WorldWideScience

Sample records for gene encoding rna

  1. Molecular characterization of rpoB gene encoding the RNA ...

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  2. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  3. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  4. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  5. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  6. Identification of human microRNA-like sequences embedded within the protein-encoding genes of the human immunodeficiency virus.

    Bryan Holland

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the

  7. Efficient procedure for transferring specific human genes into Chinese hamster cell mutants: interspecific transfer of the human genes encoding leucyl- and asparaginyl-tRNA synthetases

    Cirullo, R.E.; Dana, S.; Wasmuth, J.J.

    1983-01-01

    A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure

  8. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  9. Genetics and Molecular Biology of Epstein-Barr Virus-Encoded BART MicroRNA: A Paradigm for Viral Modulation of Host Immune Response Genes and Genome Stability

    David H. Dreyfus

    2017-01-01

    Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.

  10. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  11. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... is dependent on the presence of the methyl group donor, S-adenosyl methionine. Analysis of the 74-mer RNA substrate by biochemical and mass spectrometric methods shows that TlrB adds a single methyl group to the base of G748. Homologues of TlrB in other bacteria have been revealed through database searches...

  12. The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

    Ying Wang

    Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

  13. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    Lu, C.; Fedoroff, N.

    2000-01-01

    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  14. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

    Mariza M. Coêlho

    2011-01-01

    Full Text Available Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla, were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species.

  15. Structure of the gene encoding VGF, a nervous system-specific mRNA that is rapidly and selectively induced by nerve growth factor in PC12 cells.

    Salton, S R; Fischberg, D J; Dong, K W

    1991-05-01

    Nerve growth factor (NGF) plays a critical role in the development and survival of neurons in the peripheral nervous system. Following treatment with NGF but not epidermal growth factor, rat pheochromocytoma (PC12) cells undergo neural differentiation. We have cloned a nervous system-specific mRNA, NGF33.1, that is rapidly and relatively selectively induced by treatment of PC12 cells with NGF and basic fibroblast growth factor in comparison with epidermal growth factor. Analysis of the nucleic acid and predicted amino acid sequences of the NGF33.1 cDNA clone suggested that this clone corresponded to the NGF-inducible mRNA called VGF (A. Levi, J. D. Eldridge, and B. M. Paterson, Science 229:393-395, 1985; R. Possenti, J. D. Eldridge, B. M. Paterson, A. Grasso, and A. Levi, EMBO J. 8:2217-2223, 1989). We have used the NGF33.1 cDNA clone to isolate and characterize the VGF gene, and in this paper we report the complete sequence of the VGF gene, including 853 bases of 5' flank revealed TATAA and CCAAT elements, several GC boxes, and a consensus cyclic AMP response element-binding protein binding site. The VGF promoter contains sequences homologous to other NGF-inducible, neuronal promoters. We further show that VGF mRNA is induced in PC12 cells to a greater extent by depolarization and by phorbol-12-myristate-13-acetate treatment than by 8-bromo-cyclic AMP treatment. By Northern (RNA) and RNase protection analysis, VGF mRNA is detectable in embryonic and postnatal central and peripheral nervous tissues but not in a number of nonneural tissues. In the cascade of events which ultimately leads to the neural differentiation of NGF-treated PC12 cells, the VGF gene encodes the most rapidly and selectively regulated, nervous-system specific mRNA yet identified.

  16. [Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

    Shpakovskiĭ, G V; Lebedenko, E N

    1997-05-01

    The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

  17. RNA-Seq-based analysis of cold shock response in Thermoanaerobacter tengcongensis, a bacterium harboring a single cold shock protein encoding gene.

    Bo Liu

    Full Text Available BACKGROUND: Although cold shock responses and the roles of cold shock proteins in microorganisms containing multiple cold shock protein genes have been well characterized, related studies on bacteria possessing a single cold shock protein gene have not been reported. Thermoanaerobacter tengcongensis MB4, a thermophile harboring only one known cold shock protein gene (TtescpC, can survive from 50° to 80 °C, but has poor natural competence under cold shock at 50 °C. We therefore examined cold shock responses and their effect on natural competence in this bacterium. RESULTS: The transcriptomes of T. tengcongensis before and after cold shock were analyzed by RNA-seq and over 1200 differentially expressed genes were successfully identified. These genes were involved in a wide range of biological processes, including modulation of DNA replication, recombination, and repair; energy metabolism; production of cold shock protein; synthesis of branched amino acids and branched-chain fatty acids; and sporulation. RNA-seq analysis also suggested that T. tengcongensis initiates cell wall and membrane remodeling processes, flagellar assembly, and sporulation in response to low temperature. Expression profiles of TtecspC and failed attempts to produce a TtecspC knockout strain confirmed the essential role of TteCspC in the cold shock response, and also suggested a role of this protein in survival at optimum growth temperature. Repression of genes encoding ComEA and ComEC and low energy metabolism levels in cold-shocked cells are the likely basis of poor natural competence at low temperature. CONCLUSION: Our study demonstrated changes in global gene expression under cold shock and identified several candidate genes related to cold shock in T. tengcongensis. At the same time, the relationship between cold shock response and poor natural competence at low temperature was preliminarily elucidated. These findings provide a foundation for future studies on genetic

  18. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  19. Expansion of genes encoding piRNA-associated argonaute proteins in the pea aphid: diversification of expression profiles in different plastic morphs.

    Hsiao-Ling Lu

    Full Text Available Piwi-interacting RNAs (piRNAs are known to regulate transposon activity in germ cells of several animal models that propagate sexually. However, the role of piRNAs during asexual reproduction remains almost unknown. Aphids that can alternate sexual and asexual reproduction cycles in response to seasonal changes of photoperiod provide a unique opportunity to study piRNAs and the piRNA pathway in both reproductive modes. Taking advantage of the recently sequenced genome of the pea aphid Acyrthosiphon pisum, we found an unusually large lineage-specific expansion of genes encoding the Piwi sub-clade of Argonaute proteins. In situ hybridisation showed differential expressions between the duplicated piwi copies: while Api-piwi2 and Api-piwi6 are "specialised" in germ cells their most closely related copy, respectively Api-piwi5 and Api-piwi3, are expressed in the somatic cells. The differential expression was also identified in duplicated ago3: Api-ago3a in germ cells and Api-ago3b in somatic cells. Moreover, analyses of expression profiles of the expanded piwi and ago3 genes by semi-quantitative RT-PCR showed that expressions varied according to the reproductive types. These specific expression patterns suggest that expanded aphid piwi and ago3 genes have distinct roles in asexual and sexual reproduction.

  20. Identification of the yeast gene encoding the tRNA m1G methyltransferase responsible for modification at position 9.

    Jackman, Jane E; Montange, Rebecca K; Malik, Harmit S; Phizicky, Eric M

    2003-05-01

    Methylation of tRNA at the N-1 position of guanosine to form m(1)G occurs widely in nature. It occurs at position 37 in tRNAs from all three kingdoms, and the methyltransferase that catalyzes this reaction is known from previous work of others to be critically important for cell growth in Escherichia coli and the yeast Saccharomyces cerevisiae. m(1)G is also widely found at position 9 in eukaryotic tRNAs, but the corresponding methyltransferase was unknown. We have used a biochemical genomics approach with a collection of purified yeast GST-ORF fusion proteins to show that m(1)G(9) formation of yeast tRNA(Gly) is associated with ORF YOL093w, named TRM10. Extracts lacking Trm10p have undetectable levels of m(1)G(9) methyltransferase activity but retain normal m(1)G(37) methyltransferase activity. Yeast Trm10p purified from E. coli quantitatively modifies the G(9) position of tRNA(Gly) in an S-adenosylmethionine-dependent fashion. Trm10p is responsible in vivo for most if not all m(1)G(9) modification of tRNAs, based on two results: tRNA(Gly) purified from a trm10-Delta/trm10-Delta strain is lacking detectable m(1)G; and a primer extension block occurring at m(1)G(9) is removed in trm10-Delta/trm10-Delta-derived tRNAs for all 9 m(1)G(9)-containing species that were testable by this method. There is no obvious growth defect of trm10-Delta/trm10-Delta strains. Trm10p bears no detectable resemblance to the yeast m(1)G(37) methyltransferase, Trm5p, or its orthologs. Trm10p homologs are found widely in eukaryotes and many archaea, with multiple homologs in several metazoans, including at least three in humans.

  1. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  2. Identification of the gene encoding a type 1 RNase H with an N-terminal double-stranded RNA binding domain from a psychrotrophic bacterium.

    Tadokoro, Takashi; Chon, Hyongi; Koga, Yuichi; Takano, Kazufumi; Kanaya, Shigenori

    2007-07-01

    The gene encoding a bacterial type 1 RNase H, termed RBD-RNase HI, was cloned from the psychrotrophic bacterium Shewanella sp. SIB1, overproduced in Escherichia coli, and the recombinant protein was purified and biochemically characterized. SIB1 RBD-RNase HI consists of 262 amino acid residues and shows amino acid sequence identities of 26% to SIB1 RNase HI, 17% to E. coli RNase HI, and 32% to human RNase H1. SIB1 RBD-RNase HI has a double-stranded RNA binding domain (RBD) at the N-terminus, which is commonly present at the N-termini of eukaryotic type 1 RNases H. Gel mobility shift assay indicated that this domain binds to an RNA/DNA hybrid in an isolated form, suggesting that this domain is involved in substrate binding. SIB1 RBD-RNase HI exhibited the enzymatic activity both in vitro and in vivo. Its optimum pH and metal ion requirement were similar to those of SIB1 RNase HI, E. coli RNase HI, and human RNase H1. The specific activity of SIB1 RBD-RNase HI was comparable to that of E. coli RNase HI and was much higher than those of SIB1 RNase HI and human RNase H1. SIB1 RBD-RNase HI showed poor cleavage-site specificity for oligomeric substrates. SIB1 RBD-RNase HI was less stable than E. coli RNase HI but was as stable as human RNase H1. Database searches indicate that several bacteria and archaea contain an RBD-RNase HI. This is the first report on the biochemical characterization of RBD-RNase HI.

  3. MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

    Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

    particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

  4. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  5. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin

    2006-01-01

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

  6. Suppressors of RNA silencing encoded by tomato leaf curl ...

    2013-01-06

    Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

  7. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  8. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)

    2013-10-15

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.

  9. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    Wu, Yongyan; Ai, Zhiying; Yao, Kezhen; Cao, Lixia; Du, Juan; Shi, Xiaoyan; Guo, Zekun; Zhang, Yong

    2013-01-01

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR

  10. The mouse Gtl2 gene is differentially expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA.

    Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A

    1998-06-01

    We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.

  11. CERKL, a retinal disease gene, encodes an mRNA-binding protein that localizes in compact and untranslated mRNPs associated with microtubules.

    Alihamze Fathinajafabadi

    Full Text Available The function of CERKL (CERamide Kinase Like, a causative gene of retinitis pigmentosa and cone-rod dystrophy, still awaits characterization. To approach its cellular role we have investigated the subcellular localization and interaction partners of the full length CERKL isoform, CERKLa of 532 amino acids, in different cell lines, including a photoreceptor-derived cell line. We demonstrate that CERKLa is a main component of compact and untranslated mRNPs and that associates with other RNP complexes such as stress granules, P-bodies and polysomes. CERKLa is a protein that binds through its N-terminus to mRNAs and interacts with other mRNA-binding proteins like eIF3B, PABP, HSP70 and RPS3. Except for eIF3B, these interactions depend on the integrity of mRNAs but not of ribosomes. Interestingly, the C125W CERKLa pathological mutant does not interact with eIF3B and is absent from these complexes. Compact mRNPs containing CERKLa also associate with microtubules and are found in neurites of neural differentiated cells. These localizations had not been reported previously for any member of the retinal disorders gene family and should be considered when investigating the pathogenic mechanisms and therapeutical approaches in these diseases.

  12. Chondroitin sulfate-polyethylenimine copolymer-coated superparamagnetic iron oxide nanoparticles as an efficient magneto-gene carrier for microRNA-encoding plasmid DNA delivery

    Lo, Yu-Lun; Chou, Han-Lin; Liao, Zi-Xian; Huang, Shih-Jer; Ke, Jyun-Han; Liu, Yu-Sheng; Chiu, Chien-Chih; Wang, Li-Fang

    2015-04-01

    MicroRNA-128 (miR-128) is an attractive therapeutic molecule with powerful glioblastoma regulation properties. However, miR-128 lacks biological stability and leads to poor delivery efficacy in clinical applications. In our previous study, we demonstrated two effective transgene carriers, including polyethylenimine (PEI)-decorated superparamagnetic iron oxide nanoparticles (SPIONs) as well as chemically-conjugated chondroitin sulfate-PEI copolymers (CPs). In this contribution, we report optimized conditions for coating CPs onto the surfaces of SPIONs, forming CPIOs, for magneto-gene delivery systems. The optimized weight ratio of the CPs and SPIONs is 2 : 1, which resulted in the formation of a stable particle as a good transgene carrier. The hydrodynamic diameter of the CPIOs is ~136 nm. The gel electrophoresis results demonstrate that the weight ratio of CPIO/DNA required to completely encapsulate pDNA is >=3. The in vitro tests of CPIO/DNA were done in 293 T, CRL5802, and U87-MG cells in the presence and absence of an external magnetic field. The magnetofection efficiency of CPIO/DNA was measured in the three cell lines with or without fetal bovine serum (FBS). CPIO/DNA exhibited remarkably improved gene expression in the presence of the magnetic field and 10% FBS as compared with a gold non-viral standard, PEI/DNA, and a commercial magnetofection reagent, PolyMag/DNA. In addition, CPIO/DNA showed less cytotoxicity than PEI/DNA and PolyMag/DNA against the three cell lines. The transfection efficiency of the magnetoplex improved significantly with an assisted magnetic field. In miR-128 delivery, a microRNA plate array and fluorescence in situ hybridization were used to demonstrate that CPIO/pMIRNA-128 indeed expresses more miR-128 with the assisted magnetic field than without. In a biodistribution test, CPIO/Cy5-DNA showed higher accumulation at the tumor site where an external magnet is placed nearby.MicroRNA-128 (miR-128) is an attractive therapeutic molecule

  13. Darwinian Evolution of Mutualistic RNA Replicators with Different Genes

    Mizuuchi, R.; Ichihashi, N.

    2017-07-01

    We report a sustainable long-term replication and evolution of two distinct cooperative RNA replicators encoding different genes. One of the RNAs evolved to maintain or increase the cooperativity, despite selective advantage of selfish mutations.

  14. MicroRNA-encoding long non-coding RNAs

    Zhu Xiaopeng

    2008-05-01

    Full Text Available Abstract Background Recent analysis of the mouse transcriptional data has revealed the existence of ~34,000 messenger-like non-coding RNAs (ml-ncRNAs. Whereas the functional properties of these ml-ncRNAs are beginning to be unravelled, no functional information is available for the large majority of these transcripts. Results A few ml-ncRNA have been shown to have genomic loci that overlap with microRNA loci, leading us to suspect that a fraction of ml-ncRNA may encode microRNAs. We therefore developed an algorithm (PriMir for specifically detecting potential microRNA-encoding transcripts in the entire set of 34,030 mouse full-length ml-ncRNAs. In combination with mouse-rat sequence conservation, this algorithm detected 97 (80 of them were novel strong miRNA-encoding candidates, and for 52 of these we obtained experimental evidence for the existence of their corresponding mature microRNA by microarray and stem-loop RT-PCR. Sequence analysis of the microRNA-encoding RNAs revealed an internal motif, whose presence correlates strongly (R2 = 0.9, P-value = 2.2 × 10-16 with the occurrence of stem-loops with characteristics of known pre-miRNAs, indicating the presence of a larger number microRNA-encoding RNAs (from 300 up to 800 in the ml-ncRNAs population. Conclusion Our work highlights a unique group of ml-ncRNAs and offers clues to their functions.

  15. Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them

    Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika

    2007-03-13

    The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

  16. The Epstein-Barr virus BILF1 gene encodes a G protein-coupled receptor that inhibits phosphorylation of RNA-dependent protein kinase

    Beisser, P.S.; Verzijl, D.; Gruijthuijsen, Y.K.; Beuken, E.V.; Smit, M.J.; Leurs, R.; Bruggeman, C.A.; Vink, C.

    2005-01-01

    Epstein-Barr vires (EBV) infection is associated with many lymphoproliferative diseases, such as infectious mononucleosis and Burkitt's lymphoma. Consequently, EBV is one of the most extensively studied herpesvirases. Surprisingly, a putative G protein-coupled receptor (GPCR) gene of EBV, BILF1, has

  17. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Monika Stimac

    Full Text Available Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET (TS plasmid, in comparison to the plasmid with constitutive promoter (CON plasmid, in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  18. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Stimac, Monika; Dolinsek, Tanja; Lampreht, Ursa; Cemazar, Maja; Sersa, Gregor

    2015-01-01

    Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β) co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET) (TS plasmid), in comparison to the plasmid with constitutive promoter (CON plasmid), in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET) of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  19. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  20. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  1. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  2. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  3. A human torque teno virus encodes a microRNA that inhibits interferon signaling.

    Rodney P Kincaid

    Full Text Available Torque teno viruses (TTVs are a group of viruses with small, circular DNA genomes. Members of this family are thought to ubiquitously infect humans, although causal disease associations are currently lacking. At present, there is no understanding of how infection with this diverse group of viruses is so prevalent. Using a combined computational and synthetic approach, we predict and identify miRNA-coding regions in diverse human TTVs and provide evidence for TTV miRNA production in vivo. The TTV miRNAs are transcribed by RNA polymerase II, processed by Drosha and Dicer, and are active in RISC. A TTV mutant defective for miRNA production replicates as well as wild type virus genome; demonstrating that the TTV miRNA is dispensable for genome replication in a cell culture model. We demonstrate that a recombinant TTV genome is capable of expressing an exogenous miRNA, indicating the potential utility of TTV as a small RNA vector. Gene expression profiling of host cells identifies N-myc (and STAT interactor (NMI as a target of a TTV miRNA. NMI transcripts are directly regulated through a binding site in the 3'UTR. SiRNA knockdown of NMI contributes to a decreased response to interferon signaling. Consistent with this, we show that a TTV miRNA mediates a decreased response to IFN and increased cellular proliferation in the presence of IFN. Thus, we add Annelloviridae to the growing list of virus families that encode miRNAs, and suggest that miRNA-mediated immune evasion can contribute to the pervasiveness associated with some of these viruses.

  4. Extreme expansion of NBS-encoding genes in Rosaceae.

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  5. Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

    L.M. 't Hart (Leen); H.A.P. Pols (Huib); T. Hansen (Torben); I. Rietveld (Ingrid); J.M. Dekker (Jacqueline); J.A. Maassen (Johannes); M.G.A.A.M. Nijpels (Giel); G.M.C. Janssen (George); P.P. Arp (Pascal); R.J. Heine (Robert); A.G. Uitterlinden (André); T. Jorgensen (Torben); C.M. van Duijn (Cornelia); K. Borch-Johnsen; O. Pedersen (Oluf)

    2005-01-01

    textabstractPreviously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA

  6. BIOLOGICAL FUNCTION OF TOMBUSVIRUS-ENCODED SUPPRESSOR OF RNA SILENCING IN PLANTS

    Omarov R.T.

    2012-08-01

    Full Text Available RNA interference (RNAi plays multiple biological roles in eukaryotic organisms to regulate gene expression. RNAi also operates as a conserved adaptive molecular immune mechanism against invading viruses. The antiviral RNAi pathway is initiated with the generation of virus-derived short-interfering RNAs (siRNAs that are used for subsequent sequence-specific recognition and degradation of the cognate viral RNA molecules. As an efficient counter-defensive strategy, most plant viruses evolved the ability to encode specific proteins capable of interfering with RNAi, and this process is commonly known as RNA silencing suppression. Virus-encoded suppressors of RNAi (VSRs operate at different steps in the RNAi pathway and display distinct biochemical properties that enable these proteins to efficiently interfere with the host-defense system. Tombusvirus-encoded P19 is an important pathogenicity factor, required for symptom development and elicitation of a hypersensitive response in a host-dependent manner. Protein plays a crucial role of TBSV P19 in protecting viral RNA during systemic infection on Nicotiana benthamiana. The X-ray crystallographic studies conducted by two independent groups revealed the existence of a P19-siRNA complex; a conformation whereby caliper tryptophan residues on two subunits of P19 dimers measure and bind 21-nt siRNA duplexes. These structural studies provided the first details on the possible molecular mechanism of any viral suppressor to block RNAi. The association between P19 and siRNAs was also shown to occur in infected plants These and related studies revealed that in general the ability of P19 to efficiently sequester siRNAs influences symptom severity, however this is not a strict correlation in all hosts.The current working model is that during TBSV infection of plants, P19 appropriates abundantly circulating Tombusvirus-derived siRNAs thereby rendering these unavailable to program RISC, to prevent degradation of

  7. dPORE-miRNA: Polymorphic regulation of microRNA genes

    Schmeier, Sebastian

    2011-02-04

    Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

  8. dPORE-miRNA: Polymorphic regulation of microRNA genes

    Schmeier, Sebastian; Schaefer, Ulf; MacPherson, Cameron R.; Bajic, Vladimir B.

    2011-01-01

    Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

  9. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  10. Cloning, expression and characterisation of a novel gene encoding ...

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  11. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents ...

  12. Cowpea mosaic virus RNA-1 acts as an amplicon whose effects can be counteracted by a RNA-2-encoded suppressor of silencing

    Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.

    2004-01-01

    Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS

  13. pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A Sequences

    Alexandra E Grier

    2016-01-01

    Full Text Available Increasing demand for large-scale synthesis of in vitro transcribed (IVT mRNA is being driven by the increasing use of mRNA for transient gene expression in cell engineering and therapeutic applications. An important determinant of IVT mRNA potency is the 3′ polyadenosine (poly(A tail, the length of which correlates with translational efficiency. However, present methods for generation of IVT mRNA rely on templates derived from circular plasmids or PCR products, in which homopolymeric tracts are unstable, thus limiting encoded poly(A tail lengths to ≃120 base pairs (bp. Here, we have developed a novel method for generation of extended poly(A tracts using a previously described linear plasmid system, pJazz. We find that linear plasmids can successfully propagate poly(A tracts up to ≃500 bp in length for IVT mRNA production. We then modified pJazz by removing extraneous restriction sites, adding a T7 promoter sequence upstream from an extended multiple cloning site, and adding a unique type-IIS restriction site downstream from the encoded poly(A tract to facilitate generation of IVT mRNA with precisely defined encoded poly(A tracts and 3′ termini. The resulting plasmid, designated pEVL, can be used to generate IVT mRNA with consistent defined lengths and terminal residue(s.

  14. The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.

    Fujii, Yoichi Robertus

    2013-01-01

    MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.

  15. Transcription Profiling of Bacillus subtilis Cells Infected with AR9, a Giant Phage Encoding Two Multisubunit RNA Polymerases.

    Lavysh, Daria; Sokolova, Maria; Slashcheva, Marina; Förstner, Konrad U; Severinov, Konstantin

    2017-02-14

    Bacteriophage AR9 is a recently sequenced jumbo phage that encodes two multisubunit RNA polymerases. Here we investigated the AR9 transcription strategy and the effect of AR9 infection on the transcription of its host, Bacillus subtilis Analysis of whole-genome transcription revealed early, late, and continuously expressed AR9 genes. Alignment of sequences upstream of the 5' ends of AR9 transcripts revealed consensus sequences that define early and late phage promoters. Continuously expressed AR9 genes have both early and late promoters in front of them. Early AR9 transcription is independent of protein synthesis and must be determined by virion RNA polymerase injected together with viral DNA. During infection, the overall amount of host mRNAs is significantly decreased. Analysis of relative amounts of host transcripts revealed notable differences in the levels of some mRNAs. The physiological significance of up- or downregulation of host genes for AR9 phage infection remains to be established. AR9 infection is significantly affected by rifampin, an inhibitor of host RNA polymerase transcription. The effect is likely caused by the antibiotic-induced killing of host cells, while phage genome transcription is solely performed by viral RNA polymerases. IMPORTANCE Phages regulate the timing of the expression of their own genes to coordinate processes in the infected cell and maximize the release of viral progeny. Phages also alter the levels of host transcripts. Here we present the results of a temporal analysis of the host and viral transcriptomes of Bacillus subtilis infected with a giant phage, AR9. We identify viral promoters recognized by two virus-encoded RNA polymerases that are a unique feature of the phiKZ-related group of phages to which AR9 belongs. Our results set the stage for future analyses of highly unusual RNA polymerases encoded by AR9 and other phiKZ-related phages. Copyright © 2017 Lavysh et al.

  16. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  17. HIV-1 nef suppression by virally encoded microRNA

    Brisibe Ebiamadon

    2004-12-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are 21~25-nucleotides (nt long and interact with mRNAs to trigger either translational repression or RNA cleavage through RNA interference (RNAi, depending on the degree of complementarity with the target mRNAs. Our recent study has shown that HIV-1 nef dsRNA from AIDS patients who are long-term non-progressors (LTNPs inhibited the transcription of HIV-1. Results Here, we show the possibility that nef-derived miRNAs are produced in HIV-1 persistently infected cells. Furthermore, nef short hairpin RNA (shRNA that corresponded to a predicted nef miRNA (~25 nt, miR-N367 can block HIV-1 Nef expression in vitro and the suppression by shRNA/miR-N367 would be related with low viremia in an LTNP (15-2-2. In the 15-2-2 model mice, the weight loss, which may be rendered by nef was also inhibited by shRNA/miR-N367 corresponding to suppression of nef expression in vivo. Conclusions These data suggest that nef/U3 miRNAs produced in HIV-1-infected cells may suppress both Nef function and HIV-1 virulence through the RNAi pathway.

  18. Horse cDNA clones encoding two MHC class I genes

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  19. A deep auto-encoder model for gene expression prediction.

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  20. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  1. Transcriptional modulation of genes encoding nitrate reductase in ...

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  2. Identification and characterization of a gene encoding a putative ...

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  3. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  4. Roles of Prolyl Isomerases in RNA-Mediated Gene Expression

    Roopa Thapar

    2015-05-01

    Full Text Available The peptidyl-prolyl cis-trans isomerases (PPIases that include immunophilins (cyclophilins and FKBPs and parvulins (Pin1, Par14, Par17 participate in cell signaling, transcription, pre-mRNA processing and mRNA decay. The human genome encodes 19 cyclophilins, 18 FKBPs and three parvulins. Immunophilins are receptors for the immunosuppressive drugs cyclosporin A, FK506, and rapamycin that are used in organ transplantation. Pin1 has also been targeted in the treatment of Alzheimer’s disease, asthma, and a number of cancers. While these PPIases are characterized as molecular chaperones, they also act in a nonchaperone manner to promote protein-protein interactions using surfaces outside their active sites. The immunosuppressive drugs act by a gain-of-function mechanism by promoting protein-protein interactions in vivo. Several immunophilins have been identified as components of the spliceosome and are essential for alternative splicing. Pin1 plays roles in transcription and RNA processing by catalyzing conformational changes in the RNA Pol II C-terminal domain. Pin1 also binds several RNA binding proteins such as AUF1, KSRP, HuR, and SLBP that regulate mRNA decay by remodeling mRNP complexes. The functions of ribonucleoprotein associated PPIases are largely unknown. This review highlights PPIases that play roles in RNA-mediated gene expression, providing insight into their structures, functions and mechanisms of action in mRNP remodeling in vivo.

  5. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  6. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  7. Fungicidal activity of peptides encoded by immunoglobulin genes

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  8. Chimeras taking shape: Potential functions of proteins encoded by chimeric RNA transcripts

    Frenkel-Morgenstern, Milana; Lacroix, Vincent; Ezkurdia, Iakes; Levin, Yishai; Gabashvili, Alexandra; Prilusky, Jaime; del Pozo, Angela; Tress, Michael; Johnson, Rory; Guigo, Roderic; Valencia, Alfonso

    2012-01-01

    Chimeric RNAs comprise exons from two or more different genes and have the potential to encode novel proteins that alter cellular phenotypes. To date, numerous putative chimeric transcripts have been identified among the ESTs isolated from several organisms and using high throughput RNA sequencing. The few corresponding protein products that have been characterized mostly result from chromosomal translocations and are associated with cancer. Here, we systematically establish that some of the putative chimeric transcripts are genuinely expressed in human cells. Using high throughput RNA sequencing, mass spectrometry experimental data, and functional annotation, we studied 7424 putative human chimeric RNAs. We confirmed the expression of 175 chimeric RNAs in 16 human tissues, with an abundance varying from 0.06 to 17 RPKM (Reads Per Kilobase per Million mapped reads). We show that these chimeric RNAs are significantly more tissue-specific than non-chimeric transcripts. Moreover, we present evidence that chimeras tend to incorporate highly expressed genes. Despite the low expression level of most chimeric RNAs, we show that 12 novel chimeras are translated into proteins detectable in multiple shotgun mass spectrometry experiments. Furthermore, we confirm the expression of three novel chimeric proteins using targeted mass spectrometry. Finally, based on our functional annotation of exon organization and preserved domains, we discuss the potential features of chimeric proteins with illustrative examples and suggest that chimeras significantly exploit signal peptides and transmembrane domains, which can alter the cellular localization of cognate proteins. Taken together, these findings establish that some chimeric RNAs are translated into potentially functional proteins in humans. PMID:22588898

  9. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  10. Use of bacterially expressed dsRNA to downregulate Entamoeba histolytica gene expression.

    Carlos F Solis

    Full Text Available BACKGROUND: Modern RNA interference (RNAi methodologies using small interfering RNA (siRNA oligonucleotide duplexes or episomally synthesized hairpin RNA are valuable tools for the analysis of gene function in the protozoan parasite Entamoeba histolytica. However, these approaches still require time-consuming procedures including transfection and drug selection, or costly synthetic molecules. PRINCIPAL FINDINGS: Here we report an efficient and handy alternative for E. histolytica gene down-regulation mediated by bacterial double-stranded RNA (dsRNA targeting parasite genes. The Escherichia coli strain HT115 which is unable to degrade dsRNA, was genetically engineered to produce high quantities of long dsRNA segments targeting the genes that encode E. histolytica beta-tubulin and virulence factor KERP1. Trophozoites cultured in vitro were directly fed with dsRNA-expressing bacteria or soaked with purified dsRNA. Both dsRNA delivery methods resulted in significant reduction of protein expression. In vitro host cell-parasite assays showed that efficient downregulation of kerp1 gene expression mediated by bacterial dsRNA resulted in significant reduction of parasite adhesion and lytic capabilities, thus supporting a major role for KERP1 in the pathogenic process. Furthermore, treatment of trophozoites cultured in microtiter plates, with a repertoire of eighty-five distinct bacterial dsRNA segments targeting E. histolytica genes with unknown function, led to the identification of three genes potentially involved in the growth of the parasite. CONCLUSIONS: Our results showed that the use of bacterial dsRNA is a powerful method for the study of gene function in E. histolytica. This dsRNA delivery method is also technically suitable for the study of a large number of genes, thus opening interesting perspectives for the identification of novel drug and vaccine targets.

  11. Concerted evolution of the tandemly repeated genes encoding primate U2 small nuclear RNA (the RNU2 locus) does not prevent rapid diversification of the (CT){sub n} {center_dot} (GA){sub n} microsatellite embedded within the U2 repeat unit

    Liao, D.; Weiner, A.M. [Yale Univ., New Haven, CT (United States)

    1995-12-10

    The RNU2 locus encoding human U2 small nuclear RNA (snRNA) is organized as a nearly perfect tandem array containing 5 to 22 copies of a 5.8-kb repeat unit. Just downstream of the U2 snRNA gene in each 5.8-kb repeat unit lies a large (CT){sub n}{center_dot}(GA){sub n} dinucleotide repeat (n {approx} 70). This form of genomic organization, in which one repeat is embedded within another, provides an unusual opportunity to study the balance of forces maintaining the homogeneity of both kinds of repeats. Using a combination of field inversion gel electrophoresis and polymerase chain reaction, we have been able to study the CT microsatellites within individual U2 tandem arrays. We find that the CT microsatellites within an RNU2 allele exhibit significant length polymorphism, despite the remarkable homogeneity of the surrounding U2 repeat units. Length polymorphism is due primarily to loss or gain of CT dinucleotide repeats, but other types of deletions, insertions, and substitutions are also frequent. Polymorphism is greatly reduced in regions where pure (CT){sub n} tracts are interrupted by occasional G residues, suggesting that irregularities stabilize both the length and the sequence of the dinucleotide repeat. We further show that the RNU2 loci of other catarrhine primates (gorilla, chimpanzee, ogangutan, and baboon) contain orthologous CT microsatellites; these also exhibit length polymorphism, but are highly divergent from each other. Thus, although the CT microsatellite is evolving far more rapidly than the rest of the U2 repeat unit, it has persisted through multiple speciation events spanning >35 Myr. The persistence of the CT microsatellite, despite polymorphism and rapid evolution, suggests that it might play a functional role in concerted evolution of the RNU2 loci, perhaps as an initiation site for recombination and/or gene conversion. 70 refs., 5 figs.

  12. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  13. Extreme heterogeneity of polyadenylation sites in mRNAs encoding chloroplast RNA-binding proteins in Nicotiana plumbaginifolia.

    Klahre, U; Hemmings-Mieszczak, M; Filipowicz, W

    1995-06-01

    We have previously characterized nuclear cDNA clones encoding two RNA binding proteins, CP-RBP30 and CP-RBP-31, which are targeted to chloroplasts in Nicotiana plumbaginifolia. In this report we describe the analysis of the 3'-untranslated regions (3'-UTRs) in 22 CP-RBP30 and 8 CP-RBP31 clones which reveals that mRNAs encoding both proteins have a very complex polyadenylation pattern. Fourteen distinct poly(A) sites were identified among CP-RBP30 clones and four sites among the CP-RBP31 clones. The authenticity of the sites was confirmed by RNase A/T1 mapping of N. plumbaginifolia RNA. CP-RBP30 provides an extreme example of the heterogeneity known to be a feature of mRNA polyadenylation in higher plants. Using PCR we have demonstrated that CP-RBP genes in N. plumbaginifolia and N. sylvestris, in addition to the previously described introns interrupting the coding region, contain an intron located in the 3' non-coding part of the gene. In the case of the CP-RBP31, we have identified one polyadenylation event occurring in this intron.

  14. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

    2013-12-01

    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  15. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  16. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  17. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  18. A deep learning method for lincRNA detection using auto-encoder algorithm.

    Yu, Ning; Yu, Zeng; Pan, Yi

    2017-12-06

    RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly

  19. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  20. Influenza polymerase encoding mRNAs utilize atypical mRNA nuclear export.

    Larsen, Sean; Bui, Steven; Perez, Veronica; Mohammad, Adeba; Medina-Ramirez, Hilario; Newcomb, Laura L

    2014-08-28

    Influenza is a segmented negative strand RNA virus. Each RNA segment is encapsulated by influenza nucleoprotein and bound by the viral RNA dependent RNA polymerase (RdRP) to form viral ribonucleoproteins responsible for RNA synthesis in the nucleus of the host cell. Influenza transcription results in spliced mRNAs (M2 and NS2), intron-containing mRNAs (M1 and NS1), and intron-less mRNAs (HA, NA, NP, PB1, PB2, and PA), all of which undergo nuclear export into the cytoplasm for translation. Most cellular mRNA nuclear export is Nxf1-mediated, while select mRNAs utilize Crm1. Here we inhibited Nxf1 and Crm1 nuclear export prior to infection with influenza A/Udorn/307/1972(H3N2) virus and analyzed influenza intron-less mRNAs using cellular fractionation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR). We examined direct interaction between Nxf1 and influenza intron-less mRNAs using immuno purification of Nxf1 and RT-PCR of associated RNA. Inhibition of Nxf1 resulted in less influenza intron-less mRNA export into the cytoplasm for HA and NA influenza mRNAs in both human embryonic kidney cell line (293 T) and human lung adenocarcinoma epithelial cell line (A549). However, in 293 T cells no change was observed for mRNAs encoding the components of the viral ribonucleoproteins; NP, PA, PB1, and PB2, while in A549 cells, only PA, PB1, and PB2 mRNAs, encoding the RdRP, remained unaffected; NP mRNA was reduced in the cytoplasm. In A549 cells NP, NA, HA, mRNAs were found associated with Nxf1 but PA, PB1, and PB2 mRNAs were not. Crm1 inhibition also resulted in no significant difference in PA, PB1, and PB2 mRNA nuclear export. These results further confirm Nxf1-mediated nuclear export is functional during the influenza life cycle and hijacked for select influenza mRNA nuclear export. We reveal a cell type difference for Nxf1-mediated nuclear export of influenza NP mRNA, a reminder that cell type can influence molecular mechanisms. Importantly, we

  1. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

    Stern David B

    2010-09-01

    Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  2. Critical role of the virus-encoded microRNA-155 ortholog in the induction of Marek's disease lymphomas.

    Yuguang Zhao

    2011-02-01

    Full Text Available Notwithstanding the well-characterised roles of a number of oncogenes in neoplastic transformation, microRNAs (miRNAs are increasingly implicated in several human cancers. Discovery of miRNAs in several oncogenic herpesviruses such as KSHV has further highlighted the potential of virus-encoded miRNAs to contribute to their oncogenic capabilities. Nevertheless, despite the identification of several possible cancer-related genes as their targets, the direct in vivo role of virus-encoded miRNAs in neoplastic diseases such as those induced by KSHV is difficult to demonstrate in the absence of suitable models. However, excellent natural disease models of rapid-onset Marek's disease (MD lymphomas in chickens allow examination of the oncogenic potential of virus-encoded miRNAs. Using viruses modified by reverse genetics of the infectious BAC clone of the oncogenic RB-1B strain of MDV, we show that the deletion of the six-miRNA cluster 1 from the viral genome abolished the oncogenicity of the virus. This loss of oncogenicity appeared to be primarily due to the single miRNA within the cluster, miR-M4, the ortholog of cellular miR-155, since its deletion or a 2-nucleotide mutation within its seed region was sufficient to inhibit the induction of lymphomas. The definitive role of this miR-155 ortholog in oncogenicity was further confirmed by the rescue of oncogenic phenotype by revertant viruses that expressed either the miR-M4 or the cellular homolog gga-miR-155. This is the first demonstration of the direct in vivo role of a virus-encoded miRNA in inducing tumors in a natural infection model. Furthermore, the use of viruses deleted in miRNAs as effective vaccines against virulent MDV challenge, enables the prospects of generating genetically defined attenuated vaccines.

  3. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

    Fangquan Wang

    2016-05-01

    Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  4. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

    Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

    2016-05-11

    Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  5. Species-independent MicroRNA Gene Discovery

    Kamanu, Timothy K.

    2012-12-01

    MicroRNA (miRNA) are a class of small endogenous non-coding RNA that are mainly negative transcriptional and post-transcriptional regulators in both plants and animals. Recent studies have shown that miRNA are involved in different types of cancer and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. miRNA genes are classified into different groups (miRNA families). This study reports about 19,000 unknown miRNA genes in nine species whereby approximately 15,300 predictions were computationally validated to contain at least one experimentally verified functional miRNA product. The predictions are based on a novel computational strategy which relies on miRNA family groupings and exploits the physics and geometry of miRNA genes to unveil the hidden palindromic signals and symmetries in miRNA gene sequences. Unlike conventional computational miRNA gene discovery methods, the algorithm developed here is species-independent: it allows prediction at higher accuracy and resolution from arbitrary RNA/DNA sequences in any species and thus enables examination of repeat-prone genomic regions which are thought to be non-informative or ’junk’ sequences. The information non-redundancy of uni-directional RNA sequences compared to information redundancy of bi-directional DNA is demonstrated, a fact that is overlooked by most pattern discovery algorithms. A novel method for computing upstream and downstream miRNA gene boundaries based on mathematical/statistical functions is suggested, as well as cutoffs for annotation of miRNA genes in different miRNA families. Another tool is proposed to allow hypotheses generation and visualization of data matrices, intra- and inter-species chromosomal distribution of miRNA genes or miRNA families. Our results indicate that: miRNA and miRNA

  6. Rift Valley fever virus NSS gene expression correlates with a defect in nuclear mRNA export.

    Copeland, Anna Maria; Van Deusen, Nicole M; Schmaljohn, Connie S

    2015-12-01

    We investigated the localization of host mRNA during Rift Valley fever virus (RVFV) infection. Fluorescence in situ hybridization revealed that infection with RVFV altered the localization of host mRNA. mRNA accumulated in the nuclei of RVFV-infected but not mock-infected cells. Further, overexpression of the NSS gene, but not the N, GN or NSM genes correlated with mRNA nuclear accumulation. Nuclear accumulation of host mRNA was not observed in cells infected with a strain of RVFV lacking the gene encoding NSS, confirming that expression of NSS is likely responsible for this phenomenon. Published by Elsevier Inc.

  7. Genome wide identification of cotton (Gossypium hirsutum)-encoded microRNA targets against Cotton leaf curl Burewala virus.

    Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad

    2018-01-05

    Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  9. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  10. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  11. Organization and transient expression of the gene for human U11 snRNA

    Clemens, Suter-Crazzolara; Walter, Keller

    1991-01-01

    The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214

  12. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  13. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  14. RNA amplification for successful gene profiling analysis

    Wang Ena

    2005-07-01

    Full Text Available Abstract The study of clinical samples is often limited by the amount of material available to study. While proteins cannot be multiplied in their natural form, DNA and RNA can be amplified from small specimens and used for high-throughput analyses. Therefore, genetic studies offer the best opportunity to screen for novel insights of human pathology when little material is available. Precise estimates of DNA copy numbers in a given specimen are necessary. However, most studies investigate static variables such as the genetic background of patients or mutations within pathological specimens without a need to assess proportionality of expression among different genes throughout the genome. Comparative genomic hybridization of DNA samples represents a crude exception to this rule since genomic amplification or deletion is compared among different specimens directly. For gene expression analysis, however, it is critical to accurately estimate the proportional expression of distinct RNA transcripts since such proportions directly govern cell function by modulating protein expression. Furthermore, comparative estimates of relative RNA expression at different time points portray the response of cells to environmental stimuli, indirectly informing about broader biological events affecting a particular tissue in physiological or pathological conditions. This cognitive reaction of cells is similar to the detection of electroencephalographic patterns which inform about the status of the brain in response to external stimuli. As our need to understand human pathophysiology at the global level increases, the development and refinement of technologies for high fidelity messenger RNA amplification have become the focus of increasing interest during the past decade. The need to increase the abundance of RNA has been met not only for gene specific amplification, but, most importantly for global transcriptome wide, unbiased amplification. Now gene

  15. mRNA expression of genes regulating lipid metabolism in ringed seals (Pusa hispida) from differently polluted areas

    Castelli, Martina Galatea; Rusten, Marte; Goksøyr, Anders; Routti, Heli

    2014-01-01

    Highlights: •Genes regulating lipid metabolism were studied in ringed seals. •We compared highly contaminated Baltic seals and less contaminated Svalbard seals. •mRNA expression of hepatic PPARγ was higher in the Baltic seals. •mRNA expression of adipose PPARγ target genes was higher in the Baltic seals. •Contaminant exposure may affect lipid metabolism in the Baltic ringed seals. -- Abstract: There is a growing concern about the ability of persistent organic pollutants (POPs) to influence lipid metabolism. Although POPs are found at high concentrations in some populations of marine mammals, for example in the ringed seal (Pusa hispida) from the Baltic Sea, little is known about the effects of POPs on their lipid metabolism. An optimal regulation of lipid metabolism is crucial for ringed seals during the fasting/molting season. This is a physiologically stressful period, during which they rely on the energy stored in their fat reserves. The mRNA expression levels for seven genes involved in lipid metabolism were analyzed in liver and/or blubber tissue from molting ringed seals from the polluted Baltic Sea and a less polluted reference location, Svalbard (Norway). mRNA expression of genes encoding peroxisome proliferator-activated receptors (PPAR) α and γ and their target genes acyl-coenzyme A oxidase 1 (ACOX1) and cluster of differentiation 36 (CD36) were analyzed in liver. mRNA expression level of genes encoding PPARβ, PPARγ and their target genes encoding fatty acid binding protein 4 (FABP4) and adiponectin (ADIPOQ) were measured in inner and middle blubber layers. In addition, we evaluated the influence of molting status on hepatic mRNA expression of genes encoding PPARs and their target genes in ringed seals from Svalbard. Our results show higher mRNA expression of genes encoding hepatic PPARγ and adipose PPARβ, FABP4, and ADIPOQ in the Baltic seals compared to the Svalbard seals. A positive relationship between mRNA expressions of genes

  16. mRNA expression of genes regulating lipid metabolism in ringed seals (Pusa hispida) from differently polluted areas

    Castelli, Martina Galatea [Norwegian Polar Institute, Fram Centre, 9296 Tromsø (Norway); University of Bergen, Department of Biology, 5020 Bergen (Norway); Rusten, Marte; Goksøyr, Anders [University of Bergen, Department of Biology, 5020 Bergen (Norway); Routti, Heli, E-mail: heli.routti@npolar.no [Norwegian Polar Institute, Fram Centre, 9296 Tromsø (Norway)

    2014-01-15

    Highlights: •Genes regulating lipid metabolism were studied in ringed seals. •We compared highly contaminated Baltic seals and less contaminated Svalbard seals. •mRNA expression of hepatic PPARγ was higher in the Baltic seals. •mRNA expression of adipose PPARγ target genes was higher in the Baltic seals. •Contaminant exposure may affect lipid metabolism in the Baltic ringed seals. -- Abstract: There is a growing concern about the ability of persistent organic pollutants (POPs) to influence lipid metabolism. Although POPs are found at high concentrations in some populations of marine mammals, for example in the ringed seal (Pusa hispida) from the Baltic Sea, little is known about the effects of POPs on their lipid metabolism. An optimal regulation of lipid metabolism is crucial for ringed seals during the fasting/molting season. This is a physiologically stressful period, during which they rely on the energy stored in their fat reserves. The mRNA expression levels for seven genes involved in lipid metabolism were analyzed in liver and/or blubber tissue from molting ringed seals from the polluted Baltic Sea and a less polluted reference location, Svalbard (Norway). mRNA expression of genes encoding peroxisome proliferator-activated receptors (PPAR) α and γ and their target genes acyl-coenzyme A oxidase 1 (ACOX1) and cluster of differentiation 36 (CD36) were analyzed in liver. mRNA expression level of genes encoding PPARβ, PPARγ and their target genes encoding fatty acid binding protein 4 (FABP4) and adiponectin (ADIPOQ) were measured in inner and middle blubber layers. In addition, we evaluated the influence of molting status on hepatic mRNA expression of genes encoding PPARs and their target genes in ringed seals from Svalbard. Our results show higher mRNA expression of genes encoding hepatic PPARγ and adipose PPARβ, FABP4, and ADIPOQ in the Baltic seals compared to the Svalbard seals. A positive relationship between mRNA expressions of genes

  17. A Simple Laboratory Practical to Illustrate RNA Mediated Gene Interference Using Drosophila Cell Culture

    Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak

    2010-01-01

    RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…

  18. Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

    Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

    1993-01-01

    CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

  19. RNA-seq reveals more consistent reference genes for gene expression studies in human non-melanoma skin cancers

    Van L.T. Hoang

    2017-08-01

    Full Text Available Identification of appropriate reference genes (RGs is critical to accurate data interpretation in quantitative real-time PCR (qPCR experiments. In this study, we have utilised next generation RNA sequencing (RNA-seq to analyse the transcriptome of a panel of non-melanoma skin cancer lesions, identifying genes that are consistently expressed across all samples. Genes encoding ribosomal proteins were amongst the most stable in this dataset. Validation of this RNA-seq data was examined using qPCR to confirm the suitability of a set of highly stable genes for use as qPCR RGs. These genes will provide a valuable resource for the normalisation of qPCR data for the analysis of non-melanoma skin cancer.

  20. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  1. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  2. Maternally expressed gene 3, an imprinted noncoding RNA gene, is associated with meningioma pathogenesis and progression.

    Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N; Klibanski, Anne

    2010-03-15

    Meningiomas are common tumors, representing 15% to 25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. The chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore, it has been proposed that an as yet unidentified tumor suppressor is present at this locus. Maternally expressed gene 3 (MEG3) is an imprinted gene located at 14q32 which encodes a noncoding RNA with an antiproliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in bromodeoxyuridine incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a noncoding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism.

  3. Diversity of 23S rRNA genes within individual prokaryotic genomes.

    Anna Pei

    Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

  4. Functional characterization of the proteolytic activity of the tomato black ring nepovirus RNA-1-encoded polyprotein.

    Hemmer, O; Greif, C; Dufourcq, P; Reinbolt, J; Fritsch, C

    1995-01-10

    Translation of tomato black ring virus (TBRV) RNA-1 in a rabbit reticulocyte lysate leads to the synthesis of a 250K polyprotein which cleaves itself into smaller proteins of 50, 60, 120, and 190K. Polypeptides synthesized from synthetic transcripts corresponding to different regions of TBRV RNA-1 are processed only when they encode the 23K protein delimited earlier by sequence homology with the cowpea mosaic virus 24K protease. The proteolytic activity of this protein is completely lost by mutating residues C170 (to I) or L188 (to H), residues which align with conserved residues of the viral serine-like proteases. The 120K protein is generated by cleavage of the dipeptide K/A localized in front of the VPg but is not further cleaved in vitro at the K/S site (at the C terminus of the VPg) or between the protease and polymerase domains. However, both the protein VPgProPol (120K) and the protein ProPol (117K) produced in vitro from synthetic transcripts can cleave in trans the RNA-2-encoded 150K polyprotein, but they cannot cleave in trans polypeptides containing a cleavage site expressed from RNA-1 transcripts in which the protease cistron is absent or modified.

  5. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  6. Drosha regulates gene expression independently of RNA cleavage function

    Gromak, Natalia; Dienstbier, Martin; Macias, Sara

    2013-01-01

    Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-dependent manner. This binding is not associated with miRNA production or RNA cleavage. Drosha knockdown in HeLa cells downregulated nascent gene transcription, resulting in a reduction of polyadenylated mRNA produced from these gene regions. Furthermore, we show that this function of Drosha is dependent on its N......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....

  7. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  8. A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.

    Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L

    2017-07-15

    Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.

  9. Valyl-tRNA synthetase gene of Escherichia coli K12: Molecular genetic characterization and homology within a family of aminoacyl-tRNA synthetases

    Heck, J.D. III.

    1988-01-01

    This work reports the subcloning and characterization of the molecular elements necessary for the expression of the Escherichia coli valS gene encoding valyl-tRNA synthetase. The valS gene was subcloned from plasmid pLC26-22 by genetic complementation of a valS ts strain. The DNA region encoding the valS structural gene was determined by in vitro coupled transcription-translation assays. Cells transformed with a plasmid containing a full length copy of the valS gene enhanced in vivo valyl-tRNA synthetase specific activity twelve-fold. DNA sequences flanking the valS structural gene are presented. The transcription initiation sites of the valS gene were determined, in vivo and in vitro, by S1 nuclease protection studies, primer-extension analysis and both [α- 32 P]labeled and [γ- 32 P]end-labeled in vitro transcription assays. The DNA sequence of the valS gene of Escherichia coli has been determined. Significant similarity at the primary sequence level was detected between valyl-tRNA synthetase of E. coli and other known branched-chain aminoacyl-tRNA synthetases. An extended open reading frame (ORF) encoded on the DNA strand opposite the valS structural gene is described

  10. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

  11. Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes.

    Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Qiu, Shuqing; Rollins, Meaghen; Datla, Raju; Gupta, Vidya S; Kadoo, Narendra Y

    2013-04-01

    MicroRNAs (miRNAs) are small (20-24 nucleotide long) endogenous regulatory RNAs that play important roles in plant growth and development. They regulate gene expression at the post-transcriptional level by translational repression or target degradation and gene silencing. In this study, we identified 116 conserved miRNAs belonging to 23 families from the flax (Linum usitatissimum L.) genome using a computational approach. The precursor miRNAs varied in length; while most of the mature miRNAs were 21 nucleotide long, intergenic and showed conserved signatures of RNA polymerase II transcripts in their upstream regions. Promoter region analysis of the flax miRNA genes indicated prevalence of MYB transcription factor binding sites. Four miRNA gene clusters containing members of three phylogenetic groups were identified. Further, 142 target genes were predicted for these miRNAs and most of these represent transcriptional regulators. The miRNA encoding genes were expressed in diverse tissues as determined by digital expression analysis as well as real-time PCR. The expression of fourteen miRNAs and nine target genes was independently validated using the quantitative reverse transcription PCR (qRT-PCR). This study suggests that a large number of conserved plant miRNAs are also found in flax and these may play important roles in growth and development of flax.

  12. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  13. Methylation of miRNA genes and oncogenesis.

    Loginov, V I; Rykov, S V; Fridman, M V; Braga, E A

    2015-02-01

    Interaction between microRNA (miRNA) and messenger RNA of target genes at the posttranscriptional level provides fine-tuned dynamic regulation of cell signaling pathways. Each miRNA can be involved in regulating hundreds of protein-coding genes, and, conversely, a number of different miRNAs usually target a structural gene. Epigenetic gene inactivation associated with methylation of promoter CpG-islands is common to both protein-coding genes and miRNA genes. Here, data on functions of miRNAs in development of tumor-cell phenotype are reviewed. Genomic organization of promoter CpG-islands of the miRNA genes located in inter- and intragenic areas is discussed. The literature and our own results on frequency of CpG-island methylation in miRNA genes from tumors are summarized, and data regarding a link between such modification and changed activity of miRNA genes and, consequently, protein-coding target genes are presented. Moreover, the impact of miRNA gene methylation on key oncogenetic processes as well as affected signaling pathways is discussed.

  14. Methods and compositions for controlling gene expression by RNA processing

    Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

    2017-08-29

    The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

  15. Developmental regulation of Xenopus 5S RNA genes

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  16. DAG1, no gene for RNA regulation?

    Brancaccio, Andrea

    2012-04-10

    DAG1 encodes for a precursor protein that liberates the two subunits featured by the dystroglycan (DG) adhesion complex that are involved in an increasing number of cellular functions in a wide variety of cells and tissues. Aside from the proteolytic events producing the α and β subunits, especially the former undergoes extensive "post-production" modifications taking place within the ER/Golgi where its core protein is both N- and O-decorated with sugars. These post-translational events, that are mainly orchestrated by a plethora of certified, or putative, glycosyltransferases, prelude to the excocytosis-mediated trafficking and targeting of the DG complex to the plasma membrane. Extensive genetic and biochemical evidences have been accumulated so far on α-DG glycosylation, while little is know on possible regulatory events underlying the chromatine activation, transcription or post-transcription (splicing and escape from the nucleus) of DAG1 or of its mRNA. A scenario is envisaged in which cells would use a sort of preferential, and scarcely regulated, route for DAG1 activation, that would imply fast mRNA transcription, maturation and export to the cytosol, and would prelude to the multiple time-consuming enzymatic post-translational activities needed for its glycosylation. Such a provocative view might be helpful to trigger future work aiming at disclosing the complete molecular mechanisms underlying DAG1 activation and at improving our knowledge of any pre-translational step that is involved in dystroglycan regulation. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Common changes in global gene expression induced by RNA polymerase inhibitors in Shigella flexneri.

    Hua Fu

    Full Text Available Characterization of expression profile of organisms in response to antimicrobials provides important information on the potential mechanism of action of the drugs. The special expression signature can be used to predict whether other drugs act on the same target. Here, the common response of Shigella flexneri to two inhibitors of RNA polymerase was examined using gene expression profiling. Consistent with similar effects of the two drugs, the gene expression profiles indicated that responses of the bacteria to these drugs were roughly the same, with 225 genes affected commonly. Of them, 88 were induced and 137 were repressed. Real-time PCR was performed for selected genes to verify the microarray results. Analysis of the expression data revealed that more than 30% of the plasmid-encoded genes on the array were up-regulated by the antibiotics including virF regulon, other virulence-related genes, and genes responsible for plasmid replication, maintenance, and transfer. In addition, some chromosome-encoded genes involved in virulence and genes acquired from horizontal transfer were also significantly up-regulated. However, the expression of genes encoding the beta-subunit of RNA polymerase was increased moderately. The repressed genes include those that code for products associated with the ribosome, citrate cycle, glycolysis, thiamine biosynthesis, purine metabolism, fructose metabolism, mannose metabolism, and cold shock proteins. This study demonstrates that the two antibiotics induce rapid cessation of RNA synthesis resulting in inhibition of translation components. It also indicates that the production of virulence factors involved in intercellular dissemination, tissue invasion and inflammatory destruction may be enhanced through derepressing horizontal transfer genes by the drugs.

  18. A retinoic acid-inducible mRNA from F9 teratocarcinoma cells encodes a novel protease inhibitor homologue.

    Wang, S Y; Gudas, L J

    1990-09-15

    We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.

  19. Poly-dipeptides encoded by the C9orf72 repeats bind nucleoli, impede RNA biogenesis, and kill cells.

    Kwon, Ilmin; Xiang, Siheng; Kato, Masato; Wu, Leeju; Theodoropoulos, Pano; Wang, Tao; Kim, Jiwoong; Yun, Jonghyun; Xie, Yang; McKnight, Steven L

    2014-09-05

    Many RNA regulatory proteins controlling pre-messenger RNA splicing contain serine:arginine (SR) repeats. Here, we found that these SR domains bound hydrogel droplets composed of fibrous polymers of the low-complexity domain of heterogeneous ribonucleoprotein A2 (hnRNPA2). Hydrogel binding was reversed upon phosphorylation of the SR domain by CDC2-like kinases 1 and 2 (CLK1/2). Mutated variants of the SR domains changing serine to glycine (SR-to-GR variants) also bound to hnRNPA2 hydrogels but were not affected by CLK1/2. When expressed in mammalian cells, these variants bound nucleoli. The translation products of the sense and antisense transcripts of the expansion repeats associated with the C9orf72 gene altered in neurodegenerative disease encode GRn and PRn repeat polypeptides. Both peptides bound to hnRNPA2 hydrogels independent of CLK1/2 activity. When applied to cultured cells, both peptides entered cells, migrated to the nucleus, bound nucleoli, and poisoned RNA biogenesis, which caused cell death. Copyright © 2014, American Association for the Advancement of Science.

  20. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  1. Transfection of tumor-infiltrating T cells with mRNA encoding CXCR2

    Idorn, Manja; thor Straten, Eivind Per; Svane, Inge Marie

    2016-01-01

    Adoptive T-cell therapy based on the infusion of patient’s own immune cells after ex vivo culturing is among the most potent forms of personalized treatment among recent clinical developments for the treatment of cancer. However, despite high rates of successful initial clinical responses, only...... infused T cells migrating to the tumor and the clinical response, but also that only a small fraction of adoptively transferred Tcells reach the tumor site. In this chapter, we describe a protocol for transfection of TILs with mRNA encoding the chemokine receptor CXCR2 transiently redirecting...

  2. Pseudogenes regulate parental gene expression via ceRNA network.

    An, Yang; Furber, Kendra L; Ji, Shaoping

    2017-01-01

    The concept of competitive endogenous RNA (ceRNA) was first proposed by Salmena and colleagues. Evidence suggests that pseudogene RNAs can act as a 'sponge' through competitive binding of common miRNA, releasing or attenuating repression through sequestering miRNAs away from parental mRNA. In theory, ceRNAs refer to all transcripts such as mRNA, tRNA, rRNA, long non-coding RNA, pseudogene RNA and circular RNA, because all of them may become the targets of miRNA depending on spatiotemporal situation. As binding of miRNA to the target RNA is not 100% complementary, it is possible that one miRNA can bind to multiple target RNAs and vice versa. All RNAs crosstalk through competitively binding to miRNAvia miRNA response elements (MREs) contained within the RNA sequences, thus forming a complex regulatory network. The ratio of a subset of miRNAs to the corresponding number of MREs determines repression strength on a given mRNA translation or stability. An increase in pseudogene RNA level can sequester miRNA and release repression on the parental gene, leading to an increase in parental gene expression. A massive number of transcripts constitute a complicated network that regulates each other through this proposed mechanism, though some regulatory significance may be mild or even undetectable. It is possible that the regulation of gene and pseudogene expression occurring in this manor involves all RNAs bearing common MREs. In this review, we will primarily discuss how pseudogene transcripts regulate expression of parental genes via ceRNA network and biological significance of regulation. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  3. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  4. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  5. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  6. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  7. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  8. Genome-wide identification of structural variants in genes encoding drug targets

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  9. A novel TBP-TAF complex on RNA polymerase II-transcribed snRNA genes.

    Zaborowska, Justyna; Taylor, Alice; Roeder, Robert G; Murphy, Shona

    2012-01-01

    Initiation of transcription of most human genes transcribed by RNA polymerase II (RNAP II) requires the formation of a preinitiation complex comprising TFIIA, B, D, E, F, H and RNAP II. The general transcription factor TFIID is composed of the TATA-binding protein and up to 13 TBP-associated factors. During transcription of snRNA genes, RNAP II does not appear to make the transition to long-range productive elongation, as happens during transcription of protein-coding genes. In addition, recognition of the snRNA gene-type specific 3' box RNA processing element requires initiation from an snRNA gene promoter. These characteristics may, at least in part, be driven by factors recruited to the promoter. For example, differences in the complement of TAFs might result in differential recruitment of elongation and RNA processing factors. As precedent, it already has been shown that the promoters of some protein-coding genes do not recruit all the TAFs found in TFIID. Although TAF5 has been shown to be associated with RNAP II-transcribed snRNA genes, the full complement of TAFs associated with these genes has remained unclear. Here we show, using a ChIP and siRNA-mediated approach, that the TBP/TAF complex on snRNA genes differs from that found on protein-coding genes. Interestingly, the largest TAF, TAF1, and the core TAFs, TAF10 and TAF4, are not detected on snRNA genes. We propose that this snRNA gene-specific TAF subset plays a key role in gene type-specific control of expression.

  10. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  11. Nucleotide sequence of a human tRNA gene heterocluster

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  12. Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

    Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

    2016-11-15

    Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

  13. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  14. MicroRNA and gene signature of severe cutaneous drug ...

    Purpose: To build a microRNA and gene signature of severe cutaneous adverse drug reactions (SCAR), including Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). Methods: MicroRNA expression profiles were downloaded from miRNA expression profile of patients' skin suffering from TEN using an ...

  15. RNA Chimeras as a Gene Signature of Breast Cancer

    2013-05-01

    www.plosone.org 11 August 2012 | Volume 7 | Issue 8 | e41659 Human genes Human ACTB mRNA: >gi|168480144|ref|NM_001101.3| Homo sapiens actin, beta...TCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGAGTGGGTGGAGGCAGCCAGGGCTTACCTGTACACTGACTTGAGACCAGTTGAATAAA AGTGCACACCTTAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Human GAPDH mRNA: >gi|83641890|ref|NM_002046.4| Homo sapiens ...Homo sapiens hypoxanthine phosphoribosyltransferase 1 (HPRT1), mRNA

  16. Transcription factor trapping by RNA in gene regulatory elements.

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  17. Species-independent MicroRNA Gene Discovery

    Kamanu, Timothy K.

    2012-01-01

    and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. mi

  18. Molecular cloning and functional analysis of the gene encoding ...

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  19. IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells

    Giuseppe Fiume

    2016-11-01

    Full Text Available The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03% of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7% and 698 downregulated (54.3% RNAs. In K562 cells, 1959 (3.1% of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7% and 906 downregulated (46.3%. Only 137 transcripts (0.22% were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

  20. IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.

    Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

    2016-11-07

    The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

  1. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  2. Characterization of the ptr5+ gene involved in nuclear mRNA export in fission yeast

    Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka; Tani, Tokio

    2012-01-01

    Highlights: ► We cloned the ptr5 + gene involved in nuclear mRNA export in fission yeast. ► The ptr5 + gene was found to encode nucleoporin 85 (Nup85). ► Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. ► Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. ► Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A) + RNA transport] 1 to 11, which accumulate poly(A) + RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5–1 mutant shows dots- or a ring-like accumulation of poly(A) + RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5 + gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5–1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5–1 mutation. In addition, we found that the ptr5–1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5–1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.

  3. Conserved genes encode guide RNAs in mitochondria of Crithidia fasciculata

    van der Spek, H.; Arts, G. J.; Zwaal, R. R.; van den Burg, J.; Sloof, P.; Benne, R.

    1991-01-01

    RNA editing is the post-transcriptional alteration of the nucleotide sequence of RNA, which in trypanosome mitochondria is characterized by the insertion and deletion of uridine residues. It has recently been proposed that the information for the sequence alteration in Leishmania tarentolae is

  4. Evolution of RLSB, a nuclear-encoded S1 domain RNA binding protein associated with post-transcriptional regulation of plastid-encoded rbcL mRNA in vascular plants.

    Yerramsetty, Pradeep; Stata, Matt; Siford, Rebecca; Sage, Tammy L; Sage, Rowan F; Wong, Gane Ka-Shu; Albert, Victor A; Berry, James O

    2016-06-29

    RLSB, an S-1 domain RNA binding protein of Arabidopsis, selectively binds rbcL mRNA and co-localizes with Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) within chloroplasts of C3 and C4 plants. Previous studies using both Arabidopsis (C3) and maize (C4) suggest RLSB homologs are post-transcriptional regulators of plastid-encoded rbcL mRNA. While RLSB accumulates in all Arabidopsis leaf chlorenchyma cells, in C4 leaves RLSB-like proteins accumulate only within Rubisco-containing bundle sheath chloroplasts of Kranz-type species, and only within central compartment chloroplasts in the single cell C4 plant Bienertia. Our recent evidence implicates this mRNA binding protein as a primary determinant of rbcL expression, cellular localization/compartmentalization, and photosynthetic function in all multicellular green plants. This study addresses the hypothesis that RLSB is a highly conserved Rubisco regulatory factor that occurs in the chloroplasts all higher plants. Phylogenetic analysis has identified RLSB orthologs and paralogs in all major plant groups, from ancient liverworts to recent angiosperms. RLSB homologs were also identified in algae of the division Charophyta, a lineage closely related to land plants. RLSB-like sequences were not identified in any other algae, suggesting that it may be specific to the evolutionary line leading to land plants. The RLSB family occurs in single copy across most angiosperms, although a few species with two copies were identified, seemingly randomly distributed throughout the various taxa, although perhaps correlating in some cases with known ancient whole genome duplications. Monocots of the order Poales (Poaceae and Cyperaceae) were found to contain two copies, designated here as RLSB-a and RLSB-b, with only RLSB-a implicated in the regulation of rbcL across the maize developmental gradient. Analysis of microsynteny in angiosperms revealed high levels of conservation across eudicot species and for both paralogs in

  5. The distribution, diversity, and importance of 16S rRNA gene introns in the order Thermoproteales.

    Jay, Zackary J; Inskeep, William P

    2015-07-09

    Intron sequences are common in 16S rRNA genes of specific thermophilic lineages of Archaea, specifically the Thermoproteales (phylum Crenarchaeota). Environmental sequencing (16S rRNA gene and metagenome) from geothermal habitats in Yellowstone National Park (YNP) has expanded the available datasets for investigating 16S rRNA gene introns. The objectives of this study were to characterize and curate archaeal 16S rRNA gene introns from high-temperature habitats, evaluate the conservation and distribution of archaeal 16S rRNA introns in geothermal systems, and determine which "universal" archaeal 16S rRNA gene primers are impacted by the presence of intron sequences. Several new introns were identified and their insertion loci were constrained to thirteen locations across the 16S rRNA gene. Many of these introns encode homing endonucleases, although some introns were short or partial sequences. Pyrobaculum, Thermoproteus, and Caldivirga 16S rRNA genes contained the most abundant and diverse intron sequences. Phylogenetic analysis of introns revealed that sequences within the same locus are distributed biogeographically. The most diverse set of introns were observed in a high-temperature, circumneutral (pH 6) sulfur sediment environment, which also contained the greatest diversity of different Thermoproteales phylotypes. The widespread presence of introns in the Thermoproteales indicates a high probability of misalignments using different "universal" 16S rRNA primers employed in environmental microbial community analysis.

  6. Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

    Ronander, Elena; Bengtsson, Dominique C; Joergensen, Louise

    2012-01-01

    Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has...... been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors...... fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE(1). Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human...

  7. RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells

    Diener, Yvonne; Jurk, Marion; Kandil, Britta; Choi, Yeong-Hoon; Wild, Stefan; Bissels, Ute; Bosio, Andreas

    2015-01-01

    Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable gene modification by viral vectors that are burdensome when translating protocols into clinical settings. Our study aimed at exploring new ways to transiently modify HSPC gene expression using non-integrating, RNA-based molecules. First, we tested different methods to deliver these molecules into HSPCs. The delivery of siRNAs with chemical transfection methods such as lipofection or cationic polymers did not lead to target knockdown, although we observed more than 90% fluorescent cells using a fluorochrome-coupled siRNA. Confocal microscopic analysis revealed that despite extensive washing, siRNA stuck to or in the cell surface, thereby mimicking a transfection event. In contrast, electroporation resulted in efficient, siRNA-mediated protein knockdown. For transient overexpression of proteins, we used optimised mRNA molecules with modified 5′- and 3′-UTRs. Electroporation of mRNA encoding GFP resulted in fast, efficient and persistent protein expression for at least seven days. Our data provide a broad-ranging comparison of transfection methods for hard-to-transfect cells and offer new opportunities for DNA-free, non-integrating gene modulation in HSPCs. PMID:26599627

  8. Detecting microRNA activity from gene expression data

    Madden, Stephen F

    2010-05-18

    Abstract Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  9. Detecting microRNA activity from gene expression data.

    Madden, Stephen F

    2010-01-01

    BACKGROUND: MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. RESULTS: Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. CONCLUSIONS: We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  10. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  11. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  12. Dysregulation of RNA Mediated Gene Expression in Motor Neuron Diseases.

    Gonçalves, Inês do Carmo G; Rehorst, Wiebke A; Kye, Min Jeong

    2016-01-01

    Recent findings indicate an important role for RNA-mediated gene expression in motor neuron diseases, including ALS (amyotrophic lateral sclerosis) and SMA (spinal muscular atrophy). ALS, also known as Lou Gehrig's disease, is an adult-onset progressive neurodegenerative disorder, whereby SMA or "children's Lou Gehrig's disease" is considered a pediatric neurodevelopmental disorder. Despite the difference in genetic causes, both ALS and SMA share common phenotypes; dysfunction/loss of motor neurons that eventually leads to muscle weakness and atrophy. With advanced techniques in molecular genetics and cell biology, current data suggest that these two distinct motor neuron diseases share more than phenotypes; ALS and SMA have similar cellular pathological mechanisms including mitochondrial dysfunction, oxidative stress and dysregulation in RNA-mediated gene expression. Here, we will discuss the current findings on these two diseases with specific focus on RNA-mediated gene regulation including miRNA expression, pre-mRNA processing and RNA binding proteins.

  13. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F [Department of Pharmaceutical Science, Zhujiang Hospital, Southern Medical University, Guangzhou 510282 (China); Yang, B, E-mail: andrewfxu1998@gmail.co [Department of Chemistry, Indiana University-Bloomington, Bloomington, IN 47405 (United States)

    2009-10-07

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  14. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F; Yang, B

    2009-01-01

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  15. ELFN1-AS1: A Novel Primate Gene with Possible MicroRNA Function Expressed Predominantly in Human Tumors

    Dmitrii E. Polev

    2014-01-01

    Full Text Available Human gene LOC100505644 uncharacterized LOC100505644 [Homo sapiens] (Entrez Gene ID 100505644 is abundantly expressed in tumors but weakly expressed in few normal tissues. Till now the function of this gene remains unknown. Here we identified the chromosomal borders of the transcribed region and the major splice form of the LOC100505644-specific transcript. We characterised the major regulatory motifs of the gene and its splice sites. Analysis of the secondary structure of the major transcript variant revealed a hairpin-like structure characteristic for precursor microRNAs. Comparative genomic analysis of the locus showed that it originated in primates de novo. Taken together, our data indicate that human gene LOC100505644 encodes some non-protein coding RNA, likely a microRNA. It was assigned a gene symbol ELFN1-AS1 (ELFN1 antisense RNA 1 (non-protein coding. This gene combines features of evolutionary novelty and predominant expression in tumors.

  16. Non-functional genes repaired at the RNA level.

    Burger, Gertraud

    2016-01-01

    Genomes and genes continuously evolve. Gene sequences undergo substitutions, deletions or nucleotide insertions; mobile genetic elements invade genomes and interleave in genes; chromosomes break, even within genes, and pieces reseal in reshuffled order. To maintain functional gene products and assure an organism's survival, two principal strategies are used - either repair of the gene itself or of its product. I will introduce common types of gene aberrations and how gene function is restored secondarily, and then focus on systematically fragmented genes found in a poorly studied protist group, the diplonemids. Expression of their broken genes involves restitching of pieces at the RNA-level, and substantial RNA editing, to compensate for point mutations. I will conclude with thoughts on how such a grotesquely unorthodox system may have evolved, and why this group of organisms persists and thrives since tens of millions of years. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  17. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  18. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  19. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  20. Rapid duplication and loss of nbs-encoding genes in eurosids II

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  1. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  2. A family of related proteins is encoded by the major Drosophila heat shock gene family

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  3. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  4. RNomics and Modomics in the halophilic archaea Haloferax volcanii: identification of RNA modification genes

    Decatur Wayne A

    2008-10-01

    Full Text Available Abstract Background Naturally occurring RNAs contain numerous enzymatically altered nucleosides. Differences in RNA populations (RNomics and pattern of RNA modifications (Modomics depends on the organism analyzed and are two of the criteria that distinguish the three kingdoms of life. If the genomic sequences of the RNA molecules can be derived from whole genome sequence information, the modification profile cannot and requires or direct sequencing of the RNAs or predictive methods base on the presence or absence of the modifications genes. Results By employing a comparative genomics approach, we predicted almost all of the genes coding for the t+rRNA modification enzymes in the mesophilic moderate halophile Haloferax volcanii. These encode both guide RNAs and enzymes. Some are orthologous to previously identified genes in Archaea, Bacteria or in Saccharomyces cerevisiae, but several are original predictions. Conclusion The number of modifications in t+rRNAs in the halophilic archaeon is surprisingly low when compared with other Archaea or Bacteria, particularly the hyperthermophilic organisms. This may result from the specific lifestyle of halophiles that require high intracellular salt concentration for survival. This salt content could allow RNA to maintain its functional structural integrity with fewer modifications. We predict that the few modifications present must be particularly important for decoding, accuracy of translation or are modifications that cannot be functionally replaced by the electrostatic interactions provided by the surrounding salt-ions. This analysis also guides future experimental validation work aiming to complete the understanding of the function of RNA modifications in Archaeal translation.

  5. Use of tiling array data and RNA secondary structure predictions to identify noncoding RNA genes

    Weile, Christian; Gardner, Paul P; Hedegaard, Mads M

    2007-01-01

    neuroblastoma cell line SK-N-AS. Using this strategy, we identify thousands of human candidate RNA genes. To further verify the expression of these genes, we focused on candidate genes that had a stable hairpin structures or a high level of covariance. Using northern blotting, we verify the expression of 2 out...

  6. Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.

    Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A

    1997-07-01

    Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

  7. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  8. The noncoding RNA taurine upregulated gene 1 is required for differentiation of the murine retina.

    Young, T L; Matsuda, T; Cepko, C L

    2005-03-29

    With the advent of genome-wide analyses, it is becoming evident that a large number of noncoding RNAs (ncRNAs) are expressed in vertebrates. However, of the thousands of ncRNAs identified, the functions of relatively few have been established. In a screen for genes upregulated by taurine in developing retinal cells, we identified a gene that appears to be a ncRNA. Taurine Upregulated Gene 1 (TUG1) is a spliced, polyadenylated RNA that does not encode any open reading frame greater than 82 amino acids in its full-length, 6.7 kilobase (kb) RNA sequence. Analyses of Northern blots and in situ hybridization revealed that TUG1 is expressed in the developing retina and brain, as well as in adult tissues. In the newborn retina, knockdown of TUG1 with RNA interference (RNAi) resulted in malformed or nonexistent outer segments of transfected photoreceptors. Immunofluorescent staining and microarray analyses suggested that this loss of proper photoreceptor differentiation is a result of the disregulation of photoreceptor gene expression. A function for a newly identified ncRNA, TUG1, has been established. TUG1 is necessary for the proper formation of photoreceptors in the developing rodent retina.

  9. RNA Sequencing Reveals that Kaposi Sarcoma-Associated Herpesvirus Infection Mimics Hypoxia Gene Expression Signature

    Viollet, Coralie; Davis, David A.; Tekeste, Shewit S.; Reczko, Martin; Pezzella, Francesco; Ragoussis, Jiannis

    2017-01-01

    Kaposi sarcoma-associated herpesvirus (KSHV) causes several tumors and hyperproliferative disorders. Hypoxia and hypoxia-inducible factors (HIFs) activate latent and lytic KSHV genes, and several KSHV proteins increase the cellular levels of HIF. Here, we used RNA sequencing, qRT-PCR, Taqman assays, and pathway analysis to explore the miRNA and mRNA response of uninfected and KSHV-infected cells to hypoxia, to compare this with the genetic changes seen in chronic latent KSHV infection, and to explore the degree to which hypoxia and KSHV infection interact in modulating mRNA and miRNA expression. We found that the gene expression signatures for KSHV infection and hypoxia have a 34% overlap. Moreover, there were considerable similarities between the genes up-regulated by hypoxia in uninfected (SLK) and in KSHV-infected (SLKK) cells. hsa-miR-210, a HIF-target known to have pro-angiogenic and anti-apoptotic properties, was significantly up-regulated by both KSHV infection and hypoxia using Taqman assays. Interestingly, expression of KSHV-encoded miRNAs was not affected by hypoxia. These results demonstrate that KSHV harnesses a part of the hypoxic cellular response and that a substantial portion of hypoxia-induced changes in cellular gene expression are induced by KSHV infection. Therefore, targeting hypoxic pathways may be a useful way to develop therapeutic strategies for KSHV-related diseases. PMID:28046107

  10. Polymorphisms in miRNA genes and their involvement in autoimmune diseases susceptibility.

    Latini, Andrea; Ciccacci, Cinzia; Novelli, Giuseppe; Borgiani, Paola

    2017-08-01

    MicroRNAs (miRNAs) are small non-coding RNA molecules that negatively regulate the expression of multiple protein-encoding genes at the post-transcriptional level. MicroRNAs are involved in different pathways, such as cellular proliferation and differentiation, signal transduction and inflammation, and play crucial roles in the development of several diseases, such as cancer, diabetes, and cardiovascular diseases. They have recently been recognized to play a role also in the pathogenesis of autoimmune diseases. Although the majority of studies are focused on miRNA expression profiles investigation, a growing number of studies have been investigating the role of polymorphisms in miRNA genes in the autoimmune diseases development. Indeed, polymorphisms affecting the miRNA genes can modify the set of targets they regulate or the maturation efficiency. This review is aimed to give an overview about the available studies that have investigated the association of miRNA gene polymorphisms with the susceptibility to various autoimmune diseases and to their clinical phenotypes.

  11. Intrinsic noise of microRNA-regulated genes and the ceRNA hypothesis.

    Javad Noorbakhsh

    Full Text Available MicroRNAs are small noncoding RNAs that regulate genes post-transciptionally by binding and degrading target eukaryotic mRNAs. We use a quantitative model to study gene regulation by inhibitory microRNAs and compare it to gene regulation by prokaryotic small non-coding RNAs (sRNAs. Our model uses a combination of analytic techniques as well as computational simulations to calculate the mean-expression and noise profiles of genes regulated by both microRNAs and sRNAs. We find that despite very different molecular machinery and modes of action (catalytic vs stoichiometric, the mean expression levels and noise profiles of microRNA-regulated genes are almost identical to genes regulated by prokaryotic sRNAs. This behavior is extremely robust and persists across a wide range of biologically relevant parameters. We extend our model to study crosstalk between multiple mRNAs that are regulated by a single microRNA and show that noise is a sensitive measure of microRNA-mediated interaction between mRNAs. We conclude by discussing possible experimental strategies for uncovering the microRNA-mRNA interactions and testing the competing endogenous RNA (ceRNA hypothesis.

  12. Recruitment of PfSET2 by RNA polymerase II to variant antigen encoding loci contributes to antigenic variation in P. falciparum.

    Uchechi E Ukaegbu

    2014-01-01

    Full Text Available Histone modifications are important regulators of gene expression in all eukaryotes. In Plasmodium falciparum, these epigenetic marks regulate expression of genes involved in several aspects of host-parasite interactions, including antigenic variation. While the identities and genomic positions of many histone modifications have now been cataloged, how they are targeted to defined genomic regions remains poorly understood. For example, how variant antigen encoding loci (var are targeted for deposition of unique histone marks is a mystery that continues to perplex the field. Here we describe the recruitment of an ortholog of the histone modifier SET2 to var genes through direct interactions with the C-terminal domain (CTD of RNA polymerase II. In higher eukaryotes, SET2 is a histone methyltransferase recruited by RNA pol II during mRNA transcription; however, the ortholog in P. falciparum (PfSET2 has an atypical architecture and its role in regulating transcription is unknown. Here we show that PfSET2 binds to the unphosphorylated form of the CTD, a property inconsistent with its recruitment during mRNA synthesis. Further, we show that H3K36me3, the epigenetic mark deposited by PfSET2, is enriched at both active and silent var gene loci, providing additional evidence that its recruitment is not associated with mRNA production. Over-expression of a dominant negative form of PfSET2 designed to disrupt binding to RNA pol II induced rapid var gene expression switching, confirming both the importance of PfSET2 in var gene regulation and a role for RNA pol II in its recruitment. RNA pol II is known to transcribe non-coding RNAs from both active and silent var genes, providing a possible mechanism by which it could recruit PfSET2 to var loci. This work unifies previous reports of histone modifications, the production of ncRNAs, and the promoter activity of var introns into a mechanism that contributes to antigenic variation by malaria parasites.

  13. Improvement of In Vivo Expression of Genes Delivered by Self-Amplifying RNA Using Vaccinia Virus Immune Evasion Proteins

    Beissert, Tim; Koste, Lars; Perkovic, Mario; Walzer, Kerstin C.; Erbar, Stephanie; Selmi, Abderraouf; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

    2017-01-01

    Among nucleic acid–based delivery platforms, self-amplifying RNA (saRNA) vectors are of increasing interest for applications such as transient expression of recombinant proteins and vaccination. saRNA is safe and, due to its capability to amplify intracellularly, high protein levels can be produced from even minute amounts of transfected templates. However, it is an obstacle to full exploitation of this platform that saRNA induces a strong innate host immune response. In transfected cells, pattern recognition receptors sense double-stranded RNA intermediates and via activation of protein kinase R (PKR) and interferon signaling initiate host defense measures including a translational shutdown. To reduce pattern recognition receptor stimulation and unleash suppressed saRNA translation, this study co-delivered non-replicating mRNA encoding vaccinia virus immune evasion proteins E3, K3, and B18. It was shown that E3 is far superior to K3 or B18 as a highly potent blocker of PKR activation and of interferon (IFN)-β upregulation. B18, in contrast, is superior in controlling OAS1, a key IFN-inducible gene involved in viral RNA degradation. By combining all three vaccinia proteins, the study achieved significant suppression of PKR and IFN pathway activation in vitro and enhanced expression of saRNA-encoded genes of interest both in vitro and in vivo. This approach promises to overcome key hurdles of saRNA gene delivery. Its application may improve the bioavailability of the encoded protein, and reduce the effective dose and correspondingly the cost of goods of manufacture in the various fields where saRNA utilization is envisioned. PMID:28877647

  14. Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.

    Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J

    2010-11-01

    MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.

  15. Molecular quantification of genes encoding for green-fluorescent proteins

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  16. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

    Ricardo Harakava

    2005-01-01

    Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

  17. Evolutionary relationships between miRNA genes and their activity.

    Zhu, Yan; Skogerbø, Geir; Ning, Qianqian; Wang, Zhen; Li, Biqing; Yang, Shuang; Sun, Hong; Li, Yixue

    2012-12-22

    The emergence of vertebrates is characterized by a strong increase in miRNA families. MicroRNAs interact broadly with many transcripts, and the evolution of such a system is intriguing. However, evolutionary questions concerning the origin of miRNA genes and their subsequent evolution remain unexplained. In order to systematically understand the evolutionary relationship between miRNAs gene and their function, we classified human known miRNAs into eight groups based on their evolutionary ages estimated by maximum parsimony method. New miRNA genes with new functional sequences accumulated more dynamically in vertebrates than that observed in Drosophila. Different levels of evolutionary selection were observed over miRNA gene sequences with different time of origin. Most genic miRNAs differ from their host genes in time of origin, there is no particular relationship between the age of a miRNA and the age of its host genes, genic miRNAs are mostly younger than the corresponding host genes. MicroRNAs originated over different time-scales are often predicted/verified to target the same or overlapping sets of genes, opening the possibility of substantial functional redundancy among miRNAs of different ages. Higher degree of tissue specificity and lower expression level was found in young miRNAs. Our data showed that compared with protein coding genes, miRNA genes are more dynamic in terms of emergence and decay. Evolution patterns are quite different between miRNAs of different ages. MicroRNAs activity is under tight control with well-regulated expression increased and targeting decreased over time. Our work calls attention to the study of miRNA activity with a consideration of their origin time.

  18. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  19. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  20. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  1. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  2. Isolation and characterization of a gene encoding a polyethylene ...

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous ... mechanisms is that a gene must be inducible in response to an external threat, to ..... of CPs known in plants. The others are legumain (C13), calcium-dependent.

  3. Thermodynamic control of small RNA-mediated gene silencing

    Kumiko eUi-Tei

    2012-06-01

    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

  4. Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

    Howe, J G; Shu, M D

    1988-08-01

    Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.

  5. Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-01-01

    Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

  6. Mitochondrial tRNA gene translocations in highly eusocial bees

    Daniela Silvestre

    2006-01-01

    Full Text Available Mitochondrial gene rearrangement events, especially involving tRNA genes, have been described more frequently as more complete mitochondrial genome sequences are becoming available. In the present work, we analyzed mitochondrial tRNA gene rearrangements between two bee species belonging to the tribes Apini and Meliponini within the "corbiculate Apidae". Eleven tRNA genes are in different genome positions or strands. The molecular events responsible for each translocation are explained. Considering the high number of rearrangements observed, the data presented here contradict the general rule of high gene order conservation among closely related organisms, and also represent a powerful molecular tool to help solve questions about phylogeny and evolution in bees.

  7. Electroporated Antigen-Encoding mRNA Is Not a Danger Signal to Human Mature Monocyte-Derived Dendritic Cells

    Stefanie Hoyer

    2015-01-01

    Full Text Available For therapeutic cancer vaccination, the adoptive transfer of mRNA-electroporated dendritic cells (DCs is frequently performed, usually with monocyte-derived, cytokine-matured DCs (moDCs. However, DCs are rich in danger-sensing receptors which could recognize the exogenously delivered mRNA and induce DC activation, hence influencing the DCs’ immunogenicity. Therefore, we examined whether electroporation of mRNA with a proper cap and a poly-A tail of at least 64 adenosines had any influence on cocktail-matured moDCs. We used 16 different RNAs, encoding tumor antigens (MelanA, NRAS, BRAF, GNAQ, GNA11, and WT1, and variants thereof. None of those RNAs induced changes in the expression of CD25, CD40, CD83, CD86, and CD70 or the secretion of the cytokines IL-8, IL-6, and TNFα of more than 1.5-fold compared to the control condition, while an mRNA encoding an NF-κB-activation protein as positive control induced massive secretion of the cytokines. To determine whether mRNA electroporation had any effect on the whole transcriptome of the DCs, we performed microarray analyses of DCs of 6 different donors. None of 60,000 probes was significantly different between mock-electroporated DCs and MelanA-transfected DCs. Hence, we conclude that no transcriptional programs were induced within cocktail-matured DCs by electroporation of single tumor-antigen-encoding mRNAs.

  8. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    Mojumdar, M.

    1986-01-01

    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  9. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  10. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  11. RNA.

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  12. Identification of Aquifex aeolicus tRNA (m2(2G26) methyltransferase gene.

    Takeda, Hiroshi; Hori, Hiroyuki; Endo, Yaeta

    2002-01-01

    The modifications of N2,N2-dimethylguanine (m2(2)G) are found in tRNAs and rRNAs from eukarya and archaea. In tRNAs, modification at position G26 is generated by tRNA (m2(2)G26) methyltransferase, which is encoded by the corresponding gene, trm1. This enzyme catalyzes the methyl-transfer from S-adenosyl-L-methionine to the semi-conserved residue, G26, via the intermediate modified base, m2G26. Recent genome sequencing project has been reported that the putative trm1 is encoded in the genome of Aquifex aeolicus, a hyper-thermophilic eubacterium as only one exception among eubacteria. In order to confirm whether this bacterial trm1 gene product is a real tRNA (m2(2)G26) methyltransferase or not, we expressed this protein by wheat germ in vitro cell-free translation system. Our biochemical analysis clearly showed that this gene product possessed tRNA (m2(2)G26) methyltransferase activity.

  13. Amtyr1: characterization of a gene from honeybee (Apis mellifera) brain encoding a functional tyramine receptor.

    Blenau, W; Balfanz, S; Baumann, A

    2000-03-01

    Biogenic amine receptors are involved in the regulation and modulation of various physiological and behavioral processes in both vertebrates and invertebrates. We have cloned a member of this gene family from the CNS of the honeybee, Apis mellifera. The deduced amino acid sequence is homologous to tyramine receptors cloned from Locusta migratoria and Drosophila melanogaster as well as to an octopamine receptor cloned from Heliothis virescens. Functional properties of the honeybee receptor were studied in stably transfected human embryonic kidney 293 cells. Tyramine reduced forskolin-induced cyclic AMP production in a dose-dependent manner with an EC50 of approximately 130 nM. A similar effect of tyramine was observed in membrane homogenates of honeybee brains. Octopamine also reduced cyclic AMP production in the transfected cell line but was both less potent (EC50 of approximately 3 microM) and less efficacious than tyramine. Receptor-encoding mRNA has a wide-spread distribution in the brain and subesophageal ganglion of the honeybee, suggesting that this tyramine receptor is involved in sensory signal processing as well as in higher-order brain functions.

  14. The Down regulated in Adenoma (dra) gene encodes an intestine-specific membrane sulfate transport protein.

    Silberg, D G; Wang, W; Moseley, R H; Traber, P G

    1995-05-19

    A gene has been described, Down Regulated in Adenoma (dra), which is expressed in normal colon but is absent in the majority of colon adenomas and adenocarcinomas. However, the function of this protein is unknown. Because of sequence similarity to a recently cloned membrane sulfate transporter in rat liver, the transport function of Dra was examined. We established that dra encodes for a Na(+)-independent transporter for both sulfate and oxalate using microinjected Xenopus oocytes as an assay system. Sulfate transport was sensitive to the anion exchange inhibitor DIDS (4,4'-diisothiocyano-2,2' disulfonic acid stilbene). Using an RNase protection assay, we found that dra mRNA expression is limited to the small intestine and colon in mouse, therefore identifying Dra as an intestine-specific sulfate transporter. dra also had a unique pattern of expression during intestinal development. Northern blot analysis revealed a low level of expression in colon at birth with a marked increase in the first 2 postnatal weeks. In contrast, there was a lower, constant level of expression in small intestine in the postnatal period. Caco-2 cells, a colon carcinoma cell line that differentiates over time in culture, demonstrated a marked induction of dra mRNA as cells progressed from the preconfluent (undifferentiated) to the postconfluent (differentiated) state. These results show that Dra is an intestine-specific Na(+)-independent sulfate transporter that has differential expression during colonic development. This functional characterization provides the foundation for investigation of the role of Dra in intestinal sulfate transport and in the malignant phenotype.

  15. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  16. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  17. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  18. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  19. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  20. Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

    Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

    2017-12-01

    Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

  1. mRNA/microRNA gene expression profile in microsatellite unstable colorectal cancer

    Calin George A

    2007-08-01

    Full Text Available Abstract Background Colorectal cancer develops through two main genetic instability pathways characterized by distinct pathologic features and clinical outcome. Results We investigated colon cancer samples (23 characterized by microsatellite stability, MSS, and 16 by high microsatellite instability, MSI-H for genome-wide expression of microRNA (miRNA and mRNA. Based on combined miRNA and mRNA gene expression, a molecular signature consisting of twenty seven differentially expressed genes, inclusive of 8 miRNAs, could correctly distinguish MSI-H versus MSS colon cancer samples. Among the differentially expressed miRNAs, various members of the oncogenic miR-17-92 family were significantly up-regulated in MSS cancers. The majority of protein coding genes were also up-regulated in MSS cancers. Their functional classification revealed that they were most frequently associated with cell cycle, DNA replication, recombination, repair, gastrointestinal disease and immune response. Conclusion This is the first report that indicates the existence of differences in miRNA expression between MSS versus MSI-H colorectal cancers. In addition, the work suggests that the combination of mRNA/miRNA expression signatures may represent a general approach for improving bio-molecular classification of human cancer.

  2. Gene encoding virulence markers among Escherichia coli isolates ...

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  3. Cloning and heterologous expression of a gene encoding lycopene ...

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  4. Molecular cloning and characterization of a gene encoding RING ...

    PRAKASH KUMAR G

    such as BRCA1 (a product of a breast cancer-associated gene) and Cb1 ... research has indicated that ubiquitination mediated by the ... environment and is unique to China. Since it is ..... benefit the normal biological function of the plant. We.

  5. RNA preparation and characterization for gene expression studies

    Stangegaard, Michael

    2009-01-01

    Much information can be obtained from knowledge of the relative expression level of each gene in the transcriptome. With the current advances in technology as little as a single cell is required as starting material for gene expression experiments. The mRNA from a single cell may be linearly...

  6. A Caenorhabditis elegans RNA polymerase II gene, ama-1 IV, and nearby essential genes.

    Rogalski, T M; Riddle, D L

    1988-01-01

    The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20 degrees but are arrested as larvae at 25 degrees, and two others are fertile at 20 degrees and sterile at 25 degrees. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25 degrees is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four gamma-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development.

  7. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

    1987-01-01

    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  8. In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

    Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

    2018-01-01

    The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Translational control and differential RNA decay are key elements regulating postsegregational expression of the killer protein encoded by the parB locus of plasmid R1

    Gerdes, K; Helin, K; Christensen, O W

    1988-01-01

    The parB locus of plasmid R1, which mediates plasmid stability via postsegregational killing of plasmid-free cells, encodes two genes, hok and sok. The hok gene product is a potent cell-killing protein. The hok gene is regulated at the translational level by the sok gene-encoded repressor, a small...

  10. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  11. Thermal response of rat fibroblasts stably transfected with the human 70-kDa heat shock protein-encoding gene

    Li, G.C.; Li, Ligeng; Liu, Yunkang; Mak, J.Y.; Chen, Lili; Lee, W.M.F.

    1991-01-01

    The major heat shock protein hsp70 is synthesized by cells of a wide variety of organisms in response to heat shock or other environmental stresses and is assumed to play an important role in protecting cells from thermal stress. The authors have tested this hypothesis directly by transfecting a constitutively expressed recombinant human hsp70-encoding gene into rat fibroblasts and examining the relationship between the levels of human hsp70 expressed and thermal resistance of the stably transfected rat cells. Successful transfection and expression of the gene for human hsp70 were characterized by RNA hybridization analysis, low-dimensional gel electrophoresis, and immunoblot analysis. When individual cloned cell lines were exposed to 45C and their thermal survivals were determined by colony-formation assay, they found that the expression of human hsp70 conferred heat resistance to the rat cells. These results reinforce the hypothesis that hsp70 has a protective function against thermal stress

  12. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  13. Smoking, genes encoding dopamine pathway and risk for Parkinson's disease.

    Gu, Zhuqin; Feng, Xiuli; Dong, Xiumin; Chan, Piu

    2010-09-20

    Smoking has been reported to be inversely associated with Parkinson's disease (PD) in many studies, but a recent study in China found that smoking increased the risk of PD. Variants in genes associated with dopamine metabolism found to increase the risk for PD have also been associated with smoking behavior. To investigate the association between smoking and PD in a Chinese population and determine whether the genetic variants of genes involved in dopamine metabolism influence the relationship between smoking and risk for PD. Chinese PD patients were recruited from Xuanwu Hospital. Controls were sampled from community. Detailed information on life-long smoking behavior was collected by face-to-face interview. Genotypes were determined for SLC6A3 VNTR, COMT Val108/158Met and MAO-B intron13 A/G polymorphisms by PCR-RFLP, DHPLC and sequencing. Chi-square and logistic regression model were used in the analysis. 176 PD cases and 354 controls were enrolled in this study. 23.9% cases are smokers, compared to 48.0% in controls. Ever smoking is inversely associated with PD (odds ratio=0.14, 95% CI 0.08-0.26, adjusted for age and gender). None of the above-mentioned genetic polymorphisms was associated with PD risk or smoking. When each variant was included in the logistic regression model, the inverse association between smoking and PD remained the same, and the interactions between smoking and variants were not significant in the model. Our data support a reduction of PD risk associated with smoking in a Chinese population. These variants of genes associated with DA uptake and metabolism do not affect the inverse association between smoking and PD. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  14. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  15. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  16. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  17. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  18. Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

    Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

    2015-12-01

    In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  19. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  20. Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli.

    Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada

    2002-07-01

    Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.

  1. In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.

    Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj

    2014-12-01

    Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.

  2. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  3. Replication of alfalfa mosaic virus RNA 3 with movement and coat protein genes replaced by corresponding genes of Prunus necrotic ringspot ilarvirus.

    Sánchez-Navarro, J A; Reusken, C B; Bol, J F; Pallás, V

    1997-12-01

    Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) are tripartite positive-strand RNA plant viruses that encode functionally similar translation products. Although the two viruses are phylogenetically closely related, they infect a very different range of natural hosts. The coat protein (CP) gene, the movement protein (MP) gene or both genes in AMV RNA 3 were replaced by the corresponding genes of PNRSV. The chimeric viruses were tested for heterologous encapsidation, replication in protoplasts from plants transformed with AMV replicase genes P1 and P2 (P12 plants) and for cell-to-cell transport in P12 plants. The chimeric viruses exhibited basic competence for encapsidation and replication in P12 protoplasts and for a low level of cell-to-cell movement in P12 plants. The potential involvement of the MP gene in determining host specificity in ilarviruses is discussed.

  4. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  5. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  6. In Vivo Testing of MicroRNA-Mediated Gene Knockdown in Zebrafish

    Ivone Un San Leong

    2012-01-01

    Full Text Available The zebrafish (Danio rerio has become an attractive model for human disease modeling as there are a large number of orthologous genes that encode similar proteins to those found in humans. The number of tools available to manipulate the zebrafish genome is limited and many currently used techniques are only effective during early development (such as morpholino-based antisense technology or it is phenotypically driven and does not offer targeted gene knockdown (such as chemical mutagenesis. The use of RNA interference has been met with controversy as off-target effects can make interpreting phenotypic outcomes difficult; however, this has been resolved by creating zebrafish lines that contain stably integrated miRNA constructs that target the desired gene of interest. In this study, we show that a commercially available miRNA vector system with a mouse-derived miRNA backbone is functional in zebrafish and is effective in causing eGFP knockdown in a transient in vivo eGFP sensor assay system. We chose to apply this system to the knockdown of transcripts that are implicated in the human cardiac disorder, Long QT syndrome.

  7. Maternally Expressed Gene 3, an imprinted non-coding RNA gene, is associated with meningioma pathogenesis and progression

    Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne

    2010-01-01

    Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190

  8. High throughput 16S rRNA gene amplicon sequencing

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  9. Functional diversification upon leader protease domain duplication in the Citrus tristeza virus genome: Role of RNA sequences and the encoded proteins.

    Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y

    2018-01-15

    Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  11. Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

    hart, Leen M; Hansen, Torben; Rietveld, Ingrid

    2005-01-01

    Previously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA synthetase...... gene (LARS2), involved in aminoacylation of tRNA(Leu(UUR)), associate with type 2 diabetes. Direct sequencing of LARS2 cDNA from 25 type 2 diabetic subjects revealed eight single nucleotide polymorphisms. Two of the variants were examined in 7,836 subjects from four independent populations...... in the Netherlands and Denmark. A -109 g/a variant was not associated with type 2 diabetes. Allele frequencies for the other variant, H324Q, were 3.5% in type 2 diabetic and 2.7% in control subjects, respectively. The common odds ratio across all four studies was 1.40 (95% CI 1.12-1.76), P = 0.004. There were...

  12. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  13. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  14. RNA interference: learning gene knock-down from cell physiology

    Provenzano Maurizio

    2004-11-01

    Full Text Available Summary Over the past decade RNA interference (RNAi has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design.

  15. RNA interference: learning gene knock-down from cell physiology

    Mocellin, Simone; Provenzano, Maurizio

    2004-01-01

    Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

  16. miRNA-Processing Gene Methylation and Cancer Risk.

    Joyce, Brian T; Zheng, Yinan; Zhang, Zhou; Liu, Lei; Kocherginsky, Masha; Murphy, Robert; Achenbach, Chad J; Musa, Jonah; Wehbe, Firas; Just, Allan; Shen, Jincheng; Vokonas, Pantel; Schwartz, Joel; Baccarelli, Andrea A; Hou, Lifang

    2018-05-01

    Background: Dysregulation of miRNA and methylation levels are epigenetic hallmarks of cancer, potentially linked via miRNA-processing genes. Studies have found genetic alterations to miRNA-processing genes in cancer cells and human population studies. Our objective was to prospectively examine changes in DNA methylation of miRNA-processing genes and their associations with cancer risk. Methods: We examined cohort data from the Department of Veterans' Affairs Normative Aging Study. Participants were assessed every 3 to 5 years starting in 1999 through 2013 including questionnaires, medical record review, and blood collection. Blood from 686 consenting participants was analyzed using the Illumina 450K BeadChip array to measure methylation at CpG sites throughout the genome. We selected 19 genes based on a literature review, with 519 corresponding CpG sites. We then used Cox proportional hazards models to examine associations with cancer incidence, and generalized estimating equations to examine associations with cancer prevalence. Associations at false discovery rate time to cancer development (positively for cg06751583, inversely for cg23230564 and cg21034183), whereas methylation of one CpG site ( DROSHA : cg16131300) was positively associated with cancer prevalence. Conclusions: DNA methylation of DROSHA , a key miRNA-processing gene, and TNRC6B may play a role in early carcinogenesis. Impact: Changes in miRNA processing may exert multiple effects on cancer development, including protecting against it via altered global miRNAs, and may be a useful early detection biomarker of cancer. Cancer Epidemiol Biomarkers Prev; 27(5); 550-7. ©2018 AACR . ©2018 American Association for Cancer Research.

  17. RNA-Seq for gene identification and transcript profiling of three Stevia rebaudiana genotypes.

    Chen, Junwen; Hou, Kai; Qin, Peng; Liu, Hongchang; Yi, Bin; Yang, Wenting; Wu, Wei

    2014-07-07

    Stevia (Stevia rebaudiana) is an important medicinal plant that yields diterpenoid steviol glycosides (SGs). SGs are currently used in the preparation of medicines, food products and neutraceuticals because of its sweetening property (zero calories and about 300 times sweeter than sugar). Recently, some progress has been made in understanding the biosynthesis of SGs in Stevia, but little is known about the molecular mechanisms underlying this process. Additionally, the genomics of Stevia, a non-model species, remains uncharacterized. The recent advent of RNA-Seq, a next generation sequencing technology, provides an opportunity to expand the identification of Stevia genes through in-depth transcript profiling. We present a comprehensive landscape of the transcriptome profiles of three genotypes of Stevia with divergent SG compositions characterized using RNA-seq. 191,590,282 high-quality reads were generated and then assembled into 171,837 transcripts with an average sequence length of 969 base pairs. A total of 80,160 unigenes were annotated, and 14,211 of the unique sequences were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes. Gene sequences of all enzymes known to be involved in SG synthesis were examined. A total of 143 UDP-glucosyltransferase (UGT) unigenes were identified, some of which might be involved in SG biosynthesis. The expression patterns of eight of these genes were further confirmed by RT-QPCR. RNA-seq analysis identified candidate genes encoding enzymes responsible for the biosynthesis of SGs in Stevia, a non-model plant without a reference genome. The transcriptome data from this study yielded new insights into the process of SG accumulation in Stevia. Our results demonstrate that RNA-Seq can be successfully used for gene identification and transcript profiling in a non-model species.

  18. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  19. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  20. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  1. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  2. Cloning of human genes encoding novel G protein-coupled receptors

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  3. Rift Valley fever virus NS{sub S} gene expression correlates with a defect in nuclear mRNA export

    Copeland, Anna Maria; Van Deusen, Nicole M.; Schmaljohn, Connie S., E-mail: Connie.s.schmaljohn.civ@mail.mil

    2015-12-15

    We investigated the localization of host mRNA during Rift Valley fever virus (RVFV) infection. Fluorescence in situ hybridization revealed that infection with RVFV altered the localization of host mRNA. mRNA accumulated in the nuclei of RVFV-infected but not mock-infected cells. Further, overexpression of the NS{sub S} gene, but not the N, G{sub N} or NS{sub M} genes correlated with mRNA nuclear accumulation. Nuclear accumulation of host mRNA was not observed in cells infected with a strain of RVFV lacking the gene encoding NS{sub S}, confirming that expression of NS{sub S} is likely responsible for this phenomenon. - Highlights: • Rift Valley fever virus (RVFV) infection alters the localization of host mRNA. • mRNA accumulates in the nuclei of RVFV-infected but not mock-infected cells. • NS{sub S} is likely responsible for mRNA relocalization to the nucleus.

  4. A Regulatory RNA Inducing Transgenerationally Inherited Phenotypes

    Jensen, Lea Møller

    . The variation in Arabidopsis enables different regulatory networks and mechanisms to shape the phenotypic characteristics. The thesis describes the identification of regulatory RNA encoded by an enzyme encoding gene. The RNA regulates by inducing transgenerationally inherited phenotypes. The function of the RNA...... is dependent on the genetic background illustrating that polymorphisms are found in either interactors or target genes of the RNA. Furthermore, the RNA provides a mechanistic link between accumulation of glucosinolate and onset of flowering....

  5. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  6. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  7. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  8. Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

    Chisholm, G.E.; Summers, W.C.

    1986-01-01

    The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

  9. Reconstruction of ribosomal RNA genes from metagenomic data.

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  10. LNA-antisense rivals siRNA for gene silencing

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

  11. Computational prediction of miRNA genes from small RNA sequencing data

    Wenjing eKang

    2015-01-01

    Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.

  12. Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

    Shuhua Zhan

    Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

  13. RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

    Michele Gusberti

    Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

  14. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  15. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  16. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

    2018-01-01

    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

  17. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  18. Unravelling the complexity of microRNA-mediated gene regulation in black pepper (Piper nigrum L.) using high-throughput small RNA profiling.

    Asha, Srinivasan; Sreekumar, Sweda; Soniya, E V

    2016-01-01

    Analysis of high-throughput small RNA deep sequencing data, in combination with black pepper transcriptome sequences revealed microRNA-mediated gene regulation in black pepper ( Piper nigrum L.). Black pepper is an important spice crop and its berries are used worldwide as a natural food additive that contributes unique flavour to foods. In the present study to characterize microRNAs from black pepper, we generated a small RNA library from black pepper leaf and sequenced it by Illumina high-throughput sequencing technology. MicroRNAs belonging to a total of 303 conserved miRNA families were identified from the sRNAome data. Subsequent analysis from recently sequenced black pepper transcriptome confirmed precursor sequences of 50 conserved miRNAs and four potential novel miRNA candidates. Stem-loop qRT-PCR experiments demonstrated differential expression of eight conserved miRNAs in black pepper. Computational analysis of targets of the miRNAs showed 223 potential black pepper unigene targets that encode diverse transcription factors and enzymes involved in plant development, disease resistance, metabolic and signalling pathways. RLM-RACE experiments further mapped miRNA-mediated cleavage at five of the mRNA targets. In addition, miRNA isoforms corresponding to 18 miRNA families were also identified from black pepper. This study presents the first large-scale identification of microRNAs from black pepper and provides the foundation for the future studies of miRNA-mediated gene regulation of stress responses and diverse metabolic processes in black pepper.

  19. Development of a universal RNA beacon for exogenous gene detection.

    Guo, Yuanjian; Lu, Zhongju; Cohen, Ira Stephen; Scarlata, Suzanne

    2015-05-01

    Stem cell therapy requires a nontoxic and high-throughput method to achieve a pure cell population to prevent teratomas that can occur if even one cell in the implant has not been transformed. A promising method to detect and separate cells expressing a particular gene is RNA beacon technology. However, developing a successful, specific beacon to a particular transfected gene can take months to develop and in some cases is impossible. Here, we report on an off-the-shelf universal beacon that decreases the time and cost of applying beacon technology to select any living cell population transfected with an exogenous gene. ©AlphaMed Press.

  20. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  1. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  2. An intronic microRNA silences genes that are functionally antagonistic to its host gene.

    Barik, Sailen

    2008-09-01

    MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

  3. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  4. Computational fitness landscape for all gene-order permutations of an RNA virus.

    Kwang-il Lim

    2009-02-01

    Full Text Available How does the growth of a virus depend on the linear arrangement of genes in its genome? Answering this question may enhance our basic understanding of virus evolution and advance applications of viruses as live attenuated vaccines, gene-therapy vectors, or anti-tumor therapeutics. We used a mathematical model for vesicular stomatitis virus (VSV, a prototype RNA virus that encodes five genes (N-P-M-G-L, to simulate the intracellular growth of all 120 possible gene-order variants. Simulated yields of virus infection varied by 6,000-fold and were found to be most sensitive to gene-order permutations that increased levels of the L gene transcript or reduced levels of the N gene transcript, the lowest and highest expressed genes of the wild-type virus, respectively. Effects of gene order on virus growth also depended upon the host-cell environment, reflecting different resources for protein synthesis and different cell susceptibilities to infection. Moreover, by computationally deleting intergenic attenuations, which define a key mechanism of transcriptional regulation in VSV, the variation in growth associated with the 120 gene-order variants was drastically narrowed from 6,000- to 20-fold, and many variants produced higher progeny yields than wild-type. These results suggest that regulation by intergenic attenuation preceded or co-evolved with the fixation of the wild type gene order in the evolution of VSV. In summary, our models have begun to reveal how gene functions, gene regulation, and genomic organization of viruses interact with their host environments to define processes of viral growth and evolution.

  5. Exogenous mRNA encoding tetanus or botulinum neurotoxins expressed in Aplysia neurons

    Mochida, Sumiko; Poulain, Bernard; Eisel, Ulrich; Binz, Thomas; Kurazono, Hisao; Niemann, Heiner; Tauc, Ladislav; Bullock, Theodore H.

    1990-01-01

    Injection of exogenous mRNA purified from various tissue preparations into cellular translation systems such as Xenopus oocytes has allowed expression of complex proteins (e.g., receptors for neurotransmitters). No evidence for expression of injected exogenous mRNA, however, has been reported in

  6. Characterization of the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast

    Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan); Tani, Tokio, E-mail: ttani@sci.kumamoto-u.ac.jp [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan)

    2012-02-03

    Highlights: Black-Right-Pointing-Pointer We cloned the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast. Black-Right-Pointing-Pointer The ptr5{sup +} gene was found to encode nucleoporin 85 (Nup85). Black-Right-Pointing-Pointer Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. Black-Right-Pointing-Pointer Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. Black-Right-Pointing-Pointer Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A){sup +} RNA transport] 1 to 11, which accumulate poly(A){sup +} RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5-1 mutant shows dots- or a ring-like accumulation of poly(A){sup +} RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5{sup +} gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5-1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5-1 mutation. In addition, we found that the ptr5-1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5-1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.

  7. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    Dam, M; Douthwaite, S; Tenson, T

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore......, the erythromycin resistance determinant in the mutants was shown to be confined to a small 23 S rRNA segment containing the coding region and the ribosome binding site of the E-peptide open reading frame. It thus appears that the domain II mutations mediate erythromycin resistance by increasing expression...

  8. The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

    Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

    2014-02-13

    Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  10. RNA-Generated and Gene-Edited Induced Pluripotent Stem Cells for Disease Modeling and Therapy.

    Kehler, James; Greco, Marianna; Martino, Valentina; Pachiappan, Manickam; Yokoe, Hiroko; Chen, Alice; Yang, Miranda; Auerbach, Jonathan; Jessee, Joel; Gotte, Martin; Milanesi, Luciano; Albertini, Alberto; Bellipanni, Gianfranco; Zucchi, Ileana; Reinbold, Rolland A; Giordano, Antonio

    2017-06-01

    Cellular reprogramming by epigenomic remodeling of chromatin holds great promise in the field of human regenerative medicine. As an example, human-induced Pluripotent Stem Cells (iPSCs) obtained by reprograming of patient somatic cells are sufficiently similar to embryonic stem cells (ESCs) and can generate all cell types of the human body. Clinical use of iPSCs is dependent on methods that do not utilize genome altering transgenic technologies that are potentially unsafe and ethically unacceptable. Transient delivery of exogenous RNA into cells provides a safer reprogramming system to transgenic approaches that rely on exogenous DNA or viral vectors. RNA reprogramming may prove to be more suitable for clinical applications and provide stable starting cell lines for gene-editing, isolation, and characterization of patient iPSC lines. The introduction and rapid evolution of CRISPR/Cas9 gene-editing systems has provided a readily accessible research tool to perform functional human genetic experiments. Similar to RNA reprogramming, transient delivery of mRNA encoding Cas9 in combination with guide RNA sequences to target specific points in the genome eliminates the risk of potential integration of Cas9 plasmid constructs. We present optimized RNA-based laboratory procedure for making and editing iPSCs. In the near-term these two powerful technologies are being harnessed to dissect mechanisms of human development and disease in vitro, supporting both basic, and translational research. J. Cell. Physiol. 232: 1262-1269, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  11. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  12. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  13. Using RNA-Seq Data to Evaluate Reference Genes Suitable for Gene Expression Studies in Soybean.

    Aldrin Kay-Yuen Yim

    Full Text Available Differential gene expression profiles often provide important clues for gene functions. While reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is an important tool, the validity of the results depends heavily on the choice of proper reference genes. In this study, we employed new and published RNA-sequencing (RNA-Seq datasets (26 sequencing libraries in total to evaluate reference genes reported in previous soybean studies. In silico PCR showed that 13 out of 37 previously reported primer sets have multiple targets, and 4 of them have amplicons with different sizes. Using a probabilistic approach, we identified new and improved candidate reference genes. We further performed 2 validation tests (with 26 RNA samples on 8 commonly used reference genes and 7 newly identified candidates, using RT-qPCR. In general, the new candidate reference genes exhibited more stable expression levels under the tested experimental conditions. The three newly identified candidate reference genes Bic-C2, F-box protein2, and VPS-like gave the best overall performance, together with the commonly used ELF1b. It is expected that the proposed probabilistic model could serve as an important tool to identify stable reference genes when more soybean RNA-Seq data from different growth stages and treatments are used.

  14. Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: Evidence for differential gene expression

    Kim, Sunyoung; Baltimore, D.; Byrn, R.; Groopman, J.

    1989-01-01

    The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4 + lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes

  15. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  16. Impact of haloperidol and quetiapine on the expression of genes encoding antioxidant enzymes in human neuroblastoma SH-SY5Y cells.

    Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip

    2009-05-01

    Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.

  17. Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes.

    Thomas Birkballe Hansen

    Full Text Available BACKGROUND: miRNAs are key players in gene expression regulation. To fully understand the complex nature of cellular differentiation or initiation and progression of disease, it is important to assess the expression patterns of as many miRNAs as possible. Thereby, identifying novel miRNAs is an essential prerequisite to make possible a comprehensive and coherent understanding of cellular biology. METHODOLOGY/PRINCIPAL FINDINGS: Based on two extensive, but previously published, small RNA sequence datasets from human embryonic stem cells and human embroid bodies, respectively [1], we identified 112 novel miRNA-like structures and were able to validate miRNA processing in 12 out of 17 investigated cases. Several miRNA candidates were furthermore substantiated by including additional available small RNA datasets, thereby demonstrating the power of combining datasets to identify miRNAs that otherwise may be assigned as experimental noise. CONCLUSIONS/SIGNIFICANCE: Our analysis highlights that existing datasets are not yet exhaustedly studied and continuous re-analysis of the available data is important to uncover all features of small RNA sequencing.

  18. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  19. The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

    Keebaugh, Alaine C; Thomas, James W

    2010-06-01

    Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

  20. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  1. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  2. Small RNA-Controlled Gene Regulatory Networks in Pseudomonas putida

    Bojanovic, Klara

    evolved numerous mechanisms to controlgene expression in response to specific environmental signals. In addition to two-component systems, small regulatory RNAs (sRNAs) have emerged as major regulators of gene expression. The majority of sRNAs bind to mRNA and regulate their expression. They often have...... multiple targets and are incorporated into large regulatory networks and the RNA chaper one Hfq in many cases facilitates interactions between sRNAs and their targets. Some sRNAs also act by binding to protein targets and sequestering their function. In this PhD thesis we investigated the transcriptional....... Detailed insights into the mechanisms through which P. putida responds to different stress conditions and increased understanding of bacterial adaptation in natural and industrial settings were gained. Additionally, we identified genome-wide transcription start sites, andmany regulatory RNA elements...

  3. Characterization of TRZ1, a yeast homolog of the human candidate prostate cancer susceptibility gene ELAC2 encoding tRNase Z

    Chen Yuan

    2005-05-01

    Full Text Available Abstract Background In humans, mutation of ELAC2 is associated with an increased risk of prostate cancer. ELAC2 has been shown to have tRNase Z activity and is associated with the γ-tubulin complex. Results In this work, we show that the yeast homolog of ELAC2, encoded by TRZ1 (tRNase Z 1, is involved genetically in RNA processing. The temperature sensitivity of a trz1 mutant can be rescued by multiple copies of REX2, which encodes a protein with RNA 3' processing activity, suggesting a role of Trz1p in RNA processing in vivo. Trz1p has two putative nucleotide triphosphate-binding motifs (P-loop and a conserved histidine motif. The histidine motif and the putative nucleotide binding motif at the C-domain are important for Trz1p function because mutant proteins bearing changes to the critical residues in these motifs are unable to rescue deletion of TRZ1. The growth defect exhibited by trz1 yeast is not complemented by the heterologous ELAC2, suggesting that Trz1p may have additional functions in yeast. Conclusion Our results provide genetic evidence that prostate cancer susceptibility gene ELAC2 may be involved in RNA processing, especially rRNA processing and mitochondrial function.

  4. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  5. Dinucleotide controlled null models for comparative RNA gene prediction

    Gesell Tanja

    2008-05-01

    Full Text Available Abstract Background Comparative prediction of RNA structures can be used to identify functional noncoding RNAs in genomic screens. It was shown recently by Babak et al. [BMC Bioinformatics. 8:33] that RNA gene prediction programs can be biased by the genomic dinucleotide content, in particular those programs using a thermodynamic folding model including stacking energies. As a consequence, there is need for dinucleotide-preserving control strategies to assess the significance of such predictions. While there have been randomization algorithms for single sequences for many years, the problem has remained challenging for multiple alignments and there is currently no algorithm available. Results We present a program called SISSIz that simulates multiple alignments of a given average dinucleotide content. Meeting additional requirements of an accurate null model, the randomized alignments are on average of the same sequence diversity and preserve local conservation and gap patterns. We make use of a phylogenetic substitution model that includes overlapping dependencies and site-specific rates. Using fast heuristics and a distance based approach, a tree is estimated under this model which is used to guide the simulations. The new algorithm is tested on vertebrate genomic alignments and the effect on RNA structure predictions is studied. In addition, we directly combined the new null model with the RNAalifold consensus folding algorithm giving a new variant of a thermodynamic structure based RNA gene finding program that is not biased by the dinucleotide content. Conclusion SISSIz implements an efficient algorithm to randomize multiple alignments preserving dinucleotide content. It can be used to get more accurate estimates of false positive rates of existing programs, to produce negative controls for the training of machine learning based programs, or as standalone RNA gene finding program. Other applications in comparative genomics that require

  6. Dinucleotide controlled null models for comparative RNA gene prediction.

    Gesell, Tanja; Washietl, Stefan

    2008-05-27

    Comparative prediction of RNA structures can be used to identify functional noncoding RNAs in genomic screens. It was shown recently by Babak et al. [BMC Bioinformatics. 8:33] that RNA gene prediction programs can be biased by the genomic dinucleotide content, in particular those programs using a thermodynamic folding model including stacking energies. As a consequence, there is need for dinucleotide-preserving control strategies to assess the significance of such predictions. While there have been randomization algorithms for single sequences for many years, the problem has remained challenging for multiple alignments and there is currently no algorithm available. We present a program called SISSIz that simulates multiple alignments of a given average dinucleotide content. Meeting additional requirements of an accurate null model, the randomized alignments are on average of the same sequence diversity and preserve local conservation and gap patterns. We make use of a phylogenetic substitution model that includes overlapping dependencies and site-specific rates. Using fast heuristics and a distance based approach, a tree is estimated under this model which is used to guide the simulations. The new algorithm is tested on vertebrate genomic alignments and the effect on RNA structure predictions is studied. In addition, we directly combined the new null model with the RNAalifold consensus folding algorithm giving a new variant of a thermodynamic structure based RNA gene finding program that is not biased by the dinucleotide content. SISSIz implements an efficient algorithm to randomize multiple alignments preserving dinucleotide content. It can be used to get more accurate estimates of false positive rates of existing programs, to produce negative controls for the training of machine learning based programs, or as standalone RNA gene finding program. Other applications in comparative genomics that require randomization of multiple alignments can be considered. SISSIz

  7. A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

    Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

    2014-06-01

    Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

  8. Identification of putative noncoding RNA genes in the Burkholderia cenocepacia J2315 genome

    Coenye, T.; Drevinek, P.; Mahenthiralingam, E.

    2007-01-01

    Noncoding RNA (ncRNA) genes are not involved in the production of mRNA and proteins, but produce transcripts that function directly as structural or regulatory RNAs. In the present study, the presence of ncRNA genes in the genome of Burkholderia cenocepacia J2315 was evaluated by combining...

  9. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  10. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  11. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  12. Characterization of cDNAs encoding human leukosialin and localization of the leukosialin gene to chromosome 16

    Pallant, A.; Eskenazi, A.; Frelinger, J.G.; Mattei, M.G.; Fournier, R.E.K.; Carlsson, S.R.; Fukuda, M.

    1989-01-01

    The authors describe the isolation and characterization of cDNA clones encoding human leukosialin, a major sialoglycoprotein of human leukocytes. Leukosialin is very closely related or identical to the sialophorin molecule, which is involved in T-cell proliferation and whose expression is altered in Wiskott-Aldrich syndrome (WAS), an X-chromosome-linked immunodeficiency disease. Using a rabbit antiserum to leukosialin, a cDNA clone was isolated from a λgt11 cDNA library constructed from human peripheral blood cells. The λgt11 clone was used to isolate longer cDNA clones that correspond to the entire coding sequence of leukosialin. DNA sequence analysis reveals three domains in the predicted mature protein. The extracellular domain is enriched for Ser, Thr, and Pro and contains four contiguous 18-amino acid repeats. The transmembrane and intracellular domains of the human leukosialin molecule are highly homologous to the rat W3/13 molecule. RNA gel blot analysis reveals two polyadenylylated species of 2.3 and 8 kilobases. Southern blot analysis suggests that human leukosialin is a single-copy gene. Analysis of monochromosomal cell hybrids indicates that the leukosialin gene is not X chromosome linked and in situ hybridization shows leukosialin is located on chromosome 16. These findings demonstrate that the primary mutation in WAS is not a defect in the structural gene for leukosialin

  13. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  14. Avian reovirus L2 genome segment sequences and predicted structure/function of the encoded RNA-dependent RNA polymerase protein

    Xu Wanhong

    2008-12-01

    Full Text Available Abstract Background The orthoreoviruses are infectious agents that possess a genome comprised of 10 double-stranded RNA segments encased in two concentric protein capsids. Like virtually all RNA viruses, an RNA-dependent RNA polymerase (RdRp enzyme is required for viral propagation. RdRp sequences have been determined for the prototype mammalian orthoreoviruses and for several other closely-related reoviruses, including aquareoviruses, but have not yet been reported for any avian orthoreoviruses. Results We determined the L2 genome segment nucleotide sequences, which encode the RdRp proteins, of two different avian reoviruses, strains ARV138 and ARV176 in order to define conserved and variable regions within reovirus RdRp proteins and to better delineate structure/function of this important enzyme. The ARV138 L2 genome segment was 3829 base pairs long, whereas the ARV176 L2 segment was 3830 nucleotides long. Both segments were predicted to encode λB RdRp proteins 1259 amino acids in length. Alignments of these newly-determined ARV genome segments, and their corresponding proteins, were performed with all currently available homologous mammalian reovirus (MRV and aquareovirus (AqRV genome segment and protein sequences. There was ~55% amino acid identity between ARV λB and MRV λ3 proteins, making the RdRp protein the most highly conserved of currently known orthoreovirus proteins, and there was ~28% identity between ARV λB and homologous MRV and AqRV RdRp proteins. Predictive structure/function mapping of identical and conserved residues within the known MRV λ3 atomic structure indicated most identical amino acids and conservative substitutions were located near and within predicted catalytic domains and lining RdRp channels, whereas non-identical amino acids were generally located on the molecule's surfaces. Conclusion The ARV λB and MRV λ3 proteins showed the highest ARV:MRV identity values (~55% amongst all currently known ARV and MRV

  15. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  16. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  17. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  18. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  19. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  20. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  1. Deletion of the Sm1 encoding motif in the lsm gene results in distinct changes in the transcriptome and enhanced swarming activity of Haloferax cells.

    Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita

    2015-10-01

    Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  3. miRNA-mediated 'tug-of-war' model reveals ceRNA propensity of genes in cancers.

    Swain, Arpit Chandan; Mallick, Bibekanand

    2018-06-01

    Competing endogenous RNA (ceRNA) are transcripts that cross-regulate each other at the post-transcriptional level by competing for shared microRNA response elements (MREs). These have been implicated in various biological processes impacting cell-fate decisions and diseases including cancer. There are several studies that predict possible ceRNA pairs by adopting various machine-learning and mathematical approaches; however, there is no method that enables us to gauge as well as compare the propensity of the ceRNA of a gene and precisely envisages which among a pair exerts a stronger pull on the shared miRNA pool. In this study, we developed a method that uses the 'tug of war of genes' concept to predict and quantify ceRNA potential of a gene for the shared miRNA pool in cancers based on a score represented by SoCeR (score of competing endogenous RNA). The method was executed on the RNA-Seq transcriptional profiles of genes and miRNA available at TCGA along with CLIP-supported miRNA-target sites to predict ceRNA in 32 cancer types which were validated with already reported cases. The proposed method can be used to determine the sequestering capability of the gene of interest as well as in ranking the probable ceRNA candidates of a gene. Finally, we developed standalone applications (SoCeR tool) to aid researchers in easier implementation of the method in analysing different data sets or diseases. © 2018 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.

  4. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  5. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  6. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  7. Identification of cytokinin-responsive genes using microarray meta-analysis and RNA-Seq in Arabidopsis.

    Bhargava, Apurva; Clabaugh, Ivory; To, Jenn P; Maxwell, Bridey B; Chiang, Yi-Hsuan; Schaller, G Eric; Loraine, Ann; Kieber, Joseph J

    2013-05-01

    Cytokinins are N(6)-substituted adenine derivatives that play diverse roles in plant growth and development. We sought to define a robust set of genes regulated by cytokinin as well as to query the response of genes not represented on microarrays. To this end, we performed a meta-analysis of microarray data from a variety of cytokinin-treated samples and used RNA-seq to examine cytokinin-regulated gene expression in Arabidopsis (Arabidopsis thaliana). Microarray meta-analysis using 13 microarray experiments combined with empirically defined filtering criteria identified a set of 226 genes differentially regulated by cytokinin, a subset of which has previously been validated by other methods. RNA-seq validated about 73% of the up-regulated genes identified by this meta-analysis. In silico promoter analysis indicated an overrepresentation of type-B Arabidopsis response regulator binding elements, consistent with the role of type-B Arabidopsis response regulators as primary mediators of cytokinin-responsive gene expression. RNA-seq analysis identified 73 cytokinin-regulated genes that were not represented on the ATH1 microarray. Representative genes were verified using quantitative reverse transcription-polymerase chain reaction and NanoString analysis. Analysis of the genes identified reveals a substantial effect of cytokinin on genes encoding proteins involved in secondary metabolism, particularly those acting in flavonoid and phenylpropanoid biosynthesis, as well as in the regulation of redox state of the cell, particularly a set of glutaredoxin genes. Novel splicing events were found in members of some gene families that are known to play a role in cytokinin signaling or metabolism. The genes identified in this analysis represent a robust set of cytokinin-responsive genes that are useful in the analysis of cytokinin function in plants.

  8. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  9. Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

    Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

    2017-01-01

    Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

  10. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  11. Identification of a novel splice variant of human PD-L1 mRNA encoding an isoform-lacking Igv-like domain.

    He, Xian-hui; Xu, Li-hui; Liu, Yi

    2005-04-01

    To investigate the expression and regulation of PD-1 ligand 1 (PD-L1) in peripheral blood mononuclear cells (PBMC). The cDNA encoding human PD-L1 precursor was cloned from the total RNA extracted from the resting and phorbol dibutyrate plus ionomycin- or phytohemagglutinin-activated PBMC, by reverse transcription polymerase chain reaction (RT-PCR), and independent clones were sequenced and analyzed. The expression and subcellular localization were examined in transiently transfected cells. The PD-L1 gene expression in different PBMC was also analyzed by RT-PCR. A novel human PD-L1 splice variant was identified from the activated PBMC. It was generated by splicing out exon? encoding an immunoglobulin variable domain (Igv)-like domain but retaining all other exons without a frame-shift. Consequently, the putative translated protein contained all other domains including the transmembrane region except for the Igv-like domain. Furthermore, the conventional isoform was expressed on the plasma surface whereas the novel isoform showed a pattern of intracellular membrane distribution in transiently transfected K562 cells. In addition, the expression pattern of the PD-L1 splice variant was variable in different individuals and in different cellular status. PD-L1 expression may be regulated at the posttranscriptional level through alternative splicing, and modulation of the PD-L1 isoform expression may influence the outcome of specific immune responses in the peripheral tissues.

  12. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  13. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  15. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  16. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  17. MicroRNA Dysregulation, Gene Networks, and Risk for Schizophrenia in 22q11.2 Deletion Syndrome

    Merico, Daniele; Costain, Gregory; Butcher, Nancy J.; Warnica, William; Ogura, Lucas; Alfred, Simon E.; Brzustowicz, Linda M.; Bassett, Anne S.

    2014-01-01

    The role of microRNAs (miRNAs) in the etiology of schizophrenia is increasingly recognized. Microdeletions at chromosome 22q11.2 are recurrent structural variants that impart a high risk for schizophrenia and are found in up to 1% of all patients with schizophrenia. The 22q11.2 deletion region overlaps gene DGCR8, encoding a subunit of the miRNA microprocessor complex. We identified miRNAs overlapped by the 22q11.2 microdeletion and for the first time investigated their predicted target genes...

  18. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage

    Morgan, E.A.; Nomura, M.

    1979-01-01

    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA 1 /sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA 1 /sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA 1 /sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage

  19. Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

    Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

    2013-01-30

    Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

  20. Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant.

    Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping

    2017-08-15

    Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N

  1. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  2. Detailed analysis of putative genes encoding small proteins in legume genomes

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  3. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  4. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  5. Dicer and Argonaute Genes Involved in RNA Interference in the Entomopathogenic Fungus Metarhizium robertsii.

    Meng, Huimin; Wang, Zhangxun; Wang, Yulong; Zhu, Hong; Huang, Bo

    2017-04-01

    RNA interference (RNAi) is a gene-silencing mechanism that plays an important role in gene regulation in a number of eukaryotic organisms. Two core components, Dicer and Argonaute, are central in the RNAi machinery. However, the physiological roles of Dicer and Argonaute in the entomopathogenic fungus Metarhizium robertsii have remained unclear. Here, the roles of genes encoding Dicer ( M. robertsii dcl1 [ Mrdcl1 ] and Mrdcl2 ) and Argonaute ( Mrago1 and Mrago2 ) proteins in M. robertsii were investigated. The results showed that the Dicer-like protein MrDCL2 and Argonaute protein MrAGO1 are the major components of the RNAi process occurring in M. robertsii The Dicer and Argonaute genes were not involved in the regulation of growth and diverse abiotic stress response in M. robertsii under the tested conditions. Moreover, our results showed that the Dicer and Argonaute gene mutants demonstrated reduced abilities to produce conidia, compared to the wild type (WT) and the gene-rescued mutant. In particular, the conidial yields in the Δ dcl2 and Δ ago1 mutants were reduced by 55.8% and 59.3%, respectively, compared with those from the control strains. Subsequently, for the WT and Δ dcl2 mutant strains, digital gene expression (DGE) profiling analysis of the stage of mycelium growth and conidiogenesis revealed that modest changes occur in development or metabolism processes, which may explain the reduction in conidiation in the Δ dcl2 mutant. In addition, we further applied high-throughput sequencing technology to identify small RNAs (sRNAs) that are differentially expressed in the WT and the Δ dcl2 mutant and found that 4 known microRNA-like small RNAs (milRNAs) and 8 novel milRNAs were Mrdcl2 dependent in M. robertsii IMPORTANCE The identification and characterization of components in RNAi have contributed significantly to our understanding of the mechanism and functions of RNAi in eukaryotes. Here, we found that Dicer and Argonaute genes play an important role

  6. The Obesity-Associated FTO Gene Encodes a 2-Oxoglutarate–Dependent Nucleic Acid Demethylase

    Gerken, Thomas; Girard, Christophe A.; Tung, Yi-Chun Loraine; Webby, Celia J.; Saudek, Vladimir; Hewitson, Kirsty S.; Yeo, Giles S. H.; McDonough, Michael A.; Cunliffe, Sharon; McNeill, Luke A.; Galvanovskis, Juris; Rorsman, Patrik; Robins, Peter; Prieur, Xavier; Coll, Anthony P.; Ma, Marcella; Jovanovic, Zorica; Farooqi, I. Sadaf; Sedgwick, Barbara; Barroso, Inês; Lindahl, Tomas; Ponting, Chris P.; Ashcroft, Frances M.; O'Rahilly, Stephen; Schofield, Christopher J.

    2009-01-01

    Variants in the FTO (fat mass and obesity associated) gene are associated with increased body mass index in humans. Here, we show by bioinformatics analysis that FTO shares sequence motifs with Fe(II)- and 2-oxoglutarate–dependent oxygenases. We find that recombinant murine Fto catalyzes the Fe(II)- and 2OG-dependent demethylation of 3-methylthymine in single-stranded DNA, with concomitant production of succinate, formaldehyde, and carbon dioxide. Consistent with a potential role in nucleic acid demethylation, Fto localizes to the nucleus in transfected cells. Studies of wild-type mice indicate that Fto messenger RNA (mRNA) is most abundant in the brain, particularly in hypothalamic nuclei governing energy balance, and that Fto mRNA levels in the arcuate nucleus are regulated by feeding and fasting. Studies can now be directed toward determining the physiologically relevant FTO substrate and how nucleic acid methylation status is linked to increased fat mass. PMID:17991826

  7. CRISPRstrand: predicting repeat orientations to determine the crRNA-encoding strand at CRISPR loci

    Alkhnbashi, Omer S.; Costa, Fabrizio; Shah, Shiraz Ali

    2014-01-01

    Motivation: The discovery of CRISPR-Cas systems almost 20 years ago rapidly changed our perception of the bacterial and archaeal immune systems. CRISPR loci consist of several repetitive DNA sequences called repeats, inter-spaced by stretches of variable length sequences called spacers. This CRISPR...... array is transcribed and processed into multiple mature RNA species (crRNAs). A single crRNA is integrated into an interference complex, together with CRISPR-associated (Cas) proteins, to bind and degrade invading nucleic acids. Although existing bioinformatics tools can recognize CRISPR loci...... by their characteristic repeat-spacer architecture, they generally output CRISPR arrays of ambiguous orientation and thus do not determine the strand from which crRNAs are processed. Knowledge of the correct orientation is crucial for many tasks, including the classification of CRISPR conservation, the detection...

  8. RNA-seq analysis of overexpressing ovine AANAT gene of melatonin biosynthesis in switchgrass

    Shan Yuan

    2016-08-01

    Full Text Available Melatonin serves important functions in the promotion of growth and anti-stress regulation by efficient radical scavenging and regulation of antioxidant enzyme activity in various plants. To investigate its regulatory roles and metabolism pathways, the transcriptomic profile of overexpressing the ovine arylalkylamine N-acetyltransferase (oAANAT gene, encoding the penultimate enzyme in melatonin biosynthesis, was compared with empty vector (EV control using RNA-seq in switchgrass, a model plant of cellulosic ethanol conversion. The 85.22 million high quality reads that were assembled into 135,684 unigenes were generated by Illumina sequencing for transgenic oAANAT switchgrass with an average sequence length of 716 bp. A total of 946 differential expression genes (DEGs in transgenic line comparing to control switchgrass, including 737 up-regulated and 209 down-regulated genes, were mainly enriched with two main functional patterns of melatonin identifying by gene ontology analysis: the growth regulator and stress tolerance. Furthermore, KEGG maps indicated that the biosynthetic pathways of secondary metabolite (phenylpropanoids, flavonoids, steroids, stilbenoid, diarylheptanoid and gingerol and signaling pathways (MAPK signaling pathway, estrogen signaling pathway were involved in melatonin metabolism. This study substantially expands the transcriptome information for switchgrass and provides valuable clues for identifying candidate genes involved in melatonin biosynthesis and elucidating the mechanism of melatonin metabolism.

  9. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  10. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

    2005-01-01

    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  11. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  12. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  13. The milkweed pod1 gene encodes a KANADI protein that is required for abaxial/adaxial patterning in maize leaves.

    Candela, Héctor; Johnston, Robyn; Gerhold, Abigail; Foster, Toshi; Hake, Sarah

    2008-08-01

    Leaf primordia initiate from the shoot apical meristem with inherent polarity; the adaxial side faces the meristem, while the abaxial side faces away from the meristem. Adaxial/abaxial polarity is thought to be necessary for laminar growth of leaves, as mutants lacking either adaxial or abaxial cell types often develop radially symmetric lateral organs. The milkweed pod1 (mwp1) mutant of maize (Zea mays) has adaxialized sectors in the sheath, the proximal part of the leaf. Ectopic leaf flaps develop where adaxial and abaxial cell types juxtapose. Ectopic expression of the HD-ZIPIII gene rolled leaf1 (rld1) correlates with the adaxialized regions. Cloning of mwp1 showed that it encodes a KANADI transcription factor. Double mutants of mwp1-R with a microRNA-resistant allele of rld1, Rld1-N1990, show a synergistic phenotype with polarity defects in sheath and blade and a failure to differentiate vascular and photosynthetic cell types in the adaxialized sectors. The sectored phenotype and timing of the defect suggest that mwp1 is required late in leaf development to maintain abaxial cell fate. The phenotype of mwp1; Rld1 double mutants shows that both genes are also required early in leaf development to delineate leaf margins as well as to initiate vascular and photosynthetic tissues.

  14. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

  15. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  16. The microRNA machinery regulates fasting-induced changes in gene expression and longevity in Caenorhabditis elegans.

    Kogure, Akiko; Uno, Masaharu; Ikeda, Takako; Nishida, Eisuke

    2017-07-07

    Intermittent fasting (IF) is a dietary restriction regimen that extends the lifespans of Caenorhabditis elegans and mammals by inducing changes in gene expression. However, how IF induces these changes and promotes longevity remains unclear. One proposed mechanism involves gene regulation by microRNAs (miRNAs), small non-coding RNAs (∼22 nucleotides) that repress gene expression and whose expression can be altered by fasting. To test this proposition, we examined the role of the miRNA machinery in fasting-induced transcriptional changes and longevity in C. elegans We revealed that fasting up-regulated the expression of the miRNA-induced silencing complex (miRISC) components, including Argonaute and GW182, and the miRNA-processing enzyme DRSH-1 (the ortholog of the Drosophila Drosha enzyme). Our lifespan measurements demonstrated that IF-induced longevity was suppressed by knock-out or knockdown of miRISC components and was completely inhibited by drsh-1 ablation. Remarkably, drsh-1 ablation inhibited the fasting-induced changes in the expression of the target genes of DAF-16, the insulin/IGF-1 signaling effector in C. elegans Fasting-induced transcriptome alterations were substantially and modestly suppressed in the drsh-1 null mutant and the null mutant of ain-1 , a gene encoding GW182, respectively. Moreover, miRNA array analyses revealed that the expression levels of numerous miRNAs changed after 2 days of fasting. These results indicate that components of the miRNA machinery, especially the miRNA-processing enzyme DRSH-1, play an important role in mediating IF-induced longevity via the regulation of fasting-induced changes in gene expression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

    Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z.

    1990-01-01

    We have synthesized 32 P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies

  18. Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

    Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z. (National Institutes of Health, Bethesda, MD (USA))

    1990-08-01

    We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies.

  19. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  20. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  1. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  2. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  3. Regulation of Gene Expression by DNA Methylation and RNA Editing in Animals

    Li, Qiye

    , there has been growing interest in exploring the modifications occurring at the RNA level, which can impact the fate and function of mRNA. One fascinating type of such modifications is RNA editing, which alters specific nucleotides in transcribed RNA and thus can produce transcripts that are not encoded...... (Heterocephalus glaber), a eusocial mammal living in cooperative colonies. Finally, I introduce a software package that I developed that is specifically designed for the genome-wide identification of RNA-editing sites in animals, with the ultimate aim of promoting the evolutionary and functional study of RNA...... editing in different species....

  4. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  5. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  6. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  7. NMR study of the possible interaction in solution of angiotensin II with a peptide encoded by angiotensin II complementary RNA

    Eaton, H.L.; Fesik, S.W.; Austin, R.E.; Martin, S.F.

    1989-01-01

    The potential binding of angiotensin II (Asp-Arg-Val-Tyr-Ile-His-Pro-Phe) (AII) to a peptide encoded by its complementary RNA (Lys-Gly-Val-Asp-Val-Try-Ala-Val) (IIA) has been studied by monitoring the 1 H NMR spectrum of IIA in aqueous phosphate or Tris·HCl buffer ( 2 H 2 O) as it is titrated with AII. For molar ratios of AII/IIA ranging from 0.2 to 1.8, the NMR spectra are unchanged as compared to the spectra of the isolated peptides. Based on these findings, the K d for the putative biomolecular complex of the two peptides under these conditions is calculated to be >10 -4 M. This result does not support the suggestion of Elton et al. that AII and IIA engage in high-affinity binding (K d ∼ 5 x 10 -8 M) with each other

  8. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

    Dongsheng Li

    Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

  9. Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

    Arthur K Tugume

    Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

  10. Identification of active methanotrophs in a landfill cover soil through detection of expression of 16S rRNA and functional genes.

    Chen, Yin; Dumont, Marc G; Cébron, Aurélie; Murrell, J Colin

    2007-11-01

    Active methanotrophs in a landfill soil were revealed by detecting the 16S rRNA of methanotrophs and the mRNA transcripts of key genes involved in methane oxidation. New 16S rRNA primers targeting type I and type II methanotrophs were designed and optimized for analysis by denaturing gradient gel electrophoresis. Direct extraction of RNA from soil enabled the analysis of the expression of the functional genes: mmoX, pmoA and mxaF, which encode subunits of soluble methane monooxygenase, particulate methane monooxygenase and methanol dehydrogenase respectively. The 16S rRNA polymerase chain reaction (PCR) primers for type I methanotrophs detected Methylomonas, Methylosarcina and Methylobacter sequences from both soil DNA and cDNA which was generated from RNA extracted directly from the landfill cover soil. The 16S rRNA primers for type II methanotrophs detected primarily Methylocella and some Methylocystis 16S rRNA genes. Phylogenetic analysis of mRNA recovered from the soil indicated that Methylobacter, Methylosarcina, Methylomonas, Methylocystis and Methylocella were actively expressing genes involved in methane and methanol oxidation. Transcripts of pmoA but not mmoX were readily detected by reverse transcription polymerase chain reaction (RT-PCR), indicating that particulate methane monooxygenase may be largely responsible for methane oxidation in situ.

  11. Analysis of the complement and molecular evolution of tRNA genes in cow

    Barris Wesley C

    2009-04-01

    Full Text Available Abstract Background Detailed information regarding the number and organization of transfer RNA (tRNA genes at the genome level is becoming readily available with the increase of DNA sequencing of whole genomes. However the identification of functional tRNA genes is challenging for species that have large numbers of repetitive elements containing tRNA derived sequences, such as Bos taurus. Reliable identification and annotation of entire sets of tRNA genes allows the evolution of tRNA genes to be understood on a genomic scale. Results In this study, we explored the B. taurus genome using bioinformatics and comparative genomics approaches to catalogue and analyze cow tRNA genes. The initial analysis of the cow genome using tRNAscan-SE identified 31,868 putative tRNA genes and 189,183 pseudogenes, where 28,830 of the 31,868 predicted tRNA genes were classified as repetitive elements by the RepeatMasker program. We then used comparative genomics to further discriminate between functional tRNA genes and tRNA-derived sequences for the remaining set of 3,038 putative tRNA genes. For our analysis, we used the human, chimpanzee, mouse, rat, horse, dog, chicken and fugu genomes to predict that the number of active tRNA genes in cow lies in the vicinity of 439. Of this set, 150 tRNA genes were 100% identical in their sequences across all nine vertebrate genomes studied. Using clustering analyses, we identified a new tRNA-GlyCCC subfamily present in all analyzed mammalian genomes. We suggest that this subfamily originated from an ancestral tRNA-GlyGCC gene via a point mutation prior to the radiation of the mammalian lineages. Lastly, in a separate analysis we created phylogenetic profiles for each putative cow tRNA gene using a representative set of genomes to gain an overview of common evolutionary histories of tRNA genes. Conclusion The use of a combination of bioinformatics and comparative genomics approaches has allowed the confident identification of a

  12. Citrus psorosis virus RNA 1 is of negative polarity and potentially encodes in its complementary strand a 24K protein of unknown function and 280K putative RNA dependent RNA polymerase.

    Naum-Onganía, Gabriela; Gago-Zachert, Selma; Peña, Eduardo; Grau, Oscar; Garcia, Maria Laura

    2003-10-01

    Citrus psorosis virus (CPsV), the type member of genus Ophiovirus, has three genomic RNAs. Complete sequencing of CPsV RNA 1 revealed a size of 8184 nucleotides and Northern blot hybridization with chain specific probes showed that its non-coding strand is preferentially encapsidated. The complementary strand of RNA 1 contains two open reading frames (ORFs) separated by a 109-nt intergenic region, one located near the 5'-end potentially encoding a 24K protein of unknown function, and another of 280K containing the core polymerase motifs characteristic of viral RNA-dependent RNA polymerases (RdRp). Comparison of the core RdRp motifs of negative-stranded RNA viruses, supports grouping CPsV, Ranunculus white mottle virus (RWMV) and Mirafiori lettuce virus (MiLV) within the same genus (Ophiovirus), constituting a monophyletic group separated from all other negative-stranded RNA viruses. Furthermore, RNAs 1 of MiLV, CPsV and RWMV are similar in size and those of MiLV and CPsV also in genomic organization and sequence.

  13. Human α2-HS-glycoprotein: the A and B chains with a connecting sequence are encoded by a single mRNA transcript

    Lee, C.C.; Bowman, B.H.; Yang, F.

    1987-01-01

    The α 2 -HS-glycoprotein (AHSG) is a plasma protein reported to play roles in bone mineralization and in the immune response. It is composed of two subunits, the A and B chains. Recombinant plasmids containing human cDNA AHSG have been isolated by screening an adult human liver library with a mixed oligonucleotide probe. The cDNA clones containing AHSG inserts span approximately 1.5 kilobase pairs and include the entire AHSG coding sequence, demonstrating that the A and B chains are encoded by a single mRNA transcript. The cDNA sequence predicts an 18-amino-acid signal peptide, followed by the A-chain sequence of AHSG. A heretofore unseen connecting sequence of 40 amino acids was deduced between the A- and B-chain sequences. The connecting sequence demonstrates the unique amino acid doublets and collagen triplets found in the A and B chains; it is not homologous with other reported amino acid sequences. The connecting sequence may be cleaved in a posttranslational step by limited proteolysis before mature AHSG is released into the circulation or may vary in its presence because of alternative processing. The AHSG cDNA was utilized for mapping the AHSG gene to the 3q21→qter region of human chromosome 3. The availability of the AHSG cDNA clone will facilitate the analysis of its genetic control and gene expression during development and bone formation

  14. Activation of pluripotency genes in human fibroblast cells by a novel mRNA based approach.

    Jordan R Plews

    2010-12-01

    Full Text Available Several methods have been used to induce somatic cells to re-enter the pluripotent state. Viral transduction of reprogramming genes yields higher efficiency but involves random insertions of viral sequences into the human genome. Although induced pluripotent stem (iPS cells can be obtained with the removable PiggyBac transposon system or an episomal system, both approaches still use DNA constructs so that resulting cell lines need to be thoroughly analyzed to confirm they are free of harmful genetic modification. Thus a method to change cell fate without using DNA will be very useful in regenerative medicine.In this study, we synthesized mRNAs encoding OCT4, SOX2, cMYC, KLF4 and SV40 large T (LT and electroporated them into human fibroblast cells. Upon transfection, fibroblasts expressed these factors at levels comparable to, or higher than those in human embryonic stem (ES cells. Ectopically expressed OCT4 localized to the cell nucleus within 4 hours after mRNA introduction. Transfecting fibroblasts with a mixture of mRNAs encoding all five factors significantly increased the expression of endogenous OCT4, NANOG, DNMT3β, REX1 and SALL4. When such transfected fibroblasts were also exposed to several small molecules (valproic acid, BIX01294 and 5'-aza-2'-deoxycytidine and cultured in human embryonic stem cell (ES medium they formed small aggregates positive for alkaline phosphatase activity and OCT4 protein within 30 days.Our results demonstrate that mRNA transfection can be a useful approach to precisely control the protein expression level and short-term expression of reprogramming factors is sufficient to activate pluripotency genes in differentiated cells.

  15. Localization of the Norrie disease gene mRNA by in situ hybridization.

    Hartzer, M K; Cheng, M; Liu, X; Shastry, B S

    1999-07-15

    Norrie disease is a rare X-linked recessive neurodevelopmental disorder. The affected males manifest congenital blindness, which is often associated with hearing loss, mental retardation and psychiatric problems. Genetic linkage studies have localized the gene to the short arm of the X-chromosome and the gene has been isolated recently. The encoded protein is a member of the superfamily of growth factors containing a cystine knot motif and may be involved in cell adhesion and neurodevelopment. Molecular genetic analysis revealed a large number of missense, nonsense, deletion, and splice-site mutations among Norrie patients. In order to further determine the role of the Norrie disease gene, we studied the distribution pattern of its mRNA in the retina and in brain by in situ hybridization. The results show abundant hybridization signals in outer nuclear, inner nuclear, and ganglion cell layers of the retina in all three species (mice, rabbit, and human) examined. There was no significant expression in the vitreous body, lens, and rod outer segment. High expression levels were also observed in the cerebellar granular layer, hippocampus, olfactory bulb, cortex, and epithelium of the rabbit brain. These data suggest that the Norrie disease gene could play a critical role in the differentiation or maintenance of the differentiated state of the retina.

  16. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

    2018-03-19

    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  17. Pan-Cancer Analysis of lncRNA Regulation Supports Their Targeting of Cancer Genes in Each Tumor Context

    Hua-Sheng Chiu

    2018-04-01

    Full Text Available Summary: Long noncoding RNAs (lncRNAs are commonly dysregulated in tumors, but only a handful are known to play pathophysiological roles in cancer. We inferred lncRNAs that dysregulate cancer pathways, oncogenes, and tumor suppressors (cancer genes by modeling their effects on the activity of transcription factors, RNA-binding proteins, and microRNAs in 5,185 TCGA tumors and 1,019 ENCODE assays. Our predictions included hundreds of candidate onco- and tumor-suppressor lncRNAs (cancer lncRNAs whose somatic alterations account for the dysregulation of dozens of cancer genes and pathways in each of 14 tumor contexts. To demonstrate proof of concept, we showed that perturbations targeting OIP5-AS1 (an inferred tumor suppressor and TUG1 and WT1-AS (inferred onco-lncRNAs dysregulated cancer genes and altered proliferation of breast and gynecologic cancer cells. Our analysis indicates that, although most lncRNAs are dysregulated in a tumor-specific manner, some, including OIP5-AS1, TUG1, NEAT1, MEG3, and TSIX, synergistically dysregulate cancer pathways in multiple tumor contexts. : Chiu et al. present a pan-cancer analysis of lncRNA regulatory interactions. They suggest that the dysregulation of hundreds of lncRNAs target and alter the expression of cancer genes and pathways in each tumor context. This implies that hundreds of lncRNAs can alter tumor phenotypes in each tumor context. Keywords: lncRNA, regulation, modulation, cancer gene, pan-cancer, noncoding RNA, microRNA, RNA-binding proteins, interactome

  18. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  19. GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML.

    Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas

    2013-09-01

    GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.

  20. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  1. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  2. Water deficit modulates gene expression in growing zones of soybean seedlings. Analysis of differentially expressed cDNAs, a new beta-tubulin gene, and expression of genes encoding cell wall proteins.

    Creelman, R A; Mullet, J E

    1991-10-01

    Transfer of soybean seedlings to low-water-potential vermiculite (psi w = -0.3 MPa) results in a reversible decrease in hypocotyl growth and modulation of several polysomal mRNAs (Plant Physiol 92: 205-214). We report here the isolation of two cDNA clones (pGE16 and pGE95) which correspond to genes whose mRNA levels are increased, and one cDNA clone (pGE23) which corresponds to a gene whose mRNA level is decreased in the hypocotyl zone of cell elongation by water deficit. In well-watered seedlings mRNAs hybridizing to pGE16 and pGE95 are most abundant in mature regions of the seedling, but in water-deficient seedlings mRNA levels are reduced in mature regions and enhanced in elongating regions. RNA corresponding to soybean proline-rich protein 1 (sbPRP1) shows a similar tissue distribution and response to water deficit. In contrast, in well-watered seedlings, the gene corresponding to pGE23 was highly expressed in the hypocotyl and root growing zones. Transfer of seedlings to low-water-potential vermiculite caused a rapid decrease in mRNA hybridizing to pGE23. Sequence analysis revealed that pGE23 has high homology with beta-tubulin. Water deficit also reduced the level of mRNA hybridizing to JCW1, an auxin-modulated gene, although with different kinetics. Furthermore, mRNA encoding actin, glycine-rich proteins (GRPs), and hydroxyproline-rich glycoproteins (HRGPs) were down-regulated in the hypocotyl zone of elongation of seedlings exposed to water deficit. No effect of water deficit was observed on the expression of chalcone synthase. Decreased expression of beta-tubulin, actin, JCW1, HRGP and GRP and increased expression of sbPRP1, pGE95 and pGE16 in the hypocotyl zone of cell elongation could participate in the reversible growth inhibition observed in water-deficient soybean seedlings.

  3. Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.

    Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria

    2018-05-01

    RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.

  4. MicroRNA Dysregulation, Gene Networks, and Risk for Schizophrenia in 22q11.2 Deletion Syndrome

    Merico, Daniele; Costain, Gregory; Butcher, Nancy J.; Warnica, William; Ogura, Lucas; Alfred, Simon E.; Brzustowicz, Linda M.; Bassett, Anne S.

    2014-01-01

    The role of microRNAs (miRNAs) in the etiology of schizophrenia is increasingly recognized. Microdeletions at chromosome 22q11.2 are recurrent structural variants that impart a high risk for schizophrenia and are found in up to 1% of all patients with schizophrenia. The 22q11.2 deletion region overlaps gene DGCR8, encoding a subunit of the miRNA microprocessor complex. We identified miRNAs overlapped by the 22q11.2 microdeletion and for the first time investigated their predicted target genes, and those implicated by DGCR8, to identify targets that may be involved in the risk for schizophrenia. The 22q11.2 region encompasses seven validated or putative miRNA genes. Employing two standard prediction tools, we generated sets of predicted target genes. Functional enrichment profiles of the 22q11.2 region miRNA target genes suggested a role in neuronal processes and broader developmental pathways. We then constructed a protein interaction network of schizophrenia candidate genes and interaction partners relevant to brain function, independent of the 22q11.2 region miRNA mechanisms. We found that the predicted gene targets of the 22q11.2 deletion miRNAs, and targets of the genome-wide miRNAs predicted to be dysregulated by DGCR8 hemizygosity, were significantly represented in this schizophrenia network. The findings provide new insights into the pathway from 22q11.2 deletion to expression of schizophrenia, and suggest that hemizygosity of the 22q11.2 region may have downstream effects implicating genes elsewhere in the genome that are relevant to the general schizophrenia population. These data also provide further support for the notion that robust genetic findings in schizophrenia may converge on a reasonable number of final pathways. PMID:25484875

  5. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  6. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  7. Mutations in 23S rRNA gene associated with decreased susceptibility to tiamulin and valnemulin in Mycoplasma gallisepticum.

    Li, Bei-Bei; Shen, Jian-Zhong; Cao, Xing-Yuan; Wang, Yang; Dai, Lei; Huang, Si-Yang; Wu, Cong-Ming

    2010-07-01

    Mycoplasma gallisepticum is a major etiological agent of chronic respiratory disease (CRD) in chickens and sinusitis in turkeys. The pleuromutilin antibiotics tiamulin and valnemulin are currently used in the treatment of M. gallisepticum infection. We studied the in vitro development of pleuromutilin resistance in M. gallisepticum and investigated the molecular mechanisms involved in this process. Pleuromutilin-resistant mutants were selected by serial passages of M. gallisepticum strains PG31 and S6 in broth medium containing subinhibitory concentrations of tiamulin or valnemulin. A portion of the gene encoding 23S rRNA gene (domain V) and the gene encoding ribosome protein L3 were amplified and sequenced. No mutation could be detected in ribosome protein L3. Mutations were found at nucleotide positions 2058, 2059, 2061, 2447 and 2503 of 23S rRNA gene (Escherichia coli numbering). Although a single mutation could cause elevation of tiamulin and valnemulin MICs, combinations of two or three mutations were necessary to produce high-level resistance. All the mutants were cross-resistant to lincomycin, chloramphenicol and florfenicol. Mutants with the A2058G or the A2059G mutation exhibited cross-resistance to macrolide antibiotics erythromycin, tilmicosin and tylosin.

  8. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  9. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  10. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  11. Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia.

    Kojima, Kenji K; Jurka, Jerzy

    2015-01-01

    Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an "archaeal" RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes.

  12. Brain Gene Expression Signatures From Cerebrospinal Fluid Exosome RNA Profiling

    Zanello, S. B.; Stevens, B.; Calvillo, E.; Tang, R.; Gutierrez Flores, B.; Hu, L.; Skog, J.; Bershad, E.

    2016-01-01

    While the Visual Impairment and Intracranial Pressure (VIIP) syndrome observations have focused on ocular symptoms, spaceflight has been also associated with a number of other performance and neurologic signs, such as headaches, cognitive changes, vertigo, nausea, sleep/circadian disruption and mood alterations, which, albeit likely multifactorial, can also result from elevation of intracranial pressure (ICP). We therefore hypothesize that these various symptoms are caused by disturbances in the neurophysiology of the brain structures and are correlated with molecular markers in the cerebrospinal fluid (CSF) as indicators of neurophysiological changes. Exosomes are 30-200 nm microvesicles shed into all biofluids, including blood, urine, and CSF, carrying a highly rich source of intact protein and RNA cargo. Exosomes have been identified in human CSF, and their proteome and RNA pool is a potential new reservoir for biomarker discovery in neurological disorders. The purpose of this study is to investigate changes in brain gene expression via exosome analysis in patients suffering from ICP elevation of varied severity (idiopathic intracranial hypertension -IIH), a condition which shares some of the neuroophthalmological features of VIIP, as a first step toward obtaining evidence suggesting that cognitive function and ICP levels can be correlated with biomarkers in the CSF. Our preliminary work, reported last year, validated the exosomal technology applicable to CSF analysis and demonstrated that it was possible to obtain gene expression evidence of inflammation processes in traumatic brain injury patients. We are now recruiting patients with suspected IIH requiring lumbar puncture at Baylor College of Medicine. Both CSF (5 ml) and human plasma (10 ml) are being collected in order to compare the pattern of differentially expressed genes observed in CSF and in blood. Since blood is much more accessible than CSF, we would like to determine whether plasma biomarkers for

  13. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  14. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

    2011-01-01

    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  16. Isolation and expression analysis of four HD-ZIP III family genes targeted by microRNA166 in peach.

    Zhang, C H; Zhang, B B; Ma, R J; Yu, M L; Guo, S L; Guo, L

    2015-10-30

    MicroRNA166 (miR166) is known to have highly conserved targets that encode proteins of the class III homeodomain-leucine zipper (HD-ZIP III) family, in a broad range of plant species. To further understand the relationship between HD-ZIP III genes and miR166, four HD-ZIP III family genes (PpHB14, PpHB15, PpHB8, and PpREV) were isolated from peach (Prunus persica) tissue and characterized. Spatio-temporal expression profiles of the genes were analyzed. Genes of the peach HD-ZIP III family were predicted to encode five conserved domains. Deduced amino acid sequences and tertiary structures of the four peach HD-ZIP III genes were highly conserved, with corresponding genes in Arabidopsis thaliana. The expression level of four targets displayed the opposite trend to that of miR166 throughout fruit development, with the exception of PpHB14 from 35 to 55 days after full bloom (DAFB). This finding indicates that miR166 may negatively regulate its four targets throughout fruit development. As for leaf and phloem, the same trend in expression level was observed between four targets and miR166 from 75 to 105 DAFB. However, the opposite trend was observed for the transcript level between four targets and miR166 from 35 to 55 DAFB. miRNA166 may negatively regulate four targets in some but not all developmental stages for a given tissue. The four genes studied were observed to have, exactly or generally, the same change tendency as individual tissue development, a finding that suggests genes of the HD-ZIP III family in peach may have complementary or cooperative functions in various tissues.

  17. OmniSearch: a semantic search system based on the Ontology for MIcroRNA Target (OMIT) for microRNA-target gene interaction data.

    Huang, Jingshan; Gutierrez, Fernando; Strachan, Harrison J; Dou, Dejing; Huang, Weili; Smith, Barry; Blake, Judith A; Eilbeck, Karen; Natale, Darren A; Lin, Yu; Wu, Bin; Silva, Nisansa de; Wang, Xiaowei; Liu, Zixing; Borchert, Glen M; Tan, Ming; Ruttenberg, Alan

    2016-01-01

    As a special class of non-coding RNAs (ncRNAs), microRNAs (miRNAs) perform important roles in numerous biological and pathological processes. The realization of miRNA functions depends largely on how miRNAs regulate specific target genes. It is therefore critical to identify, analyze, and cross-reference miRNA-target interactions to better explore and delineate miRNA functions. Semantic technologies can help in this regard. We previously developed a miRNA domain-specific application ontology, Ontology for MIcroRNA Target (OMIT), whose goal was to serve as a foundation for semantic annotation, data integration, and semantic search in the miRNA field. In this paper we describe our continuing effort to develop the OMIT, and demonstrate its use within a semantic search system, OmniSearch, designed to facilitate knowledge capture of miRNA-target interaction data. Important changes in the current version OMIT are summarized as: (1) following a modularized ontology design (with 2559 terms imported from the NCRO ontology); (2) encoding all 1884 human miRNAs (vs. 300 in previous versions); and (3) setting up a GitHub project site along with an issue tracker for more effective community collaboration on the ontology development. The OMIT ontology is free and open to all users, accessible at: http://purl.obolibrary.org/obo/omit.owl. The OmniSearch system is also free and open to all users, accessible at: http://omnisearch.soc.southalabama.edu/index.php/Software.

  18. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  19. An efficient approach to finding Siraitia grosvenorii triterpene biosynthetic genes by RNA-seq and digital gene expression analysis

    Song Cai

    2011-07-01

    Full Text Available Abstract Background Siraitia grosvenorii (Luohanguo is an herbaceous perennial plant native to southern China and most prevalent in Guilin city. Its fruit contains a sweet, fleshy, edible pulp that is widely used in traditional Chinese medicine. The major bioactive constituents in the fruit extract are the cucurbitane-type triterpene saponins known as mogrosides. Among them, mogroside V is nearly 300 times sweeter than sucrose. However, little is known about mogrosides biosynthesis in S. grosvenorii, especially the late steps of the pathway. Results In this study, a cDNA library generated from of equal amount of RNA taken from S. grosvenorii fruit at 50 days after flowering (DAF and 70 DAF were sequenced using Illumina/Solexa platform. More than 48,755,516 high-quality reads from a cDNA library were generated that was assembled into 43,891 unigenes. De novo assembly and gap-filling generated 43,891 unigenes with an average sequence length of 668 base pairs. A total of 26,308 (59.9% unique sequences were annotated and 11,476 of the unique sequences were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes. cDNA sequences for all of the known enzymes involved in mogrosides backbone synthesis were identified from our library. Additionally, a total of eighty-five cytochrome P450 (CYP450 and ninety UDP-glucosyltransferase (UDPG unigenes were identified, some of which appear to encode enzymes responsible for the conversion of the mogroside backbone into the various mogrosides. Digital gene expression profile (DGE analysis using Solexa sequencing was performed on three important stages of fruit development, and based on their expression pattern, seven CYP450s and five UDPGs were selected as the candidates most likely to be involved in mogrosides biosynthesis. Conclusion A combination of RNA-seq and DGE analysis based on the next generation sequencing technology was shown to be a powerful method for identifying

  20. HOXD-AS1 is a novel lncRNA encoded in HOXD cluster and a marker of neuroblastoma progression revealed via integrative analysis of noncoding transcriptome

    2014-01-01

    Background Long noncoding RNAs (lncRNAs) constitute a major, but poorly characterized part of human transcriptome. Recent evidence indicates that many lncRNAs are involved in cancer and can be used as predictive and prognostic biomarkers. Significant fraction of lncRNAs is represented on widely used microarray platforms, however they have usually been ignored in cancer studies. Results We developed a computational pipeline to annotate lncRNAs on popular Affymetrix U133 microarrays, creating a resource allowing measurement of expression of 1581 lncRNAs. This resource can be utilized to interrogate existing microarray datasets for various lncRNA studies. We found that these lncRNAs fall into three distinct classes according to their statistical distribution by length. Remarkably, these three classes of lncRNAs were co-localized with protein coding genes exhibiting distinct gene ontology groups. This annotation was applied to microarray analysis which identified a 159 lncRNA signature that discriminates between localized and metastatic stages of neuroblastoma. Analysis of an independent patient cohort revealed that this signature differentiates also relapsing from non-relapsing primary tumors. This is the first example of the signature developed via the analysis of expression of lncRNAs solely. One of these lncRNAs, termed HOXD-AS1, is encoded in HOXD cluster. HOXD-AS1 is evolutionary conserved among hominids and has all bona fide features of a gene. Studying retinoid acid (RA) response of SH-SY5Y cell line, a model of human metastatic neuroblastoma, we found that HOXD-AS1 is a subject to morphogenic regulation, is activated by PI3K/Akt pathway and itself is involved in control of RA-induced cell differentiation. Knock-down experiments revealed that HOXD-AS1 controls expression levels of clinically significant protein-coding genes involved in angiogenesis and inflammation, the hallmarks of metastatic cancer. Conclusions Our findings greatly extend the number of

  1. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

  2. Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB).

    Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini

    2015-06-01

    Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.

  3. Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB

    Lenice Roteia Cardoso Jung

    2015-06-01

    Full Text Available Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR. The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.

  4. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  5. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  6. NCYM, a Cis-antisense gene of MYCN, encodes a de novo evolved protein that inhibits GSK3β resulting in the stabilization of MYCN in human neuroblastomas.

    Yusuke Suenaga

    2014-01-01

    Full Text Available The rearrangement of pre-existing genes has long been thought of as the major mode of new gene generation. Recently, de novo gene birth from non-genic DNA was found to be an alternative mechanism to generate novel protein-coding genes. However, its functional role in human disease remains largely unknown. Here we show that NCYM, a cis-antisense gene of the MYCN oncogene, initially thought to be a large non-coding RNA, encodes a de novo evolved protein regulating the pathogenesis of human cancers, particularly neuroblastoma. The NCYM gene is evolutionally conserved only in the taxonomic group containing humans and chimpanzees. In primary human neuroblastomas, NCYM is 100% co-amplified and co-expressed with MYCN, and NCYM mRNA expression is associated with poor clinical outcome. MYCN directly transactivates both NCYM and MYCN mRNA, whereas NCYM stabilizes MYCN protein by inhibiting the activity of GSK3β, a kinase that promotes MYCN degradation. In contrast to MYCN transgenic mice, neuroblastomas in MYCN/NCYM double transgenic mice were frequently accompanied by distant metastases, behavior reminiscent of human neuroblastomas with MYCN amplification. The NCYM protein also interacts with GSK3β, thereby stabilizing the MYCN protein in the tumors of the MYCN/NCYM double transgenic mice. Thus, these results suggest that GSK3β inhibition by NCYM stabilizes the MYCN protein both in vitro and in vivo. Furthermore, the survival of MYCN transgenic mice bearing neuroblastoma was improved by treatment with NVP-BEZ235, a dual PI3K/mTOR inhibitor shown to destabilize MYCN via GSK3β activation. In contrast, tumors caused in MYCN/NCYM double transgenic mice showed chemo-resistance to the drug. Collectively, our results show that NCYM is the first de novo evolved protein known to act as an oncopromoting factor in human cancer, and suggest that de novo evolved proteins may functionally characterize human disease.

  7. Analysis of gene expression in normal and neoplastic human testis: new roles of RNA

    Novotny, G W; Nielsen, J E; Sonne, Si Brask

    2007-01-01

    Large-scale methods for analysing gene expression, such as microarrays, have yielded a wealth of information about gene expression at the mRNA level. However, expression of alternative transcripts, together with the presence of a wide range of largely undescribed RNA transcripts combined with reg......Large-scale methods for analysing gene expression, such as microarrays, have yielded a wealth of information about gene expression at the mRNA level. However, expression of alternative transcripts, together with the presence of a wide range of largely undescribed RNA transcripts combined...

  8. Identification of Phosphoglycerate Kinase 1 (PGK1 as a reference gene for quantitative gene expression measurements in human blood RNA

    Unger Elizabeth R

    2011-09-01

    Full Text Available Abstract Background Blood is a convenient sample and increasingly used for quantitative gene expression measurements with a variety of diseases including chronic fatigue syndrome (CFS. Quantitative gene expression measurements require normalization of target genes to reference genes that are stable and independent from variables being tested in the experiment. Because there are no genes that are useful for all situations, reference gene selection is an essential step to any quantitative reverse transcription-PCR protocol. Many publications have described appropriate genes for a wide variety of tissues and experimental conditions, however, reference genes that may be suitable for the analysis of CFS, or human blood RNA derived from whole blood as well as isolated peripheral blood mononuclear cells (PBMCs, have not been described. Findings Literature review and analyses of our unpublished microarray data were used to narrow down the pool of candidate reference genes to six. We assayed whole blood RNA from Tempus tubes and cell preparation tube (CPT-collected PBMC RNA from 46 subjects, and used the geNorm and NormFinder algorithms to select the most stable reference genes. Phosphoglycerate kinase 1 (PGK1 was one of the optimal normalization genes for both whole blood and PBMC RNA, however, additional genes differed for the two sample types; Ribosomal protein large, P0 (RPLP0 for PBMC RNA and Peptidylprolyl isomerase B (PPIB for whole blood RNA. We also show that the use of a single reference gene is sufficient for normalization when the most stable candidates are used. Conclusions We have identified PGK1 as a stable reference gene for use with whole blood RNA and RNA derived from PBMC. When stable genes are selected it is possible to use a single gene for normalization rather than two or three. Optimal normalization will improve the ability of results from PBMC RNA to be compared with those from whole blood RNA and potentially allows comparison of

  9. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  10. Identification of microRNA genes in three opisthorchiids.

    Vladimir Y Ovchinnikov

    2015-04-01

    Full Text Available Opisthorchis felineus, O. viverrini, and Clonorchis sinensis (family Opisthorchiidae are parasitic flatworms that pose a serious threat to humans in some countries and cause opisthorchiasis/clonorchiasis. Chronic disease may lead to a risk of carcinogenesis in the biliary ducts. MicroRNAs (miRNAs are small noncoding RNAs that control gene expression at post-transcriptional level and are implicated in the regulation of various cellular processes during the parasite- host interplay. However, to date, the miRNAs of opisthorchiid flukes, in particular those essential for maintaining their complex biology and parasitic mode of existence, have not been satisfactorily described.Using a SOLiD deep sequencing-bioinformatic approach, we identified 43 novel and 18 conserved miRNAs for O. felineus (miracidia, metacercariae and adult worms, 20 novel and 16 conserved miRNAs for O. viverrini (adult worms, and 33 novel and 18 conserved miRNAs for C. sinensis (adult worms. The analysis of the data revealed differences in the expression level of conserved miRNAs among the three species and among three the developmental stages of O. felineus. Analysis of miRNA genes revealed two gene clusters, one cluster-like region and one intronic miRNA in the genome. The presence and structure of the two gene clusters were validated using a PCR-based approach in the three flukes.This study represents a comprehensive description of miRNAs in three members of the family Opistorchiidae, significantly expands our knowledge of miRNAs in multicellular parasites and provides a basis for understanding the structural and functional evolution of miRNAs in these metazoan parasites. Results of this study also provides novel resources for deeper understanding the complex parasite biology, for further research on the pathogenesis and molecular events of disease induced by the liver flukes. The present data may also facilitate the development of novel approaches for the prevention and

  11. Stage-dependent and temperature-controlled expression of the gene encoding the precursor protein of diapause hormone and pheromone biosynthesis activating neuropeptide in the silkworm, Bombyx mori.

    Xu, W H; Sato, Y; Ikeda, M; Yamashita, O

    1995-02-24

    Embryonic diapause and sex pheromone biosynthesis in the silkworm, Bombyx mori, are, respectively, induced by diapause hormone (DH) and pheromone biosynthesis activating neuropeptide (PBAN), which are produced in the subesophageal ganglion from a common polyprotein precursor (DH-PBAN precursor) encoded by a single gene (DH-PBAN gene). Using DH-PBAN cDNA as a probe, we quantitatively measured DH-PBAN mRNA content throughout embryonic and postembryonic development and observed the effects of incubation temperature, which is a key factor for determination of diapause, on DH-PBAN gene expression. The silkworm, which is programmed to lay diapause eggs by being incubated at 25 degrees C, showed peaks of DH-PBAN mRNA content at five different stages throughout the life cycle: at the late embryonic stage, at the middle of the fourth and the fifth larval instars, and at early and late stages of pupal-adult development. In the non-diapause type silkworms programmed by a 15 degrees C incubation, only the last peak of DH-PBAN mRNA in pupal-adult development was found, and the other peaks were absent. Furthermore, interruption of the incubation period at 25 degrees C by incubation at 15 degrees C decreased both DH-PBAN mRNA content in mature embryos and in subesophageal ganglia of day 3 pupae and the incidence of diapause eggs. Thus, there were two types of regulatory mechanisms for DH-PBAN gene expression. One is a temperature-controlled expression that is responsible for diapause induction, and the other is a temperature-independent, stage-dependent expression related to pheromone production.

  12. Impact of MicroRNA Levels, Target-Site Complementarity, and Cooperativity on Competing Endogenous RNA-Regulated Gene Expression.

    Denzler, Rémy; McGeary, Sean E; Title, Alexandra C; Agarwal, Vikram; Bartel, David P; Stoffel, Markus

    2016-11-03

    Expression changes of competing endogenous RNAs (ceRNAs) have been proposed to influence microRNA (miRNA) activity and thereby regulate other transcripts containing miRNA-binding sites. Here, we find that although miRNA levels define the extent of repression, they have little effect on the magnitude of the ceRNA expression change required to observe derepression. Canonical 6-nt sites, which typically mediate modest repression, can nonetheless compete for miRNA binding, with potency ∼20% of that observed for canonical 8-nt sites. In aggregate, low-affinity/background sites also contribute to competition. Sites with extensive additional complementarity can appear as more potent, but only because they induce miRNA degradation. Cooperative binding of proximal sites for the same or different miRNAs does increase potency. These results provide quantitative insights into the stoichiometric relationship between miRNAs and target abundance, target-site spacing, and affinity requirements for ceRNA-mediated gene regulation, and the unusual circumstances in which ceRNA-mediated gene regulation might be observed. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  14. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  15. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  16. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  17. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  18. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

    2012-07-30

    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  19. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  20. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  1. A viral microRNA down-regulates multiple cell cycle genes through mRNA 5'UTRs.

    Finn Grey

    2010-06-01

    Full Text Available Global gene expression data combined with bioinformatic analysis provides strong evidence that mammalian miRNAs mediate repression of gene expression primarily through binding sites within the 3' untranslated region (UTR. Using RNA induced silencing complex immunoprecipitation (RISC-IP techniques we have identified multiple cellular targets for a human cytomegalovirus (HCMV miRNA, miR-US25-1. Strikingly, this miRNA binds target sites primarily within 5'UTRs, mediating significant reduction in gene expression. Intriguingly, many of the genes targeted by miR-US25-1 are associated with cell cycle control, including cyclin E2, BRCC3, EID1, MAPRE2, and CD147, suggesting that miR-US25-1 is targeting genes within a related pathway. Deletion of miR-US25-1 from HCMV results in over expression of cyclin E2 in the context of viral infection. Our studies demonstrate that a viral miRNA mediates translational repression of multiple cellular genes by targeting mRNA 5'UTRs.

  2. Aberrant chimeric RNA GOLM1-MAK10 encoding a secreted fusion protein as a molecular signature for human esophageal squamous cell carcinoma

    Zhang, Hao; Lin, Wan; Kannan, Kalpana; Luo, Liming; Li, Jing; Chao, Pei-Wen; Wang, Yan; Chen, Yu-Ping; Gu, Jiang; Yen, Laising

    2013-01-01

    It is increasingly recognized that chimeric RNAs may exert a novel layer of cellular complexity that contributes to oncogenesis and cancer progression, and could be utilized as molecular biomarkers and therapeutic targets. To date yet no fusion chimeric RNAs have been identified in esophageal cancer, the 6th most frequent cause of cancer death in the world. While analyzing the expression of 32 recurrent cancer chimeric RNAs in esophageal squamous cell carcinoma (ESCC) from patients and cancer cell lines, we identified GOLM1-MAK10, as a highly cancer-enriched chimeric RNA in ESCC. In situ hybridization revealed that the expression of the chimera is largely restricted to cancer cells in patient tumors, and nearly undetectable in non-neoplastic esophageal tissue from normal subjects. The aberrant chimera closely correlated with histologic differentiation and lymph node metastasis. Furthermore, we demonstrate that chimera GOLM1-MAK10 encodes a secreted fusion protein. Mechanistic studies reveal that GOLM1-MAK10 is likely derived from transcription read-through/splicing rather than being generated from a fusion gene. Collectively, these findings provide novel insights into the molecular mechanism involved in ESCC and provide a novel potential target for future therapies. The secreted fusion protein translated from GOLM1-MAK10 could also serve as a unique protein signature detectable by standard non-invasive assays. These observations are critical as there is no clinically useful molecular signature available for detecting this deadly disease or monitoring the treatment response. PMID:24243830

  3. Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

    Tiane Martin de Moura

    2012-10-01

    Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

  4. Evaluation of 10 genes encoding cardiac proteins in Doberman Pinschers with dilated cardiomyopathy.

    O'Sullivan, M Lynne; O'Grady, Michael R; Pyle, W Glen; Dawson, John F

    2011-07-01

    To identify a causative mutation for dilated cardiomyopathy (DCM) in Doberman Pinschers by sequencing the coding regions of 10 cardiac genes known to be associated with familial DCM in humans. 5 Doberman Pinschers with DCM and congestive heart failure and 5 control mixed-breed dogs that were euthanized or died. RNA was extracted from frozen ventricular myocardial samples from each dog, and first-strand cDNA was synthesized via reverse transcription, followed by PCR amplification with gene-specific primers. Ten cardiac genes were analyzed: cardiac actin, α-actinin, α-tropomyosin, β-myosin heavy chain, metavinculin, muscle LIM protein, myosinbinding protein C, tafazzin, titin-cap (telethonin), and troponin T. Sequences for DCM-affected and control dogs and the published canine genome were compared. None of the coding sequences yielded a common causative mutation among all Doberman Pinscher samples. However, 3 variants were identified in the α-actinin gene in the DCM-affected Doberman Pinschers. One of these variants, identified in 2 of the 5 Doberman Pinschers, resulted in an amino acid change in the rod-forming triple coiled-coil domain. Mutations in the coding regions of several genes associated with DCM in humans did not appear to consistently account for DCM in Doberman Pinschers. However, an α-actinin variant was detected in some Doberman Pinschers that may contribute to the development of DCM given its potential effect on the structure of this protein. Investigation of additional candidate gene coding and noncoding regions and further evaluation of the role of α-actinin in development of DCM in Doberman Pinschers are warranted.

  5. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  6. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  7. IER5 gene's mRNA expression after irradiation

    Ding Kuke; Shen Jingjing; Xu Lili; Li Yanling; Zhou Ping; Ma Binrong; Zhao Zengqiang; Sui Jianli; Zhou Pingkun

    2008-01-01

    Objective: To explore the effect of irradiation on IER5 gene expression. Methods: Two kinds of cells (AHH-1 and HeLa) and the BALB/c-nu mice inoculated with tumor cells were exposed to 60 Co γ- rays and analyzed by real-time PCR. The above-mentioned irradiated objects were firstly divided into groups by different doses and post-radiation time, then mRNA were extracted and reverse-transcripted to DNA before real-time PCR test. Results: Under the same condition, AHH-1 was more sensitive to radiation than HeLa. The dose level corresponding to the expression peak of AHH-1 was less than that of HeLa. For AHH-1 cells, the response to 2 Gy irradiation was earlier than that to 10 Gy. But there was not remarkable difference for HeLa response between 2 and 10 Gy, and the top transcriptional levels for both cells nearly simultaneously appeared at 2 h after irradiation. In addition, the IER5 gene of human liver tumor was more sensitive than that of lung cancer and brain tumor. Conclusions: IER5 might be a candidate biomarker of radiation injury, and had the potential value in radiation-therapy for liver tumor. (authors)

  8. Highly efficient gene delivery by mRNA electroporation in human hematopoietic cells: superiority to lipofection and passive pulsing of mRNA and to electroporation of plasmid cDNA for tumor antigen loading of dendritic cells.

    Van Tendeloo, V F; Ponsaerts, P; Lardon, F; Nijs, G; Lenjou, M; Van Broeckhoven, C; Van Bockstaele, D R; Berneman, Z N

    2001-07-01

    Designing effective strategies to load human dendritic cells (DCs) with tumor antigens is a challenging approach for DC-based tumor vaccines. Here, a cytoplasmic expression system based on mRNA electroporation to efficiently introduce tumor antigens into DCs is described. Preliminary experiments in K562 cells using an enhanced green fluorescent protein (EGFP) reporter gene revealed that mRNA electroporation as compared with plasmid DNA electroporation showed a markedly improved transfection efficiency (89% versus 40% EGFP(+) cells, respectively) and induced a strikingly lower cell toxicity (15% death rate with mRNA versus 51% with plasmid DNA). Next, mRNA electroporation was applied for nonviral transfection of different types of human DCs, including monocyte-derived DCs (Mo-DCs), CD34(+) progenitor-derived DCs (34-DCs) and Langerhans cells (34-LCs). High-level transgene expression by mRNA electroporation was obtained in more than 50% of all DC types. mRNA-electroporated DCs retained their phenotype and maturational potential. Importantly, DCs electroporated with mRNA-encoding Melan-A strongly activated a Melan-A-specific cytotoxic T lymphocyte (CTL) clone in an HLA-restricted manner and were superior to mRNA-lipofected or -pulsed DCs. Optimal stimulation of the CTL occurred when Mo-DCs underwent maturation following mRNA transfection. Strikingly, a nonspecific stimulation of CTL was observed when DCs were transfected with plasmid DNA. The data clearly demonstrate that Mo-DCs electroporated with mRNA efficiently present functional antigenic peptides to cytotoxic T cells. Therefore, electroporation of mRNA-encoding tumor antigens is a powerful technique to charge human dendritic cells with tumor antigens and could serve applications in future DC-based tumor vaccines.

  9. An RNA editing/dsRNA binding-independent gene regulatory mechanism of ADARs and its clinical implication in cancer.

    Qi, Lihua; Song, Yangyang; Chan, Tim Hon Man; Yang, Henry; Lin, Chi Ho; Tay, Daryl Jin Tai; Hong, HuiQi; Tang, Sze Jing; Tan, Kar Tong; Huang, Xi Xiao; Lin, Jaymie Siqi; Ng, Vanessa Hui En; Maury, Julien Jean Pierre; Tenen, Daniel G; Chen, Leilei

    2017-10-13

    Adenosine-to-inosine (A-to-I) RNA editing, catalyzed by Adenosine DeAminases acting on double-stranded RNA(dsRNA) (ADAR), occurs predominantly in the 3' untranslated regions (3'UTRs) of spliced mRNA. Here we uncover an unanticipated link between ADARs (ADAR1 and ADAR2) and the expression of target genes undergoing extensive 3'UTR editing. Using METTL7A (Methyltransferase Like 7A), a novel tumor suppressor gene with multiple editing sites at its 3'UTR, we demonstrate that its expression could be repressed by ADARs beyond their RNA editing and double-stranded RNA (dsRNA) binding functions. ADARs interact with Dicer to augment the processing of pre-miR-27a to mature miR-27a. Consequently, mature miR-27a targets the METTL7A 3'UTR to repress its expression level. In sum, our study unveils that the extensive 3'UTR editing of METTL7A is merely a footprint of ADAR binding, and there are a subset of target genes that are equivalently regulated by ADAR1 and ADAR2 through their non-canonical RNA editing and dsRNA binding-independent functions, albeit maybe less common. The functional significance of ADARs is much more diverse than previously appreciated and this gene regulatory function of ADARs is most likely to be of high biological importance beyond the best-studied editing function. This non-editing side of ADARs opens another door to target cancer. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.

    Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok

    2018-03-16

    Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.

  12. Diversity of 16S rRNA and dioxygenase genes detected in coal-tar-contaminated site undergoing active bioremediation

    Kumar, M; Khanna, S [NIIT Univ, Neemrana (India). Dept. of Biotechnology & Bioinformation

    2010-04-15

    In order to develop effective bioremediation strategies for polyaromatic hydrocarbons (PAHs) degradation, the composition and metabolic potential of microbial communities need to be better understood, especially in highly PAH contaminated sites in which little information on the cultivation-independent communities is available. Coal-tar-contaminated soil was collected, which consisted of 122-122.5 mg g{sup -1} total extractable PAH compounds. Biodegradation studies with this soil indicated the presence of microbial community that is capable of degrading the model PAH compounds viz naphthalene, phenanthrene and pyrene at 50 ppm each. PCR clone libraries were established from the DNA of the coal-tar-contaminated soil, targeting the 16S rRNA to characterize (I) the microbial communities, (ii) partial gene fragment encoding the Rieske iron sulfur center {alpha}-subunit) common to all PAH dioxygenase enzymes and (iii) {beta}-subunit of dioxygenase. Phylotypes related to Proteobacteria ({Alpha}-, {Epsilon}- and Gammaproteobacteria), Acidobacteria, Actinobacteria, Firmicutes, Gemmatimonadetes and Deinococci were detected in 16S rRNA derived clone libraries. Many of the gene fragment sequences of alpha-subunit and beta-subunit of dioxygenase obtained from the respective clone libraries fell into clades that are distinct from the reference dioxygenase gene sequences. Presence of consensus sequence of the Rieske type (2Fe2S) cluster binding site suggested that these gene fragments encode for {alpha}-subunit of dioxygenase gene. Sequencing of the cloned libraries representing {alpha}-subunit gene fragments (Rf1) and beta-subunit of dioxygenase showed the presence of hitherto unidentified dioxygenase in coal-tar-contaminated soil.

  13. Functional characterization of endogenous siRNA target genes in Caenorhabditis elegans

    Heikkinen Liisa

    2008-06-01

    Full Text Available Abstract Background Small interfering RNA (siRNA molecules mediate sequence specific silencing in RNA interference (RNAi, a gene regulatory phenomenon observed in almost all organisms. Large scale sequencing of small RNA libraries obtained from C. elegans has revealed that a broad spectrum of siRNAs is endogenously transcribed from genomic sequences. The biological role and molecular diversity of C. elegans endogenous siRNA (endo-siRNA molecules, nonetheless, remain poorly understood. In order to gain insight into their biological function, we annotated two large libraries of endo-siRNA sequences, identified their cognate targets, and performed gene ontology analysis to identify enriched functional categories. Results Systematic trends in categorization of target genes according to the specific length of siRNA sequences were observed: 18- to 22-mer siRNAs were associated with genes required for embryonic development; 23-mers were associated uniquely with post-embryonic development; 24–26-mers were associated with phosphorus metabolism or protein modification. Moreover, we observe that some argonaute related genes associate with siRNAs with multiple reads. Sequence frequency graphs suggest that different lengths of siRNAs share similarities in overall sequence structure: the 5' end begins with G, while the body predominates with U and C. Conclusion These results suggest that the lengths of endogenous siRNA molecules are consequential to their biological functions since the gene ontology categories for their cognate mRNA targets vary depending upon their lengths.

  14. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  15. Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...

    Asdmin

    2014-01-15

    Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.

  16. Screening a yeast promoter library leads to the isolation of the RP29/L32 and SNR17B/RPL37A divergent promoters and the discovery of a gene encoding ribosomal protein L37.

    Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

    1991-08-30

    Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).

  17. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  18. RNA-seq reveals transcriptome changes in goats following myostatin gene knockout

    Cai, Bei; Zhou, Shiwei; Zhu, Haijing; Qu, Lei; Wang, Xiaolong

    2017-01-01

    Myostatin (MSTN) is a powerful negative regulator of skeletal muscle mass in mammalian species that is primarily expressed in skeletal muscles, and mutations of its encoding gene can result in the double-muscling trait. In this study, the CRISPR/Cas9 technique was used to edit MSTN in Shaanbei Cashmere goats and generate knockout animals. RNA sequencing was used to determine and compare the transcriptome profiles of the muscles from three wild-type (WT) goats, three fibroblast growth factor 5 (FGF5) knockout goats (FGF5+/- group) and three goats with disrupted expression of both the FGF5 and MSTN genes (FM+/- group). The sequence reads were obtained using the Illumina HiSeq 2000 system and mapped to the Capra hircus reference genome using TopHat (v2.0.9). In total, 68.93, 62.04 and 66.26 million clean sequencing reads were obtained from the WT, FM+/- and FGF5+/- groups, respectively. There were 201 differentially expressed genes (DEGs) between the WT and FGF5+/- groups, with 86 down- and 115 up-regulated genes in the FGF5+/- group. Between the WT and FM+/- groups, 121 DEGs were identified, including 81 down- and 40 up-regulated genes in the FM+/- group. A total of 198 DEGs were detected between the FGF5+/- group and FM+/- group, with 128 down- and 70 up-regulated genes in the FM+/- group. At the transcriptome level, we found substantial changes in genes involved in fatty acid metabolism and the biosynthesis of unsaturated fatty acids, such as stearoyl-CoA dehydrogenase, 3-hydroxyacyl-CoA dehydratase 2, ELOVL fatty acid elongase 6 and fatty acid synthase, suggesting that the expression levels of these genes may be directly regulated by MSTN and that these genes are likely downstream targets of MSTN with potential roles in lipid metabolism in goats. Moreover, five randomly selected DEGs were further validated with qRT-PCR, and the results were consistent with the transcriptome analysis. The present study provides insight into the unique transcriptome profile of the

  19. An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

    Lim Chee Liew

    Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

  20. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  1. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  2. Differential Influence of Inositol Hexaphosphate on the Expression of Genes Encoding TGF-β Isoforms and Their Receptors in Intestinal Epithelial Cells Stimulated with Proinflammatory Agents

    Małgorzata Kapral

    2013-01-01

    Full Text Available Transforming growth factor β (TGF-β is a multifunctional cytokine recognized as an important regulator of inflammatory responses. The effect of inositol hexaphosphate (IP6, a naturally occurring phytochemical, on the mRNA expression of TGF-β1, TGF-β2, TGF-β3 and TβRI, TβRII, and TβRIII receptors stimulated with bacterial lipopolysaccharides (Escherichia coli and Salmonella typhimurium and IL-1β in intestinal cells Caco-2 for 3 and 12 h was investigated. Real-time qRT-PCR was used to validate mRNAs level of examined genes. Bacterial endotoxin promoted differential expression of TGF-βs and their receptors in a time-dependent manner. IL-1β upregulated mRNA levels of all TGF-βs and receptors at both 3 h and 12 h. IP6 elicited the opposed to LPS effect by increasing downregulated transcription of the examined genes and suppressing the expression of TGF-β1 at 12 h. IP6 counteracted the stimulatory effect of IL-1β on TGF-β1 and receptors expression by decreasing their mRNA levels. IP6 enhanced LPS- and IL-1β-stimulated mRNA expression of TGF-β2 and -β3. Based on these studies it may be concluded that IP6 present in the intestinal milieu may exert immunoregulatory effects and chemopreventive activity on colonic epithelium under inflammatory conditions or during microbe-induced infection/inflammation by modulating the expression of genes encoding TGF-βs and their receptors at transcriptional level.

  3. A mitochondrial tRNA(His) gene mutation causing pigmentary retinopathy and neurosensorial deafness.

    Crimi, M; Galbiati, S; Perini, M P; Bordoni, A; Malferrari, G; Sciacco, M; Biunno, I; Strazzer, S; Moggio, M; Bresolin, N; Comi, G P

    2003-04-08

    We have identified a heteroplasmic G to A mutation at position 12,183 of the mitochondrial transfer RNA Histidine (tRNA(His)) gene in three related patients. These phenotypes varied according to mutation heteroplasmy: one had severe pigmentary retinopathy, neurosensorial deafness, testicular dysfunction, muscle hypotrophy, and ataxia; the other two had only retinal and inner ear involvement. The mutation is in a highly conserved region of the T(psi)C stem of the tRNA(His) gene and may alter secondary structure formation. This is the first described pathogenic, maternally inherited mutation of the mitochondrial tRNA(His) gene.

  4. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

    Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

    2017-05-01

    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

  5. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    Viuff, Dorthe; Greve, Torben; Holm, Peter

    2002-01-01

    ; there was no silver staining at the sites of the rRNA genes and nucleolus precursor bodies. From 30 hpc onwards, most 4-cell embryos had medium size to large clusters of FITC-labeled areas colocalized with silver staining of rRNA gene clusters and fibrillogranular nucleoli. These observations indicate that r...

  6. A temperature-sensitive allele of a putative mRNA splicing helicase down-regulates many cell wall genes and causes radial swelling in Arabidopsis thaliana.

    Howles, Paul A; Gebbie, Leigh K; Collings, David A; Varsani, Arvind; Broad, Ronan C; Ohms, Stephen; Birch, Rosemary J; Cork, Ann H; Arioli, Tony; Williamson, Richard E

    2016-05-01

    The putative RNA helicase encoded by the Arabidopsis gene At1g32490 is a homolog of the yeast splicing RNA helicases Prp2 and Prp22. We isolated a temperature-sensitive allele (rsw12) of the gene in a screen for root radial swelling mutants. Plants containing this allele grown at the restrictive temperature showed weak radial swelling, were stunted with reduced root elongation, and contained reduced levels of cellulose. The role of the protein was further explored by microarray analysis. By using both fold change cutoffs and a weighted gene coexpression network analysis (WGCNA) to investigate coexpression of genes, we found that the radial swelling phenotype was not linked to genes usually associated with primary cell wall biosynthesis. Instead, the mutation has strong effects on expression of secondary cell wall related genes. Many genes potentially associated with secondary walls were present in the most significant WGCNA module, as were genes coding for arabinogalactans and proteins with GPI anchors. The proportion of up-regulated genes that possess introns in rsw12 was above that expected if splicing was unrelated to the activity of the RNA helicase, suggesting that the helicase does indeed play a role in splicing in Arabidopsis. The phenotype may be due to a change in the expression of one or more genes coding for cell wall proteins.

  7. tRNA gene diversity in the three domains of life

    Kosuke eFujishima

    2014-05-01

    Full Text Available Transfer RNA (tRNA is widely known for its key role in decoding mRNA into protein. Despite their necessity and relatively short nucleotide sequences, a large diversity of gene structures and RNA secondary structures of pre-tRNAs and mature tRNAs have recently been discovered in the three domains of life. Growing evidences of disrupted tRNA genes in the genomes of Archaea reveals unique gene structures such as, intron-containing tRNA, split tRNA, and permuted tRNA. Coding sequence for these tRNAs are either separated with introns, fragmented, or permuted at the genome level. Although evolutionary scenario behind the tRNA gene disruption is still unclear, diversity of tRNA structure seems to be co-evolved with their processing enzyme, so-called RNA splicing endonuclease. Metazoan mitochondrial tRNAs (mtRNAs are known for their unique lack of either one or two arms from the typical tRNA cloverleaf structure, while still maintaining functionality. Recently identified nematode-specific V-arm containing tRNAs (nev-tRNAs possess long variable arms that are specific to eukaryotic class II tRNASer and tRNALeu but also decode class I tRNA codons. Moreover, many tRNA-like sequences have been found in the genomes of different organisms and viruses. Thus this review is aimed to cover the latest knowledge on tRNA gene diversity and further recapitulate the evolutionary and biological aspects that caused such uniqueness.

  8. Differences in correlation of mRNA gene expression in mice sensitive and resistant to radiation-induced pulmonary fibrosis

    Johnston, C.J.; Piedboeuf, B.; Finkelstein, J.N.; Baggs, R.; Rubin, P.

    1995-01-01

    Fibrosis, characterized by the accumulation of collagen, is a late result of thoracic irradiation. The purpose of this study was to determine if extracellular matrix protein and transforming growth factor β mRNA expression are altered late in the course of pulmonary fibrosis after irradiation, and then to determine if these changes differ between two strains of mice which vary in their sensitivity to radiation. Radiation-sensitive (C57BL/6) and radiation-resistant (C3H/HeJ) mice were irradiated with a single dose of 5 or 12.5 Gy to the thorax. Total lung RNA was prepared and immobilized by Northern and slot blotting and hybridized with radiolabeled cDNA probes for collagens I, III and IV, fibronectin, and transforming growth factor β 1 and β 3 . Autoradiographic data were quantified by video densitometry and results normalized to a control probe encoding for glyceralde-hyde-3-phosphate dehydrogenase. Alterations in mRNA abundance were observed in the sensitive mice at all times, while levels in the resistant mice were unaffected until 26 weeks after irradiation. The relationship between extracellular matrix protein per se and increased mRNA abundance suggests that late matrix protein accumulation may be a function of gene expression. Differences in levels of transforming growth factor βmRNA may lead to strain-dependent variation in fibrotic response and may also contribute to the radiation-induced component of pulmonary fibrosis. 32 refs., 5 figs

  9. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

    Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

    2015-04-01

    Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

  10. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  11. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin

    2008-01-01

    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy

  12. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  13. The hypoxic proteome is influenced by gene-specific changes in mRNA translation

    Koritzinsky, Marianne; Seigneuric, Renaud; Magagnin, Michael G.; Beucken, Twan van den; Lambin, Philippe; Wouters, Bradly G.

    2005-01-01

    Background and purpose: Hypoxia causes a rapid reduction in mRNA translation efficiency. This inhibition does not affect all mRNA species to the same extent and can therefore contribute significantly to hypoxia-induced differential protein expression. Our aim in this study was to characterize changes in gene expression during acute hypoxia and evaluate the contribution of regulation via mRNA translation on these changes. For each gene, the contribution of changes in mRNA abundance versus mRNA translation was determined. Materials and methods: DU145 prostate carcinoma cells were exposed to 4 h of hypoxia ( 2 ). Efficiently translated mRNAs were isolated by sedimentation through a sucrose gradient. Affymetrix microarray technology was used to evaluate both the transcriptional and translational contribution to gene expression. Results were validated by quantitative PCR. Results: One hundred and twenty genes were more than 4-fold upregulated by hypoxia in the efficiently translated fraction of mRNA, in comparison to only 76 genes at the level of transcription. Of the 50 genes demonstrating the largest changes in translation, 11 were found to be more than 2-fold over represented in the translated fraction in comparison to their overall transcriptional level. The gene with the highest translational contribution to its induction was CITED-2, which is a negative regulator of HIF-1 transcriptional activity. Conclusions: Gene-specific regulation of mRNA translation contributes significantly to differential gene expression during hypoxia

  14. Sp1-mediated transcription regulation of TAF-Ialpha gene encoding a histone chaperone.

    Asaka, Masamitsu N; Murano, Kensaku; Nagata, Kyosuke

    2008-11-28

    TAF-I, one of histone chaperones, consists of two subtypes, TAF-Ialpha and TAF-Ibeta. The histone chaperone activity of TAF-I is regulated by dimer patterns of these subtypes. TAF-Ibeta is expressed ubiquitously, while the expression level of TAF-Ialpha with less activity than TAF-Ibeta differs among cell types. It is, therefore, assumed that the expression level of TAF-Ialpha in a cell is important for the TAF-I activity level. Here, we found that TAF-Ialpha and TAF-Ibeta genes are under the control of distinct promoters. Reporter assays and gel shift assays demonstrated that Sp1 binds to three regions in the TAF-Ialpha promoter and two or all mutaions of the three Sp1 binding regions reduced the TAF-Ialpha promoter activity. ChIP assays demonstrated that Sp1 binds to the TAF-Ialpha promoter in vivo. Furthermore, the expression level of TAF-Ialpha mRNA was reduced by knockdown of Sp1 using siRNA method. These studies indicated that the TAF-Ialpha promoter is under the control of Sp1.

  15. Integration analysis of microRNA and mRNA paired expression profiling identifies deregulated microRNA-transcription factor-gene regulatory networks in ovarian endometriosis.

    Zhao, Luyang; Gu, Chenglei; Ye, Mingxia; Zhang, Zhe; Li, Li'an; Fan, Wensheng; Meng, Yuanguang

    2018-01-22

    The etiology and pathophysiology of endometriosis remain unclear. Accumulating evidence suggests that aberrant microRNA (miRNA) and transcription factor (TF) expression may be involved in the pathogenesis and development of endometriosis. This study therefore aims to survey the key miRNAs, TFs and genes and further understand the mechanism of endometriosis. Paired expression profiling of miRNA and mRNA in ectopic endometria compared with eutopic endometria were determined by high-throughput sequencing techniques in eight patients with ovarian endometriosis. Binary interactions and circuits among the miRNAs, TFs, and corresponding genes were identified by the Pearson correlation coefficients. miRNA-TF-gene regulatory networks were constructed using bioinformatic methods. Eleven selected miRNAs and TFs were validated by quantitative reverse transcription-polymerase chain reaction in 22 patients. Overall, 107 differentially expressed miRNAs and 6112 differentially expressed mRNAs were identified by comparing the sequencing of the ectopic endometrium group and the eutopic endometrium group. The miRNA-TF-gene regulatory network consists of 22 miRNAs, 12 TFs and 430 corresponding genes. Specifically, some key regulators from the miR-449 and miR-34b/c cluster, miR-200 family, miR-106a-363 cluster, miR-182/183, FOX family, GATA family, and E2F family as well as CEBPA, SOX9 and HNF4A were suggested to play vital regulatory roles in the pathogenesis of endometriosis. Integration analysis of the miRNA and mRNA expression profiles presents a unique insight into the regulatory network of this enigmatic disorder and possibly provides clues regarding replacement therapy for endometriosis.

  16. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  17. Integration of the Pokeweed miRNA and mRNA Transcriptomes Reveals Targeting of Jasmonic Acid-Responsive Genes

    Kira C. M. Neller

    2018-05-01

    Full Text Available The American pokeweed plant, Phytolacca americana, displays broad-spectrum resistance to plant viruses and is a heavy metal hyperaccumulator. However, little is known about the regulation of biotic and abiotic stress responses in this non-model plant. To investigate the control of miRNAs in gene expression, we sequenced the small RNA transcriptome of pokeweed treated with jasmonic acid (JA, a hormone that mediates pathogen defense and stress tolerance. We predicted 145 miRNAs responsive to JA, most of which were unique to pokeweed. These miRNAs were low in abundance and condition-specific, with discrete expression change. Integration of paired mRNA-Seq expression data enabled us to identify correlated, novel JA-responsive targets that mediate hormone biosynthesis, signal transduction, and pathogen defense. The expression of approximately half the pairs was positively correlated, an uncommon finding that we functionally validated by mRNA cleavage. Importantly, we report that a pokeweed-specific miRNA targets the transcript of OPR3, novel evidence that a miRNA regulates a JA biosynthesis enzyme. This first large-scale small RNA study of a Phytolaccaceae family member shows that miRNA-mediated control is a significant component of the JA response, associated with widespread changes in expression of genes required for stress adaptation.

  18. Genetic selection and DNA sequences of 4.5S RNA homologs

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  19. Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

    Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

    2014-01-13

    Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The

  20. In vitro processing of the RNA-2-encoded polyprotein of two nepoviruses: tomato black ring virus and grapevine chrome mosaic virus.

    Demangeat, G; Hemmer, O; Fritsch, C; Le Gall, O; Candresse, T

    1991-02-01

    In vitro translation of RNA-2 of each of two closely related nepoviruses, tomato black ring virus (TBRV) and grapevine chrome mosaic virus (GCMV), in a rabbit reticulocyte lysate resulted in the synthesis of single polypeptides of 150K and 146K respectively. Processing of these polyproteins occurred after the addition of translation products of homologous RNA-1. The positions of the cleavage products within the polyproteins were determined. From the N to the C terminus, Mr values for the proteins were 50K, 46K and 59K for TBRV and 44K, 46K and 56K for GCMV. TBRV RNA-1 translation products also cleaved the polyproteins encoded by GCMV RNA-2 which suggests that the cleavage sites in the two polyproteins are similar.

  1. A genome-wide characterization of microRNA genes in maize.

    Lifang Zhang

    2009-11-01

    Full Text Available MicroRNAs (miRNAs are small, non-coding RNAs that play essential roles in plant growth, development, and stress response. We conducted a genome-wide survey of maize miRNA genes, characterizing their structure, expression, and evolution. Computational approaches based on homology and secondary structure modeling identified 150 high-confidence genes within 26 miRNA families. For 25 families, expression was verified by deep-sequencing of small RNA libraries that were prepared from an assortment of maize tissues. PCR-RACE amplification of 68 miRNA transcript precursors, representing 18 families conserved across several plant species, showed that splice variation and the use of alternative transcriptional start and stop sites is common within this class of genes. Comparison of sequence variation data from diverse maize inbred lines versus teosinte accessions suggest that the mature miRNAs are under strong purifying selection while the flanking sequences evolve equivalently to other genes. Since maize is derived from an ancient tetraploid, the effect of whole-genome duplication on miRNA evolution was examined. We found that, like protein-coding genes, duplicated miRNA genes underwent extensive gene-loss, with approximately 35% of ancestral sites retained as duplicate homoeologous miRNA genes. This number is higher than that observed with protein-coding genes. A search for putative miRNA targets indicated bias towards genes in regulatory and metabolic pathways. As maize is one of the principal models for plant growth and development, this study will serve as a foundation for future research into the functional roles of miRNA genes.

  2. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  3. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  4. Cocaine Administration and Its Withdrawal Enhance the Expression of Genes Encoding Histone-Modifying Enzymes and Histone Acetylation in the Rat Prefrontal Cortex.

    Sadakierska-Chudy, Anna; Frankowska, Małgorzata; Jastrzębska, Joanna; Wydra, Karolina; Miszkiel, Joanna; Sanak, Marek; Filip, Małgorzata

    2017-07-01

    Chronic exposure to cocaine, craving, and relapse are attributed to long-lasting changes in gene expression arising through epigenetic and transcriptional mechanisms. Although several brain regions are involved in these processes, the prefrontal cortex seems to play a crucial role not only in motivation and decision-making but also in extinction and seeking behavior. In this study, we applied cocaine self-administration and extinction training procedures in rats with a yoked triad to determine differentially expressed genes in prefrontal cortex. Microarray analysis showed significant upregulation of several genes encoding histone modification enzymes during early extinction training. Subsequent real-time PCR testing of these genes following cocaine self-administration or early (third day) and late (tenth day) extinction revealed elevated levels of their transcripts. Interestingly, we found the enrichment of Brd1 messenger RNA in rats self-administering cocaine that lasted until extinction training during cocaine withdrawal with concomitant increased acetylation of H3K9 and H4K8. However, despite elevated levels of methyl- and demethyltransferase-encoded transcripts, no changes in global di- and tri-methylation of histone H3 at lysine 4, 9, 27, and 79 were observed. Surprisingly, at the end of extinction training (10 days of cocaine withdrawal), most of the analyzed genes in the rats actively and passively administering cocaine returned to the control level. Together, the alterations identified in the rat prefrontal cortex may suggest enhanced chromatin remodeling and transcriptional activity induced by early cocaine abstinence; however, to know whether they are beneficial or not for the extinction of drug-seeking behavior, further in vivo evaluation is required.

  5. Bcmimp1, a Botrytis cinerea gene transiently expressed in planta, encodes a mitochondrial protein

    David eBenito-Pescador

    2016-02-01

    Full Text Available Botrytis cinerea is a widespread necrotrophic fungus which infects more than 200 plant species. In an attempt to characterize the physiological status of the fungus in planta and to identify genetic factors contributing to its ability to infect the host cells, a differential gene expression analysis during the interaction B. cinerea-tomato was carried out. Gene Bcmimp1 codes for a mRNA detected by differential display in the course of this analysis. During the interaction with the host, it shows a transient expression pattern with maximal expression levels during the colonization and maceration of the infected tissues. Bioinformatic analysis suggested that BCMIMP1 is an integral membrane protein located in the mitochondrial inner membrane. Co-localization experiments with a BCMIMP1-GFP fusion protein confirmed that the protein is targeted to the mitochondria. ΔBcmimp1 mutants do not show obvious phenotypic differences during saprophytic growth and their infection ability was unaltered as compared to the wild-type. Interestingly, the mutants produced increased levels of ROS, likely as a consequence of disturbed mitochondrial function. Although Bcmimp1 expression is enhanced in planta it cannot be considered a pathogenicity factor.

  6. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  7. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  8. EsrE-A yigP Locus-Encoded Transcript-Is a 3′ UTR sRNA Involved in the Respiratory Chain of E. coli

    Hui Xia

    2017-08-01

    Full Text Available The yigP locus is widely conserved among γ-proteobacteria. Mutation of the yigP locus impacts aerobic growth of Gram-negative bacteria. However, the underlying mechanism of how the yigP locus influences aerobic growth remains largely unknown. Here, we demonstrated that the yigP locus in Escherichia coli encodes two transcripts; the mRNA of ubiquinone biosynthesis protein, UbiJ, and the 3′ untranslated region small regulatory RNA (sRNA, EsrE. EsrE is an independent transcript that is transcribed using an internal promoter of the yigP locus. Surprisingly, we found that both the EsrE sRNA and UbiJ protein were required for Q8 biosynthesis, and were sufficient to rescue the growth defect ascribed to deletion of the yigP locus. Moreover, our data showed that EsrE targeted multiple mRNAs involved in several cellular processes including murein biosynthesis and the tricarboxylic acid cycle. Among these targets, sdhD mRNA that encodes one subunit of succinate dehydrogenase (SDH, was significantly activated. Our findings provided an insight into the important function of EsrE in bacterial adaptation to various environments, as well as coordinating different aspects of bacterial physiology.

  9. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Jiangyu Wu

    2013-01-01

    Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.

  10. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Huang, Weizhe; He, Ziying

    2013-01-01

    RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

  11. Transcriptome-wide effects of inverted SINEs on gene expression and their impact on RNA polymerase II activity.

    Tajaddod, Mansoureh; Tanzer, Andrea; Licht, Konstantin; Wolfinger, Michael T; Badelt, Stefan; Huber, Florian; Pusch, Oliver; Schopoff, Sandy; Janisiw, Michael; Hofacker, Ivo; Jantsch, Michael F

    2016-10-25

    Short interspersed elements (SINEs) represent the most abundant group of non-long-terminal repeat transposable elements in mammalian genomes. In primates, Alu elements are the most prominent and homogenous representatives of SINEs. Due to their frequent insertion within or close to coding regions, SINEs have been suggested to play a crucial role during genome evolution. Moreover, Alu elements within mRNAs have also been reported to control gene expression at different levels. Here, we undertake a genome-wide analysis of insertion patterns of human Alus within transcribed portions of the genome. Multiple, nearby insertions of SINEs within one transcript are more abundant in tandem orientation than in inverted orientation. Indeed, analysis of transcriptome-wide expression levels of 15 ENCODE cell lines suggests a cis-repressive effect of inverted Alu elements on gene expression. Using reporter assays, we show that the negative effect of inverted SINEs on gene expression is independent of known sensors of double-stranded RNAs. Instead, transcriptional elongation seems impaired, leading to reduced mRNA levels. Our study suggests that there is a bias against multiple SINE insertions that can promote intramolecular base pairing within a transcript. Moreover, at a genome-wide level, mRNAs harboring inverted SINEs are less expressed than mRNAs harboring single or tandemly arranged SINEs. Finally, we demonstrate a novel mechanism by which inverted SINEs can impact on gene expression by interfering with RNA polymerase II.

  12. RNA-Seq analysis identifies key genes associated with haustorial development in the root hemiparasite Santalum album

    Xinhua eZhang

    2015-09-01

    Full Text Available Santalum album (sandalwood is one of the economically important plant species in the Santalaceae for its production of highly valued perfume oils. Sandalwood is also a hemiparasitic tree that obtains some of its water and simple nutrients by tapping into other plants through haustoria which are highly specialized organs in parasitic angiosperms. However, an understanding of the molecular mechanisms involved in haustorium development is limited. In this study, RNA sequencing (RNA-seq analyses were performed to identify changes in gene expression and metabolic pathways associated with the development of the S. album haustorium. A total of 56,011 non-redundant contigs with a mean contig size of 618 bp were obtained by de novo assembly of the transcriptome of haustoria and non-haustorial seedling roots. A substantial number of the identified differentially expressed genes were involved in cell wall metabolism and protein metabolism, as well as mitochondrial electron transport functions. Phytohormone-mediated regulation might play an important role during haustorial development. Especially, auxin signaling is likely to be essential for haustorial initiation, and genes related to cytokinin and gibberellin biosynthesis and metabolism are involved in haustorial development. Our results suggest that genes encoding nodulin-like proteins may be important for haustorial morphogenesis in S. album. The obtained sequence data will become a rich resource for future research in this interesting species. This information improves our understanding of haustorium development in root hemiparasitic species and will allow further exploration of the detailed molecular mechanisms underlying plant parasitism.

  13. Human intronless genes: Functional groups, associated diseases, evolution, and mRNA processing in absence of splicing

    Grzybowska, Ewa A.

    2012-01-01

    Highlights: ► Functional characteristics of intronless genes (IGs). ► Diseases associated with IGs. ► Origin and evolution of IGs. ► mRNA processing without splicing. -- Abstract: Intronless genes (IGs) constitute approximately 3% of the human genome. Human IGs are essentially different in evolution and functionality from the IGs of unicellular eukaryotes, which represent the majority in their genomes. Functional analysis of IGs has revealed a massive over-representation of signal transduction genes and genes encoding regulatory proteins important for growth, proliferation, and development. IGs also often display tissue-specific expression, usually in the nervous system and testis. These characteristics translate into IG-associated diseases, mainly neuropathies, developmental disorders, and cancer. IGs represent recent additions to the genome, created mostly by retroposition of processed mRNAs with retained functionality. Processing, nuclear export, and translation of these mRNAs should be hampered dramatically by the lack of splice factors, which normally tightly cover mature transcripts and govern their fate. However, natural IGs manage to maintain satisfactory expression levels. Different mechanisms by which IGs solve the problem of mRNA processing and nuclear export are discussed here, along with their possible impact on reporter studies.

  14. Seeing the forest for the trees: annotating small RNA producing genes in plants.

    Coruh, Ceyda; Shahid, Saima; Axtell, Michael J

    2014-04-01

    A key goal in genomics is the complete annotation of the expressed regions of the genome. In plants, substantial portions of the genome make regulatory small RNAs produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins. These include miRNAs and various types of endogenous siRNAs. Small RNA-seq, enabled by cheap and fast DNA sequencing, has produced an enormous volume of data on plant miRNA and siRNA expression in recent years. In this review, we discuss recent progress in using small RNA-seq data to produce stable and reliable annotations of miRNA and siRNA genes in plants. In addition, we highlight key goals for the future of small RNA gene annotation in plants. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  16. How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?

    Pelczar, P.; Fiett, J.; Bartnik, E.

    1994-01-01

    We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig

  17. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  18. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  19. Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa.

    Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz

    2013-08-30

    Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Transcriptomic profiling of interacting nasal staphylococci species reveals global changes in gene and non-coding RNA expression

    Hermansen, Grith Miriam Maigaard; Sazinas, Pavelas; Kofod, Ditte

    2018-01-01

    Interspecies interactions between bacterial pathogens and the commensal microbiota can influence disease outcome. In the nasal cavities, Staphylococcus epidermidis has been shown to be a determining factor for Staphylococcus aureus colonization and biofilm formation. However, the interaction...... between S. epidermidis and S. aureus has mainly been described by phenotypic analysis, and little is known about how this interaction modulates gene expression.This study aimed to determine the interactome of nasal S. aureus and S. epidermidis isolates to understand the molecular effect of interaction...... also identified putative non-coding RNAs (ncRNAs) and, interestingly, detected a putative ncRNA transcribed antisense to esp, the serine protease of S. epidermidis, that has previously been shown to inhibit nasal colonization of S. aureus. In our study, the gene encoding Esp and the antisense nc...

  1. Phage T4 SegB protein is a homing endonuclease required for the preferred inheritance of T4 tRNA gene region occurring in co-infection with a related phage.

    Brok-Volchanskaya, Vera S; Kadyrov, Farid A; Sivogrivov, Dmitry E; Kolosov, Peter M; Sokolov, Andrey S; Shlyapnikov, Michael G; Kryukov, Valentine M; Granovsky, Igor E

    2008-04-01

    Homing endonucleases initiate nonreciprocal transfer of DNA segments containing their own genes and the flanking sequences by cleaving the recipient DNA. Bacteriophage T4 segB gene, which is located in a cluster of tRNA genes, encodes a protein of unknown function, homologous to homing endonucleases of the GIY-YIG family. We demonstrate that SegB protein is a site-specific endonuclease, which produces mostly 3' 2-nt protruding ends at its DNA cleavage site. Analysis of SegB cleavage sites suggests that SegB recognizes a 27-bp sequence. It contains 11-bp conserved sequence, which corresponds to a conserved motif of tRNA TpsiC stem-loop, whereas the remainder of the recognition site is rather degenerate. T4-related phages T2L, RB1 and RB3 contain tRNA gene regions that are homologous to that of phage T4 but lack segB gene and several tRNA genes. In co-infections of phages T4 and T2L, segB gene is inherited with nearly 100% of efficiency. The preferred inheritance depends absolutely on the segB gene integrity and is accompanied by the loss of the T2L tRNA gene region markers. We suggest that SegB is a homing endonuclease that functions to ensure spreading of its own gene and the surrounding tRNA genes among T4-related phages.

  2. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  3. Simultaneous visualization of the subfemtomolar expression of microRNA and microRNA target gene using HILO microscopy.

    Lin, Yi-Zhen; Ou, Da-Liang; Chang, Hsin-Yuan; Lin, Wei-Yu; Hsu, Chiun; Chang, Po-Ling

    2017-09-01

    The family of microRNAs (miRNAs) not only plays an important role in gene regulation but is also useful for the diagnosis of diseases. A reliable method with high sensitivity may allow researchers to detect slight fluctuations in ultra-trace amounts of miRNA. In this study, we propose a sensitive imaging method for the direct probing of miR-10b (miR-10b-3p, also called miR-10b*) and its target ( HOXD10 mRNA) in fixed cells based on the specific recognition of molecular beacons combined with highly inclined and laminated optical sheet (HILO) fluorescence microscopy. The designed dye-quencher-labelled molecular beacons offer excellent efficiencies of fluorescence resonance energy transfer that allow us to detect miRNA and the target mRNA simultaneously in hepatocellular carcinoma cells using HILO fluorescence microscopy. Not only can the basal trace amount of miRNA be observed in each individual cell, but the obtained images also indicate that this method is useful for monitoring the fluctuations in ultra-trace amounts of miRNA when the cells are transfected with a miRNA precursor or a miRNA inhibitor (anti-miR). Furthermore, a reasonable causal relation between the miR-10b and HOXD10 expression levels was observed in miR-10b* precursor-transfected cells and miR-10b* inhibitor-transfected cells. The trends of the miRNA alterations obtained using HILO microscopy completely matched the RT-qPCR data and showed remarkable reproducibility (the coefficient of variation [CV] = 0.86%) and sensitivity (<1.0 fM). This proposed imaging method appears to be useful for the simultaneous visualisation of ultra-trace amounts of miRNA and target mRNA and excludes the procedures for RNA extraction and amplification. Therefore, the visualisation of miRNA and the target mRNA should facilitate the exploration of the functions of ultra-trace amounts of miRNA in fixed cells in biological studies and may serve as a powerful tool for diagnoses based on circulating cancer cells.

  4. Squamous Cell Carcinoma Antigen-encoding Genes SERPINB3/B4 as Potentially Useful Markers for the Stratification of HNSCC Tumours.

    Saidak, Zuzana; Morisse, Mony Chenda; Chatelain, Denis; Sauzay, Chloé; Houessinon, Aline; Guilain, Nelly; Soyez, Marion; Chauffert, Bruno; Dakpé, Stéphanie; Galmiche, Antoine

    2018-03-01

    The squamous cell carcinoma antigen (SCCA), encoded by the genes SERPINB3/B4, is a tumour marker produced by head and neck squamous cell carcinoma (HNSCC). We aimed to examine SERPINB3/B4 mRNA levels and its clinical significance in the therapeutic context. We retrieved mRNA expression levels, clinical, pathological and genomic data for 520 HNSCC from The Cancer Genome Atlas (TCGA). HNSCC tumours express high levels of SERPINB3/B4 mRNA. SERPINB3 expression differs depending on Human papillomavirus (HPV) infection status, primary tumour location, grade and differentiation, extension to lymph nodes and extracapsular spread. Interestingly, we observed an association between SERPINB3/B4 and the presence of tumour immune infiltrate as well as the expression of the immune checkpoint regulators PD-L1/PD-L2 that depended on HPV status. Our findings point to potential interest of SERPINB3/B4 for the stratification of HNSCC patients in the therapeutic context. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  5. The differentiation status of primary gonadal germ cell tumors correlates inversely with telomerase activity and the expression level of the gene encoding the catalytic subunit of telomerase

    Schrader, Mark; Burger, Angelika M; Müller, Markus; Krause, Hans; Straub, Bernd; Schostak, Martin; Schulze, Wolfgang; Lauke, Heidrun; Miller, Kurt

    2002-01-01

    The activity of the ribonucleoprotein enzyme telomerase is detectable in germ, stem and tumor cells. One major component of telomerase is human telomerase reverse transcriptase (hTERT), which encodes the catalytic subunit of telomerase. Here we investigate the correlation of telomerase activity and hTERT gene expression and the differentiation status of primary testicular germ cell tumors (TGCT). Telomerase activity (TA) was detected by a quantitative telomerase PCR ELISA, and hTERT mRNA expression was quantified by online RT-PCR in 42 primary testicular germ cell tumors. The control group consisted of benign testicular biopsies from infertile patients. High levels of telomerase activity and hTERT expression were detected in all examined undifferentiated TGCTs and in the benign testicular tissue specimens with germ cell content. In contrast, differentiated teratomas and testicular control tissue without germ cells (Sertoli-cell-only syndrome) showed no telomerase activity and only minimal hTERT expression. These findings demonstrate an inverse relationship between the level of telomerase activity and hTERT mRNA expression and the differentiation state of germ cell tumors. Quantification of telomerase activity and hTERT mRNA expression enables a new molecular-diagnostic subclassification of germ cell tumors that describes their proliferation potential and differentiation status

  6. The differentiation status of primary gonadal germ cell tumors correlates inversely with telomerase activity and the expression level of the gene encoding the catalytic subunit of telom