637. The data have been deposited in the Gene Expression Omnibus (GEO with the accession number GSE64420.

A Tyrosine-Dependent Riboswitch Controls the Expression of a Tyrosyl-tRNA Synthetase from Acidithiobacillus ferrooxidans

Directory of Open Access Journals (Sweden)

Paula Bustamante

2016-06-01

Full Text Available Expression of aminoacyl-tRNA synthetases is regulated by a variety of mechanisms at the level of transcription or translation. A T-box dependent transcription termination / antitermination riboswitch system that responds to charged / uncharged tRNA regulates expression of aminoacyl tRNA synthetase genes in Gram-positive bacteria. TyrZ, the gene encoding tyrosyl-tRNA synthetase from Acidithiobacillus ferrooxidans, a Gram-negative acidophilic bacterium that participates in bioleaching of minerals, resembles the gene from Bacillus subtilis including the 5´-untranslated region encoding the riboswitch. Transcription of A. ferrooxidans tyrZ is induced by the presence of tyrosine by a mechanism involving antitermination of transcription. This mechanism is probably adapted to the low supply of amino acids of acidic environments of autotrophic bioleaching microorganisms. This work is licensed under a Creative Commons Attribution 4.0 International License.

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

Using RNA-Seq Data to Evaluate Reference Genes Suitable for Gene Expression Studies in Soybean.

Directory of Open Access Journals (Sweden)

Aldrin Kay-Yuen Yim

Full Text Available Differential gene expression profiles often provide important clues for gene functions. While reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is an important tool, the validity of the results depends heavily on the choice of proper reference genes. In this study, we employed new and published RNA-sequencing (RNA-Seq datasets (26 sequencing libraries in total to evaluate reference genes reported in previous soybean studies. In silico PCR showed that 13 out of 37 previously reported primer sets have multiple targets, and 4 of them have amplicons with different sizes. Using a probabilistic approach, we identified new and improved candidate reference genes. We further performed 2 validation tests (with 26 RNA samples on 8 commonly used reference genes and 7 newly identified candidates, using RT-qPCR. In general, the new candidate reference genes exhibited more stable expression levels under the tested experimental conditions. The three newly identified candidate reference genes Bic-C2, F-box protein2, and VPS-like gave the best overall performance, together with the commonly used ELF1b. It is expected that the proposed probabilistic model could serve as an important tool to identify stable reference genes when more soybean RNA-Seq data from different growth stages and treatments are used.

Computational prediction of miRNA genes from small RNA sequencing data

Directory of Open Access Journals (Sweden)

Wenjing eKang

2015-01-01

Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.

Complex chloroplast RNA metabolism: just debugging the genetic programme?

Directory of Open Access Journals (Sweden)

Schmitz-Linneweber Christian

2008-08-01

Full Text Available Abstract Background The gene expression system of chloroplasts is far more complex than that of their cyanobacterial progenitor. This gain in complexity affects in particular RNA metabolism, specifically the transcription and maturation of RNA. Mature chloroplast RNA is generated by a plethora of nuclear-encoded proteins acquired or recruited during plant evolution, comprising additional RNA polymerases and sigma factors, and sequence-specific RNA maturation factors promoting RNA splicing, editing, end formation and translatability. Despite years of intensive research, we still lack a comprehensive explanation for this complexity. Results We inspected the available literature and genome databases for information on components of RNA metabolism in land plant chloroplasts. In particular, new inventions of chloroplast-specific mechanisms and the expansion of some gene/protein families detected in land plants lead us to suggest that the primary function of the additional nuclear-encoded components found in chloroplasts is the transgenomic suppression of point mutations, fixation of which occurred due to an enhanced genetic drift exhibited by chloroplast genomes. We further speculate that a fast evolution of transgenomic suppressors occurred after the water-to-land transition of plants. Conclusion Our inspections indicate that several chloroplast-specific mechanisms evolved in land plants to remedy point mutations that occurred after the water-to-land transition. Thus, the complexity of chloroplast gene expression evolved to guarantee the functionality of chloroplast genetic information and may not, with some exceptions, be involved in regulatory functions.

The Spot 42 RNA: A regulatory small RNA with roles in the central metabolism

Science.gov (United States)

Bækkedal, Cecilie; Haugen, Peik

2015-01-01

The Spot 42 RNA is a 109 nucleotide long (in Escherichia coli) noncoding small regulatory RNA (sRNA) encoded by the spf (spot fourty-two) gene. spf is found in gamma-proteobacteria and the majority of experimental work on Spot 42 RNA has been performed using E. coli, and recently Aliivibrio salmonicida. In the cell Spot 42 RNA plays essential roles as a regulator in carbohydrate metabolism and uptake, and its expression is activated by glucose, and inhibited by the cAMP-CRP complex. Here we summarize the current knowledge on Spot 42, and present the natural distribution of spf, show family-specific secondary structural features of Spot 42, and link highly conserved structural regions to mRNA target binding. PMID:26327359

The Spot 42 RNA: A regulatory small RNA with roles in the central metabolism.

Science.gov (United States)

Bækkedal, Cecilie; Haugen, Peik

2015-01-01

The Spot 42 RNA is a 109 nucleotide long (in Escherichia coli) noncoding small regulatory RNA (sRNA) encoded by the spf (spot fourty-two) gene. spf is found in gamma-proteobacteria and the majority of experimental work on Spot 42 RNA has been performed using E. coli, and recently Aliivibrio salmonicida. In the cell Spot 42 RNA plays essential roles as a regulator in carbohydrate metabolism and uptake, and its expression is activated by glucose, and inhibited by the cAMP-CRP complex. Here we summarize the current knowledge on Spot 42, and present the natural distribution of spf, show family-specific secondary structural features of Spot 42, and link highly conserved structural regions to mRNA target binding.

Phage T4 SegB protein is a homing endonuclease required for the preferred inheritance of T4 tRNA gene region occurring in co-infection with a related phage.

Science.gov (United States)

Brok-Volchanskaya, Vera S; Kadyrov, Farid A; Sivogrivov, Dmitry E; Kolosov, Peter M; Sokolov, Andrey S; Shlyapnikov, Michael G; Kryukov, Valentine M; Granovsky, Igor E

2008-04-01

Homing endonucleases initiate nonreciprocal transfer of DNA segments containing their own genes and the flanking sequences by cleaving the recipient DNA. Bacteriophage T4 segB gene, which is located in a cluster of tRNA genes, encodes a protein of unknown function, homologous to homing endonucleases of the GIY-YIG family. We demonstrate that SegB protein is a site-specific endonuclease, which produces mostly 3' 2-nt protruding ends at its DNA cleavage site. Analysis of SegB cleavage sites suggests that SegB recognizes a 27-bp sequence. It contains 11-bp conserved sequence, which corresponds to a conserved motif of tRNA TpsiC stem-loop, whereas the remainder of the recognition site is rather degenerate. T4-related phages T2L, RB1 and RB3 contain tRNA gene regions that are homologous to that of phage T4 but lack segB gene and several tRNA genes. In co-infections of phages T4 and T2L, segB gene is inherited with nearly 100% of efficiency. The preferred inheritance depends absolutely on the segB gene integrity and is accompanied by the loss of the T2L tRNA gene region markers. We suggest that SegB is a homing endonuclease that functions to ensure spreading of its own gene and the surrounding tRNA genes among T4-related phages.

PURA, the gene encoding Pur-alpha, member of an ancient nucleic acid-binding protein family with mammalian neurological functions.

Science.gov (United States)

Daniel, Dianne C; Johnson, Edward M

2018-02-15

The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding

An intronic microRNA silences genes that are functionally antagonistic to its host gene.

Science.gov (United States)

Barik, Sailen

2008-09-01

MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

A temperature-sensitive allele of a putative mRNA splicing helicase down-regulates many cell wall genes and causes radial swelling in Arabidopsis thaliana.

Science.gov (United States)

Howles, Paul A; Gebbie, Leigh K; Collings, David A; Varsani, Arvind; Broad, Ronan C; Ohms, Stephen; Birch, Rosemary J; Cork, Ann H; Arioli, Tony; Williamson, Richard E

2016-05-01

The putative RNA helicase encoded by the Arabidopsis gene At1g32490 is a homolog of the yeast splicing RNA helicases Prp2 and Prp22. We isolated a temperature-sensitive allele (rsw12) of the gene in a screen for root radial swelling mutants. Plants containing this allele grown at the restrictive temperature showed weak radial swelling, were stunted with reduced root elongation, and contained reduced levels of cellulose. The role of the protein was further explored by microarray analysis. By using both fold change cutoffs and a weighted gene coexpression network analysis (WGCNA) to investigate coexpression of genes, we found that the radial swelling phenotype was not linked to genes usually associated with primary cell wall biosynthesis. Instead, the mutation has strong effects on expression of secondary cell wall related genes. Many genes potentially associated with secondary walls were present in the most significant WGCNA module, as were genes coding for arabinogalactans and proteins with GPI anchors. The proportion of up-regulated genes that possess introns in rsw12 was above that expected if splicing was unrelated to the activity of the RNA helicase, suggesting that the helicase does indeed play a role in splicing in Arabidopsis. The phenotype may be due to a change in the expression of one or more genes coding for cell wall proteins.

Regulation of Gene Expression by DNA Methylation and RNA Editing in Animals

DEFF Research Database (Denmark)

Li, Qiye

, there has been growing interest in exploring the modifications occurring at the RNA level, which can impact the fate and function of mRNA. One fascinating type of such modifications is RNA editing, which alters specific nucleotides in transcribed RNA and thus can produce transcripts that are not encoded...... (Heterocephalus glaber), a eusocial mammal living in cooperative colonies. Finally, I introduce a software package that I developed that is specifically designed for the genome-wide identification of RNA-editing sites in animals, with the ultimate aim of promoting the evolutionary and functional study of RNA...... editing in different species....

miRNA-mediated functional changes through co-regulating function related genes.

Directory of Open Access Journals (Sweden)

Jie He

Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.

Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

Directory of Open Access Journals (Sweden)

Li Guo

2014-01-01

Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

Identification of Phosphoglycerate Kinase 1 (PGK1 as a reference gene for quantitative gene expression measurements in human blood RNA

Directory of Open Access Journals (Sweden)

Unger Elizabeth R

2011-09-01

Full Text Available Abstract Background Blood is a convenient sample and increasingly used for quantitative gene expression measurements with a variety of diseases including chronic fatigue syndrome (CFS. Quantitative gene expression measurements require normalization of target genes to reference genes that are stable and independent from variables being tested in the experiment. Because there are no genes that are useful for all situations, reference gene selection is an essential step to any quantitative reverse transcription-PCR protocol. Many publications have described appropriate genes for a wide variety of tissues and experimental conditions, however, reference genes that may be suitable for the analysis of CFS, or human blood RNA derived from whole blood as well as isolated peripheral blood mononuclear cells (PBMCs, have not been described. Findings Literature review and analyses of our unpublished microarray data were used to narrow down the pool of candidate reference genes to six. We assayed whole blood RNA from Tempus tubes and cell preparation tube (CPT-collected PBMC RNA from 46 subjects, and used the geNorm and NormFinder algorithms to select the most stable reference genes. Phosphoglycerate kinase 1 (PGK1 was one of the optimal normalization genes for both whole blood and PBMC RNA, however, additional genes differed for the two sample types; Ribosomal protein large, P0 (RPLP0 for PBMC RNA and Peptidylprolyl isomerase B (PPIB for whole blood RNA. We also show that the use of a single reference gene is sufficient for normalization when the most stable candidates are used. Conclusions We have identified PGK1 as a stable reference gene for use with whole blood RNA and RNA derived from PBMC. When stable genes are selected it is possible to use a single gene for normalization rather than two or three. Optimal normalization will improve the ability of results from PBMC RNA to be compared with those from whole blood RNA and potentially allows comparison of

Localization of the Norrie disease gene mRNA by in situ hybridization.

Science.gov (United States)

Hartzer, M K; Cheng, M; Liu, X; Shastry, B S

1999-07-15

Norrie disease is a rare X-linked recessive neurodevelopmental disorder. The affected males manifest congenital blindness, which is often associated with hearing loss, mental retardation and psychiatric problems. Genetic linkage studies have localized the gene to the short arm of the X-chromosome and the gene has been isolated recently. The encoded protein is a member of the superfamily of growth factors containing a cystine knot motif and may be involved in cell adhesion and neurodevelopment. Molecular genetic analysis revealed a large number of missense, nonsense, deletion, and splice-site mutations among Norrie patients. In order to further determine the role of the Norrie disease gene, we studied the distribution pattern of its mRNA in the retina and in brain by in situ hybridization. The results show abundant hybridization signals in outer nuclear, inner nuclear, and ganglion cell layers of the retina in all three species (mice, rabbit, and human) examined. There was no significant expression in the vitreous body, lens, and rod outer segment. High expression levels were also observed in the cerebellar granular layer, hippocampus, olfactory bulb, cortex, and epithelium of the rabbit brain. These data suggest that the Norrie disease gene could play a critical role in the differentiation or maintenance of the differentiated state of the retina.

Systematic identification of novel, essential host genes affecting bromovirus RNA replication.

Directory of Open Access Journals (Sweden)

Brandi L Gancarz

Full Text Available Positive-strand RNA virus replication involves viral proteins and cellular proteins at nearly every replication step. Brome mosaic virus (BMV is a well-established model for dissecting virus-host interactions and is one of very few viruses whose RNA replication, gene expression and encapsidation have been reproduced in the yeast Saccharomyces cerevisiae. Previously, our laboratory identified ∼100 non-essential host genes whose loss inhibited or enhanced BMV replication at least 3-fold. However, our isolation of additional BMV-modulating host genes by classical genetics and other results underscore that genes essential for cell growth also contribute to BMV RNA replication at a frequency that may be greater than that of non-essential genes. To systematically identify novel, essential host genes affecting BMV RNA replication, we tested a collection of ∼900 yeast strains, each with a single essential gene promoter replaced by a doxycycline-repressible promoter, allowing repression of gene expression by adding doxycycline to the growth medium. Using this strain array of ∼81% of essential yeast genes, we identified 24 essential host genes whose depleted expression reproducibly inhibited or enhanced BMV RNA replication. Relevant host genes are involved in ribosome biosynthesis, cell cycle regulation and protein homeostasis, among other cellular processes. BMV 2a(Pol levels were significantly increased in strains depleted for a heat shock protein (HSF1 or proteasome components (PRE1 and RPT6, suggesting these genes may affect BMV RNA replication by directly or indirectly modulating 2a(Pol localization, post-translational modification or interacting partners. Investigating the diverse functions of these newly identified essential host genes should advance our understanding of BMV-host interactions and normal cellular pathways, and suggest new modes of virus control.

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

Dysregulation of RNA Mediated Gene Expression in Motor Neuron Diseases.

Science.gov (United States)

Gonçalves, Inês do Carmo G; Rehorst, Wiebke A; Kye, Min Jeong

2016-01-01

Recent findings indicate an important role for RNA-mediated gene expression in motor neuron diseases, including ALS (amyotrophic lateral sclerosis) and SMA (spinal muscular atrophy). ALS, also known as Lou Gehrig's disease, is an adult-onset progressive neurodegenerative disorder, whereby SMA or "children's Lou Gehrig's disease" is considered a pediatric neurodevelopmental disorder. Despite the difference in genetic causes, both ALS and SMA share common phenotypes; dysfunction/loss of motor neurons that eventually leads to muscle weakness and atrophy. With advanced techniques in molecular genetics and cell biology, current data suggest that these two distinct motor neuron diseases share more than phenotypes; ALS and SMA have similar cellular pathological mechanisms including mitochondrial dysfunction, oxidative stress and dysregulation in RNA-mediated gene expression. Here, we will discuss the current findings on these two diseases with specific focus on RNA-mediated gene regulation including miRNA expression, pre-mRNA processing and RNA binding proteins.

Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

International Nuclear Information System (INIS)

Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

1987-01-01

A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

International Nuclear Information System (INIS)

Mojumdar, M.

1986-01-01

pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

RNA-seq analysis of overexpressing ovine AANAT gene of melatonin biosynthesis in switchgrass

Directory of Open Access Journals (Sweden)

Shan Yuan

2016-08-01

Full Text Available Melatonin serves important functions in the promotion of growth and anti-stress regulation by efficient radical scavenging and regulation of antioxidant enzyme activity in various plants. To investigate its regulatory roles and metabolism pathways, the transcriptomic profile of overexpressing the ovine arylalkylamine N-acetyltransferase (oAANAT gene, encoding the penultimate enzyme in melatonin biosynthesis, was compared with empty vector (EV control using RNA-seq in switchgrass, a model plant of cellulosic ethanol conversion. The 85.22 million high quality reads that were assembled into 135,684 unigenes were generated by Illumina sequencing for transgenic oAANAT switchgrass with an average sequence length of 716 bp. A total of 946 differential expression genes (DEGs in transgenic line comparing to control switchgrass, including 737 up-regulated and 209 down-regulated genes, were mainly enriched with two main functional patterns of melatonin identifying by gene ontology analysis: the growth regulator and stress tolerance. Furthermore, KEGG maps indicated that the biosynthetic pathways of secondary metabolite (phenylpropanoids, flavonoids, steroids, stilbenoid, diarylheptanoid and gingerol and signaling pathways (MAPK signaling pathway, estrogen signaling pathway were involved in melatonin metabolism. This study substantially expands the transcriptome information for switchgrass and provides valuable clues for identifying candidate genes involved in melatonin biosynthesis and elucidating the mechanism of melatonin metabolism.

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

RNA transcription in isolated chloroplasts during senescence and rejuvenation of intact cotyledons of CUCURBITA PEPO L. (ZUCCHINI)

International Nuclear Information System (INIS)

Mishev, K.; Ananiev, E.; Denev, L.; Radeva, G.

2006-01-01

RNA transcription was studied in intact chloroplasts isolated from cotyledons of Cucurbita pepoL. (zucchini) during their growth and development including natural senescence and rejuvenation. Rejuvenation of cotyledons was studied after decapitation of the epicotyl above the senescing yellow cotyledons. Maximal incorporation of [32P] UTP into overall chloroplast RNA was measured two days after exposure of seedlings to light (day 6 th after the onset of germination), followed by a gradual decrease reaching minimal values at the age of 25-28 days when cotyledons began to yellow and eventually die. Rejuvenation of cotyledons completely restored chloroplast RNA synthesis and fifteen days after decapitation (at the age of 40 days), the values of chloroplast transcription even exceeded that of the maximal transcriptional activity in young cotyledons. Inhibitory analysis with tagetitoxin (a specific inhibitor of plastid encoded chloroplast RNA polymerase (PEP)) showed that in young and rejuvenated cotyledons about 85% of chloroplast RNA polymerase activity was due to PEP and only 15% corresponded to the nuclear encoded plastid RNA polymerase (NEP). Definite regions of two chloroplast encoded genes were amplified by means of PCR technique using specific DNA primers for Rubisco large subunit gene (rbcL) and the housekeeping gene for chloroplast 16S rRNA as well as chloroplast DNA as a template. The appropriate lengths of the amplified DNA fragments were checked by restriction analysis

Development of functional genomic tools in trematodes: RNA interference and luciferase reporter gene activity in Fasciola hepatica.

Directory of Open Access Journals (Sweden)

Gabriel Rinaldi

2008-07-01

Full Text Available The growing availability of sequence information from diverse parasites through genomic and transcriptomic projects offer new opportunities for the identification of key mediators in the parasite-host interaction. Functional genomics approaches and methods for the manipulation of genes are essential tools for deciphering the roles of genes and to identify new intervention targets in parasites. Exciting advances in functional genomics for parasitic helminths are starting to occur, with transgene expression and RNA interference (RNAi reported in several species of nematodes, but the area is still in its infancy in flatworms, with reports in just three species. While advancing in model organisms, there is a need to rapidly extend these technologies to other parasites responsible for several chronic diseases of humans and cattle. In order to extend these approaches to less well studied parasitic worms, we developed a test method for the presence of a viable RNAi pathway by silencing the exogenous reporter gene, firefly luciferase (fLUC. We established the method in the human blood fluke Schistosoma mansoni and then confirmed its utility in the liver fluke Fasciola hepatica. We transformed newly excysted juveniles of F. hepatica by electroporation with mRNA of fLUC and three hours later were able to detect luciferase enzyme activity, concentrated mainly in the digestive ceca. Subsequently, we tested the presence of an active RNAi pathway in F. hepatica by knocking down the exogenous luciferase activity by introduction into the transformed parasites of double-stranded RNA (dsRNA specific for fLUC. In addition, we tested the RNAi pathway targeting an endogenous F. hepatica gene encoding leucine aminopeptidase (FhLAP, and observed a significant reduction in specific mRNA levels. In summary, these studies demonstrated the utility of RNAi targeting reporter fLUC as a reporter gene assay to establish the presence of an intact RNAi pathway in helminth

Permuted tRNA genes of Cyanidioschyzon merolae, the origin of the tRNA molecule and the root of the Eukarya domain.

Science.gov (United States)

Di Giulio, Massimo

2008-08-07

An evolutionary analysis is conducted on the permuted tRNA genes of Cyanidioschyzon merolae, in which the 5' half of the tRNA molecule is codified at the 3' end of the gene and its 3' half is codified at the 5' end. This analysis has shown that permuted genes cannot be considered as derived traits but seem to possess characteristics that suggest they are ancestral traits, i.e. they originated when tRNA molecule genes originated for the first time. In particular, if the hypothesis that permuted genes are a derived trait were true, then we should not have been able to observe that the most frequent class of permuted genes is that of the anticodon loop type, for the simple reason that this class would derive by random permutation from a class of non-permuted tRNA genes, which instead is the rarest. This would not explain the high frequency with which permuted tRNA genes with perfectly separate 5' and 3' halves were observed. Clearly the mechanism that produced this class of permuted genes would envisage the existence, in an advanced stage of evolution, of minigenes codifying for the 5' and 3' halves of tRNAs which were assembled in a permuted way at the origin of the tRNA molecule, thus producing a high frequency of permuted genes of the class here referred. Therefore, this evidence supports the hypothesis that the genes of the tRNA molecule were assembled by minigenes codifying for hairpin-like RNA molecules, as suggested by one model for the origin of tRNA [Di Giulio, M., 1992. On the origin of the transfer RNA molecule. J. Theor. Biol. 159, 199-214; Di Giulio, M., 1999. The non-monophyletic origin of tRNA molecule. J. Theor. Biol. 197, 403-414]. Moreover, the late assembly of the permuted genes of C. merolae, as well as their ancestrality, strengthens the hypothesis of the polyphyletic origins of these genes. Finally, on the basis of the uniqueness and the ancestrality of these permuted genes, I suggest that the root of the Eukarya domain is in the super

RNA-Seq analysis during the life cycle of Cryptosporidium parvum reveals significant differential gene expression between proliferating stages in the intestine and infectious sporozoites.

Science.gov (United States)

Lippuner, Christoph; Ramakrishnan, Chandra; Basso, Walter U; Schmid, Marc W; Okoniewski, Michal; Smith, Nicholas C; Hässig, Michael; Deplazes, Peter; Hehl, Adrian B

2018-05-01

Cryptosporidium parvum is a major cause of diarrhoea in humans and animals. There are no vaccines and few drugs available to control C. parvum. In this study, we used RNA-Seq to compare gene expression in sporozoites and intracellular stages of C. parvum to identify genes likely to be important for successful completion of the parasite's life cycle and, thereby, possible targets for drugs or vaccines. We identified 3774 protein-encoding transcripts in C. parvum. Applying a stringent cut-off of eight fold for determination of differential expression, we identified 173 genes (26 coding for predicted secreted proteins) upregulated in sporozoites. On the other hand, expression of 1259 genes was upregulated in intestinal stages (merozoites/gamonts) with a gene ontology enrichment for 63 biological processes and upregulation of 117 genes in 23 metabolic pathways. There was no clear stage specificity of expression of AP2-domain containing transcription factors, although sporozoites had a relatively small repertoire of these important regulators. Our RNA-Seq analysis revealed a new calcium-dependent protein kinase, bringing the total number of known calcium-dependent protein kinases (CDPKs) in C. parvum to 11. One of these, CDPK1, was expressed in all stages, strengthening the notion that it is a valid drug target. By comparing parasites grown in vivo (which produce bona fide thick-walled oocysts) and in vitro (which are arrested in sexual development prior to oocyst generation) we were able to confirm that genes encoding oocyst wall proteins are expressed in gametocytes and that the proteins are stockpiled rather than generated de novo in zygotes. RNA-Seq analysis of C. parvum revealed genes expressed in a stage-specific manner and others whose expression is required at all stages of development. The functional significance of these can now be addressed through recent advances in transgenics for C. parvum, and may lead to the identification of viable drug and vaccine

Highly efficient gene delivery by mRNA electroporation in human hematopoietic cells: superiority to lipofection and passive pulsing of mRNA and to electroporation of plasmid cDNA for tumor antigen loading of dendritic cells.

Science.gov (United States)

Van Tendeloo, V F; Ponsaerts, P; Lardon, F; Nijs, G; Lenjou, M; Van Broeckhoven, C; Van Bockstaele, D R; Berneman, Z N

2001-07-01

Designing effective strategies to load human dendritic cells (DCs) with tumor antigens is a challenging approach for DC-based tumor vaccines. Here, a cytoplasmic expression system based on mRNA electroporation to efficiently introduce tumor antigens into DCs is described. Preliminary experiments in K562 cells using an enhanced green fluorescent protein (EGFP) reporter gene revealed that mRNA electroporation as compared with plasmid DNA electroporation showed a markedly improved transfection efficiency (89% versus 40% EGFP(+) cells, respectively) and induced a strikingly lower cell toxicity (15% death rate with mRNA versus 51% with plasmid DNA). Next, mRNA electroporation was applied for nonviral transfection of different types of human DCs, including monocyte-derived DCs (Mo-DCs), CD34(+) progenitor-derived DCs (34-DCs) and Langerhans cells (34-LCs). High-level transgene expression by mRNA electroporation was obtained in more than 50% of all DC types. mRNA-electroporated DCs retained their phenotype and maturational potential. Importantly, DCs electroporated with mRNA-encoding Melan-A strongly activated a Melan-A-specific cytotoxic T lymphocyte (CTL) clone in an HLA-restricted manner and were superior to mRNA-lipofected or -pulsed DCs. Optimal stimulation of the CTL occurred when Mo-DCs underwent maturation following mRNA transfection. Strikingly, a nonspecific stimulation of CTL was observed when DCs were transfected with plasmid DNA. The data clearly demonstrate that Mo-DCs electroporated with mRNA efficiently present functional antigenic peptides to cytotoxic T cells. Therefore, electroporation of mRNA-encoding tumor antigens is a powerful technique to charge human dendritic cells with tumor antigens and could serve applications in future DC-based tumor vaccines.

Human Immunodeficiency Virus-Type 1 LTR DNA contains an intrinsic gene producing antisense RNA and protein products

Directory of Open Access Journals (Sweden)

Hsiao Chiu-Bin

2006-11-01

Full Text Available Abstract Background While viruses have long been shown to capitalize on their limited genomic size by utilizing both strands of DNA or complementary DNA/RNA intermediates to code for viral proteins, it has been assumed that human retroviruses have all their major proteins translated only from the plus or sense strand of RNA, despite their requirement for a dsDNA proviral intermediate. Several studies, however, have suggested the presence of antisense transcription for both HIV-1 and HTLV-1. More recently an antisense transcript responsible for the HTLV-1 bZIP factor (HBZ protein has been described. In this study we investigated the possibility of an antisense gene contained within the human immunodeficiency virus type 1 (HIV-1 long terminal repeat (LTR. Results Inspection of published sequences revealed a potential transcription initiator element (INR situated downstream of, and in reverse orientation to, the usual HIV-1 promoter and transcription start site. This antisense initiator (HIVaINR suggested the possibility of an antisense gene responsible for RNA and protein production. We show that antisense transcripts are generated, in vitro and in vivo, originating from the TAR DNA of the HIV-1 LTR. To test the possibility that protein(s could be translated from this novel HIV-1 antisense RNA, recombinant HIV antisense gene-FLAG vectors were designed. Recombinant protein(s were produced and isolated utilizing carboxy-terminal FLAG epitope (DYKDDDDK sequences. In addition, affinity-purified antisera to an internal peptide derived from the HIV antisense protein (HAP sequences identified HAPs from HIV+ human peripheral blood lymphocytes. Conclusion HIV-1 contains an antisense gene in the U3-R regions of the LTR responsible for both an antisense RNA transcript and proteins. This antisense transcript has tremendous potential for intrinsic RNA regulation because of its overlap with the beginning of all HIV-1 sense RNA transcripts by 25 nucleotides. The

Origin of sphinx, a young chimeric RNA gene in Drosophila melanogaster

Science.gov (United States)

Wang, Wen; Brunet, Frédéric G.; Nevo, Eviatar; Long, Manyuan

2002-01-01

Non-protein-coding RNA genes play an important role in various biological processes. How new RNA genes originated and whether this process is controlled by similar evolutionary mechanisms for the origin of protein-coding genes remains unclear. A young chimeric RNA gene that we term sphinx (spx) provides the first insight into the early stage of evolution of RNA genes. spx originated as an insertion of a retroposed sequence of the ATP synthase chain F gene at the cytological region 60DB since the divergence of Drosophila melanogaster from its sibling species 2–3 million years ago. This retrosequence, which is located at 102F on the fourth chromosome, recruited a nearby exon and intron, thereby evolving a chimeric gene structure. This molecular process suggests that the mechanism of exon shuffling, which can generate protein-coding genes, also plays a role in the origin of RNA genes. The subsequent evolutionary process of spx has been associated with a high nucleotide substitution rate, possibly driven by a continuous positive Darwinian selection for a novel function, as is shown in its sex- and development-specific alternative splicing. To test whether spx has adapted to different environments, we investigated its population genetic structure in the unique “Evolution Canyon” in Israel, revealing a similar haplotype structure in spx, and thus similar evolutionary forces operating on spx between environments. PMID:11904380

RNA-Seq-based analysis of the physiologic cold shock-induced changes in Moraxella catarrhalis gene expression.

Directory of Open Access Journals (Sweden)

Violeta Spaniol

Full Text Available BACKGROUND: Moraxella catarrhalis, a major nasopharyngeal pathogen of the human respiratory tract, is exposed to rapid downshifts of environmental temperature when humans breathe cold air. The prevalence of pharyngeal colonization and respiratory tract infections caused by M. catarrhalis is greatest in winter. We investigated how M. catarrhalis uses the physiologic exposure to cold air to regulate pivotal survival systems that may contribute to M. catarrhalis virulence. RESULTS: In this study we used the RNA-seq techniques to quantitatively catalogue the transcriptome of M. catarrhalis exposed to a 26 °C cold shock or to continuous growth at 37 °C. Validation of RNA-seq data using quantitative RT-PCR analysis demonstrated the RNA-seq results to be highly reliable. We observed that a 26 °C cold shock induces the expression of genes that in other bacteria have been related to virulence a strong induction was observed for genes involved in high affinity phosphate transport and iron acquisition, indicating that M. catarrhalis makes a better use of both phosphate and iron resources after exposure to cold shock. We detected the induction of genes involved in nitrogen metabolism, as well as several outer membrane proteins, including ompA, m35-like porin and multidrug efflux pump (acrAB indicating that M. catarrhalis remodels its membrane components in response to downshift of temperature. Furthermore, we demonstrate that a 26 °C cold shock enhances the induction of genes encoding the type IV pili that are essential for natural transformation, and increases the genetic competence of M. catarrhalis, which may facilitate the rapid spread and acquisition of novel virulence-associated genes. CONCLUSION: Cold shock at a physiologically relevant temperature of 26 °C induces in M. catarrhalis a complex of adaptive mechanisms that could convey novel pathogenic functions and may contribute to enhanced colonization and virulence.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

The European Regulatory Environment of RNA-Based Vaccines.

Science.gov (United States)

Hinz, Thomas; Kallen, Kajo; Britten, Cedrik M; Flamion, Bruno; Granzer, Ulrich; Hoos, Axel; Huber, Christoph; Khleif, Samir; Kreiter, Sebastian; Rammensee, Hans-Georg; Sahin, Ugur; Singh-Jasuja, Harpreet; Türeci, Özlem; Kalinke, Ulrich

2017-01-01

A variety of different mRNA-based drugs are currently in development. This became possible, since major breakthroughs in RNA research during the last decades allowed impressive improvements of translation, stability and delivery of mRNA. This article focuses on antigen-encoding RNA-based vaccines that are either directed against tumors or pathogens. mRNA-encoded vaccines are developed both for preventive or therapeutic purposes. Most mRNA-based vaccines are directly administered to patients. Alternatively, primary autologous cells from cancer patients are modified ex vivo by the use of mRNA and then are adoptively transferred to patients. In the EU no regulatory guidelines presently exist that specifically address mRNA-based vaccines. The existing regulatory framework, however, clearly defines that mRNA-based vaccines in most cases have to be centrally approved. Interestingly, depending on whether RNA-based vaccines are directed against tumors or infectious disease, they are formally considered gene therapy products or not, respectively. Besides an overview on the current clinical use of mRNA vaccines in various therapeutic areas a detailed discussion of the current regulatory situation is provided and regulatory perspectives are discussed.

Activation of pluripotency genes in human fibroblast cells by a novel mRNA based approach.

Directory of Open Access Journals (Sweden)

Jordan R Plews

2010-12-01

Full Text Available Several methods have been used to induce somatic cells to re-enter the pluripotent state. Viral transduction of reprogramming genes yields higher efficiency but involves random insertions of viral sequences into the human genome. Although induced pluripotent stem (iPS cells can be obtained with the removable PiggyBac transposon system or an episomal system, both approaches still use DNA constructs so that resulting cell lines need to be thoroughly analyzed to confirm they are free of harmful genetic modification. Thus a method to change cell fate without using DNA will be very useful in regenerative medicine.In this study, we synthesized mRNAs encoding OCT4, SOX2, cMYC, KLF4 and SV40 large T (LT and electroporated them into human fibroblast cells. Upon transfection, fibroblasts expressed these factors at levels comparable to, or higher than those in human embryonic stem (ES cells. Ectopically expressed OCT4 localized to the cell nucleus within 4 hours after mRNA introduction. Transfecting fibroblasts with a mixture of mRNAs encoding all five factors significantly increased the expression of endogenous OCT4, NANOG, DNMT3β, REX1 and SALL4. When such transfected fibroblasts were also exposed to several small molecules (valproic acid, BIX01294 and 5'-aza-2'-deoxycytidine and cultured in human embryonic stem cell (ES medium they formed small aggregates positive for alkaline phosphatase activity and OCT4 protein within 30 days.Our results demonstrate that mRNA transfection can be a useful approach to precisely control the protein expression level and short-term expression of reprogramming factors is sufficient to activate pluripotency genes in differentiated cells.

Codon optimization of the HIV-1 vpu and vif genes stabilizes their mRNA and allows for highly efficient Rev-independent expression

International Nuclear Information System (INIS)

Nguyen, Kim-Lien; Llano, Manuel; Akari, Hirofumi; Miyagi, Eri; Poeschla, Eric M.; Strebel, Klaus; Bour, Stephan

2004-01-01

Two HIV-1 accessory proteins, Vpu and Vif, are notoriously difficult to express autonomously in the absence of the viral Tat and Rev proteins. We examined whether the codon bias observed in the vpu and vif genes relative to highly expressed human genes contributes to the Rev dependence and low expression level outside the context of the viral genome. The entire vpu gene as well as the 5' half of the vif gene were codon optimized and the resulting open reading frames (ORFs) (vphu and hvif, respectively) were cloned in autonomous expression vectors under the transcriptional control of the CMV promoter. Codon optimization efficiently removed the expression block observed in the native genes and allowed high levels of Rev- and Tat-independent expression of Vpu and Vif. Most of the higher protein levels detected are accounted for by enhanced steady-state levels of the mRNA encoding the optimized species. Nuclear run-on experiments show for the first time that codon optimization has no effect on the rate of transcriptional initiation or elongation of the vphu mRNA. Instead, optimization of the vpu gene was found to stabilize the vphu mRNA in the nucleus and enhance its export to the cytoplasm. This was achieved by allowing the optimized mRNA to use a new CRM1-independent nuclear export pathway. This work provides a better understanding of the molecular mechanisms underlying the process of codon optimization and introduces novel tools to study the biological functions of the Vpu and Vif proteins independently of other viral proteins

Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data.

Science.gov (United States)

Zhu, Mingzhu; Dahmen, Jeremy L; Stacey, Gary; Cheng, Jianlin

2013-09-22

High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

Directory of Open Access Journals (Sweden)

Jiangyu Wu

2013-01-01

Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

Science.gov (United States)

Huang, Weizhe; He, Ziying

2013-01-01

RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

lncRNA Epigenetic Landscape Analysis Identifies EPIC1 as an Oncogenic lncRNA that Interacts with MYC and Promotes Cell-Cycle Progression in Cancer

NARCIS (Netherlands)

Wang, Zehua; Yang, Bo; Zhang, Min; Guo, Weiwei; Wu, Zhiyuan; Wang, Yue; Jia, Lin; Li, Song; Caesar-Johnson, Samantha J.; Demchok, John A.; Felau, Ina; Kasapi, Melpomeni; Ferguson, Martin L.; Hutter, Carolyn M.; Sofia, Heidi J.; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean C.; Zhang, Jiashan (Julia); Chudamani, Sudha; Liu, Jia; Lolla, Laxmi; Naresh, Rashi; Pihl, Todd; Sun, Qiang; Wan, Yunhu; Wu, Ye; Cho, Juok; DeFreitas, Timothy; Frazer, Scott; Gehlenborg, Nils; Getz, Gad; Heiman, David I.; Kim, Jaegil; Lawrence, Michael S.; Lin, Pei; Meier, Sam; Noble, Michael S.; Saksena, Gordon; Voet, Doug; Zhang, Hailei; Bernard, Brady; Chambwe, Nyasha; Dhankani, Varsha; Knijnenburg, Theo; Kramer, Roger; Leinonen, Kalle; Liu, Yuexin; Miller, Michael; Reynolds, Sheila; Shmulevich, Ilya; Thorsson, Vesteinn; Zhang, Wei; Akbani, Rehan; Broom, Bradley M.; Hegde, Apurva M.; Ju, Zhenlin; Kanchi, Rupa S.; Korkut, Anil; Li, Jun; Liang, Han; Ling, Shiyun; Liu, Wenbin; Lu, Yiling; Mills, Gordon B.; Ng, Kwok Shing; Rao, Arvind; Ryan, Michael; Wang, Jing; Weinstein, John N.; Zhang, Jiexin; Abeshouse, Adam; Armenia, Joshua; Chakravarty, Debyani; Chatila, Walid K.; Bruijn, Inode; Gao, Jianjiong; Gross, Benjamin E.; Heins, Zachary J.; Kundra, Ritika; La, Konnor; Ladanyi, Marc; Luna, Augustin; Nissan, Moriah G.; Ochoa, Angelica; Phillips, Sarah M.; Reznik, Ed; Sanchez-Vega, Francisco; Sander, Chris; Schultz, Nikolaus; Sheridan, Robert; Sumer, S. Onur; Sun, Yichao; Taylor, Barry S.; Wang, Jioajiao; Zhang, Hongxin; Anur, Pavana; Peto, Myron; Spellman, Paul; Benz, Christopher; Stuart, Joshua M.; Wong, Christopher K.; Yau, Christina; Hayes, D. Neil; Parker, Joel S.; Wilkerson, Matthew D.; Ally, Adrian; Balasundaram, Miruna; Bowlby, Reanne; Brooks, Denise; Carlsen, Rebecca; Chuah, Eric; Dhalla, Noreen; Holt, Robert; Jones, Steven J.M.; Kasaian, Katayoon; Lee, Darlene; Ma, Yussanne; Marra, Marco A.; Mayo, Michael; Moore, Richard A.; Mungall, Andrew J.; Mungall, Karen; Robertson, A. Gordon; Sadeghi, Sara; Schein, Jacqueline E.; Sipahimalani, Payal; Tam, Angela; Thiessen, Nina; Tse, Kane; Wong, Tina; Berger, Ashton C.; Beroukhim, Rameen; Cherniack, Andrew D.; Cibulskis, Carrie; Gabriel, Stacey B.; Gao, Galen F.; Ha, Gavin; Meyerson, Matthew; Schumacher, Steven E.; Shih, Juliann; Kucherlapati, Melanie H.; Kucherlapati, Raju S.; Baylin, Stephen; Cope, Leslie; Danilova, Ludmila; Bootwalla, Moiz S.; Lai, Phillip H.; Maglinte, Dennis T.; Van Den Berg, David J.; Weisenberger, Daniel J.; Auman, J. Todd; Balu, Saianand; Bodenheimer, Tom; Fan, Cheng; Hoadley, Katherine A.; Hoyle, Alan P.; Jefferys, Stuart R.; Jones, Corbin D.; Meng, Shaowu; Mieczkowski, Piotr A.; Mose, Lisle E.; Perou, Amy H.; Perou, Charles M.; Roach, Jeffrey; Shi, Yan; Simons, Janae V.; Skelly, Tara; Soloway, Matthew G.; Tan, Donghui; Veluvolu, Umadevi; Fan, Huihui; Hinoue, Toshinori; Laird, Peter W.; Shen, Hui; Zhou, Wanding; Bellair, Michelle; Chang, Kyle; Covington, Kyle; Creighton, Chad J.; Dinh, Huyen; Doddapaneni, Harsha Vardhan; Donehower, Lawrence A.; Drummond, Jennifer; Gibbs, Richard A.; Glenn, Robert; Hale, Walker; Han, Yi; Hu, Jianhong; Korchina, Viktoriya; Lee, Sandra; Lewis, Lora; Li, Wei; Liu, Xiuping; Morgan, Margaret; Morton, Donna; Muzny, Donna; Santibanez, Jireh; Sheth, Margi; Shinbrot, Eve; Wang, Linghua; Wang, Min; Wheeler, David A.; Xi, Liu; Zhao, Fengmei; Hess, Julian; Appelbaum, Elizabeth L.; Bailey, Matthew; Cordes, Matthew G.; Ding, Li; Fronick, Catrina C.; Fulton, Lucinda A.; Fulton, Robert S.; Kandoth, Cyriac; Mardis, Elaine R.; McLellan, Michael D.; Miller, Christopher A.; Schmidt, Heather K.; Wilson, Richard K.; Crain, Daniel; Curley, Erin; Gardner, Johanna; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph; Penny, Robert; Shelton, Candace; Shelton, Troy; Sherman, Mark; Thompson, Eric; Yena, Peggy; Bowen, Jay; Gastier-Foster, Julie M.; Gerken, Mark; Leraas, Kristen M.; Lichtenberg, Tara M.; Ramirez, Nilsa C.; Wise, Lisa; Zmuda, Erik; Corcoran, Niall; Costello, Tony; Hovens, Christopher; Carvalho, Andre L.; de Carvalho, Ana C.; Fregnani, José H.; Longatto-Filho, Adhemar; Reis, Rui M.; Scapulatempo-Neto, Cristovam; Silveira, Henrique C.S.; Vidal, Daniel O.; Burnette, Andrew; Eschbacher, Jennifer; Hermes, Beth; Noss, Ardene; Singh, Rosy; Anderson, Matthew L.; Castro, Patricia D.; Ittmann, Michael; Huntsman, David; Kohl, Bernard; Le, Xuan; Thorp, Richard; Andry, Chris; Duffy, Elizabeth R.; Lyadov, Vladimir; Paklina, Oxana; Setdikova, Galiya; Shabunin, Alexey; Tavobilov, Mikhail; McPherson, Christopher; Warnick, Ronald; Berkowitz, Ross; Cramer, Daniel; Feltmate, Colleen; Horowitz, Neil; Kibel, Adam; Muto, Michael; Raut, Chandrajit P.; Malykh, Andrei; Barnholtz-Sloan, Jill S.; Barrett, Wendi; Devine, Karen; Fulop, Jordonna; Ostrom, Quinn T.; Shimmel, Kristen; Wolinsky, Yingli; Sloan, Andrew E.; De Rose, Agostino; Giuliante, Felice; Goodman, Marc; Karlan, Beth Y.; Hagedorn, Curt H.; Eckman, John; Harr, Jodi; Myers, Jerome; Tucker, Kelinda; Zach, Leigh Anne; Deyarmin, Brenda; Hu, Hai; Kvecher, Leonid; Larson, Caroline; Mural, Richard J.; Somiari, Stella; Vicha, Ales; Zelinka, Tomas; Bennett, Joseph; Iacocca, Mary; Rabeno, Brenda; Swanson, Patricia; Latour, Mathieu; Lacombe, Louis; Têtu, Bernard; Bergeron, Alain; McGraw, Mary; Staugaitis, Susan M.; Chabot, John; Hibshoosh, Hanina; Sepulveda, Antonia; Su, Tao; Wang, Timothy; Potapova, Olga; Voronina, Olga; Desjardins, Laurence; Mariani, Odette; Roman-Roman, Sergio; Sastre, Xavier; Stern, Marc Henri; Cheng, Feixiong; Signoretti, Sabina; Berchuck, Andrew; Bigner, Darell; Lipp, Eric; Marks, Jeffrey; McCall, Shannon; McLendon, Roger; Secord, Angeles; Sharp, Alexis; Behera, Madhusmita; Brat, Daniel J.; Chen, Amy; Delman, Keith; Force, Seth; Khuri, Fadlo; Magliocca, Kelly; Maithel, Shishir; Olson, Jeffrey J.; Owonikoko, Taofeek; Pickens, Alan; Ramalingam, Suresh; Shin, Dong M.; Sica, Gabriel; Van Meir, Erwin G.; Zhang, Hongzheng; Eijckenboom, Wil; Gillis, Ad; Korpershoek, Esther; Looijenga, Leendert; Oosterhuis, Wolter; Stoop, Hans; van Kessel, Kim E.; Zwarthoff, Ellen C.; Calatozzolo, Chiara; Cuppini, Lucia; Cuzzubbo, Stefania; DiMeco, Francesco; Finocchiaro, Gaetano; Mattei, Luca; Perin, Alessandro; Pollo, Bianca; Chen, Chu; Houck, John; Lohavanichbutr, Pawadee; Hartmann, Arndt; Stoehr, Christine; Stoehr, Robert; Taubert, Helge; Wach, Sven; Wullich, Bernd; Kycler, Witold; Murawa, Dawid; Wiznerowicz, Maciej; Chung, Ki; Edenfield, W. Jeffrey; Martin, Julie; Baudin, Eric; Bubley, Glenn; Bueno, Raphael; De Rienzo, Assunta; Richards, William G.; Kalkanis, Steven; Mikkelsen, Tom; Noushmehr, Houtan; Scarpace, Lisa; Girard, Nicolas; Aymerich, Marta; Campo, Elias; Giné, Eva; Guillermo, Armando López; Van Bang, Nguyen; Hanh, Phan Thi; Phu, Bui Duc; Tang, Yufang; Colman, Howard; Evason, Kimberley; Dottino, Peter R.; Martignetti, John A.; Gabra, Hani; Juhl, Hartmut; Akeredolu, Teniola; Stepa, Serghei; Hoon, Dave; Ahn, Keunsoo; Kang, Koo Jeong; Beuschlein, Felix; Breggia, Anne; Birrer, Michael; Bell, Debra; Borad, Mitesh; Bryce, Alan H.; Castle, Erik; Chandan, Vishal; Cheville, John; Copland, John A.; Farnell, Michael; Flotte, Thomas; Giama, Nasra; Ho, Thai; Kendrick, Michael; Kocher, Jean Pierre; Kopp, Karla; Moser, Catherine; Nagorney, David; O'Brien, Daniel; O'Neill, Brian Patrick; Patel, Tushar; Petersen, Gloria; Que, Florencia; Rivera, Michael; Roberts, Lewis; Smallridge, Robert; Smyrk, Thomas; Stanton, Melissa; Thompson, R. Houston; Torbenson, Michael; Yang, Ju Dong; Zhang, Lizhi; Brimo, Fadi; Ajani, Jaffer A.; Gonzalez, Ana Maria Angulo; Behrens, Carmen; Bondaruk, Jolanta; Broaddus, Russell; Czerniak, Bogdan; Esmaeli, Bita; Fujimoto, Junya; Gershenwald, Jeffrey; Guo, Charles; Lazar, Alexander J.; Logothetis, Christopher; Meric-Bernstam, Funda; Moran, Cesar; Ramondetta, Lois; Rice, David; Sood, Anil; Tamboli, Pheroze; Thompson, Timothy; Troncoso, Patricia; Tsao, Anne; Wistuba, Ignacio; Carter, Candace; Haydu, Lauren; Hersey, Peter; Jakrot, Valerie; Kakavand, Hojabr; Kefford, Richard; Lee, Kenneth; Long, Georgina; Mann, Graham; Quinn, Michael; Saw, Robyn; Scolyer, Richard; Shannon, Kerwin; Spillane, Andrew; Stretch, Jonathan; Synott, Maria; Thompson, John; Wilmott, James; Al-Ahmadie, Hikmat; Chan, Timothy A.; Ghossein, Ronald; Gopalan, Anuradha; Levine, Douglas A.; Reuter, Victor; Singer, Samuel; Singh, Bhuvanesh; Tien, Nguyen Viet; Broudy, Thomas; Mirsaidi, Cyrus; Nair, Praveen; Drwiega, Paul; Miller, Judy; Smith, Jennifer; Zaren, Howard; Park, Joong Won; Hung, Nguyen Phi; Kebebew, Electron; Linehan, W. Marston; Metwalli, Adam R.; Pacak, Karel; Pinto, Peter A.; Schiffman, Mark; Schmidt, Laura S.; Vocke, Cathy D.; Wentzensen, Nicolas; Worrell, Robert; Yang, Hannah; Moncrieff, Marc; Goparaju, Chandra; Melamed, Jonathan; Pass, Harvey; Botnariuc, Natalia; Caraman, Irina; Cernat, Mircea; Chemencedji, Inga; Clipca, Adrian; Doruc, Serghei; Gorincioi, Ghenadie; Mura, Sergiu; Pirtac, Maria; Stancul, Irina; Tcaciuc, Diana; Albert, Monique; Alexopoulou, Iakovina; Arnaout, Angel; Bartlett, John; Engel, Jay; Gilbert, Sebastien; Parfitt, Jeremy; Sekhon, Harman; Thomas, George; Rassl, Doris M.; Rintoul, Robert C.; Bifulco, Carlo; Tamakawa, Raina; Urba, Walter; Hayward, Nicholas; Timmers, Henri; Antenucci, Anna; Facciolo, Francesco; Grazi, Gianluca; Marino, Mirella; Merola, Roberta; de Krijger, Ronald; Gimenez-Roqueplo, Anne Paule; Piché, Alain; Chevalier, Simone; McKercher, Ginette; Birsoy, Kivanc; Barnett, Gene; Brewer, Cathy; Farver, Carol; Naska, Theresa; Pennell, Nathan A.; Raymond, Daniel; Schilero, Cathy; Smolenski, Kathy; Williams, Felicia; Morrison, Carl; Borgia, Jeffrey A.; Liptay, Michael J.; Pool, Mark; Seder, Christopher W.; Junker, Kerstin; Omberg, Larsson; Dinkin, Mikhail; Manikhas, George; Alvaro, Domenico; Bragazzi, Maria Consiglia; Cardinale, Vincenzo; Carpino, Guido; Gaudio, Eugenio; Chesla, David; Cottingham, Sandra; Dubina, Michael; Moiseenko, Fedor; Dhanasekaran, Renumathy; Becker, Karl Friedrich; Janssen, Klaus Peter; Slotta-Huspenina, Julia; Abdel-Rahman, Mohamed H.; Aziz, Dina; Bell, Sue; Cebulla, Colleen M.; Davis, Amy; Duell, Rebecca; Elder, J. Bradley; Hilty, Joe; Kumar, Bahavna; Lang, James; Lehman, Norman L.; Mandt, Randy; Nguyen, Phuong; Pilarski, Robert; Rai, Karan; Schoenfield, Lynn; Senecal, Kelly; Wakely, Paul; Hansen, Paul; Lechan, Ronald; Powers, James; Tischler, Arthur; Grizzle, William E.; Sexton, Katherine C.; Kastl, Alison; Henderson, Joel; Porten, Sima; Waldmann, Jens; Fassnacht, Martin; Asa, Sylvia L.; Schadendorf, Dirk; Couce, Marta; Graefen, Markus; Huland, Hartwig; Sauter, Guido; Schlomm, Thorsten; Simon, Ronald; Tennstedt, Pierre; Olabode, Oluwole; Nelson, Mark; Bathe, Oliver; Carroll, Peter R.; Chan, June M.; Disaia, Philip; Glenn, Pat; Kelley, Robin K.; Landen, Charles N.; Phillips, Joanna; Prados, Michael; Simko, Jeffry; Smith-McCune, Karen; VandenBerg, Scott; Roggin, Kevin; Fehrenbach, Ashley; Kendler, Ady; Sifri, Suzanne; Steele, Ruth; Jimeno, Antonio; Carey, Francis; Forgie, Ian; Mannelli, Massimo; Carney, Michael; Hernandez, Brenda; Campos, Benito; Herold-Mende, Christel; Jungk, Christin; Unterberg, Andreas; von Deimling, Andreas; Bossler, Aaron; Galbraith, Joseph; Jacobus, Laura; Knudson, Michael; Knutson, Tina; Ma, Deqin; Milhem, Mohammed; Sigmund, Rita; Godwin, Andrew K.; Madan, Rashna; Rosenthal, Howard G.; Adebamowo, Clement; Adebamowo, Sally N.; Boussioutas, Alex; Beer, David; Giordano, Thomas; Mes-Masson, Anne Marie; Saad, Fred; Bocklage, Therese; Landrum, Lisa; Mannel, Robert; Moore, Kathleen; Moxley, Katherine; Postier, Russel; Walker, Joan; Zuna, Rosemary; Feldman, Michael; Valdivieso, Federico; Dhir, Rajiv; Luketich, James; Pinero, Edna M.Mora; Quintero-Aguilo, Mario; Carlotti, Carlos Gilberto; Dos Santos, Jose Sebastião; Kemp, Rafael; Sankarankuty, Ajith; Tirapelli, Daniela; Catto, James; Agnew, Kathy; Swisher, Elizabeth; Creaney, Jenette; Robinson, Bruce; Shelley, Carl Simon; Godwin, Eryn M.; Kendall, Sara; Shipman, Cassaundra; Bradford, Carol; Carey, Thomas; Haddad, Andrea; Moyer, Jeffey; Peterson, Lisa; Prince, Mark; Rozek, Laura; Wolf, Gregory; Bowman, Rayleen; Fong, Kwun M.; Yang, Ian; Korst, Robert; Rathmell, W. Kimryn; Fantacone-Campbell, J. Leigh; Hooke, Jeffrey A.; Kovatich, Albert J.; Shriver, Craig D.; DiPersio, John; Drake, Bettina; Govindan, Ramaswamy; Heath, Sharon; Ley, Timothy; Van Tine, Brian; Westervelt, Peter; Rubin, Mark A.; Lee, Jung Il; Aredes, Natália D.; Mariamidze, Armaz; Xie, Wen; Yang, Da

2018-01-01

We characterized the epigenetic landscape of genes encoding long noncoding RNAs (lncRNAs) across 6,475 tumors and 455 cancer cell lines. In stark contrast to the CpG island hypermethylation phenotype in cancer, we observed a recurrent hypomethylation of 1,006 lncRNA genes in cancer, including EPIC1

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

The Bacillus subtilis yaaH Gene Is Transcribed by SigE RNA Polymerase during Sporulation, and Its Product Is Involved in Germination of Spores

Science.gov (United States)

Kodama, Takeko; Takamatsu, Hiromu; Asai, Kei; Kobayashi, Kazuo; Ogasawara, Naotake; Watabe, Kazuhito

1999-01-01

The expression of 21 novel genes located in the region from dnaA to abrB of the Bacillus subtilis chromosome was analyzed. One of the genes, yaaH, had a predicted promoter sequence conserved among SigE-dependent genes. Northern blot analysis revealed that yaaH mRNA was first detected from 2 h after the cessation of logarithmic growth (T2) of sporulation in wild-type cells and in spoIIIG (SigG−) and spoIVCB (SigK−) mutants but not in spoIIAC (SigF−) and spoIIGAB (SigE−) mutants. The transcription start point was determined by primer extension analysis; the −10 and −35 regions are very similar to the consensus sequences recognized by SigE-containing RNA polymerase. A YaaH-His tag fusion encoded by a plasmid with a predicted promoter for the yaaH gene was produced from T2 of sporulation in a B. subtilis transformant and extracted from mature spores, indicating that the yaaH gene product is a spore protein. Inactivation of the yaaH gene by insertion of an erythromycin resistance gene did not affect vegetative growth or spore resistance to heat, chloroform, and lysozyme. The germination of yaaH mutant spores in a mixture of l-asparagine, d-glucose, d-fructose, and potassium chloride was almost the same as that of wild-type spores, but the mutant spores were defective in l-alanine-stimulated germination. These results suggest that yaaH is a novel gene encoding a spore protein produced in the mother cell compartment from T2 of sporulation and that it is required for the l-alanine-stimulated germination pathway. PMID:10419957

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

The mouse Gtl2 gene is differentially expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA.

Science.gov (United States)

Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A

1998-06-01

We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.

Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

Directory of Open Access Journals (Sweden)

Yi-Li Li

2017-11-01

Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

RNA amplification for successful gene profiling analysis

Directory of Open Access Journals (Sweden)

Wang Ena

2005-07-01

Full Text Available Abstract The study of clinical samples is often limited by the amount of material available to study. While proteins cannot be multiplied in their natural form, DNA and RNA can be amplified from small specimens and used for high-throughput analyses. Therefore, genetic studies offer the best opportunity to screen for novel insights of human pathology when little material is available. Precise estimates of DNA copy numbers in a given specimen are necessary. However, most studies investigate static variables such as the genetic background of patients or mutations within pathological specimens without a need to assess proportionality of expression among different genes throughout the genome. Comparative genomic hybridization of DNA samples represents a crude exception to this rule since genomic amplification or deletion is compared among different specimens directly. For gene expression analysis, however, it is critical to accurately estimate the proportional expression of distinct RNA transcripts since such proportions directly govern cell function by modulating protein expression. Furthermore, comparative estimates of relative RNA expression at different time points portray the response of cells to environmental stimuli, indirectly informing about broader biological events affecting a particular tissue in physiological or pathological conditions. This cognitive reaction of cells is similar to the detection of electroencephalographic patterns which inform about the status of the brain in response to external stimuli. As our need to understand human pathophysiology at the global level increases, the development and refinement of technologies for high fidelity messenger RNA amplification have become the focus of increasing interest during the past decade. The need to increase the abundance of RNA has been met not only for gene specific amplification, but, most importantly for global transcriptome wide, unbiased amplification. Now gene

Characterization of Acinetobacter baumannii clinical isolates carrying bla(OXA-23) carbapenemase and 16S rRNA methylase armA genes in Yemen.

Science.gov (United States)

Bakour, Sofiane; Alsharapy, Samer Ahmed; Touati, Abdelaziz; Rolain, Jean-Marc

2014-12-01

The aim of this study was to investigate the molecular support of resistance to carbapenems, aminoglycosides, and fluoroquinolones in Acinetobacter baumannii clinical isolates collected from Yemen hospital. Three A. baumannii were isolated in February 2013 from three patients hospitalized at Al-Thawra University Hospital in Sana'a, Yemen. Antibiotic susceptibility testing was performed using the disk diffusion and E-test methods. Carbapenemase production was carried out by the modified Hodge test (MHT) and imipenem-ethylenediaminetetraacetic acid (EDTA) methods. Carbapenem, aminoglycoside, and fluoroquinolone resistance determinants were studied by polymerase chain reaction and sequencing. The epidemiological relatedness of the three strains was studied using multilocus sequence typing (MLST). The isolates were resistant to almost all antibiotics tested with very high imipenem, amikacin, and ciprofloxacin minimum inhibitory concentrations (>32, >256, and >32 mg/L, respectively). The microbiological tests showed that the three A. baumannii were MHT positive, besides, the activity of β-lactamases was not inhibited by EDTA. All the three isolates contained the naturally occurring bla(OXA-51)-like gene and the bla(OXA-23)-like carbapenemase-encoding gene. The 16S rRNA methylase armA gene was detected in the three isolates. In addition, screening for genes encoding the aminoglycoside-modifying enzymes (AMEs) demonstrated that one isolate contained the acetyltransferase gene aac(6')-Ib. Fluoroquinolone resistance was associated with a single mutation Ser83Leu in the quinolone resistance determining region of the gyrA gene in all isolates. The MLST showed that the sequence type (ST) obtained corresponds to ST2 for the three strains. Here we report the first identification of multidrug-resistant A. baumannii isolates harboring the bla(OXA-23)-like gene, AMEs [aac(6')-Ib], and the 16S rRNA methylase (armA) in the Yemen hospital.

Integration analysis of microRNA and mRNA paired expression profiling identifies deregulated microRNA-transcription factor-gene regulatory networks in ovarian endometriosis.

Science.gov (United States)

Zhao, Luyang; Gu, Chenglei; Ye, Mingxia; Zhang, Zhe; Li, Li'an; Fan, Wensheng; Meng, Yuanguang

2018-01-22

The etiology and pathophysiology of endometriosis remain unclear. Accumulating evidence suggests that aberrant microRNA (miRNA) and transcription factor (TF) expression may be involved in the pathogenesis and development of endometriosis. This study therefore aims to survey the key miRNAs, TFs and genes and further understand the mechanism of endometriosis. Paired expression profiling of miRNA and mRNA in ectopic endometria compared with eutopic endometria were determined by high-throughput sequencing techniques in eight patients with ovarian endometriosis. Binary interactions and circuits among the miRNAs, TFs, and corresponding genes were identified by the Pearson correlation coefficients. miRNA-TF-gene regulatory networks were constructed using bioinformatic methods. Eleven selected miRNAs and TFs were validated by quantitative reverse transcription-polymerase chain reaction in 22 patients. Overall, 107 differentially expressed miRNAs and 6112 differentially expressed mRNAs were identified by comparing the sequencing of the ectopic endometrium group and the eutopic endometrium group. The miRNA-TF-gene regulatory network consists of 22 miRNAs, 12 TFs and 430 corresponding genes. Specifically, some key regulators from the miR-449 and miR-34b/c cluster, miR-200 family, miR-106a-363 cluster, miR-182/183, FOX family, GATA family, and E2F family as well as CEBPA, SOX9 and HNF4A were suggested to play vital regulatory roles in the pathogenesis of endometriosis. Integration analysis of the miRNA and mRNA expression profiles presents a unique insight into the regulatory network of this enigmatic disorder and possibly provides clues regarding replacement therapy for endometriosis.

Transfection of tumor-infiltrating T cells with mRNA encoding CXCR2

DEFF Research Database (Denmark)

Idorn, Manja; thor Straten, Eivind Per; Svane, Inge Marie

2016-01-01

Adoptive T-cell therapy based on the infusion of patient’s own immune cells after ex vivo culturing is among the most potent forms of personalized treatment among recent clinical developments for the treatment of cancer. However, despite high rates of successful initial clinical responses, only...... infused T cells migrating to the tumor and the clinical response, but also that only a small fraction of adoptively transferred Tcells reach the tumor site. In this chapter, we describe a protocol for transfection of TILs with mRNA encoding the chemokine receptor CXCR2 transiently redirecting...

Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

Directory of Open Access Journals (Sweden)

Craxton Molly

2007-07-01

Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

MicroRNA and gene signature of severe cutaneous drug ...

African Journals Online (AJOL)

Purpose: To build a microRNA and gene signature of severe cutaneous adverse drug reactions (SCAR), including Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). Methods: MicroRNA expression profiles were downloaded from miRNA expression profile of patients' skin suffering from TEN using an ...

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

Directory of Open Access Journals (Sweden)

Milbury Coren A

2010-09-01

Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

Squamous Cell Carcinoma Antigen-encoding Genes SERPINB3/B4 as Potentially Useful Markers for the Stratification of HNSCC Tumours.

Science.gov (United States)

Saidak, Zuzana; Morisse, Mony Chenda; Chatelain, Denis; Sauzay, Chloé; Houessinon, Aline; Guilain, Nelly; Soyez, Marion; Chauffert, Bruno; Dakpé, Stéphanie; Galmiche, Antoine

2018-03-01

The squamous cell carcinoma antigen (SCCA), encoded by the genes SERPINB3/B4, is a tumour marker produced by head and neck squamous cell carcinoma (HNSCC). We aimed to examine SERPINB3/B4 mRNA levels and its clinical significance in the therapeutic context. We retrieved mRNA expression levels, clinical, pathological and genomic data for 520 HNSCC from The Cancer Genome Atlas (TCGA). HNSCC tumours express high levels of SERPINB3/B4 mRNA. SERPINB3 expression differs depending on Human papillomavirus (HPV) infection status, primary tumour location, grade and differentiation, extension to lymph nodes and extracapsular spread. Interestingly, we observed an association between SERPINB3/B4 and the presence of tumour immune infiltrate as well as the expression of the immune checkpoint regulators PD-L1/PD-L2 that depended on HPV status. Our findings point to potential interest of SERPINB3/B4 for the stratification of HNSCC patients in the therapeutic context. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

About miRNAs, miRNA seeds, target genes and target pathways.

Science.gov (United States)

Kehl, Tim; Backes, Christina; Kern, Fabian; Fehlmann, Tobias; Ludwig, Nicole; Meese, Eckart; Lenhof, Hans-Peter; Keller, Andreas

2017-12-05

miRNAs are typically repressing gene expression by binding to the 3' UTR, leading to degradation of the mRNA. This process is dominated by the eight-base seed region of the miRNA. Further, miRNAs are known not only to target genes but also to target significant parts of pathways. A logical line of thoughts is: miRNAs with similar (seed) sequence target similar sets of genes and thus similar sets of pathways. By calculating similarity scores for all 3.25 million pairs of 2,550 human miRNAs, we found that this pattern frequently holds, while we also observed exceptions. Respective results were obtained for both, predicted target genes as well as experimentally validated targets. We note that miRNAs target gene set similarity follows a bimodal distribution, pointing at a set of 282 miRNAs that seems to target genes with very high specificity. Further, we discuss miRNAs with different (seed) sequences that nonetheless regulate similar gene sets or pathways. Most intriguingly, we found miRNA pairs that regulate different gene sets but similar pathways such as miR-6886-5p and miR-3529-5p. These are jointly targeting different parts of the MAPK signaling cascade. The main goal of this study is to provide a general overview on the results, to highlight a selection of relevant results on miRNAs, miRNA seeds, target genes and target pathways and to raise awareness for artifacts in respective comparisons. The full set of information that allows to infer detailed results on each miRNA has been included in miRPathDB, the miRNA target pathway database (https://mpd.bioinf.uni-sb.de).

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

RNA Chimeras as a Gene Signature of Breast Cancer

Science.gov (United States)

2013-05-01

www.plosone.org 11 August 2012 | Volume 7 | Issue 8 | e41659 Human genes Human ACTB mRNA: >gi|168480144|ref|NM_001101.3| Homo sapiens actin, beta...TCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGAGTGGGTGGAGGCAGCCAGGGCTTACCTGTACACTGACTTGAGACCAGTTGAATAAA AGTGCACACCTTAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Human GAPDH mRNA: >gi|83641890|ref|NM_002046.4| Homo sapiens ...Homo sapiens hypoxanthine phosphoribosyltransferase 1 (HPRT1), mRNA

Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls

Directory of Open Access Journals (Sweden)

Dilla Mareistia Fassah

2018-04-01

Full Text Available Objective This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Methods Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10 and steers (n = 10 of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Results Castration increased the mRNA (3.6 fold; p<0.01 and protein levels (1.4 fold; p< 0.05 of pyruvate carboxylase and mitochondrial phosphoenolpyruvate carboxykinase genes (1.7 fold; p<0.05. Hepatic mRNA levels of genes encoding the glycolysis enzymes were not changed by castration. Castration increased mRNA levels of both lactate dehydrogenase A (1.5 fold; p<0.05 and lactate dehydrogenase B (2.2 fold; p<0.01 genes for lactate utilization. Castration increased mRNA levels of glycerol kinase (2.7 fold; p<0.05 and glycerol-3-phosphate dehydrogenase 1 (1.5 fold; p<0.05 genes for glycerol utilization. Castration also increased mRNA levels of propionyl-CoA carboxylase beta (mitochondrial (3.5 fold; p<0.01 and acyl-CoA synthetase short chain family member 3 (1.3 fold; p = 0.06 genes for propionate incorporation. Conclusion Castration increases transcription levels of critical genes coding for enzymes involved in irreversible gluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular

Dual function of the McaS small RNA in controlling biofilm formation

DEFF Research Database (Denmark)

Jørgensen, Mikkel Girke; Thomason, Maureen K.; Havelund, Johannes

2013-01-01

, and biofilm formation. Moreover, ectopic McaS expression leads to induction of two additional CsrA-repressed genes encoding diguanylate cyclases. Collectively, our study shows that McaS is a dual-function sRNA with roles in the two major post-transcriptional regulons controlled by the RNA-binding proteins Hfq...

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

Directory of Open Access Journals (Sweden)

Lim Chee Liew

Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

An RNA editing/dsRNA binding-independent gene regulatory mechanism of ADARs and its clinical implication in cancer.

Science.gov (United States)

Qi, Lihua; Song, Yangyang; Chan, Tim Hon Man; Yang, Henry; Lin, Chi Ho; Tay, Daryl Jin Tai; Hong, HuiQi; Tang, Sze Jing; Tan, Kar Tong; Huang, Xi Xiao; Lin, Jaymie Siqi; Ng, Vanessa Hui En; Maury, Julien Jean Pierre; Tenen, Daniel G; Chen, Leilei

2017-10-13

Adenosine-to-inosine (A-to-I) RNA editing, catalyzed by Adenosine DeAminases acting on double-stranded RNA(dsRNA) (ADAR), occurs predominantly in the 3' untranslated regions (3'UTRs) of spliced mRNA. Here we uncover an unanticipated link between ADARs (ADAR1 and ADAR2) and the expression of target genes undergoing extensive 3'UTR editing. Using METTL7A (Methyltransferase Like 7A), a novel tumor suppressor gene with multiple editing sites at its 3'UTR, we demonstrate that its expression could be repressed by ADARs beyond their RNA editing and double-stranded RNA (dsRNA) binding functions. ADARs interact with Dicer to augment the processing of pre-miR-27a to mature miR-27a. Consequently, mature miR-27a targets the METTL7A 3'UTR to repress its expression level. In sum, our study unveils that the extensive 3'UTR editing of METTL7A is merely a footprint of ADAR binding, and there are a subset of target genes that are equivalently regulated by ADAR1 and ADAR2 through their non-canonical RNA editing and dsRNA binding-independent functions, albeit maybe less common. The functional significance of ADARs is much more diverse than previously appreciated and this gene regulatory function of ADARs is most likely to be of high biological importance beyond the best-studied editing function. This non-editing side of ADARs opens another door to target cancer. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Multigenic lentiviral vectors for combined and tissue-specific expression of miRNA- and protein-based antiangiogenic factors

Directory of Open Access Journals (Sweden)

Anne Louise Askou

Full Text Available Lentivirus-based gene delivery vectors carrying multiple gene cassettes are powerful tools in gene transfer studies and gene therapy, allowing coexpression of multiple therapeutic factors and, if desired, fluorescent reporters. Current strategies to express transgenes and microRNA (miRNA clusters from a single vector have certain limitations that affect transgene expression levels and/or vector titers. In this study, we describe a novel vector design that facilitates combined expression of therapeutic RNA- and protein-based antiangiogenic factors as well as a fluorescent reporter from back-to-back RNApolII-driven expression cassettes. This configuration allows effective production of intron-embedded miRNAs that are released upon transduction of target cells. Exploiting such multigenic lentiviral vectors, we demonstrate robust miRNA-directed downregulation of vascular endothelial growth factor (VEGF expression, leading to reduced angiogenesis, and parallel impairment of angiogenic pathways by codelivering the gene encoding pigment epithelium-derived factor (PEDF. Notably, subretinal injections of lentiviral vectors reveal efficient retinal pigment epithelium-specific gene expression driven by the VMD2 promoter, verifying that multigenic lentiviral vectors can be produced with high titers sufficient for in vivo applications. Altogether, our results suggest the potential applicability of combined miRNA- and protein-encoding lentiviral vectors in antiangiogenic gene therapy, including new combination therapies for amelioration of age-related macular degeneration.

An efficient approach to finding Siraitia grosvenorii triterpene biosynthetic genes by RNA-seq and digital gene expression analysis

Directory of Open Access Journals (Sweden)

Song Cai

2011-07-01

Full Text Available Abstract Background Siraitia grosvenorii (Luohanguo is an herbaceous perennial plant native to southern China and most prevalent in Guilin city. Its fruit contains a sweet, fleshy, edible pulp that is widely used in traditional Chinese medicine. The major bioactive constituents in the fruit extract are the cucurbitane-type triterpene saponins known as mogrosides. Among them, mogroside V is nearly 300 times sweeter than sucrose. However, little is known about mogrosides biosynthesis in S. grosvenorii, especially the late steps of the pathway. Results In this study, a cDNA library generated from of equal amount of RNA taken from S. grosvenorii fruit at 50 days after flowering (DAF and 70 DAF were sequenced using Illumina/Solexa platform. More than 48,755,516 high-quality reads from a cDNA library were generated that was assembled into 43,891 unigenes. De novo assembly and gap-filling generated 43,891 unigenes with an average sequence length of 668 base pairs. A total of 26,308 (59.9% unique sequences were annotated and 11,476 of the unique sequences were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes. cDNA sequences for all of the known enzymes involved in mogrosides backbone synthesis were identified from our library. Additionally, a total of eighty-five cytochrome P450 (CYP450 and ninety UDP-glucosyltransferase (UDPG unigenes were identified, some of which appear to encode enzymes responsible for the conversion of the mogroside backbone into the various mogrosides. Digital gene expression profile (DGE analysis using Solexa sequencing was performed on three important stages of fruit development, and based on their expression pattern, seven CYP450s and five UDPGs were selected as the candidates most likely to be involved in mogrosides biosynthesis. Conclusion A combination of RNA-seq and DGE analysis based on the next generation sequencing technology was shown to be a powerful method for identifying

The hypoxic proteome is influenced by gene-specific changes in mRNA translation

International Nuclear Information System (INIS)

Koritzinsky, Marianne; Seigneuric, Renaud; Magagnin, Michael G.; Beucken, Twan van den; Lambin, Philippe; Wouters, Bradly G.

2005-01-01

Background and purpose: Hypoxia causes a rapid reduction in mRNA translation efficiency. This inhibition does not affect all mRNA species to the same extent and can therefore contribute significantly to hypoxia-induced differential protein expression. Our aim in this study was to characterize changes in gene expression during acute hypoxia and evaluate the contribution of regulation via mRNA translation on these changes. For each gene, the contribution of changes in mRNA abundance versus mRNA translation was determined. Materials and methods: DU145 prostate carcinoma cells were exposed to 4 h of hypoxia ( 2 ). Efficiently translated mRNAs were isolated by sedimentation through a sucrose gradient. Affymetrix microarray technology was used to evaluate both the transcriptional and translational contribution to gene expression. Results were validated by quantitative PCR. Results: One hundred and twenty genes were more than 4-fold upregulated by hypoxia in the efficiently translated fraction of mRNA, in comparison to only 76 genes at the level of transcription. Of the 50 genes demonstrating the largest changes in translation, 11 were found to be more than 2-fold over represented in the translated fraction in comparison to their overall transcriptional level. The gene with the highest translational contribution to its induction was CITED-2, which is a negative regulator of HIF-1 transcriptional activity. Conclusions: Gene-specific regulation of mRNA translation contributes significantly to differential gene expression during hypoxia

Divergent regulation of Arabidopsis SAUR genes

NARCIS (Netherlands)

Mourik, van Hilda; Dijk, van Aalt D.J.; Stortenbeker, Niek; Angenent, Gerco C.; Bemer, Marian

2017-01-01

Background: Small Auxin-Upregulated RNA (SAUR) genes encode growth regulators that induce cell elongation. Arabidopsis contains more than 70 SAUR genes, of which the growth-promoting function has been unveiled in seedlings, while their role in other tissues remained largely unknown. Here, we

Thermal response of rat fibroblasts stably transfected with the human 70-kDa heat shock protein-encoding gene

International Nuclear Information System (INIS)

Li, G.C.; Li, Ligeng; Liu, Yunkang; Mak, J.Y.; Chen, Lili; Lee, W.M.F.

1991-01-01

The major heat shock protein hsp70 is synthesized by cells of a wide variety of organisms in response to heat shock or other environmental stresses and is assumed to play an important role in protecting cells from thermal stress. The authors have tested this hypothesis directly by transfecting a constitutively expressed recombinant human hsp70-encoding gene into rat fibroblasts and examining the relationship between the levels of human hsp70 expressed and thermal resistance of the stably transfected rat cells. Successful transfection and expression of the gene for human hsp70 were characterized by RNA hybridization analysis, low-dimensional gel electrophoresis, and immunoblot analysis. When individual cloned cell lines were exposed to 45C and their thermal survivals were determined by colony-formation assay, they found that the expression of human hsp70 conferred heat resistance to the rat cells. These results reinforce the hypothesis that hsp70 has a protective function against thermal stress

Evaluation of tools for highly variable gene discovery from single-cell RNA-seq data.

Science.gov (United States)

Yip, Shun H; Sham, Pak Chung; Wang, Junwen

2018-02-21

Traditional RNA sequencing (RNA-seq) allows the detection of gene expression variations between two or more cell populations through differentially expressed gene (DEG) analysis. However, genes that contribute to cell-to-cell differences are not discoverable with RNA-seq because RNA-seq samples are obtained from a mixture of cells. Single-cell RNA-seq (scRNA-seq) allows the detection of gene expression in each cell. With scRNA-seq, highly variable gene (HVG) discovery allows the detection of genes that contribute strongly to cell-to-cell variation within a homogeneous cell population, such as a population of embryonic stem cells. This analysis is implemented in many software packages. In this study, we compare seven HVG methods from six software packages, including BASiCS, Brennecke, scLVM, scran, scVEGs and Seurat. Our results demonstrate that reproducibility in HVG analysis requires a larger sample size than DEG analysis. Discrepancies between methods and potential issues in these tools are discussed and recommendations are made.

Post-transcriptional bursting in genes regulated by small RNA molecules

Science.gov (United States)

Rodrigo, Guillermo

2018-03-01

Gene expression programs in living cells are highly dynamic due to spatiotemporal molecular signaling and inherent biochemical stochasticity. Here we study a mechanism based on molecule-to-molecule variability at the RNA level for the generation of bursts of protein production, which can lead to heterogeneity in a cell population. We develop a mathematical framework to show numerically and analytically that genes regulated post transcriptionally by small RNA molecules can exhibit such bursts due to different states of translation activity (on or off), mostly revealed in a regime of few molecules. We exploit this framework to compare transcriptional and post-transcriptional bursting and also to illustrate how to tune the resulting protein distribution with additional post-transcriptional regulations. Moreover, because RNA-RNA interactions are predictable with an energy model, we define the kinetic constants of on-off switching as functions of the two characteristic free-energy differences of the system, activation and formation, with a nonequilibrium scheme. Overall, post-transcriptional bursting represents a distinctive principle linking gene regulation to gene expression noise, which highlights the importance of the RNA layer beyond the simple information transfer paradigm and significantly contributes to the understanding of the intracellular processes from a first-principles perspective.

Hox gene regulation in the central nervous system of Drosophila

Directory of Open Access Journals (Sweden)

Maheshwar eGummalla

2014-04-01

Full Text Available Hox genes specify the structures that form along the anteroposterior (AP axis of bilateria. Within the genome, they often form clusters where, remarkably enough, their position within the clusters reflects the relative positions of the structures they specify along the AP axis. This correspondence between genomic organization and gene expression pattern has been conserved through evolution and provides a unique opportunity to study how chromosomal context affects gene regulation. In Drosophila, a general rule, often called posterior dominance, states that Hox genes specifying more posterior structures repress the expression of more anterior Hox genes. This rule explains the apparent spatial complementarity of Hox gene expression patterns in Drosophila. Here we review a noticeable exception to this rule where the more-posteriorly expressed Abd-B hox gene fails to repress the more-anterior abd-A gene in cells of the central nervous system (CNS. While Abd-B is required to repress ectopic expression of abd-A in the posterior epidermis, abd-A repression in the posterior CNS is accomplished by a different mechanism that involves a large 92kb long non-coding RNA (lncRNA encoded by the intergenic region separating abd-A and Abd-B (the iab8ncRNA. Dissection of this lncRNA revealed that abd-A is repressed by the lncRNA using two redundant mechanisms. The 1st mechanism is mediated by a microRNA (mir-iab-8 encoded by intronic sequence within the large iab8-ncRNA. Meanwhile, the second mechanism seems to involve transcriptional interference by the long iab-8 ncRNA on the abd-A promoter. Recent work demonstrating CNS-specific regulation of genes by ncRNAs in Drosophila, seem to highlight a potential role for the iab-8-ncRNA in the evolution of the Drosophila hox complexes