DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Lu, C.; Fedoroff, N.
2000-01-01
Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.
Directory of Open Access Journals (Sweden)
David H. Dreyfus
2017-01-01
Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them
Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika
2007-03-13
The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).
MicroRNA-encoding long non-coding RNAs
Directory of Open Access Journals (Sweden)
Zhu Xiaopeng
2008-05-01
Full Text Available Abstract Background Recent analysis of the mouse transcriptional data has revealed the existence of ~34,000 messenger-like non-coding RNAs (ml-ncRNAs. Whereas the functional properties of these ml-ncRNAs are beginning to be unravelled, no functional information is available for the large majority of these transcripts. Results A few ml-ncRNA have been shown to have genomic loci that overlap with microRNA loci, leading us to suspect that a fraction of ml-ncRNA may encode microRNAs. We therefore developed an algorithm (PriMir for specifically detecting potential microRNA-encoding transcripts in the entire set of 34,030 mouse full-length ml-ncRNAs. In combination with mouse-rat sequence conservation, this algorithm detected 97 (80 of them were novel strong miRNA-encoding candidates, and for 52 of these we obtained experimental evidence for the existence of their corresponding mature microRNA by microarray and stem-loop RT-PCR. Sequence analysis of the microRNA-encoding RNAs revealed an internal motif, whose presence correlates strongly (R2 = 0.9, P-value = 2.2 × 10-16 with the occurrence of stem-loops with characteristics of known pre-miRNAs, indicating the presence of a larger number microRNA-encoding RNAs (from 300 up to 800 in the ml-ncRNAs population. Conclusion Our work highlights a unique group of ml-ncRNAs and offers clues to their functions.
dPORE-miRNA: Polymorphic regulation of microRNA genes
Schmeier, Sebastian; Schaefer, Ulf; MacPherson, Cameron R.; Bajic, Vladimir B.
2011-01-01
Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.
dPORE-miRNA: Polymorphic regulation of microRNA genes
Schmeier, Sebastian
2011-02-04
Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.
International Nuclear Information System (INIS)
Cirullo, R.E.; Dana, S.; Wasmuth, J.J.
1983-01-01
A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure
International Nuclear Information System (INIS)
Castelli, Martina Galatea; Rusten, Marte; Goksøyr, Anders; Routti, Heli
2014-01-01
Highlights: •Genes regulating lipid metabolism were studied in ringed seals. •We compared highly contaminated Baltic seals and less contaminated Svalbard seals. •mRNA expression of hepatic PPARγ was higher in the Baltic seals. •mRNA expression of adipose PPARγ target genes was higher in the Baltic seals. •Contaminant exposure may affect lipid metabolism in the Baltic ringed seals. -- Abstract: There is a growing concern about the ability of persistent organic pollutants (POPs) to influence lipid metabolism. Although POPs are found at high concentrations in some populations of marine mammals, for example in the ringed seal (Pusa hispida) from the Baltic Sea, little is known about the effects of POPs on their lipid metabolism. An optimal regulation of lipid metabolism is crucial for ringed seals during the fasting/molting season. This is a physiologically stressful period, during which they rely on the energy stored in their fat reserves. The mRNA expression levels for seven genes involved in lipid metabolism were analyzed in liver and/or blubber tissue from molting ringed seals from the polluted Baltic Sea and a less polluted reference location, Svalbard (Norway). mRNA expression of genes encoding peroxisome proliferator-activated receptors (PPAR) α and γ and their target genes acyl-coenzyme A oxidase 1 (ACOX1) and cluster of differentiation 36 (CD36) were analyzed in liver. mRNA expression level of genes encoding PPARβ, PPARγ and their target genes encoding fatty acid binding protein 4 (FABP4) and adiponectin (ADIPOQ) were measured in inner and middle blubber layers. In addition, we evaluated the influence of molting status on hepatic mRNA expression of genes encoding PPARs and their target genes in ringed seals from Svalbard. Our results show higher mRNA expression of genes encoding hepatic PPARγ and adipose PPARβ, FABP4, and ADIPOQ in the Baltic seals compared to the Svalbard seals. A positive relationship between mRNA expressions of genes
Energy Technology Data Exchange (ETDEWEB)
Castelli, Martina Galatea [Norwegian Polar Institute, Fram Centre, 9296 Tromsø (Norway); University of Bergen, Department of Biology, 5020 Bergen (Norway); Rusten, Marte; Goksøyr, Anders [University of Bergen, Department of Biology, 5020 Bergen (Norway); Routti, Heli, E-mail: heli.routti@npolar.no [Norwegian Polar Institute, Fram Centre, 9296 Tromsø (Norway)
2014-01-15
Highlights: •Genes regulating lipid metabolism were studied in ringed seals. •We compared highly contaminated Baltic seals and less contaminated Svalbard seals. •mRNA expression of hepatic PPARγ was higher in the Baltic seals. •mRNA expression of adipose PPARγ target genes was higher in the Baltic seals. •Contaminant exposure may affect lipid metabolism in the Baltic ringed seals. -- Abstract: There is a growing concern about the ability of persistent organic pollutants (POPs) to influence lipid metabolism. Although POPs are found at high concentrations in some populations of marine mammals, for example in the ringed seal (Pusa hispida) from the Baltic Sea, little is known about the effects of POPs on their lipid metabolism. An optimal regulation of lipid metabolism is crucial for ringed seals during the fasting/molting season. This is a physiologically stressful period, during which they rely on the energy stored in their fat reserves. The mRNA expression levels for seven genes involved in lipid metabolism were analyzed in liver and/or blubber tissue from molting ringed seals from the polluted Baltic Sea and a less polluted reference location, Svalbard (Norway). mRNA expression of genes encoding peroxisome proliferator-activated receptors (PPAR) α and γ and their target genes acyl-coenzyme A oxidase 1 (ACOX1) and cluster of differentiation 36 (CD36) were analyzed in liver. mRNA expression level of genes encoding PPARβ, PPARγ and their target genes encoding fatty acid binding protein 4 (FABP4) and adiponectin (ADIPOQ) were measured in inner and middle blubber layers. In addition, we evaluated the influence of molting status on hepatic mRNA expression of genes encoding PPARs and their target genes in ringed seals from Svalbard. Our results show higher mRNA expression of genes encoding hepatic PPARγ and adipose PPARβ, FABP4, and ADIPOQ in the Baltic seals compared to the Svalbard seals. A positive relationship between mRNA expressions of genes
Directory of Open Access Journals (Sweden)
Bryan Holland
Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the
International Nuclear Information System (INIS)
Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.
2004-01-01
Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
DEFF Research Database (Denmark)
Liu, M; Kirpekar, F; Van Wezel, G P
2000-01-01
tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... is dependent on the presence of the methyl group donor, S-adenosyl methionine. Analysis of the 74-mer RNA substrate by biochemical and mass spectrometric methods shows that TlrB adds a single methyl group to the base of G748. Homologues of TlrB in other bacteria have been revealed through database searches...
International Nuclear Information System (INIS)
Heck, J.D. III.
1988-01-01
This work reports the subcloning and characterization of the molecular elements necessary for the expression of the Escherichia coli valS gene encoding valyl-tRNA synthetase. The valS gene was subcloned from plasmid pLC26-22 by genetic complementation of a valS ts strain. The DNA region encoding the valS structural gene was determined by in vitro coupled transcription-translation assays. Cells transformed with a plasmid containing a full length copy of the valS gene enhanced in vivo valyl-tRNA synthetase specific activity twelve-fold. DNA sequences flanking the valS structural gene are presented. The transcription initiation sites of the valS gene were determined, in vivo and in vitro, by S1 nuclease protection studies, primer-extension analysis and both [α- 32 P]labeled and [γ- 32 P]end-labeled in vitro transcription assays. The DNA sequence of the valS gene of Escherichia coli has been determined. Significant similarity at the primary sequence level was detected between valyl-tRNA synthetase of E. coli and other known branched-chain aminoacyl-tRNA synthetases. An extended open reading frame (ORF) encoded on the DNA strand opposite the valS structural gene is described
International Nuclear Information System (INIS)
Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin
2006-01-01
Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents ...
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Darwinian Evolution of Mutualistic RNA Replicators with Different Genes
Mizuuchi, R.; Ichihashi, N.
2017-07-01
We report a sustainable long-term replication and evolution of two distinct cooperative RNA replicators encoding different genes. One of the RNAs evolved to maintain or increase the cooperativity, despite selective advantage of selfish mutations.
A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.
Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L
2017-07-15
Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Van L.T. Hoang
2017-08-01
Full Text Available Identification of appropriate reference genes (RGs is critical to accurate data interpretation in quantitative real-time PCR (qPCR experiments. In this study, we have utilised next generation RNA sequencing (RNA-seq to analyse the transcriptome of a panel of non-melanoma skin cancer lesions, identifying genes that are consistently expressed across all samples. Genes encoding ribosomal proteins were amongst the most stable in this dataset. Validation of this RNA-seq data was examined using qPCR to confirm the suitability of a set of highly stable genes for use as qPCR RGs. These genes will provide a valuable resource for the normalisation of qPCR data for the analysis of non-melanoma skin cancer.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian
2013-12-01
Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
BIOLOGICAL FUNCTION OF TOMBUSVIRUS-ENCODED SUPPRESSOR OF RNA SILENCING IN PLANTS
Directory of Open Access Journals (Sweden)
Omarov R.T.
2012-08-01
Full Text Available RNA interference (RNAi plays multiple biological roles in eukaryotic organisms to regulate gene expression. RNAi also operates as a conserved adaptive molecular immune mechanism against invading viruses. The antiviral RNAi pathway is initiated with the generation of virus-derived short-interfering RNAs (siRNAs that are used for subsequent sequence-specific recognition and degradation of the cognate viral RNA molecules. As an efficient counter-defensive strategy, most plant viruses evolved the ability to encode specific proteins capable of interfering with RNAi, and this process is commonly known as RNA silencing suppression. Virus-encoded suppressors of RNAi (VSRs operate at different steps in the RNAi pathway and display distinct biochemical properties that enable these proteins to efficiently interfere with the host-defense system. Tombusvirus-encoded P19 is an important pathogenicity factor, required for symptom development and elicitation of a hypersensitive response in a host-dependent manner. Protein plays a crucial role of TBSV P19 in protecting viral RNA during systemic infection on Nicotiana benthamiana. The X-ray crystallographic studies conducted by two independent groups revealed the existence of a P19-siRNA complex; a conformation whereby caliper tryptophan residues on two subunits of P19 dimers measure and bind 21-nt siRNA duplexes. These structural studies provided the first details on the possible molecular mechanism of any viral suppressor to block RNAi. The association between P19 and siRNAs was also shown to occur in infected plants These and related studies revealed that in general the ability of P19 to efficiently sequester siRNAs influences symptom severity, however this is not a strict correlation in all hosts.The current working model is that during TBSV infection of plants, P19 appropriates abundantly circulating Tombusvirus-derived siRNAs thereby rendering these unavailable to program RISC, to prevent degradation of
L.M. 't Hart (Leen); H.A.P. Pols (Huib); T. Hansen (Torben); I. Rietveld (Ingrid); J.M. Dekker (Jacqueline); J.A. Maassen (Johannes); M.G.A.A.M. Nijpels (Giel); G.M.C. Janssen (George); P.P. Arp (Pascal); R.J. Heine (Robert); A.G. Uitterlinden (André); T. Jorgensen (Torben); C.M. van Duijn (Cornelia); K. Borch-Johnsen; O. Pedersen (Oluf)
2005-01-01
textabstractPreviously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Lavysh, Daria; Sokolova, Maria; Slashcheva, Marina; Förstner, Konrad U; Severinov, Konstantin
2017-02-14
Bacteriophage AR9 is a recently sequenced jumbo phage that encodes two multisubunit RNA polymerases. Here we investigated the AR9 transcription strategy and the effect of AR9 infection on the transcription of its host, Bacillus subtilis Analysis of whole-genome transcription revealed early, late, and continuously expressed AR9 genes. Alignment of sequences upstream of the 5' ends of AR9 transcripts revealed consensus sequences that define early and late phage promoters. Continuously expressed AR9 genes have both early and late promoters in front of them. Early AR9 transcription is independent of protein synthesis and must be determined by virion RNA polymerase injected together with viral DNA. During infection, the overall amount of host mRNAs is significantly decreased. Analysis of relative amounts of host transcripts revealed notable differences in the levels of some mRNAs. The physiological significance of up- or downregulation of host genes for AR9 phage infection remains to be established. AR9 infection is significantly affected by rifampin, an inhibitor of host RNA polymerase transcription. The effect is likely caused by the antibiotic-induced killing of host cells, while phage genome transcription is solely performed by viral RNA polymerases. IMPORTANCE Phages regulate the timing of the expression of their own genes to coordinate processes in the infected cell and maximize the release of viral progeny. Phages also alter the levels of host transcripts. Here we present the results of a temporal analysis of the host and viral transcriptomes of Bacillus subtilis infected with a giant phage, AR9. We identify viral promoters recognized by two virus-encoded RNA polymerases that are a unique feature of the phiKZ-related group of phages to which AR9 belongs. Our results set the stage for future analyses of highly unusual RNA polymerases encoded by AR9 and other phiKZ-related phages. Copyright © 2017 Lavysh et al.
Identification of Aquifex aeolicus tRNA (m2(2G26) methyltransferase gene.
Takeda, Hiroshi; Hori, Hiroyuki; Endo, Yaeta
2002-01-01
The modifications of N2,N2-dimethylguanine (m2(2)G) are found in tRNAs and rRNAs from eukarya and archaea. In tRNAs, modification at position G26 is generated by tRNA (m2(2)G26) methyltransferase, which is encoded by the corresponding gene, trm1. This enzyme catalyzes the methyl-transfer from S-adenosyl-L-methionine to the semi-conserved residue, G26, via the intermediate modified base, m2G26. Recent genome sequencing project has been reported that the putative trm1 is encoded in the genome of Aquifex aeolicus, a hyper-thermophilic eubacterium as only one exception among eubacteria. In order to confirm whether this bacterial trm1 gene product is a real tRNA (m2(2)G26) methyltransferase or not, we expressed this protein by wheat germ in vitro cell-free translation system. Our biochemical analysis clearly showed that this gene product possessed tRNA (m2(2)G26) methyltransferase activity.
Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Qiu, Shuqing; Rollins, Meaghen; Datla, Raju; Gupta, Vidya S; Kadoo, Narendra Y
2013-04-01
MicroRNAs (miRNAs) are small (20-24 nucleotide long) endogenous regulatory RNAs that play important roles in plant growth and development. They regulate gene expression at the post-transcriptional level by translational repression or target degradation and gene silencing. In this study, we identified 116 conserved miRNAs belonging to 23 families from the flax (Linum usitatissimum L.) genome using a computational approach. The precursor miRNAs varied in length; while most of the mature miRNAs were 21 nucleotide long, intergenic and showed conserved signatures of RNA polymerase II transcripts in their upstream regions. Promoter region analysis of the flax miRNA genes indicated prevalence of MYB transcription factor binding sites. Four miRNA gene clusters containing members of three phylogenetic groups were identified. Further, 142 target genes were predicted for these miRNAs and most of these represent transcriptional regulators. The miRNA encoding genes were expressed in diverse tissues as determined by digital expression analysis as well as real-time PCR. The expression of fourteen miRNAs and nine target genes was independently validated using the quantitative reverse transcription PCR (qRT-PCR). This study suggests that a large number of conserved plant miRNAs are also found in flax and these may play important roles in growth and development of flax.
pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A Sequences
Directory of Open Access Journals (Sweden)
Alexandra E Grier
2016-01-01
Full Text Available Increasing demand for large-scale synthesis of in vitro transcribed (IVT mRNA is being driven by the increasing use of mRNA for transient gene expression in cell engineering and therapeutic applications. An important determinant of IVT mRNA potency is the 3′ polyadenosine (poly(A tail, the length of which correlates with translational efficiency. However, present methods for generation of IVT mRNA rely on templates derived from circular plasmids or PCR products, in which homopolymeric tracts are unstable, thus limiting encoded poly(A tail lengths to ≃120 base pairs (bp. Here, we have developed a novel method for generation of extended poly(A tracts using a previously described linear plasmid system, pJazz. We find that linear plasmids can successfully propagate poly(A tracts up to ≃500 bp in length for IVT mRNA production. We then modified pJazz by removing extraneous restriction sites, adding a T7 promoter sequence upstream from an extended multiple cloning site, and adding a unique type-IIS restriction site downstream from the encoded poly(A tract to facilitate generation of IVT mRNA with precisely defined encoded poly(A tracts and 3′ termini. The resulting plasmid, designated pEVL, can be used to generate IVT mRNA with consistent defined lengths and terminal residue(s.
Klahre, U; Hemmings-Mieszczak, M; Filipowicz, W
1995-06-01
We have previously characterized nuclear cDNA clones encoding two RNA binding proteins, CP-RBP30 and CP-RBP-31, which are targeted to chloroplasts in Nicotiana plumbaginifolia. In this report we describe the analysis of the 3'-untranslated regions (3'-UTRs) in 22 CP-RBP30 and 8 CP-RBP31 clones which reveals that mRNAs encoding both proteins have a very complex polyadenylation pattern. Fourteen distinct poly(A) sites were identified among CP-RBP30 clones and four sites among the CP-RBP31 clones. The authenticity of the sites was confirmed by RNase A/T1 mapping of N. plumbaginifolia RNA. CP-RBP30 provides an extreme example of the heterogeneity known to be a feature of mRNA polyadenylation in higher plants. Using PCR we have demonstrated that CP-RBP genes in N. plumbaginifolia and N. sylvestris, in addition to the previously described introns interrupting the coding region, contain an intron located in the 3' non-coding part of the gene. In the case of the CP-RBP31, we have identified one polyadenylation event occurring in this intron.
Common changes in global gene expression induced by RNA polymerase inhibitors in Shigella flexneri.
Directory of Open Access Journals (Sweden)
Hua Fu
Full Text Available Characterization of expression profile of organisms in response to antimicrobials provides important information on the potential mechanism of action of the drugs. The special expression signature can be used to predict whether other drugs act on the same target. Here, the common response of Shigella flexneri to two inhibitors of RNA polymerase was examined using gene expression profiling. Consistent with similar effects of the two drugs, the gene expression profiles indicated that responses of the bacteria to these drugs were roughly the same, with 225 genes affected commonly. Of them, 88 were induced and 137 were repressed. Real-time PCR was performed for selected genes to verify the microarray results. Analysis of the expression data revealed that more than 30% of the plasmid-encoded genes on the array were up-regulated by the antibiotics including virF regulon, other virulence-related genes, and genes responsible for plasmid replication, maintenance, and transfer. In addition, some chromosome-encoded genes involved in virulence and genes acquired from horizontal transfer were also significantly up-regulated. However, the expression of genes encoding the beta-subunit of RNA polymerase was increased moderately. The repressed genes include those that code for products associated with the ribosome, citrate cycle, glycolysis, thiamine biosynthesis, purine metabolism, fructose metabolism, mannose metabolism, and cold shock proteins. This study demonstrates that the two antibiotics induce rapid cessation of RNA synthesis resulting in inhibition of translation components. It also indicates that the production of virulence factors involved in intercellular dissemination, tissue invasion and inflammatory destruction may be enhanced through derepressing horizontal transfer genes by the drugs.
Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.
Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W
1993-01-01
CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...
Shpakovskiĭ, G V; Lebedenko, E N
1997-05-01
The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.
Diversity of 23S rRNA genes within individual prokaryotic genomes.
Directory of Open Access Journals (Sweden)
Anna Pei
Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.
Polymorphisms in miRNA genes and their involvement in autoimmune diseases susceptibility.
Latini, Andrea; Ciccacci, Cinzia; Novelli, Giuseppe; Borgiani, Paola
2017-08-01
MicroRNAs (miRNAs) are small non-coding RNA molecules that negatively regulate the expression of multiple protein-encoding genes at the post-transcriptional level. MicroRNAs are involved in different pathways, such as cellular proliferation and differentiation, signal transduction and inflammation, and play crucial roles in the development of several diseases, such as cancer, diabetes, and cardiovascular diseases. They have recently been recognized to play a role also in the pathogenesis of autoimmune diseases. Although the majority of studies are focused on miRNA expression profiles investigation, a growing number of studies have been investigating the role of polymorphisms in miRNA genes in the autoimmune diseases development. Indeed, polymorphisms affecting the miRNA genes can modify the set of targets they regulate or the maturation efficiency. This review is aimed to give an overview about the available studies that have investigated the association of miRNA gene polymorphisms with the susceptibility to various autoimmune diseases and to their clinical phenotypes.
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
Rift Valley fever virus NSS gene expression correlates with a defect in nuclear mRNA export.
Copeland, Anna Maria; Van Deusen, Nicole M; Schmaljohn, Connie S
2015-12-01
We investigated the localization of host mRNA during Rift Valley fever virus (RVFV) infection. Fluorescence in situ hybridization revealed that infection with RVFV altered the localization of host mRNA. mRNA accumulated in the nuclei of RVFV-infected but not mock-infected cells. Further, overexpression of the NSS gene, but not the N, GN or NSM genes correlated with mRNA nuclear accumulation. Nuclear accumulation of host mRNA was not observed in cells infected with a strain of RVFV lacking the gene encoding NSS, confirming that expression of NSS is likely responsible for this phenomenon. Published by Elsevier Inc.
Suppressors of RNA silencing encoded by tomato leaf curl ...
Indian Academy of Sciences (India)
2013-01-06
Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.
Use of bacterially expressed dsRNA to downregulate Entamoeba histolytica gene expression.
Directory of Open Access Journals (Sweden)
Carlos F Solis
Full Text Available BACKGROUND: Modern RNA interference (RNAi methodologies using small interfering RNA (siRNA oligonucleotide duplexes or episomally synthesized hairpin RNA are valuable tools for the analysis of gene function in the protozoan parasite Entamoeba histolytica. However, these approaches still require time-consuming procedures including transfection and drug selection, or costly synthetic molecules. PRINCIPAL FINDINGS: Here we report an efficient and handy alternative for E. histolytica gene down-regulation mediated by bacterial double-stranded RNA (dsRNA targeting parasite genes. The Escherichia coli strain HT115 which is unable to degrade dsRNA, was genetically engineered to produce high quantities of long dsRNA segments targeting the genes that encode E. histolytica beta-tubulin and virulence factor KERP1. Trophozoites cultured in vitro were directly fed with dsRNA-expressing bacteria or soaked with purified dsRNA. Both dsRNA delivery methods resulted in significant reduction of protein expression. In vitro host cell-parasite assays showed that efficient downregulation of kerp1 gene expression mediated by bacterial dsRNA resulted in significant reduction of parasite adhesion and lytic capabilities, thus supporting a major role for KERP1 in the pathogenic process. Furthermore, treatment of trophozoites cultured in microtiter plates, with a repertoire of eighty-five distinct bacterial dsRNA segments targeting E. histolytica genes with unknown function, led to the identification of three genes potentially involved in the growth of the parasite. CONCLUSIONS: Our results showed that the use of bacterial dsRNA is a powerful method for the study of gene function in E. histolytica. This dsRNA delivery method is also technically suitable for the study of a large number of genes, thus opening interesting perspectives for the identification of novel drug and vaccine targets.
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
Directory of Open Access Journals (Sweden)
Mariza M. Coêlho
2011-01-01
Full Text Available Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla, were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species.
Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii
Directory of Open Access Journals (Sweden)
Jie Chen
2014-03-01
Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
Organization and transient expression of the gene for human U11 snRNA
Clemens, Suter-Crazzolara; Walter, Keller
1991-01-01
The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214
Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.
Directory of Open Access Journals (Sweden)
Patrick O McGowan
Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Beissert, Tim; Koste, Lars; Perkovic, Mario; Walzer, Kerstin C.; Erbar, Stephanie; Selmi, Abderraouf; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur
2017-01-01
Among nucleic acid–based delivery platforms, self-amplifying RNA (saRNA) vectors are of increasing interest for applications such as transient expression of recombinant proteins and vaccination. saRNA is safe and, due to its capability to amplify intracellularly, high protein levels can be produced from even minute amounts of transfected templates. However, it is an obstacle to full exploitation of this platform that saRNA induces a strong innate host immune response. In transfected cells, pattern recognition receptors sense double-stranded RNA intermediates and via activation of protein kinase R (PKR) and interferon signaling initiate host defense measures including a translational shutdown. To reduce pattern recognition receptor stimulation and unleash suppressed saRNA translation, this study co-delivered non-replicating mRNA encoding vaccinia virus immune evasion proteins E3, K3, and B18. It was shown that E3 is far superior to K3 or B18 as a highly potent blocker of PKR activation and of interferon (IFN)-β upregulation. B18, in contrast, is superior in controlling OAS1, a key IFN-inducible gene involved in viral RNA degradation. By combining all three vaccinia proteins, the study achieved significant suppression of PKR and IFN pathway activation in vitro and enhanced expression of saRNA-encoded genes of interest both in vitro and in vivo. This approach promises to overcome key hurdles of saRNA gene delivery. Its application may improve the bioavailability of the encoded protein, and reduce the effective dose and correspondingly the cost of goods of manufacture in the various fields where saRNA utilization is envisioned. PMID:28877647
Directory of Open Access Journals (Sweden)
Bo Liu
Full Text Available BACKGROUND: Although cold shock responses and the roles of cold shock proteins in microorganisms containing multiple cold shock protein genes have been well characterized, related studies on bacteria possessing a single cold shock protein gene have not been reported. Thermoanaerobacter tengcongensis MB4, a thermophile harboring only one known cold shock protein gene (TtescpC, can survive from 50° to 80 °C, but has poor natural competence under cold shock at 50 °C. We therefore examined cold shock responses and their effect on natural competence in this bacterium. RESULTS: The transcriptomes of T. tengcongensis before and after cold shock were analyzed by RNA-seq and over 1200 differentially expressed genes were successfully identified. These genes were involved in a wide range of biological processes, including modulation of DNA replication, recombination, and repair; energy metabolism; production of cold shock protein; synthesis of branched amino acids and branched-chain fatty acids; and sporulation. RNA-seq analysis also suggested that T. tengcongensis initiates cell wall and membrane remodeling processes, flagellar assembly, and sporulation in response to low temperature. Expression profiles of TtecspC and failed attempts to produce a TtecspC knockout strain confirmed the essential role of TteCspC in the cold shock response, and also suggested a role of this protein in survival at optimum growth temperature. Repression of genes encoding ComEA and ComEC and low energy metabolism levels in cold-shocked cells are the likely basis of poor natural competence at low temperature. CONCLUSION: Our study demonstrated changes in global gene expression under cold shock and identified several candidate genes related to cold shock in T. tengcongensis. At the same time, the relationship between cold shock response and poor natural competence at low temperature was preliminarily elucidated. These findings provide a foundation for future studies on genetic
Yerramsetty, Pradeep; Stata, Matt; Siford, Rebecca; Sage, Tammy L; Sage, Rowan F; Wong, Gane Ka-Shu; Albert, Victor A; Berry, James O
2016-06-29
RLSB, an S-1 domain RNA binding protein of Arabidopsis, selectively binds rbcL mRNA and co-localizes with Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) within chloroplasts of C3 and C4 plants. Previous studies using both Arabidopsis (C3) and maize (C4) suggest RLSB homologs are post-transcriptional regulators of plastid-encoded rbcL mRNA. While RLSB accumulates in all Arabidopsis leaf chlorenchyma cells, in C4 leaves RLSB-like proteins accumulate only within Rubisco-containing bundle sheath chloroplasts of Kranz-type species, and only within central compartment chloroplasts in the single cell C4 plant Bienertia. Our recent evidence implicates this mRNA binding protein as a primary determinant of rbcL expression, cellular localization/compartmentalization, and photosynthetic function in all multicellular green plants. This study addresses the hypothesis that RLSB is a highly conserved Rubisco regulatory factor that occurs in the chloroplasts all higher plants. Phylogenetic analysis has identified RLSB orthologs and paralogs in all major plant groups, from ancient liverworts to recent angiosperms. RLSB homologs were also identified in algae of the division Charophyta, a lineage closely related to land plants. RLSB-like sequences were not identified in any other algae, suggesting that it may be specific to the evolutionary line leading to land plants. The RLSB family occurs in single copy across most angiosperms, although a few species with two copies were identified, seemingly randomly distributed throughout the various taxa, although perhaps correlating in some cases with known ancient whole genome duplications. Monocots of the order Poales (Poaceae and Cyperaceae) were found to contain two copies, designated here as RLSB-a and RLSB-b, with only RLSB-a implicated in the regulation of rbcL across the maize developmental gradient. Analysis of microsynteny in angiosperms revealed high levels of conservation across eudicot species and for both paralogs in
RNA decay by messenger RNA interferases
DEFF Research Database (Denmark)
Christensen-Dalsgaard, Mikkel; Overgaard, Martin; Winther, Kristoffer Skovbo
2008-01-01
Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mR...... cleaving enzymes such as RelE of Escherichia coli and the corresponding antitoxin RelB. In particular, we describe a set of plasmid vectors useful for the detailed analysis of cleavage sites in model mRNAs.......Two abundant toxin-antitoxin (TA) gene families, relBE and mazEF, encode mRNA cleaving enzymes whose ectopic overexpression abruptly inhibits translation and thereby induces a bacteriostatic condition. Here we describe and discuss protocols for the overproduction, purification, and analysis of mRNA...
Salton, S R; Fischberg, D J; Dong, K W
1991-05-01
Nerve growth factor (NGF) plays a critical role in the development and survival of neurons in the peripheral nervous system. Following treatment with NGF but not epidermal growth factor, rat pheochromocytoma (PC12) cells undergo neural differentiation. We have cloned a nervous system-specific mRNA, NGF33.1, that is rapidly and relatively selectively induced by treatment of PC12 cells with NGF and basic fibroblast growth factor in comparison with epidermal growth factor. Analysis of the nucleic acid and predicted amino acid sequences of the NGF33.1 cDNA clone suggested that this clone corresponded to the NGF-inducible mRNA called VGF (A. Levi, J. D. Eldridge, and B. M. Paterson, Science 229:393-395, 1985; R. Possenti, J. D. Eldridge, B. M. Paterson, A. Grasso, and A. Levi, EMBO J. 8:2217-2223, 1989). We have used the NGF33.1 cDNA clone to isolate and characterize the VGF gene, and in this paper we report the complete sequence of the VGF gene, including 853 bases of 5' flank revealed TATAA and CCAAT elements, several GC boxes, and a consensus cyclic AMP response element-binding protein binding site. The VGF promoter contains sequences homologous to other NGF-inducible, neuronal promoters. We further show that VGF mRNA is induced in PC12 cells to a greater extent by depolarization and by phorbol-12-myristate-13-acetate treatment than by 8-bromo-cyclic AMP treatment. By Northern (RNA) and RNase protection analysis, VGF mRNA is detectable in embryonic and postnatal central and peripheral nervous tissues but not in a number of nonneural tissues. In the cascade of events which ultimately leads to the neural differentiation of NGF-treated PC12 cells, the VGF gene encodes the most rapidly and selectively regulated, nervous-system specific mRNA yet identified.
Species-independent MicroRNA Gene Discovery
Kamanu, Timothy K.
2012-12-01
MicroRNA (miRNA) are a class of small endogenous non-coding RNA that are mainly negative transcriptional and post-transcriptional regulators in both plants and animals. Recent studies have shown that miRNA are involved in different types of cancer and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. miRNA genes are classified into different groups (miRNA families). This study reports about 19,000 unknown miRNA genes in nine species whereby approximately 15,300 predictions were computationally validated to contain at least one experimentally verified functional miRNA product. The predictions are based on a novel computational strategy which relies on miRNA family groupings and exploits the physics and geometry of miRNA genes to unveil the hidden palindromic signals and symmetries in miRNA gene sequences. Unlike conventional computational miRNA gene discovery methods, the algorithm developed here is species-independent: it allows prediction at higher accuracy and resolution from arbitrary RNA/DNA sequences in any species and thus enables examination of repeat-prone genomic regions which are thought to be non-informative or ’junk’ sequences. The information non-redundancy of uni-directional RNA sequences compared to information redundancy of bi-directional DNA is demonstrated, a fact that is overlooked by most pattern discovery algorithms. A novel method for computing upstream and downstream miRNA gene boundaries based on mathematical/statistical functions is suggested, as well as cutoffs for annotation of miRNA genes in different miRNA families. Another tool is proposed to allow hypotheses generation and visualization of data matrices, intra- and inter-species chromosomal distribution of miRNA genes or miRNA families. Our results indicate that: miRNA and miRNA
Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N; Klibanski, Anne
2010-03-15
Meningiomas are common tumors, representing 15% to 25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. The chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore, it has been proposed that an as yet unidentified tumor suppressor is present at this locus. Maternally expressed gene 3 (MEG3) is an imprinted gene located at 14q32 which encodes a noncoding RNA with an antiproliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in bromodeoxyuridine incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a noncoding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism.
Directory of Open Access Journals (Sweden)
Stern David B
2010-09-01
Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.
A Regulatory RNA Inducing Transgenerationally Inherited Phenotypes
DEFF Research Database (Denmark)
Jensen, Lea Møller
. The variation in Arabidopsis enables different regulatory networks and mechanisms to shape the phenotypic characteristics. The thesis describes the identification of regulatory RNA encoded by an enzyme encoding gene. The RNA regulates by inducing transgenerationally inherited phenotypes. The function of the RNA...... is dependent on the genetic background illustrating that polymorphisms are found in either interactors or target genes of the RNA. Furthermore, the RNA provides a mechanistic link between accumulation of glucosinolate and onset of flowering....
MicroRNA-target binding structures mimic microRNA duplex structures in humans.
Directory of Open Access Journals (Sweden)
Xi Chen
Full Text Available Traditionally, researchers match a microRNA guide strand to mRNA sequences using sequence comparisons to predict its potential target genes. However, many of the predictions can be false positives due to limitations in sequence comparison alone. In this work, we consider the association of two related RNA structures that share a common guide strand: the microRNA duplex and the microRNA-target binding structure. We have analyzed thousands of such structure pairs and found many of them share high structural similarity. Therefore, we conclude that when predicting microRNA target genes, considering just the microRNA guide strand matches to gene sequences may not be sufficient--the microRNA duplex structure formed by the guide strand and its companion passenger strand must also be considered. We have developed software to translate RNA binding structure into encoded representations, and we have also created novel automatic comparison methods utilizing such encoded representations to determine RNA structure similarity. Our software and methods can be utilized in the other RNA secondary structure comparisons as well.
The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.
Fujii, Yoichi Robertus
2013-01-01
MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
A deep learning method for lincRNA detection using auto-encoder algorithm.
Yu, Ning; Yu, Zeng; Pan, Yi
2017-12-06
RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly
In Vivo Testing of MicroRNA-Mediated Gene Knockdown in Zebrafish
Directory of Open Access Journals (Sweden)
Ivone Un San Leong
2012-01-01
Full Text Available The zebrafish (Danio rerio has become an attractive model for human disease modeling as there are a large number of orthologous genes that encode similar proteins to those found in humans. The number of tools available to manipulate the zebrafish genome is limited and many currently used techniques are only effective during early development (such as morpholino-based antisense technology or it is phenotypically driven and does not offer targeted gene knockdown (such as chemical mutagenesis. The use of RNA interference has been met with controversy as off-target effects can make interpreting phenotypic outcomes difficult; however, this has been resolved by creating zebrafish lines that contain stably integrated miRNA constructs that target the desired gene of interest. In this study, we show that a commercially available miRNA vector system with a mouse-derived miRNA backbone is functional in zebrafish and is effective in causing eGFP knockdown in a transient in vivo eGFP sensor assay system. We chose to apply this system to the knockdown of transcripts that are implicated in the human cardiac disorder, Long QT syndrome.
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
The distribution, diversity, and importance of 16S rRNA gene introns in the order Thermoproteales.
Jay, Zackary J; Inskeep, William P
2015-07-09
Intron sequences are common in 16S rRNA genes of specific thermophilic lineages of Archaea, specifically the Thermoproteales (phylum Crenarchaeota). Environmental sequencing (16S rRNA gene and metagenome) from geothermal habitats in Yellowstone National Park (YNP) has expanded the available datasets for investigating 16S rRNA gene introns. The objectives of this study were to characterize and curate archaeal 16S rRNA gene introns from high-temperature habitats, evaluate the conservation and distribution of archaeal 16S rRNA introns in geothermal systems, and determine which "universal" archaeal 16S rRNA gene primers are impacted by the presence of intron sequences. Several new introns were identified and their insertion loci were constrained to thirteen locations across the 16S rRNA gene. Many of these introns encode homing endonucleases, although some introns were short or partial sequences. Pyrobaculum, Thermoproteus, and Caldivirga 16S rRNA genes contained the most abundant and diverse intron sequences. Phylogenetic analysis of introns revealed that sequences within the same locus are distributed biogeographically. The most diverse set of introns were observed in a high-temperature, circumneutral (pH 6) sulfur sediment environment, which also contained the greatest diversity of different Thermoproteales phylotypes. The widespread presence of introns in the Thermoproteales indicates a high probability of misalignments using different "universal" 16S rRNA primers employed in environmental microbial community analysis.
Howe, J G; Shu, M D
1988-08-01
Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.
Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad
2018-01-05
Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne
2010-01-01
Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190
DEFF Research Database (Denmark)
hart, Leen M; Hansen, Torben; Rietveld, Ingrid
2005-01-01
Previously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA synthetase...... gene (LARS2), involved in aminoacylation of tRNA(Leu(UUR)), associate with type 2 diabetes. Direct sequencing of LARS2 cDNA from 25 type 2 diabetic subjects revealed eight single nucleotide polymorphisms. Two of the variants were examined in 7,836 subjects from four independent populations...... in the Netherlands and Denmark. A -109 g/a variant was not associated with type 2 diabetes. Allele frequencies for the other variant, H324Q, were 3.5% in type 2 diabetic and 2.7% in control subjects, respectively. The common odds ratio across all four studies was 1.40 (95% CI 1.12-1.76), P = 0.004. There were...
A human torque teno virus encodes a microRNA that inhibits interferon signaling.
Directory of Open Access Journals (Sweden)
Rodney P Kincaid
Full Text Available Torque teno viruses (TTVs are a group of viruses with small, circular DNA genomes. Members of this family are thought to ubiquitously infect humans, although causal disease associations are currently lacking. At present, there is no understanding of how infection with this diverse group of viruses is so prevalent. Using a combined computational and synthetic approach, we predict and identify miRNA-coding regions in diverse human TTVs and provide evidence for TTV miRNA production in vivo. The TTV miRNAs are transcribed by RNA polymerase II, processed by Drosha and Dicer, and are active in RISC. A TTV mutant defective for miRNA production replicates as well as wild type virus genome; demonstrating that the TTV miRNA is dispensable for genome replication in a cell culture model. We demonstrate that a recombinant TTV genome is capable of expressing an exogenous miRNA, indicating the potential utility of TTV as a small RNA vector. Gene expression profiling of host cells identifies N-myc (and STAT interactor (NMI as a target of a TTV miRNA. NMI transcripts are directly regulated through a binding site in the 3'UTR. SiRNA knockdown of NMI contributes to a decreased response to interferon signaling. Consistent with this, we show that a TTV miRNA mediates a decreased response to IFN and increased cellular proliferation in the presence of IFN. Thus, we add Annelloviridae to the growing list of virus families that encode miRNAs, and suggest that miRNA-mediated immune evasion can contribute to the pervasiveness associated with some of these viruses.
Methylation of miRNA genes and oncogenesis.
Loginov, V I; Rykov, S V; Fridman, M V; Braga, E A
2015-02-01
Interaction between microRNA (miRNA) and messenger RNA of target genes at the posttranscriptional level provides fine-tuned dynamic regulation of cell signaling pathways. Each miRNA can be involved in regulating hundreds of protein-coding genes, and, conversely, a number of different miRNAs usually target a structural gene. Epigenetic gene inactivation associated with methylation of promoter CpG-islands is common to both protein-coding genes and miRNA genes. Here, data on functions of miRNAs in development of tumor-cell phenotype are reviewed. Genomic organization of promoter CpG-islands of the miRNA genes located in inter- and intragenic areas is discussed. The literature and our own results on frequency of CpG-island methylation in miRNA genes from tumors are summarized, and data regarding a link between such modification and changed activity of miRNA genes and, consequently, protein-coding target genes are presented. Moreover, the impact of miRNA gene methylation on key oncogenetic processes as well as affected signaling pathways is discussed.
Rift Valley fever virus NS{sub S} gene expression correlates with a defect in nuclear mRNA export
Energy Technology Data Exchange (ETDEWEB)
Copeland, Anna Maria; Van Deusen, Nicole M.; Schmaljohn, Connie S., E-mail: Connie.s.schmaljohn.civ@mail.mil
2015-12-15
We investigated the localization of host mRNA during Rift Valley fever virus (RVFV) infection. Fluorescence in situ hybridization revealed that infection with RVFV altered the localization of host mRNA. mRNA accumulated in the nuclei of RVFV-infected but not mock-infected cells. Further, overexpression of the NS{sub S} gene, but not the N, G{sub N} or NS{sub M} genes correlated with mRNA nuclear accumulation. Nuclear accumulation of host mRNA was not observed in cells infected with a strain of RVFV lacking the gene encoding NS{sub S}, confirming that expression of NS{sub S} is likely responsible for this phenomenon. - Highlights: • Rift Valley fever virus (RVFV) infection alters the localization of host mRNA. • mRNA accumulates in the nuclei of RVFV-infected but not mock-infected cells. • NS{sub S} is likely responsible for mRNA relocalization to the nucleus.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
Down-Regulation of Gene Expression by RNA-Induced Gene Silencing
Travella, Silvia; Keller, Beat
Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.
Directory of Open Access Journals (Sweden)
Giao Ngoc Nguyen
2017-08-01
Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.
The noncoding RNA taurine upregulated gene 1 is required for differentiation of the murine retina.
Young, T L; Matsuda, T; Cepko, C L
2005-03-29
With the advent of genome-wide analyses, it is becoming evident that a large number of noncoding RNAs (ncRNAs) are expressed in vertebrates. However, of the thousands of ncRNAs identified, the functions of relatively few have been established. In a screen for genes upregulated by taurine in developing retinal cells, we identified a gene that appears to be a ncRNA. Taurine Upregulated Gene 1 (TUG1) is a spliced, polyadenylated RNA that does not encode any open reading frame greater than 82 amino acids in its full-length, 6.7 kilobase (kb) RNA sequence. Analyses of Northern blots and in situ hybridization revealed that TUG1 is expressed in the developing retina and brain, as well as in adult tissues. In the newborn retina, knockdown of TUG1 with RNA interference (RNAi) resulted in malformed or nonexistent outer segments of transfected photoreceptors. Immunofluorescent staining and microarray analyses suggested that this loss of proper photoreceptor differentiation is a result of the disregulation of photoreceptor gene expression. A function for a newly identified ncRNA, TUG1, has been established. TUG1 is necessary for the proper formation of photoreceptors in the developing rodent retina.
Characterization of the ptr5+ gene involved in nuclear mRNA export in fission yeast
International Nuclear Information System (INIS)
Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka; Tani, Tokio
2012-01-01
Highlights: ► We cloned the ptr5 + gene involved in nuclear mRNA export in fission yeast. ► The ptr5 + gene was found to encode nucleoporin 85 (Nup85). ► Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. ► Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. ► Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A) + RNA transport] 1 to 11, which accumulate poly(A) + RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5–1 mutant shows dots- or a ring-like accumulation of poly(A) + RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5 + gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5–1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5–1 mutation. In addition, we found that the ptr5–1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5–1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.
Influenza polymerase encoding mRNAs utilize atypical mRNA nuclear export.
Larsen, Sean; Bui, Steven; Perez, Veronica; Mohammad, Adeba; Medina-Ramirez, Hilario; Newcomb, Laura L
2014-08-28
Influenza is a segmented negative strand RNA virus. Each RNA segment is encapsulated by influenza nucleoprotein and bound by the viral RNA dependent RNA polymerase (RdRP) to form viral ribonucleoproteins responsible for RNA synthesis in the nucleus of the host cell. Influenza transcription results in spliced mRNAs (M2 and NS2), intron-containing mRNAs (M1 and NS1), and intron-less mRNAs (HA, NA, NP, PB1, PB2, and PA), all of which undergo nuclear export into the cytoplasm for translation. Most cellular mRNA nuclear export is Nxf1-mediated, while select mRNAs utilize Crm1. Here we inhibited Nxf1 and Crm1 nuclear export prior to infection with influenza A/Udorn/307/1972(H3N2) virus and analyzed influenza intron-less mRNAs using cellular fractionation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR). We examined direct interaction between Nxf1 and influenza intron-less mRNAs using immuno purification of Nxf1 and RT-PCR of associated RNA. Inhibition of Nxf1 resulted in less influenza intron-less mRNA export into the cytoplasm for HA and NA influenza mRNAs in both human embryonic kidney cell line (293 T) and human lung adenocarcinoma epithelial cell line (A549). However, in 293 T cells no change was observed for mRNAs encoding the components of the viral ribonucleoproteins; NP, PA, PB1, and PB2, while in A549 cells, only PA, PB1, and PB2 mRNAs, encoding the RdRP, remained unaffected; NP mRNA was reduced in the cytoplasm. In A549 cells NP, NA, HA, mRNAs were found associated with Nxf1 but PA, PB1, and PB2 mRNAs were not. Crm1 inhibition also resulted in no significant difference in PA, PB1, and PB2 mRNA nuclear export. These results further confirm Nxf1-mediated nuclear export is functional during the influenza life cycle and hijacked for select influenza mRNA nuclear export. We reveal a cell type difference for Nxf1-mediated nuclear export of influenza NP mRNA, a reminder that cell type can influence molecular mechanisms. Importantly, we
Directory of Open Access Journals (Sweden)
Hsiao-Ling Lu
Full Text Available Piwi-interacting RNAs (piRNAs are known to regulate transposon activity in germ cells of several animal models that propagate sexually. However, the role of piRNAs during asexual reproduction remains almost unknown. Aphids that can alternate sexual and asexual reproduction cycles in response to seasonal changes of photoperiod provide a unique opportunity to study piRNAs and the piRNA pathway in both reproductive modes. Taking advantage of the recently sequenced genome of the pea aphid Acyrthosiphon pisum, we found an unusually large lineage-specific expansion of genes encoding the Piwi sub-clade of Argonaute proteins. In situ hybridisation showed differential expressions between the duplicated piwi copies: while Api-piwi2 and Api-piwi6 are "specialised" in germ cells their most closely related copy, respectively Api-piwi5 and Api-piwi3, are expressed in the somatic cells. The differential expression was also identified in duplicated ago3: Api-ago3a in germ cells and Api-ago3b in somatic cells. Moreover, analyses of expression profiles of the expanded piwi and ago3 genes by semi-quantitative RT-PCR showed that expressions varied according to the reproductive types. These specific expression patterns suggest that expanded aphid piwi and ago3 genes have distinct roles in asexual and sexual reproduction.
RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells
Diener, Yvonne; Jurk, Marion; Kandil, Britta; Choi, Yeong-Hoon; Wild, Stefan; Bissels, Ute; Bosio, Andreas
2015-01-01
Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable gene modification by viral vectors that are burdensome when translating protocols into clinical settings. Our study aimed at exploring new ways to transiently modify HSPC gene expression using non-integrating, RNA-based molecules. First, we tested different methods to deliver these molecules into HSPCs. The delivery of siRNAs with chemical transfection methods such as lipofection or cationic polymers did not lead to target knockdown, although we observed more than 90% fluorescent cells using a fluorochrome-coupled siRNA. Confocal microscopic analysis revealed that despite extensive washing, siRNA stuck to or in the cell surface, thereby mimicking a transfection event. In contrast, electroporation resulted in efficient, siRNA-mediated protein knockdown. For transient overexpression of proteins, we used optimised mRNA molecules with modified 5′- and 3′-UTRs. Electroporation of mRNA encoding GFP resulted in fast, efficient and persistent protein expression for at least seven days. Our data provide a broad-ranging comparison of transfection methods for hard-to-transfect cells and offer new opportunities for DNA-free, non-integrating gene modulation in HSPCs. PMID:26599627
Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak
2010-01-01
RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip
2009-05-01
Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.
Sánchez-Navarro, J A; Reusken, C B; Bol, J F; Pallás, V
1997-12-01
Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) are tripartite positive-strand RNA plant viruses that encode functionally similar translation products. Although the two viruses are phylogenetically closely related, they infect a very different range of natural hosts. The coat protein (CP) gene, the movement protein (MP) gene or both genes in AMV RNA 3 were replaced by the corresponding genes of PNRSV. The chimeric viruses were tested for heterologous encapsidation, replication in protoplasts from plants transformed with AMV replicase genes P1 and P2 (P12 plants) and for cell-to-cell transport in P12 plants. The chimeric viruses exhibited basic competence for encapsidation and replication in P12 protoplasts and for a low level of cell-to-cell movement in P12 plants. The potential involvement of the MP gene in determining host specificity in ilarviruses is discussed.
Genetic selection and DNA sequences of 4.5S RNA homologs
DEFF Research Database (Denmark)
Brown, S; Thon, G; Tolentino, E
1989-01-01
A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Directory of Open Access Journals (Sweden)
Yuguang Zhao
2011-02-01
Full Text Available Notwithstanding the well-characterised roles of a number of oncogenes in neoplastic transformation, microRNAs (miRNAs are increasingly implicated in several human cancers. Discovery of miRNAs in several oncogenic herpesviruses such as KSHV has further highlighted the potential of virus-encoded miRNAs to contribute to their oncogenic capabilities. Nevertheless, despite the identification of several possible cancer-related genes as their targets, the direct in vivo role of virus-encoded miRNAs in neoplastic diseases such as those induced by KSHV is difficult to demonstrate in the absence of suitable models. However, excellent natural disease models of rapid-onset Marek's disease (MD lymphomas in chickens allow examination of the oncogenic potential of virus-encoded miRNAs. Using viruses modified by reverse genetics of the infectious BAC clone of the oncogenic RB-1B strain of MDV, we show that the deletion of the six-miRNA cluster 1 from the viral genome abolished the oncogenicity of the virus. This loss of oncogenicity appeared to be primarily due to the single miRNA within the cluster, miR-M4, the ortholog of cellular miR-155, since its deletion or a 2-nucleotide mutation within its seed region was sufficient to inhibit the induction of lymphomas. The definitive role of this miR-155 ortholog in oncogenicity was further confirmed by the rescue of oncogenic phenotype by revertant viruses that expressed either the miR-M4 or the cellular homolog gga-miR-155. This is the first demonstration of the direct in vivo role of a virus-encoded miRNA in inducing tumors in a natural infection model. Furthermore, the use of viruses deleted in miRNAs as effective vaccines against virulent MDV challenge, enables the prospects of generating genetically defined attenuated vaccines.
Directory of Open Access Journals (Sweden)
César M. Escobedo-Bonilla
2015-04-01
Full Text Available White spot syndrome virus (WSSV is a major pathogen in shrimp aquaculture. RNA interference (RNAi is a promising tool against viral infections. Previous works with RNAi showed different antiviral efficacies depending on the silenced gene. This work evaluated the antiviral efficacy of double-stranded (ds RNA against two non-structural (orf89, wsv191 WSSV genes compared to structural (vp26, vp28 genes to inhibit an experimental WSSV infection. Gene orf89 encodes a putative regulatory protein and gene white spot virus (wsv191 encodes a nonspecific nuclease; whereas genes vp26 and vp28 encode envelope proteins, respectively. Molecules of dsRNA against each of the WSSV genes were intramuscularly injected (4 μg per shrimp into a group of shrimp 48 h before a WSSV challenge. The highest antiviral activity occurred with dsRNA against orf89, vp28 and vp26 (cumulative mortalities 10%, 10% and 21%, respectively. In contrast, the least effective treatment was wsv191 dsRNA (cumulative mortality 83%. All dead animals were WSSV-positive by one-step PCR, whereas reverse-transcription PCR of all surviving shrimp confirmed inhibition of virus replication. This study showed that dsRNA against WSSV genes orf89, vp28 and vp26 were highly effective to inhibit virus replication and suggest an essential role in WSSV infection. Non-structural WSSV genes such as orf89 can be used as novel targets to design therapeutic RNAi molecules against WSSV infection.
A novel TBP-TAF complex on RNA polymerase II-transcribed snRNA genes.
Zaborowska, Justyna; Taylor, Alice; Roeder, Robert G; Murphy, Shona
2012-01-01
Initiation of transcription of most human genes transcribed by RNA polymerase II (RNAP II) requires the formation of a preinitiation complex comprising TFIIA, B, D, E, F, H and RNAP II. The general transcription factor TFIID is composed of the TATA-binding protein and up to 13 TBP-associated factors. During transcription of snRNA genes, RNAP II does not appear to make the transition to long-range productive elongation, as happens during transcription of protein-coding genes. In addition, recognition of the snRNA gene-type specific 3' box RNA processing element requires initiation from an snRNA gene promoter. These characteristics may, at least in part, be driven by factors recruited to the promoter. For example, differences in the complement of TAFs might result in differential recruitment of elongation and RNA processing factors. As precedent, it already has been shown that the promoters of some protein-coding genes do not recruit all the TAFs found in TFIID. Although TAF5 has been shown to be associated with RNAP II-transcribed snRNA genes, the full complement of TAFs associated with these genes has remained unclear. Here we show, using a ChIP and siRNA-mediated approach, that the TBP/TAF complex on snRNA genes differs from that found on protein-coding genes. Interestingly, the largest TAF, TAF1, and the core TAFs, TAF10 and TAF4, are not detected on snRNA genes. We propose that this snRNA gene-specific TAF subset plays a key role in gene type-specific control of expression.
Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.
2014-01-01
The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713
Directory of Open Access Journals (Sweden)
Fangquan Wang
2016-05-01
Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.
Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie
2016-05-11
Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
Dmitrii E. Polev
2014-01-01
Full Text Available Human gene LOC100505644 uncharacterized LOC100505644 [Homo sapiens] (Entrez Gene ID 100505644 is abundantly expressed in tumors but weakly expressed in few normal tissues. Till now the function of this gene remains unknown. Here we identified the chromosomal borders of the transcribed region and the major splice form of the LOC100505644-specific transcript. We characterised the major regulatory motifs of the gene and its splice sites. Analysis of the secondary structure of the major transcript variant revealed a hairpin-like structure characteristic for precursor microRNAs. Comparative genomic analysis of the locus showed that it originated in primates de novo. Taken together, our data indicate that human gene LOC100505644 encodes some non-protein coding RNA, likely a microRNA. It was assigned a gene symbol ELFN1-AS1 (ELFN1 antisense RNA 1 (non-protein coding. This gene combines features of evolutionary novelty and predominant expression in tumors.
Characterization of the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast
Energy Technology Data Exchange (ETDEWEB)
Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan); Tani, Tokio, E-mail: ttani@sci.kumamoto-u.ac.jp [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan)
2012-02-03
Highlights: Black-Right-Pointing-Pointer We cloned the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast. Black-Right-Pointing-Pointer The ptr5{sup +} gene was found to encode nucleoporin 85 (Nup85). Black-Right-Pointing-Pointer Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. Black-Right-Pointing-Pointer Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. Black-Right-Pointing-Pointer Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A){sup +} RNA transport] 1 to 11, which accumulate poly(A){sup +} RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5-1 mutant shows dots- or a ring-like accumulation of poly(A){sup +} RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5{sup +} gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5-1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5-1 mutation. In addition, we found that the ptr5-1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5-1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.
Directory of Open Access Journals (Sweden)
Arthur K Tugume
Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in
Directory of Open Access Journals (Sweden)
Uchechi E Ukaegbu
2014-01-01
Full Text Available Histone modifications are important regulators of gene expression in all eukaryotes. In Plasmodium falciparum, these epigenetic marks regulate expression of genes involved in several aspects of host-parasite interactions, including antigenic variation. While the identities and genomic positions of many histone modifications have now been cataloged, how they are targeted to defined genomic regions remains poorly understood. For example, how variant antigen encoding loci (var are targeted for deposition of unique histone marks is a mystery that continues to perplex the field. Here we describe the recruitment of an ortholog of the histone modifier SET2 to var genes through direct interactions with the C-terminal domain (CTD of RNA polymerase II. In higher eukaryotes, SET2 is a histone methyltransferase recruited by RNA pol II during mRNA transcription; however, the ortholog in P. falciparum (PfSET2 has an atypical architecture and its role in regulating transcription is unknown. Here we show that PfSET2 binds to the unphosphorylated form of the CTD, a property inconsistent with its recruitment during mRNA synthesis. Further, we show that H3K36me3, the epigenetic mark deposited by PfSET2, is enriched at both active and silent var gene loci, providing additional evidence that its recruitment is not associated with mRNA production. Over-expression of a dominant negative form of PfSET2 designed to disrupt binding to RNA pol II induced rapid var gene expression switching, confirming both the importance of PfSET2 in var gene regulation and a role for RNA pol II in its recruitment. RNA pol II is known to transcribe non-coding RNAs from both active and silent var genes, providing a possible mechanism by which it could recruit PfSET2 to var loci. This work unifies previous reports of histone modifications, the production of ncRNAs, and the promoter activity of var introns into a mechanism that contributes to antigenic variation by malaria parasites.
Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A
1997-07-01
Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.
IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells
Directory of Open Access Journals (Sweden)
Giuseppe Fiume
2016-11-01
Full Text Available The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03% of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7% and 698 downregulated (54.3% RNAs. In K562 cells, 1959 (3.1% of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7% and 906 downregulated (46.3%. Only 137 transcripts (0.22% were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.
IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.
Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana
2016-11-07
The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.
Viollet, Coralie; Davis, David A.; Tekeste, Shewit S.; Reczko, Martin; Pezzella, Francesco; Ragoussis, Jiannis
2017-01-01
Kaposi sarcoma-associated herpesvirus (KSHV) causes several tumors and hyperproliferative disorders. Hypoxia and hypoxia-inducible factors (HIFs) activate latent and lytic KSHV genes, and several KSHV proteins increase the cellular levels of HIF. Here, we used RNA sequencing, qRT-PCR, Taqman assays, and pathway analysis to explore the miRNA and mRNA response of uninfected and KSHV-infected cells to hypoxia, to compare this with the genetic changes seen in chronic latent KSHV infection, and to explore the degree to which hypoxia and KSHV infection interact in modulating mRNA and miRNA expression. We found that the gene expression signatures for KSHV infection and hypoxia have a 34% overlap. Moreover, there were considerable similarities between the genes up-regulated by hypoxia in uninfected (SLK) and in KSHV-infected (SLKK) cells. hsa-miR-210, a HIF-target known to have pro-angiogenic and anti-apoptotic properties, was significantly up-regulated by both KSHV infection and hypoxia using Taqman assays. Interestingly, expression of KSHV-encoded miRNAs was not affected by hypoxia. These results demonstrate that KSHV harnesses a part of the hypoxic cellular response and that a substantial portion of hypoxia-induced changes in cellular gene expression are induced by KSHV infection. Therefore, targeting hypoxic pathways may be a useful way to develop therapeutic strategies for KSHV-related diseases. PMID:28046107
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
Roles of Prolyl Isomerases in RNA-Mediated Gene Expression
Directory of Open Access Journals (Sweden)
Roopa Thapar
2015-05-01
Full Text Available The peptidyl-prolyl cis-trans isomerases (PPIases that include immunophilins (cyclophilins and FKBPs and parvulins (Pin1, Par14, Par17 participate in cell signaling, transcription, pre-mRNA processing and mRNA decay. The human genome encodes 19 cyclophilins, 18 FKBPs and three parvulins. Immunophilins are receptors for the immunosuppressive drugs cyclosporin A, FK506, and rapamycin that are used in organ transplantation. Pin1 has also been targeted in the treatment of Alzheimer’s disease, asthma, and a number of cancers. While these PPIases are characterized as molecular chaperones, they also act in a nonchaperone manner to promote protein-protein interactions using surfaces outside their active sites. The immunosuppressive drugs act by a gain-of-function mechanism by promoting protein-protein interactions in vivo. Several immunophilins have been identified as components of the spliceosome and are essential for alternative splicing. Pin1 plays roles in transcription and RNA processing by catalyzing conformational changes in the RNA Pol II C-terminal domain. Pin1 also binds several RNA binding proteins such as AUF1, KSRP, HuR, and SLBP that regulate mRNA decay by remodeling mRNP complexes. The functions of ribonucleoprotein associated PPIases are largely unknown. This review highlights PPIases that play roles in RNA-mediated gene expression, providing insight into their structures, functions and mechanisms of action in mRNP remodeling in vivo.
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Asha, Srinivasan; Sreekumar, Sweda; Soniya, E V
2016-01-01
Analysis of high-throughput small RNA deep sequencing data, in combination with black pepper transcriptome sequences revealed microRNA-mediated gene regulation in black pepper ( Piper nigrum L.). Black pepper is an important spice crop and its berries are used worldwide as a natural food additive that contributes unique flavour to foods. In the present study to characterize microRNAs from black pepper, we generated a small RNA library from black pepper leaf and sequenced it by Illumina high-throughput sequencing technology. MicroRNAs belonging to a total of 303 conserved miRNA families were identified from the sRNAome data. Subsequent analysis from recently sequenced black pepper transcriptome confirmed precursor sequences of 50 conserved miRNAs and four potential novel miRNA candidates. Stem-loop qRT-PCR experiments demonstrated differential expression of eight conserved miRNAs in black pepper. Computational analysis of targets of the miRNAs showed 223 potential black pepper unigene targets that encode diverse transcription factors and enzymes involved in plant development, disease resistance, metabolic and signalling pathways. RLM-RACE experiments further mapped miRNA-mediated cleavage at five of the mRNA targets. In addition, miRNA isoforms corresponding to 18 miRNA families were also identified from black pepper. This study presents the first large-scale identification of microRNAs from black pepper and provides the foundation for the future studies of miRNA-mediated gene regulation of stress responses and diverse metabolic processes in black pepper.
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Identification and Characterization of Cyprinid Herpesvirus-3 (CyHV-3 Encoded MicroRNAs.
Directory of Open Access Journals (Sweden)
Owen H Donohoe
Full Text Available MicroRNAs (miRNAs are a class of small non-coding RNAs involved in post-transcriptional gene regulation. Some viruses encode their own miRNAs and these are increasingly being recognized as important modulators of viral and host gene expression. Cyprinid herpesvirus 3 (CyHV-3 is a highly pathogenic agent that causes acute mass mortalities in carp (Cyprinus carpio carpio and koi (Cyprinus carpio koi worldwide. Here, bioinformatic analyses of the CyHV-3 genome suggested the presence of non-conserved precursor miRNA (pre-miRNA genes. Deep sequencing of small RNA fractions prepared from in vitro CyHV-3 infections led to the identification of potential miRNAs and miRNA-offset RNAs (moRNAs derived from some bioinformatically predicted pre-miRNAs. DNA microarray hybridization analysis, Northern blotting and stem-loop RT-qPCR were then used to definitively confirm that CyHV-3 expresses two pre-miRNAs during infection in vitro. The evidence also suggested the presence of an additional four high-probability and two putative viral pre-miRNAs. MiRNAs from the two confirmed pre-miRNAs were also detected in gill tissue from CyHV-3-infected carp. We also present evidence that one confirmed miRNA can regulate the expression of a putative CyHV-3-encoded dUTPase. Candidate homologues of some CyHV-3 pre-miRNAs were identified in CyHV-1 and CyHV-2. This is the first report of miRNA and moRNA genes encoded by members of the Alloherpesviridae family, a group distantly related to the Herpesviridae family. The discovery of these novel CyHV-3 genes may help further our understanding of the biology of this economically important virus and their encoded miRNAs may have potential as biomarkers for the diagnosis of latent CyHV-3.
Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia.
Kojima, Kenji K; Jurka, Jerzy
2015-01-01
Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an "archaeal" RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Intrinsic noise of microRNA-regulated genes and the ceRNA hypothesis.
Directory of Open Access Journals (Sweden)
Javad Noorbakhsh
Full Text Available MicroRNAs are small noncoding RNAs that regulate genes post-transciptionally by binding and degrading target eukaryotic mRNAs. We use a quantitative model to study gene regulation by inhibitory microRNAs and compare it to gene regulation by prokaryotic small non-coding RNAs (sRNAs. Our model uses a combination of analytic techniques as well as computational simulations to calculate the mean-expression and noise profiles of genes regulated by both microRNAs and sRNAs. We find that despite very different molecular machinery and modes of action (catalytic vs stoichiometric, the mean expression levels and noise profiles of microRNA-regulated genes are almost identical to genes regulated by prokaryotic sRNAs. This behavior is extremely robust and persists across a wide range of biologically relevant parameters. We extend our model to study crosstalk between multiple mRNAs that are regulated by a single microRNA and show that noise is a sensitive measure of microRNA-mediated interaction between mRNAs. We conclude by discussing possible experimental strategies for uncovering the microRNA-mRNA interactions and testing the competing endogenous RNA (ceRNA hypothesis.
International Nuclear Information System (INIS)
Morgan, E.A.; Nomura, M.
1979-01-01
Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA 1 /sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA 1 /sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA 1 /sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Li, Bei-Bei; Shen, Jian-Zhong; Cao, Xing-Yuan; Wang, Yang; Dai, Lei; Huang, Si-Yang; Wu, Cong-Ming
2010-07-01
Mycoplasma gallisepticum is a major etiological agent of chronic respiratory disease (CRD) in chickens and sinusitis in turkeys. The pleuromutilin antibiotics tiamulin and valnemulin are currently used in the treatment of M. gallisepticum infection. We studied the in vitro development of pleuromutilin resistance in M. gallisepticum and investigated the molecular mechanisms involved in this process. Pleuromutilin-resistant mutants were selected by serial passages of M. gallisepticum strains PG31 and S6 in broth medium containing subinhibitory concentrations of tiamulin or valnemulin. A portion of the gene encoding 23S rRNA gene (domain V) and the gene encoding ribosome protein L3 were amplified and sequenced. No mutation could be detected in ribosome protein L3. Mutations were found at nucleotide positions 2058, 2059, 2061, 2447 and 2503 of 23S rRNA gene (Escherichia coli numbering). Although a single mutation could cause elevation of tiamulin and valnemulin MICs, combinations of two or three mutations were necessary to produce high-level resistance. All the mutants were cross-resistant to lincomycin, chloramphenicol and florfenicol. Mutants with the A2058G or the A2059G mutation exhibited cross-resistance to macrolide antibiotics erythromycin, tilmicosin and tylosin.
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)
DEFF Research Database (Denmark)
Ronander, Elena; Bengtsson, Dominique C; Joergensen, Louise
2012-01-01
Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has...... been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors...... fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE(1). Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human...
Directory of Open Access Journals (Sweden)
Andrea D McCue
2012-02-01
Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs
Identification and Characterization of Cyprinid Herpesvirus-3 (CyHV-3) Encoded MicroRNAs
Donohoe, Owen H.; Henshilwood, Kathy; Way, Keith; Hakimjavadi, Roya; Stone, David M.; Walls, Dermot
2015-01-01
MicroRNAs (miRNAs) are a class of small non-coding RNAs involved in post-transcriptional gene regulation. Some viruses encode their own miRNAs and these are increasingly being recognized as important modulators of viral and host gene expression. Cyprinid herpesvirus 3 (CyHV-3) is a highly pathogenic agent that causes acute mass mortalities in carp (Cyprinus carpio carpio) and koi (Cyprinus carpio koi) worldwide. Here, bioinformatic analyses of the CyHV-3 genome suggested the presence of non-conserved precursor miRNA (pre-miRNA) genes. Deep sequencing of small RNA fractions prepared from in vitro CyHV-3 infections led to the identification of potential miRNAs and miRNA–offset RNAs (moRNAs) derived from some bioinformatically predicted pre-miRNAs. DNA microarray hybridization analysis, Northern blotting and stem-loop RT-qPCR were then used to definitively confirm that CyHV-3 expresses two pre-miRNAs during infection in vitro. The evidence also suggested the presence of an additional four high-probability and two putative viral pre-miRNAs. MiRNAs from the two confirmed pre-miRNAs were also detected in gill tissue from CyHV-3-infected carp. We also present evidence that one confirmed miRNA can regulate the expression of a putative CyHV-3-encoded dUTPase. Candidate homologues of some CyHV-3 pre-miRNAs were identified in CyHV-1 and CyHV-2. This is the first report of miRNA and moRNA genes encoded by members of the Alloherpesviridae family, a group distantly related to the Herpesviridae family. The discovery of these novel CyHV-3 genes may help further our understanding of the biology of this economically important virus and their encoded miRNAs may have potential as biomarkers for the diagnosis of latent CyHV-3. PMID:25928140
Chimeras taking shape: Potential functions of proteins encoded by chimeric RNA transcripts
Frenkel-Morgenstern, Milana; Lacroix, Vincent; Ezkurdia, Iakes; Levin, Yishai; Gabashvili, Alexandra; Prilusky, Jaime; del Pozo, Angela; Tress, Michael; Johnson, Rory; Guigo, Roderic; Valencia, Alfonso
2012-01-01
Chimeric RNAs comprise exons from two or more different genes and have the potential to encode novel proteins that alter cellular phenotypes. To date, numerous putative chimeric transcripts have been identified among the ESTs isolated from several organisms and using high throughput RNA sequencing. The few corresponding protein products that have been characterized mostly result from chromosomal translocations and are associated with cancer. Here, we systematically establish that some of the putative chimeric transcripts are genuinely expressed in human cells. Using high throughput RNA sequencing, mass spectrometry experimental data, and functional annotation, we studied 7424 putative human chimeric RNAs. We confirmed the expression of 175 chimeric RNAs in 16 human tissues, with an abundance varying from 0.06 to 17 RPKM (Reads Per Kilobase per Million mapped reads). We show that these chimeric RNAs are significantly more tissue-specific than non-chimeric transcripts. Moreover, we present evidence that chimeras tend to incorporate highly expressed genes. Despite the low expression level of most chimeric RNAs, we show that 12 novel chimeras are translated into proteins detectable in multiple shotgun mass spectrometry experiments. Furthermore, we confirm the expression of three novel chimeric proteins using targeted mass spectrometry. Finally, based on our functional annotation of exon organization and preserved domains, we discuss the potential features of chimeric proteins with illustrative examples and suggest that chimeras significantly exploit signal peptides and transmembrane domains, which can alter the cellular localization of cognate proteins. Taken together, these findings establish that some chimeric RNAs are translated into potentially functional proteins in humans. PMID:22588898
Locus-specific ribosomal RNA gene silencing in nucleolar dominance.
Directory of Open Access Journals (Sweden)
Michelle S Lewis
2007-08-01
Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.
Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C
1994-02-01
We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.
Kogure, Akiko; Uno, Masaharu; Ikeda, Takako; Nishida, Eisuke
2017-07-07
Intermittent fasting (IF) is a dietary restriction regimen that extends the lifespans of Caenorhabditis elegans and mammals by inducing changes in gene expression. However, how IF induces these changes and promotes longevity remains unclear. One proposed mechanism involves gene regulation by microRNAs (miRNAs), small non-coding RNAs (∼22 nucleotides) that repress gene expression and whose expression can be altered by fasting. To test this proposition, we examined the role of the miRNA machinery in fasting-induced transcriptional changes and longevity in C. elegans We revealed that fasting up-regulated the expression of the miRNA-induced silencing complex (miRISC) components, including Argonaute and GW182, and the miRNA-processing enzyme DRSH-1 (the ortholog of the Drosophila Drosha enzyme). Our lifespan measurements demonstrated that IF-induced longevity was suppressed by knock-out or knockdown of miRISC components and was completely inhibited by drsh-1 ablation. Remarkably, drsh-1 ablation inhibited the fasting-induced changes in the expression of the target genes of DAF-16, the insulin/IGF-1 signaling effector in C. elegans Fasting-induced transcriptome alterations were substantially and modestly suppressed in the drsh-1 null mutant and the null mutant of ain-1 , a gene encoding GW182, respectively. Moreover, miRNA array analyses revealed that the expression levels of numerous miRNAs changed after 2 days of fasting. These results indicate that components of the miRNA machinery, especially the miRNA-processing enzyme DRSH-1, play an important role in mediating IF-induced longevity via the regulation of fasting-induced changes in gene expression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
International Nuclear Information System (INIS)
Kim, Sunyoung; Baltimore, D.; Byrn, R.; Groopman, J.
1989-01-01
The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4 + lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes
Species-independent MicroRNA Gene Discovery
Kamanu, Timothy K.
2012-01-01
and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. mi
Directory of Open Access Journals (Sweden)
Shuhua Zhan
Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.
RNA-Seq for gene identification and transcript profiling of three Stevia rebaudiana genotypes.
Chen, Junwen; Hou, Kai; Qin, Peng; Liu, Hongchang; Yi, Bin; Yang, Wenting; Wu, Wei
2014-07-07
Stevia (Stevia rebaudiana) is an important medicinal plant that yields diterpenoid steviol glycosides (SGs). SGs are currently used in the preparation of medicines, food products and neutraceuticals because of its sweetening property (zero calories and about 300 times sweeter than sugar). Recently, some progress has been made in understanding the biosynthesis of SGs in Stevia, but little is known about the molecular mechanisms underlying this process. Additionally, the genomics of Stevia, a non-model species, remains uncharacterized. The recent advent of RNA-Seq, a next generation sequencing technology, provides an opportunity to expand the identification of Stevia genes through in-depth transcript profiling. We present a comprehensive landscape of the transcriptome profiles of three genotypes of Stevia with divergent SG compositions characterized using RNA-seq. 191,590,282 high-quality reads were generated and then assembled into 171,837 transcripts with an average sequence length of 969 base pairs. A total of 80,160 unigenes were annotated, and 14,211 of the unique sequences were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes. Gene sequences of all enzymes known to be involved in SG synthesis were examined. A total of 143 UDP-glucosyltransferase (UGT) unigenes were identified, some of which might be involved in SG biosynthesis. The expression patterns of eight of these genes were further confirmed by RT-QPCR. RNA-seq analysis identified candidate genes encoding enzymes responsible for the biosynthesis of SGs in Stevia, a non-model plant without a reference genome. The transcriptome data from this study yielded new insights into the process of SG accumulation in Stevia. Our results demonstrate that RNA-Seq can be successfully used for gene identification and transcript profiling in a non-model species.
Chen, Yin; Dumont, Marc G; Cébron, Aurélie; Murrell, J Colin
2007-11-01
Active methanotrophs in a landfill soil were revealed by detecting the 16S rRNA of methanotrophs and the mRNA transcripts of key genes involved in methane oxidation. New 16S rRNA primers targeting type I and type II methanotrophs were designed and optimized for analysis by denaturing gradient gel electrophoresis. Direct extraction of RNA from soil enabled the analysis of the expression of the functional genes: mmoX, pmoA and mxaF, which encode subunits of soluble methane monooxygenase, particulate methane monooxygenase and methanol dehydrogenase respectively. The 16S rRNA polymerase chain reaction (PCR) primers for type I methanotrophs detected Methylomonas, Methylosarcina and Methylobacter sequences from both soil DNA and cDNA which was generated from RNA extracted directly from the landfill cover soil. The 16S rRNA primers for type II methanotrophs detected primarily Methylocella and some Methylocystis 16S rRNA genes. Phylogenetic analysis of mRNA recovered from the soil indicated that Methylobacter, Methylosarcina, Methylomonas, Methylocystis and Methylocella were actively expressing genes involved in methane and methanol oxidation. Transcripts of pmoA but not mmoX were readily detected by reverse transcription polymerase chain reaction (RT-PCR), indicating that particulate methane monooxygenase may be largely responsible for methane oxidation in situ.
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Directory of Open Access Journals (Sweden)
Nathan D. Olson
2015-03-01
Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.
Directory of Open Access Journals (Sweden)
Decatur Wayne A
2008-10-01
Full Text Available Abstract Background Naturally occurring RNAs contain numerous enzymatically altered nucleosides. Differences in RNA populations (RNomics and pattern of RNA modifications (Modomics depends on the organism analyzed and are two of the criteria that distinguish the three kingdoms of life. If the genomic sequences of the RNA molecules can be derived from whole genome sequence information, the modification profile cannot and requires or direct sequencing of the RNAs or predictive methods base on the presence or absence of the modifications genes. Results By employing a comparative genomics approach, we predicted almost all of the genes coding for the t+rRNA modification enzymes in the mesophilic moderate halophile Haloferax volcanii. These encode both guide RNAs and enzymes. Some are orthologous to previously identified genes in Archaea, Bacteria or in Saccharomyces cerevisiae, but several are original predictions. Conclusion The number of modifications in t+rRNAs in the halophilic archaeon is surprisingly low when compared with other Archaea or Bacteria, particularly the hyperthermophilic organisms. This may result from the specific lifestyle of halophiles that require high intracellular salt concentration for survival. This salt content could allow RNA to maintain its functional structural integrity with fewer modifications. We predict that the few modifications present must be particularly important for decoding, accuracy of translation or are modifications that cannot be functionally replaced by the electrostatic interactions provided by the surrounding salt-ions. This analysis also guides future experimental validation work aiming to complete the understanding of the function of RNA modifications in Archaeal translation.
Bhargava, Apurva; Clabaugh, Ivory; To, Jenn P; Maxwell, Bridey B; Chiang, Yi-Hsuan; Schaller, G Eric; Loraine, Ann; Kieber, Joseph J
2013-05-01
Cytokinins are N(6)-substituted adenine derivatives that play diverse roles in plant growth and development. We sought to define a robust set of genes regulated by cytokinin as well as to query the response of genes not represented on microarrays. To this end, we performed a meta-analysis of microarray data from a variety of cytokinin-treated samples and used RNA-seq to examine cytokinin-regulated gene expression in Arabidopsis (Arabidopsis thaliana). Microarray meta-analysis using 13 microarray experiments combined with empirically defined filtering criteria identified a set of 226 genes differentially regulated by cytokinin, a subset of which has previously been validated by other methods. RNA-seq validated about 73% of the up-regulated genes identified by this meta-analysis. In silico promoter analysis indicated an overrepresentation of type-B Arabidopsis response regulator binding elements, consistent with the role of type-B Arabidopsis response regulators as primary mediators of cytokinin-responsive gene expression. RNA-seq analysis identified 73 cytokinin-regulated genes that were not represented on the ATH1 microarray. Representative genes were verified using quantitative reverse transcription-polymerase chain reaction and NanoString analysis. Analysis of the genes identified reveals a substantial effect of cytokinin on genes encoding proteins involved in secondary metabolism, particularly those acting in flavonoid and phenylpropanoid biosynthesis, as well as in the regulation of redox state of the cell, particularly a set of glutaredoxin genes. Novel splicing events were found in members of some gene families that are known to play a role in cytokinin signaling or metabolism. The genes identified in this analysis represent a robust set of cytokinin-responsive genes that are useful in the analysis of cytokinin function in plants.
Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada
2002-07-01
Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
MicroRNA Dysregulation, Gene Networks, and Risk for Schizophrenia in 22q11.2 Deletion Syndrome
Merico, Daniele; Costain, Gregory; Butcher, Nancy J.; Warnica, William; Ogura, Lucas; Alfred, Simon E.; Brzustowicz, Linda M.; Bassett, Anne S.
2014-01-01
The role of microRNAs (miRNAs) in the etiology of schizophrenia is increasingly recognized. Microdeletions at chromosome 22q11.2 are recurrent structural variants that impart a high risk for schizophrenia and are found in up to 1% of all patients with schizophrenia. The 22q11.2 deletion region overlaps gene DGCR8, encoding a subunit of the miRNA microprocessor complex. We identified miRNAs overlapped by the 22q11.2 microdeletion and for the first time investigated their predicted target genes...
Detecting microRNA activity from gene expression data
LENUS (Irish Health Repository)
Madden, Stephen F
2010-05-18
Abstract Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.
Detecting microRNA activity from gene expression data.
LENUS (Irish Health Repository)
Madden, Stephen F
2010-01-01
BACKGROUND: MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. RESULTS: Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. CONCLUSIONS: We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.
Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki
2014-06-01
Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down
Developmental regulation of Xenopus 5S RNA genes
International Nuclear Information System (INIS)
Wormington, W.M.; Schlissel, M.; Brown, D.D.
1983-01-01
In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table
Directory of Open Access Journals (Sweden)
Hua-Sheng Chiu
2018-04-01
Full Text Available Summary: Long noncoding RNAs (lncRNAs are commonly dysregulated in tumors, but only a handful are known to play pathophysiological roles in cancer. We inferred lncRNAs that dysregulate cancer pathways, oncogenes, and tumor suppressors (cancer genes by modeling their effects on the activity of transcription factors, RNA-binding proteins, and microRNAs in 5,185 TCGA tumors and 1,019 ENCODE assays. Our predictions included hundreds of candidate onco- and tumor-suppressor lncRNAs (cancer lncRNAs whose somatic alterations account for the dysregulation of dozens of cancer genes and pathways in each of 14 tumor contexts. To demonstrate proof of concept, we showed that perturbations targeting OIP5-AS1 (an inferred tumor suppressor and TUG1 and WT1-AS (inferred onco-lncRNAs dysregulated cancer genes and altered proliferation of breast and gynecologic cancer cells. Our analysis indicates that, although most lncRNAs are dysregulated in a tumor-specific manner, some, including OIP5-AS1, TUG1, NEAT1, MEG3, and TSIX, synergistically dysregulate cancer pathways in multiple tumor contexts. : Chiu et al. present a pan-cancer analysis of lncRNA regulatory interactions. They suggest that the dysregulation of hundreds of lncRNAs target and alter the expression of cancer genes and pathways in each tumor context. This implies that hundreds of lncRNAs can alter tumor phenotypes in each tumor context. Keywords: lncRNA, regulation, modulation, cancer gene, pan-cancer, noncoding RNA, microRNA, RNA-binding proteins, interactome
Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira
2013-01-30
Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Creelman, R A; Mullet, J E
1991-10-01
Transfer of soybean seedlings to low-water-potential vermiculite (psi w = -0.3 MPa) results in a reversible decrease in hypocotyl growth and modulation of several polysomal mRNAs (Plant Physiol 92: 205-214). We report here the isolation of two cDNA clones (pGE16 and pGE95) which correspond to genes whose mRNA levels are increased, and one cDNA clone (pGE23) which corresponds to a gene whose mRNA level is decreased in the hypocotyl zone of cell elongation by water deficit. In well-watered seedlings mRNAs hybridizing to pGE16 and pGE95 are most abundant in mature regions of the seedling, but in water-deficient seedlings mRNA levels are reduced in mature regions and enhanced in elongating regions. RNA corresponding to soybean proline-rich protein 1 (sbPRP1) shows a similar tissue distribution and response to water deficit. In contrast, in well-watered seedlings, the gene corresponding to pGE23 was highly expressed in the hypocotyl and root growing zones. Transfer of seedlings to low-water-potential vermiculite caused a rapid decrease in mRNA hybridizing to pGE23. Sequence analysis revealed that pGE23 has high homology with beta-tubulin. Water deficit also reduced the level of mRNA hybridizing to JCW1, an auxin-modulated gene, although with different kinetics. Furthermore, mRNA encoding actin, glycine-rich proteins (GRPs), and hydroxyproline-rich glycoproteins (HRGPs) were down-regulated in the hypocotyl zone of elongation of seedlings exposed to water deficit. No effect of water deficit was observed on the expression of chalcone synthase. Decreased expression of beta-tubulin, actin, JCW1, HRGP and GRP and increased expression of sbPRP1, pGE95 and pGE16 in the hypocotyl zone of cell elongation could participate in the reversible growth inhibition observed in water-deficient soybean seedlings.
Garcia, S; Kovařík, A
2013-07-01
In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.
A Caenorhabditis elegans RNA polymerase II gene, ama-1 IV, and nearby essential genes.
Rogalski, T M; Riddle, D L
1988-01-01
The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20 degrees but are arrested as larvae at 25 degrees, and two others are fertile at 20 degrees and sterile at 25 degrees. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25 degrees is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four gamma-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development.
miRNA-mediated 'tug-of-war' model reveals ceRNA propensity of genes in cancers.
Swain, Arpit Chandan; Mallick, Bibekanand
2018-06-01
Competing endogenous RNA (ceRNA) are transcripts that cross-regulate each other at the post-transcriptional level by competing for shared microRNA response elements (MREs). These have been implicated in various biological processes impacting cell-fate decisions and diseases including cancer. There are several studies that predict possible ceRNA pairs by adopting various machine-learning and mathematical approaches; however, there is no method that enables us to gauge as well as compare the propensity of the ceRNA of a gene and precisely envisages which among a pair exerts a stronger pull on the shared miRNA pool. In this study, we developed a method that uses the 'tug of war of genes' concept to predict and quantify ceRNA potential of a gene for the shared miRNA pool in cancers based on a score represented by SoCeR (score of competing endogenous RNA). The method was executed on the RNA-Seq transcriptional profiles of genes and miRNA available at TCGA along with CLIP-supported miRNA-target sites to predict ceRNA in 32 cancer types which were validated with already reported cases. The proposed method can be used to determine the sequestering capability of the gene of interest as well as in ranking the probable ceRNA candidates of a gene. Finally, we developed standalone applications (SoCeR tool) to aid researchers in easier implementation of the method in analysing different data sets or diseases. © 2018 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.
Nucleotide sequence of a human tRNA gene heterocluster
International Nuclear Information System (INIS)
Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.
1986-01-01
Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues
mRNA/microRNA gene expression profile in microsatellite unstable colorectal cancer
Directory of Open Access Journals (Sweden)
Calin George A
2007-08-01
Full Text Available Abstract Background Colorectal cancer develops through two main genetic instability pathways characterized by distinct pathologic features and clinical outcome. Results We investigated colon cancer samples (23 characterized by microsatellite stability, MSS, and 16 by high microsatellite instability, MSI-H for genome-wide expression of microRNA (miRNA and mRNA. Based on combined miRNA and mRNA gene expression, a molecular signature consisting of twenty seven differentially expressed genes, inclusive of 8 miRNAs, could correctly distinguish MSI-H versus MSS colon cancer samples. Among the differentially expressed miRNAs, various members of the oncogenic miR-17-92 family were significantly up-regulated in MSS cancers. The majority of protein coding genes were also up-regulated in MSS cancers. Their functional classification revealed that they were most frequently associated with cell cycle, DNA replication, recombination, repair, gastrointestinal disease and immune response. Conclusion This is the first report that indicates the existence of differences in miRNA expression between MSS versus MSI-H colorectal cancers. In addition, the work suggests that the combination of mRNA/miRNA expression signatures may represent a general approach for improving bio-molecular classification of human cancer.
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
Drosha regulates gene expression independently of RNA cleavage function
DEFF Research Database (Denmark)
Gromak, Natalia; Dienstbier, Martin; Macias, Sara
2013-01-01
Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-dependent manner. This binding is not associated with miRNA production or RNA cleavage. Drosha knockdown in HeLa cells downregulated nascent gene transcription, resulting in a reduction of polyadenylated mRNA produced from these gene regions. Furthermore, we show that this function of Drosha is dependent on its N......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....
Directory of Open Access Journals (Sweden)
Chen Yuan
2005-05-01
Full Text Available Abstract Background In humans, mutation of ELAC2 is associated with an increased risk of prostate cancer. ELAC2 has been shown to have tRNase Z activity and is associated with the γ-tubulin complex. Results In this work, we show that the yeast homolog of ELAC2, encoded by TRZ1 (tRNase Z 1, is involved genetically in RNA processing. The temperature sensitivity of a trz1 mutant can be rescued by multiple copies of REX2, which encodes a protein with RNA 3' processing activity, suggesting a role of Trz1p in RNA processing in vivo. Trz1p has two putative nucleotide triphosphate-binding motifs (P-loop and a conserved histidine motif. The histidine motif and the putative nucleotide binding motif at the C-domain are important for Trz1p function because mutant proteins bearing changes to the critical residues in these motifs are unable to rescue deletion of TRZ1. The growth defect exhibited by trz1 yeast is not complemented by the heterologous ELAC2, suggesting that Trz1p may have additional functions in yeast. Conclusion Our results provide genetic evidence that prostate cancer susceptibility gene ELAC2 may be involved in RNA processing, especially rRNA processing and mitochondrial function.
Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown
Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.
2013-01-01
Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148
Poly-dipeptides encoded by the C9orf72 repeats bind nucleoli, impede RNA biogenesis, and kill cells.
Kwon, Ilmin; Xiang, Siheng; Kato, Masato; Wu, Leeju; Theodoropoulos, Pano; Wang, Tao; Kim, Jiwoong; Yun, Jonghyun; Xie, Yang; McKnight, Steven L
2014-09-05
Many RNA regulatory proteins controlling pre-messenger RNA splicing contain serine:arginine (SR) repeats. Here, we found that these SR domains bound hydrogel droplets composed of fibrous polymers of the low-complexity domain of heterogeneous ribonucleoprotein A2 (hnRNPA2). Hydrogel binding was reversed upon phosphorylation of the SR domain by CDC2-like kinases 1 and 2 (CLK1/2). Mutated variants of the SR domains changing serine to glycine (SR-to-GR variants) also bound to hnRNPA2 hydrogels but were not affected by CLK1/2. When expressed in mammalian cells, these variants bound nucleoli. The translation products of the sense and antisense transcripts of the expansion repeats associated with the C9orf72 gene altered in neurodegenerative disease encode GRn and PRn repeat polypeptides. Both peptides bound to hnRNPA2 hydrogels independent of CLK1/2 activity. When applied to cultured cells, both peptides entered cells, migrated to the nucleus, bound nucleoli, and poisoned RNA biogenesis, which caused cell death. Copyright © 2014, American Association for the Advancement of Science.
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Genes involved in translation of Mycoplasma hyopneumoniae and Mycoplasma synoviae
Directory of Open Access Journals (Sweden)
Mônica de Oliveira Santos
2007-01-01
Full Text Available This is a report on the analysis of genes involved in translation of the complete genomes of Mycoplasma hyopneumoniae strain J and 7448 and Mycoplasma synoviae. In both genomes 31 ORFs encoding large ribosomal subunit proteins and 19 ORFs encoding small ribosomal subunit proteins were found. Ten ribosomal protein gene clusters encoding 42 ribosomal proteins were found in M. synoviae, while 8 clusters encoding 39 ribosomal proteins were found in both M. hyopneumoniae strains. The L33 gene of the M. hyopneumoniae strain 7448 presented two copies in different locations. The genes encoding initiation factors (IF-1, IF-2 and IF-3, elongation factors (EF-G, EF-Tu, EF-Ts and EF-P, and the genes encoding the ribosome recycling factor (frr and one polypeptide release factor (prfA were present in the genomes of M. hyopneumoniae and M. synoviae. Nineteen aminoacyl-tRNA synthases had been previously identified in both mycoplasmas. In the two strains of M. hyopneumoniae, J and 7448, only one set of 5S, 16S and 23S rRNAs had been identified. Two sets of 16S and 23S rRNA genes and three sets of 5S rRNA genes had been identified in the M. synoviae genome.
Global investigation of RNA 3'end processing and transcription termination pathways
DEFF Research Database (Denmark)
Molska, Ewa
2018-01-01
. For example, contrary to prediction, a subset of protein-coding genes utilise the machinery used by genes encoding U snRNAs. This same machinery is predominantly used by a class of lncRNA genes, encoding so-called PROMPTs, despite the presence of sequence elements predicted to guide the usage of the pathway......RNA polymerases transcribe diverse classes of genes and the produced RNAs need to be targeted to their appropriate cognate biochemical maturation pathways. The vast majority of the human transcriptome consists of long non-coding RNAs (lncRNAs), which is a heterogeneous group of RNAs...... that is inadequately divided into classes based e.g. on length, stability and association with protein-coding genes. We reasoned that further classification based on biochemical properties, in this case transcription termination and the mechanistically coupled RNA 3’-end processing, would enable a better understanding...
RNA-Generated and Gene-Edited Induced Pluripotent Stem Cells for Disease Modeling and Therapy.
Kehler, James; Greco, Marianna; Martino, Valentina; Pachiappan, Manickam; Yokoe, Hiroko; Chen, Alice; Yang, Miranda; Auerbach, Jonathan; Jessee, Joel; Gotte, Martin; Milanesi, Luciano; Albertini, Alberto; Bellipanni, Gianfranco; Zucchi, Ileana; Reinbold, Rolland A; Giordano, Antonio
2017-06-01
Cellular reprogramming by epigenomic remodeling of chromatin holds great promise in the field of human regenerative medicine. As an example, human-induced Pluripotent Stem Cells (iPSCs) obtained by reprograming of patient somatic cells are sufficiently similar to embryonic stem cells (ESCs) and can generate all cell types of the human body. Clinical use of iPSCs is dependent on methods that do not utilize genome altering transgenic technologies that are potentially unsafe and ethically unacceptable. Transient delivery of exogenous RNA into cells provides a safer reprogramming system to transgenic approaches that rely on exogenous DNA or viral vectors. RNA reprogramming may prove to be more suitable for clinical applications and provide stable starting cell lines for gene-editing, isolation, and characterization of patient iPSC lines. The introduction and rapid evolution of CRISPR/Cas9 gene-editing systems has provided a readily accessible research tool to perform functional human genetic experiments. Similar to RNA reprogramming, transient delivery of mRNA encoding Cas9 in combination with guide RNA sequences to target specific points in the genome eliminates the risk of potential integration of Cas9 plasmid constructs. We present optimized RNA-based laboratory procedure for making and editing iPSCs. In the near-term these two powerful technologies are being harnessed to dissect mechanisms of human development and disease in vitro, supporting both basic, and translational research. J. Cell. Physiol. 232: 1262-1269, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
A site-specific endonuclease encoded by a typical archaeal intron
DEFF Research Database (Denmark)
Dalgaard, Jacob; Garrett, Roger Antony; Belfort, Malene
1993-01-01
The protein encoded by the archaeal intron in the 23S rRNA gene of the hyperthermophile Desulfurococcus mobilis is a double-strand DNase that, like group I intron homing endonucleases, is capable of cleaving an intronless allele of the gene. This enzyme, I-Dmo I, is unusual among the intron...
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Energy Technology Data Exchange (ETDEWEB)
Kumar, M; Khanna, S [NIIT Univ, Neemrana (India). Dept. of Biotechnology & Bioinformation
2010-04-15
In order to develop effective bioremediation strategies for polyaromatic hydrocarbons (PAHs) degradation, the composition and metabolic potential of microbial communities need to be better understood, especially in highly PAH contaminated sites in which little information on the cultivation-independent communities is available. Coal-tar-contaminated soil was collected, which consisted of 122-122.5 mg g{sup -1} total extractable PAH compounds. Biodegradation studies with this soil indicated the presence of microbial community that is capable of degrading the model PAH compounds viz naphthalene, phenanthrene and pyrene at 50 ppm each. PCR clone libraries were established from the DNA of the coal-tar-contaminated soil, targeting the 16S rRNA to characterize (I) the microbial communities, (ii) partial gene fragment encoding the Rieske iron sulfur center {alpha}-subunit) common to all PAH dioxygenase enzymes and (iii) {beta}-subunit of dioxygenase. Phylotypes related to Proteobacteria ({Alpha}-, {Epsilon}- and Gammaproteobacteria), Acidobacteria, Actinobacteria, Firmicutes, Gemmatimonadetes and Deinococci were detected in 16S rRNA derived clone libraries. Many of the gene fragment sequences of alpha-subunit and beta-subunit of dioxygenase obtained from the respective clone libraries fell into clades that are distinct from the reference dioxygenase gene sequences. Presence of consensus sequence of the Rieske type (2Fe2S) cluster binding site suggested that these gene fragments encode for {alpha}-subunit of dioxygenase gene. Sequencing of the cloned libraries representing {alpha}-subunit gene fragments (Rf1) and beta-subunit of dioxygenase showed the presence of hitherto unidentified dioxygenase in coal-tar-contaminated soil.
MicroRNA Dysregulation, Gene Networks, and Risk for Schizophrenia in 22q11.2 Deletion Syndrome
Merico, Daniele; Costain, Gregory; Butcher, Nancy J.; Warnica, William; Ogura, Lucas; Alfred, Simon E.; Brzustowicz, Linda M.; Bassett, Anne S.
2014-01-01
The role of microRNAs (miRNAs) in the etiology of schizophrenia is increasingly recognized. Microdeletions at chromosome 22q11.2 are recurrent structural variants that impart a high risk for schizophrenia and are found in up to 1% of all patients with schizophrenia. The 22q11.2 deletion region overlaps gene DGCR8, encoding a subunit of the miRNA microprocessor complex. We identified miRNAs overlapped by the 22q11.2 microdeletion and for the first time investigated their predicted target genes, and those implicated by DGCR8, to identify targets that may be involved in the risk for schizophrenia. The 22q11.2 region encompasses seven validated or putative miRNA genes. Employing two standard prediction tools, we generated sets of predicted target genes. Functional enrichment profiles of the 22q11.2 region miRNA target genes suggested a role in neuronal processes and broader developmental pathways. We then constructed a protein interaction network of schizophrenia candidate genes and interaction partners relevant to brain function, independent of the 22q11.2 region miRNA mechanisms. We found that the predicted gene targets of the 22q11.2 deletion miRNAs, and targets of the genome-wide miRNAs predicted to be dysregulated by DGCR8 hemizygosity, were significantly represented in this schizophrenia network. The findings provide new insights into the pathway from 22q11.2 deletion to expression of schizophrenia, and suggest that hemizygosity of the 22q11.2 region may have downstream effects implicating genes elsewhere in the genome that are relevant to the general schizophrenia population. These data also provide further support for the notion that robust genetic findings in schizophrenia may converge on a reasonable number of final pathways. PMID:25484875
Thermodynamic control of small RNA-mediated gene silencing
Directory of Open Access Journals (Sweden)
Kumiko eUi-Tei
2012-06-01
Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.
A viral microRNA down-regulates multiple cell cycle genes through mRNA 5'UTRs.
Directory of Open Access Journals (Sweden)
Finn Grey
2010-06-01
Full Text Available Global gene expression data combined with bioinformatic analysis provides strong evidence that mammalian miRNAs mediate repression of gene expression primarily through binding sites within the 3' untranslated region (UTR. Using RNA induced silencing complex immunoprecipitation (RISC-IP techniques we have identified multiple cellular targets for a human cytomegalovirus (HCMV miRNA, miR-US25-1. Strikingly, this miRNA binds target sites primarily within 5'UTRs, mediating significant reduction in gene expression. Intriguingly, many of the genes targeted by miR-US25-1 are associated with cell cycle control, including cyclin E2, BRCC3, EID1, MAPRE2, and CD147, suggesting that miR-US25-1 is targeting genes within a related pathway. Deletion of miR-US25-1 from HCMV results in over expression of cyclin E2 in the context of viral infection. Our studies demonstrate that a viral miRNA mediates translational repression of multiple cellular genes by targeting mRNA 5'UTRs.
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.
Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj
2014-12-01
Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.
A genome-wide characterization of microRNA genes in maize.
Directory of Open Access Journals (Sweden)
Lifang Zhang
2009-11-01
Full Text Available MicroRNAs (miRNAs are small, non-coding RNAs that play essential roles in plant growth, development, and stress response. We conducted a genome-wide survey of maize miRNA genes, characterizing their structure, expression, and evolution. Computational approaches based on homology and secondary structure modeling identified 150 high-confidence genes within 26 miRNA families. For 25 families, expression was verified by deep-sequencing of small RNA libraries that were prepared from an assortment of maize tissues. PCR-RACE amplification of 68 miRNA transcript precursors, representing 18 families conserved across several plant species, showed that splice variation and the use of alternative transcriptional start and stop sites is common within this class of genes. Comparison of sequence variation data from diverse maize inbred lines versus teosinte accessions suggest that the mature miRNAs are under strong purifying selection while the flanking sequences evolve equivalently to other genes. Since maize is derived from an ancient tetraploid, the effect of whole-genome duplication on miRNA evolution was examined. We found that, like protein-coding genes, duplicated miRNA genes underwent extensive gene-loss, with approximately 35% of ancestral sites retained as duplicate homoeologous miRNA genes. This number is higher than that observed with protein-coding genes. A search for putative miRNA targets indicated bias towards genes in regulatory and metabolic pathways. As maize is one of the principal models for plant growth and development, this study will serve as a foundation for future research into the functional roles of miRNA genes.
Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T
2018-01-01
The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
Evolutionary relationships between miRNA genes and their activity.
Zhu, Yan; Skogerbø, Geir; Ning, Qianqian; Wang, Zhen; Li, Biqing; Yang, Shuang; Sun, Hong; Li, Yixue
2012-12-22
The emergence of vertebrates is characterized by a strong increase in miRNA families. MicroRNAs interact broadly with many transcripts, and the evolution of such a system is intriguing. However, evolutionary questions concerning the origin of miRNA genes and their subsequent evolution remain unexplained. In order to systematically understand the evolutionary relationship between miRNAs gene and their function, we classified human known miRNAs into eight groups based on their evolutionary ages estimated by maximum parsimony method. New miRNA genes with new functional sequences accumulated more dynamically in vertebrates than that observed in Drosophila. Different levels of evolutionary selection were observed over miRNA gene sequences with different time of origin. Most genic miRNAs differ from their host genes in time of origin, there is no particular relationship between the age of a miRNA and the age of its host genes, genic miRNAs are mostly younger than the corresponding host genes. MicroRNAs originated over different time-scales are often predicted/verified to target the same or overlapping sets of genes, opening the possibility of substantial functional redundancy among miRNAs of different ages. Higher degree of tissue specificity and lower expression level was found in young miRNAs. Our data showed that compared with protein coding genes, miRNA genes are more dynamic in terms of emergence and decay. Evolution patterns are quite different between miRNAs of different ages. MicroRNAs activity is under tight control with well-regulated expression increased and targeting decreased over time. Our work calls attention to the study of miRNA activity with a consideration of their origin time.
Directory of Open Access Journals (Sweden)
Saki Kondo
Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.
Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM
1992-01-01
Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632
Transcription factor trapping by RNA in gene regulatory elements.
Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A
2015-11-20
Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Isolation and expression analysis of four HD-ZIP III family genes targeted by microRNA166 in peach.
Zhang, C H; Zhang, B B; Ma, R J; Yu, M L; Guo, S L; Guo, L
2015-10-30
MicroRNA166 (miR166) is known to have highly conserved targets that encode proteins of the class III homeodomain-leucine zipper (HD-ZIP III) family, in a broad range of plant species. To further understand the relationship between HD-ZIP III genes and miR166, four HD-ZIP III family genes (PpHB14, PpHB15, PpHB8, and PpREV) were isolated from peach (Prunus persica) tissue and characterized. Spatio-temporal expression profiles of the genes were analyzed. Genes of the peach HD-ZIP III family were predicted to encode five conserved domains. Deduced amino acid sequences and tertiary structures of the four peach HD-ZIP III genes were highly conserved, with corresponding genes in Arabidopsis thaliana. The expression level of four targets displayed the opposite trend to that of miR166 throughout fruit development, with the exception of PpHB14 from 35 to 55 days after full bloom (DAFB). This finding indicates that miR166 may negatively regulate its four targets throughout fruit development. As for leaf and phloem, the same trend in expression level was observed between four targets and miR166 from 75 to 105 DAFB. However, the opposite trend was observed for the transcript level between four targets and miR166 from 35 to 55 DAFB. miRNA166 may negatively regulate four targets in some but not all developmental stages for a given tissue. The four genes studied were observed to have, exactly or generally, the same change tendency as individual tissue development, a finding that suggests genes of the HD-ZIP III family in peach may have complementary or cooperative functions in various tissues.
Functional gene silencing mediated by chitosan/siRNA nanocomplexes
Energy Technology Data Exchange (ETDEWEB)
Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F [Department of Pharmaceutical Science, Zhujiang Hospital, Southern Medical University, Guangzhou 510282 (China); Yang, B, E-mail: andrewfxu1998@gmail.co [Department of Chemistry, Indiana University-Bloomington, Bloomington, IN 47405 (United States)
2009-10-07
Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.
Functional gene silencing mediated by chitosan/siRNA nanocomplexes
International Nuclear Information System (INIS)
Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F; Yang, B
2009-01-01
Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.
RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.
Directory of Open Access Journals (Sweden)
Michele Gusberti
Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result
tRNA gene diversity in the three domains of life
Directory of Open Access Journals (Sweden)
Kosuke eFujishima
2014-05-01
Full Text Available Transfer RNA (tRNA is widely known for its key role in decoding mRNA into protein. Despite their necessity and relatively short nucleotide sequences, a large diversity of gene structures and RNA secondary structures of pre-tRNAs and mature tRNAs have recently been discovered in the three domains of life. Growing evidences of disrupted tRNA genes in the genomes of Archaea reveals unique gene structures such as, intron-containing tRNA, split tRNA, and permuted tRNA. Coding sequence for these tRNAs are either separated with introns, fragmented, or permuted at the genome level. Although evolutionary scenario behind the tRNA gene disruption is still unclear, diversity of tRNA structure seems to be co-evolved with their processing enzyme, so-called RNA splicing endonuclease. Metazoan mitochondrial tRNAs (mtRNAs are known for their unique lack of either one or two arms from the typical tRNA cloverleaf structure, while still maintaining functionality. Recently identified nematode-specific V-arm containing tRNAs (nev-tRNAs possess long variable arms that are specific to eukaryotic class II tRNASer and tRNALeu but also decode class I tRNA codons. Moreover, many tRNA-like sequences have been found in the genomes of different organisms and viruses. Thus this review is aimed to cover the latest knowledge on tRNA gene diversity and further recapitulate the evolutionary and biological aspects that caused such uniqueness.
Sakai, Hiroki; Sumitani, Megumi; Chikami, Yasuhiko; Yahata, Kensuke; Uchino, Keiro; Kiuchi, Takashi; Katsuma, Susumu; Aoki, Fugaku; Sezutsu, Hideki; Suzuki, Masataka G
2016-08-01
In Bombyx mori (B. mori), Fem piRNA originates from the W chromosome and is responsible for femaleness. The Fem piRNA-PIWI complex targets and cleaves mRNAs transcribed from the Masc gene. Masc encodes a novel CCCH type zinc-finger protein and is required for male-specific splicing of B. mori doublesex (Bmdsx) transcripts. In the present study, several silkworm strains carrying a transgene, which encodes a Fem piRNA-resistant Masc mRNA (Masc-R), were generated. Forced expression of the Masc-R transgene caused female-specific lethality during the larval stages. One of the Masc-R strains weakly expressed Masc-R in various tissues. Females heterozygous for the transgene expressed male-specific isoform of the Bombyx homolog of insulin-like growth factor II mRNA-binding protein (ImpM) and Bmdsx. All examined females showed a lower inducibility of vitellogenin synthesis and exhibited abnormalities in the ovaries. Testis-like tissues were observed in abnormal ovaries and, notably, the tissues contained considerable numbers of sperm bundles. Homozygous expression of the transgene resulted in formation of the male-specific abdominal segment in adult females and caused partial male differentiation in female genitalia. These results strongly suggest that Masc is an important regulatory gene of maleness in B. mori.
Directory of Open Access Journals (Sweden)
Stefanie Hoyer
2015-01-01
Full Text Available For therapeutic cancer vaccination, the adoptive transfer of mRNA-electroporated dendritic cells (DCs is frequently performed, usually with monocyte-derived, cytokine-matured DCs (moDCs. However, DCs are rich in danger-sensing receptors which could recognize the exogenously delivered mRNA and induce DC activation, hence influencing the DCs’ immunogenicity. Therefore, we examined whether electroporation of mRNA with a proper cap and a poly-A tail of at least 64 adenosines had any influence on cocktail-matured moDCs. We used 16 different RNAs, encoding tumor antigens (MelanA, NRAS, BRAF, GNAQ, GNA11, and WT1, and variants thereof. None of those RNAs induced changes in the expression of CD25, CD40, CD83, CD86, and CD70 or the secretion of the cytokines IL-8, IL-6, and TNFα of more than 1.5-fold compared to the control condition, while an mRNA encoding an NF-κB-activation protein as positive control induced massive secretion of the cytokines. To determine whether mRNA electroporation had any effect on the whole transcriptome of the DCs, we performed microarray analyses of DCs of 6 different donors. None of 60,000 probes was significantly different between mock-electroporated DCs and MelanA-transfected DCs. Hence, we conclude that no transcriptional programs were induced within cocktail-matured DCs by electroporation of single tumor-antigen-encoding mRNAs.
Pseudogenes regulate parental gene expression via ceRNA network.
An, Yang; Furber, Kendra L; Ji, Shaoping
2017-01-01
The concept of competitive endogenous RNA (ceRNA) was first proposed by Salmena and colleagues. Evidence suggests that pseudogene RNAs can act as a 'sponge' through competitive binding of common miRNA, releasing or attenuating repression through sequestering miRNAs away from parental mRNA. In theory, ceRNAs refer to all transcripts such as mRNA, tRNA, rRNA, long non-coding RNA, pseudogene RNA and circular RNA, because all of them may become the targets of miRNA depending on spatiotemporal situation. As binding of miRNA to the target RNA is not 100% complementary, it is possible that one miRNA can bind to multiple target RNAs and vice versa. All RNAs crosstalk through competitively binding to miRNAvia miRNA response elements (MREs) contained within the RNA sequences, thus forming a complex regulatory network. The ratio of a subset of miRNAs to the corresponding number of MREs determines repression strength on a given mRNA translation or stability. An increase in pseudogene RNA level can sequester miRNA and release repression on the parental gene, leading to an increase in parental gene expression. A massive number of transcripts constitute a complicated network that regulates each other through this proposed mechanism, though some regulatory significance may be mild or even undetectable. It is possible that the regulation of gene and pseudogene expression occurring in this manor involves all RNAs bearing common MREs. In this review, we will primarily discuss how pseudogene transcripts regulate expression of parental genes via ceRNA network and biological significance of regulation. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
International Nuclear Information System (INIS)
Grzybowska, Ewa A.
2012-01-01
Highlights: ► Functional characteristics of intronless genes (IGs). ► Diseases associated with IGs. ► Origin and evolution of IGs. ► mRNA processing without splicing. -- Abstract: Intronless genes (IGs) constitute approximately 3% of the human genome. Human IGs are essentially different in evolution and functionality from the IGs of unicellular eukaryotes, which represent the majority in their genomes. Functional analysis of IGs has revealed a massive over-representation of signal transduction genes and genes encoding regulatory proteins important for growth, proliferation, and development. IGs also often display tissue-specific expression, usually in the nervous system and testis. These characteristics translate into IG-associated diseases, mainly neuropathies, developmental disorders, and cancer. IGs represent recent additions to the genome, created mostly by retroposition of processed mRNAs with retained functionality. Processing, nuclear export, and translation of these mRNAs should be hampered dramatically by the lack of splice factors, which normally tightly cover mature transcripts and govern their fate. However, natural IGs manage to maintain satisfactory expression levels. Different mechanisms by which IGs solve the problem of mRNA processing and nuclear export are discussed here, along with their possible impact on reporter studies.
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
DEFF Research Database (Denmark)
Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels
particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...
2013-01-01
Background The production of enzymes by an industrial strain requires a complex adaption of the bacterial metabolism to the conditions within the fermenter. Regulatory events within the process result in a dynamic change of the transcriptional activity of the genome. This complex network of genes is orchestrated by proteins as well as regulatory RNA elements. Here we present an RNA-Seq based study considering selected phases of an industry-oriented fermentation of Bacillus licheniformis. Results A detailed analysis of 20 strand-specific RNA-Seq datasets revealed a multitude of transcriptionally active genomic regions. 3314 RNA features encoded by such active loci have been identified and sorted into ten functional classes. The identified sequences include the expected RNA features like housekeeping sRNAs, metabolic riboswitches and RNA switches well known from studies on Bacillus subtilis as well as a multitude of completely new candidates for regulatory RNAs. An unexpectedly high number of 855 RNA features are encoded antisense to annotated protein and RNA genes, in addition to 461 independently transcribed small RNAs. These antisense transcripts contain molecules with a remarkable size range variation from 38 to 6348 base pairs in length. The genome of the type strain B. licheniformis DSM13 was completely reannotated using data obtained from RNA-Seq analyses and from public databases. Conclusion The hereby generated data-sets represent a solid amount of knowledge on the dynamic transcriptional activities during the investigated fermentation stages. The identified regulatory elements enable research on the understanding and the optimization of crucial metabolic activities during a productive fermentation of Bacillus licheniformis strains. PMID:24079885
Wiegand, Sandra; Dietrich, Sascha; Hertel, Robert; Bongaerts, Johannes; Evers, Stefan; Volland, Sonja; Daniel, Rolf; Liesegang, Heiko
2013-10-01
The production of enzymes by an industrial strain requires a complex adaption of the bacterial metabolism to the conditions within the fermenter. Regulatory events within the process result in a dynamic change of the transcriptional activity of the genome. This complex network of genes is orchestrated by proteins as well as regulatory RNA elements. Here we present an RNA-Seq based study considering selected phases of an industry-oriented fermentation of Bacillus licheniformis. A detailed analysis of 20 strand-specific RNA-Seq datasets revealed a multitude of transcriptionally active genomic regions. 3314 RNA features encoded by such active loci have been identified and sorted into ten functional classes. The identified sequences include the expected RNA features like housekeeping sRNAs, metabolic riboswitches and RNA switches well known from studies on Bacillus subtilis as well as a multitude of completely new candidates for regulatory RNAs. An unexpectedly high number of 855 RNA features are encoded antisense to annotated protein and RNA genes, in addition to 461 independently transcribed small RNAs. These antisense transcripts contain molecules with a remarkable size range variation from 38 to 6348 base pairs in length. The genome of the type strain B. licheniformis DSM13 was completely reannotated using data obtained from RNA-Seq analyses and from public databases. The hereby generated data-sets represent a solid amount of knowledge on the dynamic transcriptional activities during the investigated fermentation stages. The identified regulatory elements enable research on the understanding and the optimization of crucial metabolic activities during a productive fermentation of Bacillus licheniformis strains.
Reconstruction of ribosomal RNA genes from metagenomic data.
Directory of Open Access Journals (Sweden)
Lu Fan
Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Identification of functional elements and regulatory circuits by Drosophila modENCODE
Energy Technology Data Exchange (ETDEWEB)
Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis
2010-12-22
To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions
MicroRNA Polymorphisms in Cancer: A Literature Analysis
International Nuclear Information System (INIS)
Pipan, Veronika; Zorc, Minja; Kunej, Tanja
2015-01-01
Single nucleotide polymorphisms (SNPs) located in microRNA (miRNA) genes (miR-SNPs) have attracted increasing attention in recent years due to their involvement in the development of various types of cancer. Therefore, a systematic review on this topic was needed. From 55 scientific publications we collected 20 SNPs, which are located within 18 miRNA encoding genes and have been associated with 16 types of cancer. Among 20 miRNA gene polymorphisms 13 are located within the premature miRNA region, five within mature, and two within mature seed miRNA region. We graphically visualized a network of miRNA-cancer associations which revealed miRNA genes and cancer types with the highest number of connections. Our study showed that, despite a large number of variations currently known to be located within miRNA genes in humans, most of them have not yet been tested for association with cancer. MicroRNA SNPs collected in this study represent only 0.43% of known miRNA gene variations (20/4687). Results of the present study will be useful to researchers investigating the clinical use of miRNAs, such as the roles of miRNAs as diagnostic markers and therapeutic targets
MicroRNA Polymorphisms in Cancer: A Literature Analysis
Energy Technology Data Exchange (ETDEWEB)
Pipan, Veronika; Zorc, Minja; Kunej, Tanja, E-mail: tanja.kunej@bf.uni-lj.si [Department of Animal Science, Biotechnical Faculty, University of Ljubljana, Groblje 3, SI-1230 Domzale (Slovenia)
2015-09-09
Single nucleotide polymorphisms (SNPs) located in microRNA (miRNA) genes (miR-SNPs) have attracted increasing attention in recent years due to their involvement in the development of various types of cancer. Therefore, a systematic review on this topic was needed. From 55 scientific publications we collected 20 SNPs, which are located within 18 miRNA encoding genes and have been associated with 16 types of cancer. Among 20 miRNA gene polymorphisms 13 are located within the premature miRNA region, five within mature, and two within mature seed miRNA region. We graphically visualized a network of miRNA-cancer associations which revealed miRNA genes and cancer types with the highest number of connections. Our study showed that, despite a large number of variations currently known to be located within miRNA genes in humans, most of them have not yet been tested for association with cancer. MicroRNA SNPs collected in this study represent only 0.43% of known miRNA gene variations (20/4687). Results of the present study will be useful to researchers investigating the clinical use of miRNAs, such as the roles of miRNAs as diagnostic markers and therapeutic targets.
Directory of Open Access Journals (Sweden)
Genta Ohno
Full Text Available Pre-mRNAs are often processed in complex patterns in tissue-specific manners to produce a variety of protein isoforms from single genes. However, mechanisms orchestrating the processing of the entire transcript are not well understood. Muscle-specific alternative pre-mRNA processing of the unc-60 gene in Caenorhabditis elegans, encoding two tissue-specific isoforms of ADF/cofilin with distinct biochemical properties in regulating actin organization, provides an excellent in vivo model of complex and tissue-specific pre-mRNA processing; it consists of a single first exon and two separate series of downstream exons. Here we visualize the complex muscle-specific processing pattern of the unc-60 pre-mRNA with asymmetric fluorescence reporter minigenes. By disrupting juxtaposed CUAAC repeats and UGUGUG stretch in intron 1A, we demonstrate that these elements are required for retaining intron 1A, as well as for switching the processing patterns of the entire pre-mRNA from non-muscle-type to muscle-type. Mutations in genes encoding muscle-specific RNA-binding proteins ASD-2 and SUP-12 turned the colour of the unc-60 reporter worms. ASD-2 and SUP-12 proteins specifically and cooperatively bind to CUAAC repeats and UGUGUG stretch in intron 1A, respectively, to form a ternary complex in vitro. Immunohistochemical staining and RT-PCR analyses demonstrate that ASD-2 and SUP-12 are also required for switching the processing patterns of the endogenous unc-60 pre-mRNA from UNC-60A to UNC-60B in muscles. Furthermore, systematic analyses of partially spliced RNAs reveal the actual orders of intron removal for distinct mRNA isoforms. Taken together, our results demonstrate that muscle-specific splicing factors ASD-2 and SUP-12 cooperatively promote muscle-specific processing of the unc-60 gene, and provide insight into the mechanisms of complex pre-mRNA processing; combinatorial regulation of a single splice site by two tissue-specific splicing regulators
Tadokoro, Takashi; Chon, Hyongi; Koga, Yuichi; Takano, Kazufumi; Kanaya, Shigenori
2007-07-01
The gene encoding a bacterial type 1 RNase H, termed RBD-RNase HI, was cloned from the psychrotrophic bacterium Shewanella sp. SIB1, overproduced in Escherichia coli, and the recombinant protein was purified and biochemically characterized. SIB1 RBD-RNase HI consists of 262 amino acid residues and shows amino acid sequence identities of 26% to SIB1 RNase HI, 17% to E. coli RNase HI, and 32% to human RNase H1. SIB1 RBD-RNase HI has a double-stranded RNA binding domain (RBD) at the N-terminus, which is commonly present at the N-termini of eukaryotic type 1 RNases H. Gel mobility shift assay indicated that this domain binds to an RNA/DNA hybrid in an isolated form, suggesting that this domain is involved in substrate binding. SIB1 RBD-RNase HI exhibited the enzymatic activity both in vitro and in vivo. Its optimum pH and metal ion requirement were similar to those of SIB1 RNase HI, E. coli RNase HI, and human RNase H1. The specific activity of SIB1 RBD-RNase HI was comparable to that of E. coli RNase HI and was much higher than those of SIB1 RNase HI and human RNase H1. SIB1 RBD-RNase HI showed poor cleavage-site specificity for oligomeric substrates. SIB1 RBD-RNase HI was less stable than E. coli RNase HI but was as stable as human RNase H1. Database searches indicate that several bacteria and archaea contain an RBD-RNase HI. This is the first report on the biochemical characterization of RBD-RNase HI.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Mitochondrial tRNA gene translocations in highly eusocial bees
Directory of Open Access Journals (Sweden)
Daniela Silvestre
2006-01-01
Full Text Available Mitochondrial gene rearrangement events, especially involving tRNA genes, have been described more frequently as more complete mitochondrial genome sequences are becoming available. In the present work, we analyzed mitochondrial tRNA gene rearrangements between two bee species belonging to the tribes Apini and Meliponini within the "corbiculate Apidae". Eleven tRNA genes are in different genome positions or strands. The molecular events responsible for each translocation are explained. Considering the high number of rearrangements observed, the data presented here contradict the general rule of high gene order conservation among closely related organisms, and also represent a powerful molecular tool to help solve questions about phylogeny and evolution in bees.
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Analysis of the complement and molecular evolution of tRNA genes in cow
Directory of Open Access Journals (Sweden)
Barris Wesley C
2009-04-01
Full Text Available Abstract Background Detailed information regarding the number and organization of transfer RNA (tRNA genes at the genome level is becoming readily available with the increase of DNA sequencing of whole genomes. However the identification of functional tRNA genes is challenging for species that have large numbers of repetitive elements containing tRNA derived sequences, such as Bos taurus. Reliable identification and annotation of entire sets of tRNA genes allows the evolution of tRNA genes to be understood on a genomic scale. Results In this study, we explored the B. taurus genome using bioinformatics and comparative genomics approaches to catalogue and analyze cow tRNA genes. The initial analysis of the cow genome using tRNAscan-SE identified 31,868 putative tRNA genes and 189,183 pseudogenes, where 28,830 of the 31,868 predicted tRNA genes were classified as repetitive elements by the RepeatMasker program. We then used comparative genomics to further discriminate between functional tRNA genes and tRNA-derived sequences for the remaining set of 3,038 putative tRNA genes. For our analysis, we used the human, chimpanzee, mouse, rat, horse, dog, chicken and fugu genomes to predict that the number of active tRNA genes in cow lies in the vicinity of 439. Of this set, 150 tRNA genes were 100% identical in their sequences across all nine vertebrate genomes studied. Using clustering analyses, we identified a new tRNA-GlyCCC subfamily present in all analyzed mammalian genomes. We suggest that this subfamily originated from an ancestral tRNA-GlyGCC gene via a point mutation prior to the radiation of the mammalian lineages. Lastly, in a separate analysis we created phylogenetic profiles for each putative cow tRNA gene using a representative set of genomes to gain an overview of common evolutionary histories of tRNA genes. Conclusion The use of a combination of bioinformatics and comparative genomics approaches has allowed the confident identification of a
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Methods and compositions for controlling gene expression by RNA processing
Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.
2017-08-29
The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.
Domestication of transposable elements into MicroRNA genes in plants.
Directory of Open Access Journals (Sweden)
Yang Li
Full Text Available Transposable elements (TE usually take up a substantial portion of eukaryotic genome. Activities of TEs can cause genome instability or gene mutations that are harmful or even disastrous to the host. TEs also contribute to gene and genome evolution at many aspects. Part of miRNA genes in mammals have been found to derive from transposons while convincing evidences are absent for plants. We found that a considerable number of previously annotated plant miRNAs are identical or homologous to transposons (TE-MIR, which include a small number of bona fide miRNA genes that conform to generally accepted plant miRNA annotation rules, and hairpin derived siRNAs likely to be pre-evolved miRNAs. Analysis of these TE-MIRs indicate that transitions from the medium to high copy TEs into miRNA genes may undergo steps such as inverted repeat formation, sequence speciation and adaptation to miRNA biogenesis. We also identified initial target genes of the TE-MIRs, which contain homologous sequences in their CDS as consequence of cognate TE insertions. About one-third of the initial target mRNAs are supported by publicly available degradome sequencing data for TE-MIR sRNA induced cleavages. Targets of the TE-MIRs are biased to non-TE related genes indicating their penchant to acquire cellular functions during evolution. Interestingly, most of these TE insertions span boundaries between coding and non-coding sequences indicating their incorporation into CDS through alteration of splicing or translation start or stop signals. Taken together, our findings suggest that TEs in gene rich regions can form foldbacks in non-coding part of transcripts that may eventually evolve into miRNA genes or be integrated into protein coding sequences to form potential targets in a "temperate" manner. Thus, transposons may supply as resources for the evolution of miRNA-target interactions in plants.
Strategies for Improving siRNA-Induced Gene Silencing Efficiency.
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-12-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.
Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.
Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J
2010-11-01
MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.
Blazier, J. Chris; Ruhlman, Tracey A.; Weng, Mao-Lun; Rehman, Sumaiyah K.; Sabir, Jamal S. M.; Jansen, Robert K.
2016-01-01
Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP ? subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled an...
Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita
2015-10-01
Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Wang, S Y; Gudas, L J
1990-09-15
We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.
Directory of Open Access Journals (Sweden)
David L Bernick
2012-07-01
Full Text Available A great diversity of small, non-coding RNA molecules with roles in gene regulation and RNA processing have been intensely studied in eukaryotic and bacterial model organisms, yet our knowledge of possible parallel roles for small RNAs in archaea is limited. We employed RNA-seq to identify novel small RNA across multiple species of the hyperthermophilic genus Pyrobaculum, known for unusual RNA gene characteristics. By comparing transcriptional data collected in parallel among four species, we were able to identify conserved RNA genes fitting into known and novel families. Among our findings, we highlight three novel cis-antisense small RNAs encoded opposite to key regulatory (ferric uptake regulator, metabolic (triose-phosphate isomerase, and core transcriptional apparatus genes (transcription factor B. We also found a large increase in the number of conserved C/D box small RNA genes over what had been previously recognized; many of these genes are encoded antisense to protein coding genes. The conserved opposition to orthologous genes across the Pyrobaculum genus suggests similarities to other cis-antisense regulatory systems. Furthermore, the genus-specific nature of these small RNAs indicates they are relatively recent, stable adaptations.
Condition-specific RNA editing in the coral symbiont Symbiodinium microadriaticum
Liew, Yi Jin
2017-03-01
RNA editing is a rare post-transcriptional event that provides cells with an additional level of gene expression regulation. It has been implicated in various processes including adaptation, viral defence and RNA interference; however, its potential role as a mechanism in acclimatization has just recently been recognised. Here, we show that RNA editing occurs in 1.6% of all nuclear-encoded genes of Symbiodinium microadriaticum, a dinoflagellate symbiont of reef-building corals. All base-substitution edit types were present, and statistically significant motifs were associated with three edit types. Strikingly, a subset of genes exhibited condition-specific editing patterns in response to different stressors that resulted in significant increases of non-synonymous changes. We posit that this previously unrecognised mechanism extends this organism’s capability to respond to stress beyond what is encoded by the genome. This in turn may provide further acclimatization capacity to these organisms, and by extension, their coral hosts.
Condition-specific RNA editing in the coral symbiont Symbiodinium microadriaticum
Liew, Yi Jin; Li, Yong; Baumgarten, Sebastian; Voolstra, Christian R.; Aranda, Manuel
2017-01-01
RNA editing is a rare post-transcriptional event that provides cells with an additional level of gene expression regulation. It has been implicated in various processes including adaptation, viral defence and RNA interference; however, its potential role as a mechanism in acclimatization has just recently been recognised. Here, we show that RNA editing occurs in 1.6% of all nuclear-encoded genes of Symbiodinium microadriaticum, a dinoflagellate symbiont of reef-building corals. All base-substitution edit types were present, and statistically significant motifs were associated with three edit types. Strikingly, a subset of genes exhibited condition-specific editing patterns in response to different stressors that resulted in significant increases of non-synonymous changes. We posit that this previously unrecognised mechanism extends this organism’s capability to respond to stress beyond what is encoded by the genome. This in turn may provide further acclimatization capacity to these organisms, and by extension, their coral hosts.
miRNA-Processing Gene Methylation and Cancer Risk.
Joyce, Brian T; Zheng, Yinan; Zhang, Zhou; Liu, Lei; Kocherginsky, Masha; Murphy, Robert; Achenbach, Chad J; Musa, Jonah; Wehbe, Firas; Just, Allan; Shen, Jincheng; Vokonas, Pantel; Schwartz, Joel; Baccarelli, Andrea A; Hou, Lifang
2018-05-01
Background: Dysregulation of miRNA and methylation levels are epigenetic hallmarks of cancer, potentially linked via miRNA-processing genes. Studies have found genetic alterations to miRNA-processing genes in cancer cells and human population studies. Our objective was to prospectively examine changes in DNA methylation of miRNA-processing genes and their associations with cancer risk. Methods: We examined cohort data from the Department of Veterans' Affairs Normative Aging Study. Participants were assessed every 3 to 5 years starting in 1999 through 2013 including questionnaires, medical record review, and blood collection. Blood from 686 consenting participants was analyzed using the Illumina 450K BeadChip array to measure methylation at CpG sites throughout the genome. We selected 19 genes based on a literature review, with 519 corresponding CpG sites. We then used Cox proportional hazards models to examine associations with cancer incidence, and generalized estimating equations to examine associations with cancer prevalence. Associations at false discovery rate time to cancer development (positively for cg06751583, inversely for cg23230564 and cg21034183), whereas methylation of one CpG site ( DROSHA : cg16131300) was positively associated with cancer prevalence. Conclusions: DNA methylation of DROSHA , a key miRNA-processing gene, and TNRC6B may play a role in early carcinogenesis. Impact: Changes in miRNA processing may exert multiple effects on cancer development, including protecting against it via altered global miRNAs, and may be a useful early detection biomarker of cancer. Cancer Epidemiol Biomarkers Prev; 27(5); 550-7. ©2018 AACR . ©2018 American Association for Cancer Research.
Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David
2018-03-19
To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.
VIRmiRNA: a comprehensive resource for experimentally validated viral miRNAs and their targets.
Qureshi, Abid; Thakur, Nishant; Monga, Isha; Thakur, Anamika; Kumar, Manoj
2014-01-01
Viral microRNAs (miRNAs) regulate gene expression of viral and/or host genes to benefit the virus. Hence, miRNAs play a key role in host-virus interactions and pathogenesis of viral diseases. Lately, miRNAs have also shown potential as important targets for the development of novel antiviral therapeutics. Although several miRNA and their target repositories are available for human and other organisms in literature, but a dedicated resource on viral miRNAs and their targets are lacking. Therefore, we have developed a comprehensive viral miRNA resource harboring information of 9133 entries in three subdatabases. This includes 1308 experimentally validated miRNA sequences with their isomiRs encoded by 44 viruses in viral miRNA ' VIRMIRNA: ' and 7283 of their target genes in ' VIRMIRTAR': . Additionally, there is information of 542 antiviral miRNAs encoded by the host against 24 viruses in antiviral miRNA ' AVIRMIR': . The web interface was developed using Linux-Apache-MySQL-PHP (LAMP) software bundle. User-friendly browse, search, advanced search and useful analysis tools are also provided on the web interface. VIRmiRNA is the first specialized resource of experimentally proven virus-encoded miRNAs and their associated targets. This database would enhance the understanding of viral/host gene regulation and may also prove beneficial in the development of antiviral therapeutics. Database URL: http://crdd.osdd.net/servers/virmirna. © The Author(s) 2014. Published by Oxford University Press.
Huang, Jingshan; Gutierrez, Fernando; Strachan, Harrison J; Dou, Dejing; Huang, Weili; Smith, Barry; Blake, Judith A; Eilbeck, Karen; Natale, Darren A; Lin, Yu; Wu, Bin; Silva, Nisansa de; Wang, Xiaowei; Liu, Zixing; Borchert, Glen M; Tan, Ming; Ruttenberg, Alan
2016-01-01
As a special class of non-coding RNAs (ncRNAs), microRNAs (miRNAs) perform important roles in numerous biological and pathological processes. The realization of miRNA functions depends largely on how miRNAs regulate specific target genes. It is therefore critical to identify, analyze, and cross-reference miRNA-target interactions to better explore and delineate miRNA functions. Semantic technologies can help in this regard. We previously developed a miRNA domain-specific application ontology, Ontology for MIcroRNA Target (OMIT), whose goal was to serve as a foundation for semantic annotation, data integration, and semantic search in the miRNA field. In this paper we describe our continuing effort to develop the OMIT, and demonstrate its use within a semantic search system, OmniSearch, designed to facilitate knowledge capture of miRNA-target interaction data. Important changes in the current version OMIT are summarized as: (1) following a modularized ontology design (with 2559 terms imported from the NCRO ontology); (2) encoding all 1884 human miRNAs (vs. 300 in previous versions); and (3) setting up a GitHub project site along with an issue tracker for more effective community collaboration on the ontology development. The OMIT ontology is free and open to all users, accessible at: http://purl.obolibrary.org/obo/omit.owl. The OmniSearch system is also free and open to all users, accessible at: http://omnisearch.soc.southalabama.edu/index.php/Software.
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
Directory of Open Access Journals (Sweden)
Xu Wanhong
2008-12-01
Full Text Available Abstract Background The orthoreoviruses are infectious agents that possess a genome comprised of 10 double-stranded RNA segments encased in two concentric protein capsids. Like virtually all RNA viruses, an RNA-dependent RNA polymerase (RdRp enzyme is required for viral propagation. RdRp sequences have been determined for the prototype mammalian orthoreoviruses and for several other closely-related reoviruses, including aquareoviruses, but have not yet been reported for any avian orthoreoviruses. Results We determined the L2 genome segment nucleotide sequences, which encode the RdRp proteins, of two different avian reoviruses, strains ARV138 and ARV176 in order to define conserved and variable regions within reovirus RdRp proteins and to better delineate structure/function of this important enzyme. The ARV138 L2 genome segment was 3829 base pairs long, whereas the ARV176 L2 segment was 3830 nucleotides long. Both segments were predicted to encode λB RdRp proteins 1259 amino acids in length. Alignments of these newly-determined ARV genome segments, and their corresponding proteins, were performed with all currently available homologous mammalian reovirus (MRV and aquareovirus (AqRV genome segment and protein sequences. There was ~55% amino acid identity between ARV λB and MRV λ3 proteins, making the RdRp protein the most highly conserved of currently known orthoreovirus proteins, and there was ~28% identity between ARV λB and homologous MRV and AqRV RdRp proteins. Predictive structure/function mapping of identical and conserved residues within the known MRV λ3 atomic structure indicated most identical amino acids and conservative substitutions were located near and within predicted catalytic domains and lining RdRp channels, whereas non-identical amino acids were generally located on the molecule's surfaces. Conclusion The ARV λB and MRV λ3 proteins showed the highest ARV:MRV identity values (~55% amongst all currently known ARV and MRV
RNA-DNA sequence differences spell genetic code ambiguities
DEFF Research Database (Denmark)
Bentin, Thomas; Nielsen, Michael L
2013-01-01
A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...
Directory of Open Access Journals (Sweden)
Olga Fernández-Miragall
Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.
Fernández-Miragall, Olga; Hernández, Carmen
2011-01-01
Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.
The imprinted SNRPN gene is associated with a polycistronic mRNA and an imprinting control element
Energy Technology Data Exchange (ETDEWEB)
Saitoh, S.; Nicholls, R.D. [Case Western Reserve Univ., Cleveland, OH (United States); Seip, J. [Pennsylvania State Univ., Hershey, PA (United States)] [and others
1994-09-01
The small nuclear ribonucleoprotein-associated protein SmN (SNRPN) gene is located in the Prader-Willi syndrome (PWS) critical region in chromosome 15q11-q13. We have previously shown that it is functionally imprinted in humans, being only expressed from the paternal allele and differentially methylated on parental alleles. Therefore, SNRPN may have a role in PWS, although genetic studies suggest that at least two genes may be necessary for the classical PWS phenotype. We have characterized the SNRPN genomic structure, and shown that it comprises ten exons. Surprisingly, we identified an open reading frame (ORF) in the first three exons, 190-bp 5{prime} to the SmN ORF. Notably, the majority of base substitutions bewteen human and rodents in the upstream ORF occurred in the wobble position of codons, suggesting selection for a protein coding function. This ORF, which we name SNURF (SNRPN upstream reading frame) encodes a putative polypeptide of 71 amino acids. By analogy to prokaryotic operons that encode proteins with related functions, it is possible that SNURF may have a role in pre-mRNA splicing.
Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y
2018-01-15
Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Directory of Open Access Journals (Sweden)
Masfique Mehedi
Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.
Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz
2013-01-01
Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.
5S rRNA gene arrangements in protists: a case of nonadaptive evolution.
Drouin, Guy; Tsang, Corey
2012-06-01
Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.
Functional characterization of endogenous siRNA target genes in Caenorhabditis elegans
Directory of Open Access Journals (Sweden)
Heikkinen Liisa
2008-06-01
Full Text Available Abstract Background Small interfering RNA (siRNA molecules mediate sequence specific silencing in RNA interference (RNAi, a gene regulatory phenomenon observed in almost all organisms. Large scale sequencing of small RNA libraries obtained from C. elegans has revealed that a broad spectrum of siRNAs is endogenously transcribed from genomic sequences. The biological role and molecular diversity of C. elegans endogenous siRNA (endo-siRNA molecules, nonetheless, remain poorly understood. In order to gain insight into their biological function, we annotated two large libraries of endo-siRNA sequences, identified their cognate targets, and performed gene ontology analysis to identify enriched functional categories. Results Systematic trends in categorization of target genes according to the specific length of siRNA sequences were observed: 18- to 22-mer siRNAs were associated with genes required for embryonic development; 23-mers were associated uniquely with post-embryonic development; 24–26-mers were associated with phosphorus metabolism or protein modification. Moreover, we observe that some argonaute related genes associate with siRNAs with multiple reads. Sequence frequency graphs suggest that different lengths of siRNAs share similarities in overall sequence structure: the 5' end begins with G, while the body predominates with U and C. Conclusion These results suggest that the lengths of endogenous siRNA molecules are consequential to their biological functions since the gene ontology categories for their cognate mRNA targets vary depending upon their lengths.
A Systematic Genetic Screen to Dissect the MicroRNA Pathway in Drosophila.
Pressman, Sigal; Reinke, Catherine A; Wang, Xiaohong; Carthew, Richard W
2012-04-01
A central goal of microRNA biology is to elucidate the genetic program of miRNA function and regulation. However, relatively few of the effectors that execute miRNA repression have been identified. Because such genes may function in many developmental processes, mutations in them are expected to be pleiotropic and thus are discarded in most standard genetic screens. Here, we describe a systematic screen designed to identify all Drosophila genes in ∼40% of the genome that function in the miRNA pathway. To identify potentially pleiotropic genes, the screen analyzed clones of homozygous mutant cells in heterozygous animals. We identified 45 mutations representing 24 genes, and we molecularly characterized 9 genes. These include 4 previously known genes that encode core components of the miRNA pathway, including Drosha, Pasha, Dicer-1, and Ago1. The rest are new genes that function through chromatin remodeling, signaling, and mRNA decapping. The results suggest genetic screens that use clonal analysis can elucidate the miRNA program and that ∼100 genes are required to execute the miRNA program.
Hemmer, O; Greif, C; Dufourcq, P; Reinbolt, J; Fritsch, C
1995-01-10
Translation of tomato black ring virus (TBRV) RNA-1 in a rabbit reticulocyte lysate leads to the synthesis of a 250K polyprotein which cleaves itself into smaller proteins of 50, 60, 120, and 190K. Polypeptides synthesized from synthetic transcripts corresponding to different regions of TBRV RNA-1 are processed only when they encode the 23K protein delimited earlier by sequence homology with the cowpea mosaic virus 24K protease. The proteolytic activity of this protein is completely lost by mutating residues C170 (to I) or L188 (to H), residues which align with conserved residues of the viral serine-like proteases. The 120K protein is generated by cleavage of the dipeptide K/A localized in front of the VPg but is not further cleaved in vitro at the K/S site (at the C terminus of the VPg) or between the protease and polymerase domains. However, both the protein VPgProPol (120K) and the protein ProPol (117K) produced in vitro from synthetic transcripts can cleave in trans the RNA-2-encoded 150K polyprotein, but they cannot cleave in trans polypeptides containing a cleavage site expressed from RNA-1 transcripts in which the protease cistron is absent or modified.
Molecular characterization of rpoB gene encoding the RNA ...
African Journals Online (AJOL)
Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...
Meng, Huimin; Wang, Zhangxun; Wang, Yulong; Zhu, Hong; Huang, Bo
2017-04-01
RNA interference (RNAi) is a gene-silencing mechanism that plays an important role in gene regulation in a number of eukaryotic organisms. Two core components, Dicer and Argonaute, are central in the RNAi machinery. However, the physiological roles of Dicer and Argonaute in the entomopathogenic fungus Metarhizium robertsii have remained unclear. Here, the roles of genes encoding Dicer ( M. robertsii dcl1 [ Mrdcl1 ] and Mrdcl2 ) and Argonaute ( Mrago1 and Mrago2 ) proteins in M. robertsii were investigated. The results showed that the Dicer-like protein MrDCL2 and Argonaute protein MrAGO1 are the major components of the RNAi process occurring in M. robertsii The Dicer and Argonaute genes were not involved in the regulation of growth and diverse abiotic stress response in M. robertsii under the tested conditions. Moreover, our results showed that the Dicer and Argonaute gene mutants demonstrated reduced abilities to produce conidia, compared to the wild type (WT) and the gene-rescued mutant. In particular, the conidial yields in the Δ dcl2 and Δ ago1 mutants were reduced by 55.8% and 59.3%, respectively, compared with those from the control strains. Subsequently, for the WT and Δ dcl2 mutant strains, digital gene expression (DGE) profiling analysis of the stage of mycelium growth and conidiogenesis revealed that modest changes occur in development or metabolism processes, which may explain the reduction in conidiation in the Δ dcl2 mutant. In addition, we further applied high-throughput sequencing technology to identify small RNAs (sRNAs) that are differentially expressed in the WT and the Δ dcl2 mutant and found that 4 known microRNA-like small RNAs (milRNAs) and 8 novel milRNAs were Mrdcl2 dependent in M. robertsii IMPORTANCE The identification and characterization of components in RNAi have contributed significantly to our understanding of the mechanism and functions of RNAi in eukaryotes. Here, we found that Dicer and Argonaute genes play an important role
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor
2015-12-01
In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Computational fitness landscape for all gene-order permutations of an RNA virus.
Directory of Open Access Journals (Sweden)
Kwang-il Lim
2009-02-01
Full Text Available How does the growth of a virus depend on the linear arrangement of genes in its genome? Answering this question may enhance our basic understanding of virus evolution and advance applications of viruses as live attenuated vaccines, gene-therapy vectors, or anti-tumor therapeutics. We used a mathematical model for vesicular stomatitis virus (VSV, a prototype RNA virus that encodes five genes (N-P-M-G-L, to simulate the intracellular growth of all 120 possible gene-order variants. Simulated yields of virus infection varied by 6,000-fold and were found to be most sensitive to gene-order permutations that increased levels of the L gene transcript or reduced levels of the N gene transcript, the lowest and highest expressed genes of the wild-type virus, respectively. Effects of gene order on virus growth also depended upon the host-cell environment, reflecting different resources for protein synthesis and different cell susceptibilities to infection. Moreover, by computationally deleting intergenic attenuations, which define a key mechanism of transcriptional regulation in VSV, the variation in growth associated with the 120 gene-order variants was drastically narrowed from 6,000- to 20-fold, and many variants produced higher progeny yields than wild-type. These results suggest that regulation by intergenic attenuation preceded or co-evolved with the fixation of the wild type gene order in the evolution of VSV. In summary, our models have begun to reveal how gene functions, gene regulation, and genomic organization of viruses interact with their host environments to define processes of viral growth and evolution.
Non-functional genes repaired at the RNA level.
Burger, Gertraud
2016-01-01
Genomes and genes continuously evolve. Gene sequences undergo substitutions, deletions or nucleotide insertions; mobile genetic elements invade genomes and interleave in genes; chromosomes break, even within genes, and pieces reseal in reshuffled order. To maintain functional gene products and assure an organism's survival, two principal strategies are used - either repair of the gene itself or of its product. I will introduce common types of gene aberrations and how gene function is restored secondarily, and then focus on systematically fragmented genes found in a poorly studied protist group, the diplonemids. Expression of their broken genes involves restitching of pieces at the RNA-level, and substantial RNA editing, to compensate for point mutations. I will conclude with thoughts on how such a grotesquely unorthodox system may have evolved, and why this group of organisms persists and thrives since tens of millions of years. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M
2014-01-13
Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The
Directory of Open Access Journals (Sweden)
Thomas C. Roberts
2016-03-01
Full Text Available Duchenne muscular dystrophy (DMD is a pediatric, X-linked, progressive muscle-wasting disorder caused by loss of function mutations affecting the gene encoding the dystrophin protein. While the primary genetic insult in DMD is well described, many details of the molecular and cellular pathologies that follow dystrophin loss are incompletely understood. To investigate gene expression in dystrophic muscle we have applied mRNA and microRNA (miRNA microarray technology to the mdx mouse model of DMD. This study was designed to generate a complete description of gene expression changes associated with dystrophic pathology and the response to an experimental therapy which restores dystrophin protein function. These datasets have enabled (1 the determination of gene expression changes associated with dystrophic pathology, (2 identification of differentially expressed genes that are restored towards wild-type levels after therapeutic dystrophin rescue, (3 investigation of the correlation between mRNA and protein expression (determined by parallel mass spectrometry proteomics analysis, and (4 prediction of pathology associated miRNA-target interactions. Here we describe in detail how the data were generated including the basic analysis as contained in the manuscript published in Human Molecular Genetics with PMID 26385637. The data have been deposited in the Gene Expression Omnibus (GEO with the accession number GSE64420.
Directory of Open Access Journals (Sweden)
Paula Bustamante
2016-06-01
Full Text Available Expression of aminoacyl-tRNA synthetases is regulated by a variety of mechanisms at the level of transcription or translation. A T-box dependent transcription termination / antitermination riboswitch system that responds to charged / uncharged tRNA regulates expression of aminoacyl tRNA synthetase genes in Gram-positive bacteria. TyrZ, the gene encoding tyrosyl-tRNA synthetase from Acidithiobacillus ferrooxidans, a Gram-negative acidophilic bacterium that participates in bioleaching of minerals, resembles the gene from Bacillus subtilis including the 5´-untranslated region encoding the riboswitch. Transcription of A. ferrooxidans tyrZ is induced by the presence of tyrosine by a mechanism involving antitermination of transcription. This mechanism is probably adapted to the low supply of amino acids of acidic environments of autotrophic bioleaching microorganisms. This work is licensed under a Creative Commons Attribution 4.0 International License.
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
Using RNA-Seq Data to Evaluate Reference Genes Suitable for Gene Expression Studies in Soybean.
Directory of Open Access Journals (Sweden)
Aldrin Kay-Yuen Yim
Full Text Available Differential gene expression profiles often provide important clues for gene functions. While reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is an important tool, the validity of the results depends heavily on the choice of proper reference genes. In this study, we employed new and published RNA-sequencing (RNA-Seq datasets (26 sequencing libraries in total to evaluate reference genes reported in previous soybean studies. In silico PCR showed that 13 out of 37 previously reported primer sets have multiple targets, and 4 of them have amplicons with different sizes. Using a probabilistic approach, we identified new and improved candidate reference genes. We further performed 2 validation tests (with 26 RNA samples on 8 commonly used reference genes and 7 newly identified candidates, using RT-qPCR. In general, the new candidate reference genes exhibited more stable expression levels under the tested experimental conditions. The three newly identified candidate reference genes Bic-C2, F-box protein2, and VPS-like gave the best overall performance, together with the commonly used ELF1b. It is expected that the proposed probabilistic model could serve as an important tool to identify stable reference genes when more soybean RNA-Seq data from different growth stages and treatments are used.
Computational prediction of miRNA genes from small RNA sequencing data
Directory of Open Access Journals (Sweden)
Wenjing eKang
2015-01-01
Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.
Complex chloroplast RNA metabolism: just debugging the genetic programme?
Directory of Open Access Journals (Sweden)
Schmitz-Linneweber Christian
2008-08-01
Full Text Available Abstract Background The gene expression system of chloroplasts is far more complex than that of their cyanobacterial progenitor. This gain in complexity affects in particular RNA metabolism, specifically the transcription and maturation of RNA. Mature chloroplast RNA is generated by a plethora of nuclear-encoded proteins acquired or recruited during plant evolution, comprising additional RNA polymerases and sigma factors, and sequence-specific RNA maturation factors promoting RNA splicing, editing, end formation and translatability. Despite years of intensive research, we still lack a comprehensive explanation for this complexity. Results We inspected the available literature and genome databases for information on components of RNA metabolism in land plant chloroplasts. In particular, new inventions of chloroplast-specific mechanisms and the expansion of some gene/protein families detected in land plants lead us to suggest that the primary function of the additional nuclear-encoded components found in chloroplasts is the transgenomic suppression of point mutations, fixation of which occurred due to an enhanced genetic drift exhibited by chloroplast genomes. We further speculate that a fast evolution of transgenomic suppressors occurred after the water-to-land transition of plants. Conclusion Our inspections indicate that several chloroplast-specific mechanisms evolved in land plants to remedy point mutations that occurred after the water-to-land transition. Thus, the complexity of chloroplast gene expression evolved to guarantee the functionality of chloroplast genetic information and may not, with some exceptions, be involved in regulatory functions.
The Spot 42 RNA: A regulatory small RNA with roles in the central metabolism
Bækkedal, Cecilie; Haugen, Peik
2015-01-01
The Spot 42 RNA is a 109 nucleotide long (in Escherichia coli) noncoding small regulatory RNA (sRNA) encoded by the spf (spot fourty-two) gene. spf is found in gamma-proteobacteria and the majority of experimental work on Spot 42 RNA has been performed using E. coli, and recently Aliivibrio salmonicida. In the cell Spot 42 RNA plays essential roles as a regulator in carbohydrate metabolism and uptake, and its expression is activated by glucose, and inhibited by the cAMP-CRP complex. Here we summarize the current knowledge on Spot 42, and present the natural distribution of spf, show family-specific secondary structural features of Spot 42, and link highly conserved structural regions to mRNA target binding. PMID:26327359
The Spot 42 RNA: A regulatory small RNA with roles in the central metabolism.
Bækkedal, Cecilie; Haugen, Peik
2015-01-01
The Spot 42 RNA is a 109 nucleotide long (in Escherichia coli) noncoding small regulatory RNA (sRNA) encoded by the spf (spot fourty-two) gene. spf is found in gamma-proteobacteria and the majority of experimental work on Spot 42 RNA has been performed using E. coli, and recently Aliivibrio salmonicida. In the cell Spot 42 RNA plays essential roles as a regulator in carbohydrate metabolism and uptake, and its expression is activated by glucose, and inhibited by the cAMP-CRP complex. Here we summarize the current knowledge on Spot 42, and present the natural distribution of spf, show family-specific secondary structural features of Spot 42, and link highly conserved structural regions to mRNA target binding.
Brok-Volchanskaya, Vera S; Kadyrov, Farid A; Sivogrivov, Dmitry E; Kolosov, Peter M; Sokolov, Andrey S; Shlyapnikov, Michael G; Kryukov, Valentine M; Granovsky, Igor E
2008-04-01
Homing endonucleases initiate nonreciprocal transfer of DNA segments containing their own genes and the flanking sequences by cleaving the recipient DNA. Bacteriophage T4 segB gene, which is located in a cluster of tRNA genes, encodes a protein of unknown function, homologous to homing endonucleases of the GIY-YIG family. We demonstrate that SegB protein is a site-specific endonuclease, which produces mostly 3' 2-nt protruding ends at its DNA cleavage site. Analysis of SegB cleavage sites suggests that SegB recognizes a 27-bp sequence. It contains 11-bp conserved sequence, which corresponds to a conserved motif of tRNA TpsiC stem-loop, whereas the remainder of the recognition site is rather degenerate. T4-related phages T2L, RB1 and RB3 contain tRNA gene regions that are homologous to that of phage T4 but lack segB gene and several tRNA genes. In co-infections of phages T4 and T2L, segB gene is inherited with nearly 100% of efficiency. The preferred inheritance depends absolutely on the segB gene integrity and is accompanied by the loss of the T2L tRNA gene region markers. We suggest that SegB is a homing endonuclease that functions to ensure spreading of its own gene and the surrounding tRNA genes among T4-related phages.
Daniel, Dianne C; Johnson, Edward M
2018-02-15
The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding
An intronic microRNA silences genes that are functionally antagonistic to its host gene.
Barik, Sailen
2008-09-01
MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.
Howles, Paul A; Gebbie, Leigh K; Collings, David A; Varsani, Arvind; Broad, Ronan C; Ohms, Stephen; Birch, Rosemary J; Cork, Ann H; Arioli, Tony; Williamson, Richard E
2016-05-01
The putative RNA helicase encoded by the Arabidopsis gene At1g32490 is a homolog of the yeast splicing RNA helicases Prp2 and Prp22. We isolated a temperature-sensitive allele (rsw12) of the gene in a screen for root radial swelling mutants. Plants containing this allele grown at the restrictive temperature showed weak radial swelling, were stunted with reduced root elongation, and contained reduced levels of cellulose. The role of the protein was further explored by microarray analysis. By using both fold change cutoffs and a weighted gene coexpression network analysis (WGCNA) to investigate coexpression of genes, we found that the radial swelling phenotype was not linked to genes usually associated with primary cell wall biosynthesis. Instead, the mutation has strong effects on expression of secondary cell wall related genes. Many genes potentially associated with secondary walls were present in the most significant WGCNA module, as were genes coding for arabinogalactans and proteins with GPI anchors. The proportion of up-regulated genes that possess introns in rsw12 was above that expected if splicing was unrelated to the activity of the RNA helicase, suggesting that the helicase does indeed play a role in splicing in Arabidopsis. The phenotype may be due to a change in the expression of one or more genes coding for cell wall proteins.
Regulation of Gene Expression by DNA Methylation and RNA Editing in Animals
DEFF Research Database (Denmark)
Li, Qiye
, there has been growing interest in exploring the modifications occurring at the RNA level, which can impact the fate and function of mRNA. One fascinating type of such modifications is RNA editing, which alters specific nucleotides in transcribed RNA and thus can produce transcripts that are not encoded...... (Heterocephalus glaber), a eusocial mammal living in cooperative colonies. Finally, I introduce a software package that I developed that is specifically designed for the genome-wide identification of RNA-editing sites in animals, with the ultimate aim of promoting the evolutionary and functional study of RNA...... editing in different species....
miRNA-mediated functional changes through co-regulating function related genes.
Directory of Open Access Journals (Sweden)
Jie He
Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.
Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression
Directory of Open Access Journals (Sweden)
Li Guo
2014-01-01
Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.
Directory of Open Access Journals (Sweden)
Unger Elizabeth R
2011-09-01
Full Text Available Abstract Background Blood is a convenient sample and increasingly used for quantitative gene expression measurements with a variety of diseases including chronic fatigue syndrome (CFS. Quantitative gene expression measurements require normalization of target genes to reference genes that are stable and independent from variables being tested in the experiment. Because there are no genes that are useful for all situations, reference gene selection is an essential step to any quantitative reverse transcription-PCR protocol. Many publications have described appropriate genes for a wide variety of tissues and experimental conditions, however, reference genes that may be suitable for the analysis of CFS, or human blood RNA derived from whole blood as well as isolated peripheral blood mononuclear cells (PBMCs, have not been described. Findings Literature review and analyses of our unpublished microarray data were used to narrow down the pool of candidate reference genes to six. We assayed whole blood RNA from Tempus tubes and cell preparation tube (CPT-collected PBMC RNA from 46 subjects, and used the geNorm and NormFinder algorithms to select the most stable reference genes. Phosphoglycerate kinase 1 (PGK1 was one of the optimal normalization genes for both whole blood and PBMC RNA, however, additional genes differed for the two sample types; Ribosomal protein large, P0 (RPLP0 for PBMC RNA and Peptidylprolyl isomerase B (PPIB for whole blood RNA. We also show that the use of a single reference gene is sufficient for normalization when the most stable candidates are used. Conclusions We have identified PGK1 as a stable reference gene for use with whole blood RNA and RNA derived from PBMC. When stable genes are selected it is possible to use a single gene for normalization rather than two or three. Optimal normalization will improve the ability of results from PBMC RNA to be compared with those from whole blood RNA and potentially allows comparison of
Localization of the Norrie disease gene mRNA by in situ hybridization.
Hartzer, M K; Cheng, M; Liu, X; Shastry, B S
1999-07-15
Norrie disease is a rare X-linked recessive neurodevelopmental disorder. The affected males manifest congenital blindness, which is often associated with hearing loss, mental retardation and psychiatric problems. Genetic linkage studies have localized the gene to the short arm of the X-chromosome and the gene has been isolated recently. The encoded protein is a member of the superfamily of growth factors containing a cystine knot motif and may be involved in cell adhesion and neurodevelopment. Molecular genetic analysis revealed a large number of missense, nonsense, deletion, and splice-site mutations among Norrie patients. In order to further determine the role of the Norrie disease gene, we studied the distribution pattern of its mRNA in the retina and in brain by in situ hybridization. The results show abundant hybridization signals in outer nuclear, inner nuclear, and ganglion cell layers of the retina in all three species (mice, rabbit, and human) examined. There was no significant expression in the vitreous body, lens, and rod outer segment. High expression levels were also observed in the cerebellar granular layer, hippocampus, olfactory bulb, cortex, and epithelium of the rabbit brain. These data suggest that the Norrie disease gene could play a critical role in the differentiation or maintenance of the differentiated state of the retina.
Systematic identification of novel, essential host genes affecting bromovirus RNA replication.
Directory of Open Access Journals (Sweden)
Brandi L Gancarz
Full Text Available Positive-strand RNA virus replication involves viral proteins and cellular proteins at nearly every replication step. Brome mosaic virus (BMV is a well-established model for dissecting virus-host interactions and is one of very few viruses whose RNA replication, gene expression and encapsidation have been reproduced in the yeast Saccharomyces cerevisiae. Previously, our laboratory identified ∼100 non-essential host genes whose loss inhibited or enhanced BMV replication at least 3-fold. However, our isolation of additional BMV-modulating host genes by classical genetics and other results underscore that genes essential for cell growth also contribute to BMV RNA replication at a frequency that may be greater than that of non-essential genes. To systematically identify novel, essential host genes affecting BMV RNA replication, we tested a collection of ∼900 yeast strains, each with a single essential gene promoter replaced by a doxycycline-repressible promoter, allowing repression of gene expression by adding doxycycline to the growth medium. Using this strain array of ∼81% of essential yeast genes, we identified 24 essential host genes whose depleted expression reproducibly inhibited or enhanced BMV RNA replication. Relevant host genes are involved in ribosome biosynthesis, cell cycle regulation and protein homeostasis, among other cellular processes. BMV 2a(Pol levels were significantly increased in strains depleted for a heat shock protein (HSF1 or proteasome components (PRE1 and RPT6, suggesting these genes may affect BMV RNA replication by directly or indirectly modulating 2a(Pol localization, post-translational modification or interacting partners. Investigating the diverse functions of these newly identified essential host genes should advance our understanding of BMV-host interactions and normal cellular pathways, and suggest new modes of virus control.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Dysregulation of RNA Mediated Gene Expression in Motor Neuron Diseases.
Gonçalves, Inês do Carmo G; Rehorst, Wiebke A; Kye, Min Jeong
2016-01-01
Recent findings indicate an important role for RNA-mediated gene expression in motor neuron diseases, including ALS (amyotrophic lateral sclerosis) and SMA (spinal muscular atrophy). ALS, also known as Lou Gehrig's disease, is an adult-onset progressive neurodegenerative disorder, whereby SMA or "children's Lou Gehrig's disease" is considered a pediatric neurodevelopmental disorder. Despite the difference in genetic causes, both ALS and SMA share common phenotypes; dysfunction/loss of motor neurons that eventually leads to muscle weakness and atrophy. With advanced techniques in molecular genetics and cell biology, current data suggest that these two distinct motor neuron diseases share more than phenotypes; ALS and SMA have similar cellular pathological mechanisms including mitochondrial dysfunction, oxidative stress and dysregulation in RNA-mediated gene expression. Here, we will discuss the current findings on these two diseases with specific focus on RNA-mediated gene regulation including miRNA expression, pre-mRNA processing and RNA binding proteins.
International Nuclear Information System (INIS)
Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.
1987-01-01
A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene
Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus
International Nuclear Information System (INIS)
Mojumdar, M.
1986-01-01
pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
RNA-seq analysis of overexpressing ovine AANAT gene of melatonin biosynthesis in switchgrass
Directory of Open Access Journals (Sweden)
Shan Yuan
2016-08-01
Full Text Available Melatonin serves important functions in the promotion of growth and anti-stress regulation by efficient radical scavenging and regulation of antioxidant enzyme activity in various plants. To investigate its regulatory roles and metabolism pathways, the transcriptomic profile of overexpressing the ovine arylalkylamine N-acetyltransferase (oAANAT gene, encoding the penultimate enzyme in melatonin biosynthesis, was compared with empty vector (EV control using RNA-seq in switchgrass, a model plant of cellulosic ethanol conversion. The 85.22 million high quality reads that were assembled into 135,684 unigenes were generated by Illumina sequencing for transgenic oAANAT switchgrass with an average sequence length of 716 bp. A total of 946 differential expression genes (DEGs in transgenic line comparing to control switchgrass, including 737 up-regulated and 209 down-regulated genes, were mainly enriched with two main functional patterns of melatonin identifying by gene ontology analysis: the growth regulator and stress tolerance. Furthermore, KEGG maps indicated that the biosynthetic pathways of secondary metabolite (phenylpropanoids, flavonoids, steroids, stilbenoid, diarylheptanoid and gingerol and signaling pathways (MAPK signaling pathway, estrogen signaling pathway were involved in melatonin metabolism. This study substantially expands the transcriptome information for switchgrass and provides valuable clues for identifying candidate genes involved in melatonin biosynthesis and elucidating the mechanism of melatonin metabolism.
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
International Nuclear Information System (INIS)
Mishev, K.; Ananiev, E.; Denev, L.; Radeva, G.
2006-01-01
RNA transcription was studied in intact chloroplasts isolated from cotyledons of Cucurbita pepoL. (zucchini) during their growth and development including natural senescence and rejuvenation. Rejuvenation of cotyledons was studied after decapitation of the epicotyl above the senescing yellow cotyledons. Maximal incorporation of [32P] UTP into overall chloroplast RNA was measured two days after exposure of seedlings to light (day 6 th after the onset of germination), followed by a gradual decrease reaching minimal values at the age of 25-28 days when cotyledons began to yellow and eventually die. Rejuvenation of cotyledons completely restored chloroplast RNA synthesis and fifteen days after decapitation (at the age of 40 days), the values of chloroplast transcription even exceeded that of the maximal transcriptional activity in young cotyledons. Inhibitory analysis with tagetitoxin (a specific inhibitor of plastid encoded chloroplast RNA polymerase (PEP)) showed that in young and rejuvenated cotyledons about 85% of chloroplast RNA polymerase activity was due to PEP and only 15% corresponded to the nuclear encoded plastid RNA polymerase (NEP). Definite regions of two chloroplast encoded genes were amplified by means of PCR technique using specific DNA primers for Rubisco large subunit gene (rbcL) and the housekeeping gene for chloroplast 16S rRNA as well as chloroplast DNA as a template. The appropriate lengths of the amplified DNA fragments were checked by restriction analysis
Directory of Open Access Journals (Sweden)
Gabriel Rinaldi
2008-07-01
Full Text Available The growing availability of sequence information from diverse parasites through genomic and transcriptomic projects offer new opportunities for the identification of key mediators in the parasite-host interaction. Functional genomics approaches and methods for the manipulation of genes are essential tools for deciphering the roles of genes and to identify new intervention targets in parasites. Exciting advances in functional genomics for parasitic helminths are starting to occur, with transgene expression and RNA interference (RNAi reported in several species of nematodes, but the area is still in its infancy in flatworms, with reports in just three species. While advancing in model organisms, there is a need to rapidly extend these technologies to other parasites responsible for several chronic diseases of humans and cattle. In order to extend these approaches to less well studied parasitic worms, we developed a test method for the presence of a viable RNAi pathway by silencing the exogenous reporter gene, firefly luciferase (fLUC. We established the method in the human blood fluke Schistosoma mansoni and then confirmed its utility in the liver fluke Fasciola hepatica. We transformed newly excysted juveniles of F. hepatica by electroporation with mRNA of fLUC and three hours later were able to detect luciferase enzyme activity, concentrated mainly in the digestive ceca. Subsequently, we tested the presence of an active RNAi pathway in F. hepatica by knocking down the exogenous luciferase activity by introduction into the transformed parasites of double-stranded RNA (dsRNA specific for fLUC. In addition, we tested the RNAi pathway targeting an endogenous F. hepatica gene encoding leucine aminopeptidase (FhLAP, and observed a significant reduction in specific mRNA levels. In summary, these studies demonstrated the utility of RNAi targeting reporter fLUC as a reporter gene assay to establish the presence of an intact RNAi pathway in helminth
Di Giulio, Massimo
2008-08-07
An evolutionary analysis is conducted on the permuted tRNA genes of Cyanidioschyzon merolae, in which the 5' half of the tRNA molecule is codified at the 3' end of the gene and its 3' half is codified at the 5' end. This analysis has shown that permuted genes cannot be considered as derived traits but seem to possess characteristics that suggest they are ancestral traits, i.e. they originated when tRNA molecule genes originated for the first time. In particular, if the hypothesis that permuted genes are a derived trait were true, then we should not have been able to observe that the most frequent class of permuted genes is that of the anticodon loop type, for the simple reason that this class would derive by random permutation from a class of non-permuted tRNA genes, which instead is the rarest. This would not explain the high frequency with which permuted tRNA genes with perfectly separate 5' and 3' halves were observed. Clearly the mechanism that produced this class of permuted genes would envisage the existence, in an advanced stage of evolution, of minigenes codifying for the 5' and 3' halves of tRNAs which were assembled in a permuted way at the origin of the tRNA molecule, thus producing a high frequency of permuted genes of the class here referred. Therefore, this evidence supports the hypothesis that the genes of the tRNA molecule were assembled by minigenes codifying for hairpin-like RNA molecules, as suggested by one model for the origin of tRNA [Di Giulio, M., 1992. On the origin of the transfer RNA molecule. J. Theor. Biol. 159, 199-214; Di Giulio, M., 1999. The non-monophyletic origin of tRNA molecule. J. Theor. Biol. 197, 403-414]. Moreover, the late assembly of the permuted genes of C. merolae, as well as their ancestrality, strengthens the hypothesis of the polyphyletic origins of these genes. Finally, on the basis of the uniqueness and the ancestrality of these permuted genes, I suggest that the root of the Eukarya domain is in the super
Lippuner, Christoph; Ramakrishnan, Chandra; Basso, Walter U; Schmid, Marc W; Okoniewski, Michal; Smith, Nicholas C; Hässig, Michael; Deplazes, Peter; Hehl, Adrian B
2018-05-01
Cryptosporidium parvum is a major cause of diarrhoea in humans and animals. There are no vaccines and few drugs available to control C. parvum. In this study, we used RNA-Seq to compare gene expression in sporozoites and intracellular stages of C. parvum to identify genes likely to be important for successful completion of the parasite's life cycle and, thereby, possible targets for drugs or vaccines. We identified 3774 protein-encoding transcripts in C. parvum. Applying a stringent cut-off of eight fold for determination of differential expression, we identified 173 genes (26 coding for predicted secreted proteins) upregulated in sporozoites. On the other hand, expression of 1259 genes was upregulated in intestinal stages (merozoites/gamonts) with a gene ontology enrichment for 63 biological processes and upregulation of 117 genes in 23 metabolic pathways. There was no clear stage specificity of expression of AP2-domain containing transcription factors, although sporozoites had a relatively small repertoire of these important regulators. Our RNA-Seq analysis revealed a new calcium-dependent protein kinase, bringing the total number of known calcium-dependent protein kinases (CDPKs) in C. parvum to 11. One of these, CDPK1, was expressed in all stages, strengthening the notion that it is a valid drug target. By comparing parasites grown in vivo (which produce bona fide thick-walled oocysts) and in vitro (which are arrested in sexual development prior to oocyst generation) we were able to confirm that genes encoding oocyst wall proteins are expressed in gametocytes and that the proteins are stockpiled rather than generated de novo in zygotes. RNA-Seq analysis of C. parvum revealed genes expressed in a stage-specific manner and others whose expression is required at all stages of development. The functional significance of these can now be addressed through recent advances in transgenics for C. parvum, and may lead to the identification of viable drug and vaccine
Van Tendeloo, V F; Ponsaerts, P; Lardon, F; Nijs, G; Lenjou, M; Van Broeckhoven, C; Van Bockstaele, D R; Berneman, Z N
2001-07-01
Designing effective strategies to load human dendritic cells (DCs) with tumor antigens is a challenging approach for DC-based tumor vaccines. Here, a cytoplasmic expression system based on mRNA electroporation to efficiently introduce tumor antigens into DCs is described. Preliminary experiments in K562 cells using an enhanced green fluorescent protein (EGFP) reporter gene revealed that mRNA electroporation as compared with plasmid DNA electroporation showed a markedly improved transfection efficiency (89% versus 40% EGFP(+) cells, respectively) and induced a strikingly lower cell toxicity (15% death rate with mRNA versus 51% with plasmid DNA). Next, mRNA electroporation was applied for nonviral transfection of different types of human DCs, including monocyte-derived DCs (Mo-DCs), CD34(+) progenitor-derived DCs (34-DCs) and Langerhans cells (34-LCs). High-level transgene expression by mRNA electroporation was obtained in more than 50% of all DC types. mRNA-electroporated DCs retained their phenotype and maturational potential. Importantly, DCs electroporated with mRNA-encoding Melan-A strongly activated a Melan-A-specific cytotoxic T lymphocyte (CTL) clone in an HLA-restricted manner and were superior to mRNA-lipofected or -pulsed DCs. Optimal stimulation of the CTL occurred when Mo-DCs underwent maturation following mRNA transfection. Strikingly, a nonspecific stimulation of CTL was observed when DCs were transfected with plasmid DNA. The data clearly demonstrate that Mo-DCs electroporated with mRNA efficiently present functional antigenic peptides to cytotoxic T cells. Therefore, electroporation of mRNA-encoding tumor antigens is a powerful technique to charge human dendritic cells with tumor antigens and could serve applications in future DC-based tumor vaccines.
Directory of Open Access Journals (Sweden)
Hsiao Chiu-Bin
2006-11-01
Full Text Available Abstract Background While viruses have long been shown to capitalize on their limited genomic size by utilizing both strands of DNA or complementary DNA/RNA intermediates to code for viral proteins, it has been assumed that human retroviruses have all their major proteins translated only from the plus or sense strand of RNA, despite their requirement for a dsDNA proviral intermediate. Several studies, however, have suggested the presence of antisense transcription for both HIV-1 and HTLV-1. More recently an antisense transcript responsible for the HTLV-1 bZIP factor (HBZ protein has been described. In this study we investigated the possibility of an antisense gene contained within the human immunodeficiency virus type 1 (HIV-1 long terminal repeat (LTR. Results Inspection of published sequences revealed a potential transcription initiator element (INR situated downstream of, and in reverse orientation to, the usual HIV-1 promoter and transcription start site. This antisense initiator (HIVaINR suggested the possibility of an antisense gene responsible for RNA and protein production. We show that antisense transcripts are generated, in vitro and in vivo, originating from the TAR DNA of the HIV-1 LTR. To test the possibility that protein(s could be translated from this novel HIV-1 antisense RNA, recombinant HIV antisense gene-FLAG vectors were designed. Recombinant protein(s were produced and isolated utilizing carboxy-terminal FLAG epitope (DYKDDDDK sequences. In addition, affinity-purified antisera to an internal peptide derived from the HIV antisense protein (HAP sequences identified HAPs from HIV+ human peripheral blood lymphocytes. Conclusion HIV-1 contains an antisense gene in the U3-R regions of the LTR responsible for both an antisense RNA transcript and proteins. This antisense transcript has tremendous potential for intrinsic RNA regulation because of its overlap with the beginning of all HIV-1 sense RNA transcripts by 25 nucleotides. The
Origin of sphinx, a young chimeric RNA gene in Drosophila melanogaster
Wang, Wen; Brunet, Frédéric G.; Nevo, Eviatar; Long, Manyuan
2002-01-01
Non-protein-coding RNA genes play an important role in various biological processes. How new RNA genes originated and whether this process is controlled by similar evolutionary mechanisms for the origin of protein-coding genes remains unclear. A young chimeric RNA gene that we term sphinx (spx) provides the first insight into the early stage of evolution of RNA genes. spx originated as an insertion of a retroposed sequence of the ATP synthase chain F gene at the cytological region 60DB since the divergence of Drosophila melanogaster from its sibling species 2–3 million years ago. This retrosequence, which is located at 102F on the fourth chromosome, recruited a nearby exon and intron, thereby evolving a chimeric gene structure. This molecular process suggests that the mechanism of exon shuffling, which can generate protein-coding genes, also plays a role in the origin of RNA genes. The subsequent evolutionary process of spx has been associated with a high nucleotide substitution rate, possibly driven by a continuous positive Darwinian selection for a novel function, as is shown in its sex- and development-specific alternative splicing. To test whether spx has adapted to different environments, we investigated its population genetic structure in the unique “Evolution Canyon” in Israel, revealing a similar haplotype structure in spx, and thus similar evolutionary forces operating on spx between environments. PMID:11904380
Directory of Open Access Journals (Sweden)
Violeta Spaniol
Full Text Available BACKGROUND: Moraxella catarrhalis, a major nasopharyngeal pathogen of the human respiratory tract, is exposed to rapid downshifts of environmental temperature when humans breathe cold air. The prevalence of pharyngeal colonization and respiratory tract infections caused by M. catarrhalis is greatest in winter. We investigated how M. catarrhalis uses the physiologic exposure to cold air to regulate pivotal survival systems that may contribute to M. catarrhalis virulence. RESULTS: In this study we used the RNA-seq techniques to quantitatively catalogue the transcriptome of M. catarrhalis exposed to a 26 °C cold shock or to continuous growth at 37 °C. Validation of RNA-seq data using quantitative RT-PCR analysis demonstrated the RNA-seq results to be highly reliable. We observed that a 26 °C cold shock induces the expression of genes that in other bacteria have been related to virulence a strong induction was observed for genes involved in high affinity phosphate transport and iron acquisition, indicating that M. catarrhalis makes a better use of both phosphate and iron resources after exposure to cold shock. We detected the induction of genes involved in nitrogen metabolism, as well as several outer membrane proteins, including ompA, m35-like porin and multidrug efflux pump (acrAB indicating that M. catarrhalis remodels its membrane components in response to downshift of temperature. Furthermore, we demonstrate that a 26 °C cold shock enhances the induction of genes encoding the type IV pili that are essential for natural transformation, and increases the genetic competence of M. catarrhalis, which may facilitate the rapid spread and acquisition of novel virulence-associated genes. CONCLUSION: Cold shock at a physiologically relevant temperature of 26 °C induces in M. catarrhalis a complex of adaptive mechanisms that could convey novel pathogenic functions and may contribute to enhanced colonization and virulence.
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
The European Regulatory Environment of RNA-Based Vaccines.
Hinz, Thomas; Kallen, Kajo; Britten, Cedrik M; Flamion, Bruno; Granzer, Ulrich; Hoos, Axel; Huber, Christoph; Khleif, Samir; Kreiter, Sebastian; Rammensee, Hans-Georg; Sahin, Ugur; Singh-Jasuja, Harpreet; Türeci, Özlem; Kalinke, Ulrich
2017-01-01
A variety of different mRNA-based drugs are currently in development. This became possible, since major breakthroughs in RNA research during the last decades allowed impressive improvements of translation, stability and delivery of mRNA. This article focuses on antigen-encoding RNA-based vaccines that are either directed against tumors or pathogens. mRNA-encoded vaccines are developed both for preventive or therapeutic purposes. Most mRNA-based vaccines are directly administered to patients. Alternatively, primary autologous cells from cancer patients are modified ex vivo by the use of mRNA and then are adoptively transferred to patients. In the EU no regulatory guidelines presently exist that specifically address mRNA-based vaccines. The existing regulatory framework, however, clearly defines that mRNA-based vaccines in most cases have to be centrally approved. Interestingly, depending on whether RNA-based vaccines are directed against tumors or infectious disease, they are formally considered gene therapy products or not, respectively. Besides an overview on the current clinical use of mRNA vaccines in various therapeutic areas a detailed discussion of the current regulatory situation is provided and regulatory perspectives are discussed.
Activation of pluripotency genes in human fibroblast cells by a novel mRNA based approach.
Directory of Open Access Journals (Sweden)
Jordan R Plews
2010-12-01
Full Text Available Several methods have been used to induce somatic cells to re-enter the pluripotent state. Viral transduction of reprogramming genes yields higher efficiency but involves random insertions of viral sequences into the human genome. Although induced pluripotent stem (iPS cells can be obtained with the removable PiggyBac transposon system or an episomal system, both approaches still use DNA constructs so that resulting cell lines need to be thoroughly analyzed to confirm they are free of harmful genetic modification. Thus a method to change cell fate without using DNA will be very useful in regenerative medicine.In this study, we synthesized mRNAs encoding OCT4, SOX2, cMYC, KLF4 and SV40 large T (LT and electroporated them into human fibroblast cells. Upon transfection, fibroblasts expressed these factors at levels comparable to, or higher than those in human embryonic stem (ES cells. Ectopically expressed OCT4 localized to the cell nucleus within 4 hours after mRNA introduction. Transfecting fibroblasts with a mixture of mRNAs encoding all five factors significantly increased the expression of endogenous OCT4, NANOG, DNMT3β, REX1 and SALL4. When such transfected fibroblasts were also exposed to several small molecules (valproic acid, BIX01294 and 5'-aza-2'-deoxycytidine and cultured in human embryonic stem cell (ES medium they formed small aggregates positive for alkaline phosphatase activity and OCT4 protein within 30 days.Our results demonstrate that mRNA transfection can be a useful approach to precisely control the protein expression level and short-term expression of reprogramming factors is sufficient to activate pluripotency genes in differentiated cells.
International Nuclear Information System (INIS)
Nguyen, Kim-Lien; Llano, Manuel; Akari, Hirofumi; Miyagi, Eri; Poeschla, Eric M.; Strebel, Klaus; Bour, Stephan
2004-01-01
Two HIV-1 accessory proteins, Vpu and Vif, are notoriously difficult to express autonomously in the absence of the viral Tat and Rev proteins. We examined whether the codon bias observed in the vpu and vif genes relative to highly expressed human genes contributes to the Rev dependence and low expression level outside the context of the viral genome. The entire vpu gene as well as the 5' half of the vif gene were codon optimized and the resulting open reading frames (ORFs) (vphu and hvif, respectively) were cloned in autonomous expression vectors under the transcriptional control of the CMV promoter. Codon optimization efficiently removed the expression block observed in the native genes and allowed high levels of Rev- and Tat-independent expression of Vpu and Vif. Most of the higher protein levels detected are accounted for by enhanced steady-state levels of the mRNA encoding the optimized species. Nuclear run-on experiments show for the first time that codon optimization has no effect on the rate of transcriptional initiation or elongation of the vphu mRNA. Instead, optimization of the vpu gene was found to stabilize the vphu mRNA in the nucleus and enhance its export to the cytoplasm. This was achieved by allowing the optimized mRNA to use a new CRM1-independent nuclear export pathway. This work provides a better understanding of the molecular mechanisms underlying the process of codon optimization and introduces novel tools to study the biological functions of the Vpu and Vif proteins independently of other viral proteins
Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data.
Zhu, Mingzhu; Dahmen, Jeremy L; Stacey, Gary; Cheng, Jianlin
2013-09-22
High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments.
Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review
Directory of Open Access Journals (Sweden)
Jiangyu Wu
2013-01-01
Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.
Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review
Huang, Weizhe; He, Ziying
2013-01-01
RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498
Wang, Zehua; Yang, Bo; Zhang, Min; Guo, Weiwei; Wu, Zhiyuan; Wang, Yue; Jia, Lin; Li, Song; Caesar-Johnson, Samantha J.; Demchok, John A.; Felau, Ina; Kasapi, Melpomeni; Ferguson, Martin L.; Hutter, Carolyn M.; Sofia, Heidi J.; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean C.; Zhang, Jiashan (Julia); Chudamani, Sudha; Liu, Jia; Lolla, Laxmi; Naresh, Rashi; Pihl, Todd; Sun, Qiang; Wan, Yunhu; Wu, Ye; Cho, Juok; DeFreitas, Timothy; Frazer, Scott; Gehlenborg, Nils; Getz, Gad; Heiman, David I.; Kim, Jaegil; Lawrence, Michael S.; Lin, Pei; Meier, Sam; Noble, Michael S.; Saksena, Gordon; Voet, Doug; Zhang, Hailei; Bernard, Brady; Chambwe, Nyasha; Dhankani, Varsha; Knijnenburg, Theo; Kramer, Roger; Leinonen, Kalle; Liu, Yuexin; Miller, Michael; Reynolds, Sheila; Shmulevich, Ilya; Thorsson, Vesteinn; Zhang, Wei; Akbani, Rehan; Broom, Bradley M.; Hegde, Apurva M.; Ju, Zhenlin; Kanchi, Rupa S.; Korkut, Anil; Li, Jun; Liang, Han; Ling, Shiyun; Liu, Wenbin; Lu, Yiling; Mills, Gordon B.; Ng, Kwok Shing; Rao, Arvind; Ryan, Michael; Wang, Jing; Weinstein, John N.; Zhang, Jiexin; Abeshouse, Adam; Armenia, Joshua; Chakravarty, Debyani; Chatila, Walid K.; Bruijn, Inode; Gao, Jianjiong; Gross, Benjamin E.; Heins, Zachary J.; Kundra, Ritika; La, Konnor; Ladanyi, Marc; Luna, Augustin; Nissan, Moriah G.; Ochoa, Angelica; Phillips, Sarah M.; Reznik, Ed; Sanchez-Vega, Francisco; Sander, Chris; Schultz, Nikolaus; Sheridan, Robert; Sumer, S. Onur; Sun, Yichao; Taylor, Barry S.; Wang, Jioajiao; Zhang, Hongxin; Anur, Pavana; Peto, Myron; Spellman, Paul; Benz, Christopher; Stuart, Joshua M.; Wong, Christopher K.; Yau, Christina; Hayes, D. Neil; Parker, Joel S.; Wilkerson, Matthew D.; Ally, Adrian; Balasundaram, Miruna; Bowlby, Reanne; Brooks, Denise; Carlsen, Rebecca; Chuah, Eric; Dhalla, Noreen; Holt, Robert; Jones, Steven J.M.; Kasaian, Katayoon; Lee, Darlene; Ma, Yussanne; Marra, Marco A.; Mayo, Michael; Moore, Richard A.; Mungall, Andrew J.; Mungall, Karen; Robertson, A. Gordon; Sadeghi, Sara; Schein, Jacqueline E.; Sipahimalani, Payal; Tam, Angela; Thiessen, Nina; Tse, Kane; Wong, Tina; Berger, Ashton C.; Beroukhim, Rameen; Cherniack, Andrew D.; Cibulskis, Carrie; Gabriel, Stacey B.; Gao, Galen F.; Ha, Gavin; Meyerson, Matthew; Schumacher, Steven E.; Shih, Juliann; Kucherlapati, Melanie H.; Kucherlapati, Raju S.; Baylin, Stephen; Cope, Leslie; Danilova, Ludmila; Bootwalla, Moiz S.; Lai, Phillip H.; Maglinte, Dennis T.; Van Den Berg, David J.; Weisenberger, Daniel J.; Auman, J. Todd; Balu, Saianand; Bodenheimer, Tom; Fan, Cheng; Hoadley, Katherine A.; Hoyle, Alan P.; Jefferys, Stuart R.; Jones, Corbin D.; Meng, Shaowu; Mieczkowski, Piotr A.; Mose, Lisle E.; Perou, Amy H.; Perou, Charles M.; Roach, Jeffrey; Shi, Yan; Simons, Janae V.; Skelly, Tara; Soloway, Matthew G.; Tan, Donghui; Veluvolu, Umadevi; Fan, Huihui; Hinoue, Toshinori; Laird, Peter W.; Shen, Hui; Zhou, Wanding; Bellair, Michelle; Chang, Kyle; Covington, Kyle; Creighton, Chad J.; Dinh, Huyen; Doddapaneni, Harsha Vardhan; Donehower, Lawrence A.; Drummond, Jennifer; Gibbs, Richard A.; Glenn, Robert; Hale, Walker; Han, Yi; Hu, Jianhong; Korchina, Viktoriya; Lee, Sandra; Lewis, Lora; Li, Wei; Liu, Xiuping; Morgan, Margaret; Morton, Donna; Muzny, Donna; Santibanez, Jireh; Sheth, Margi; Shinbrot, Eve; Wang, Linghua; Wang, Min; Wheeler, David A.; Xi, Liu; Zhao, Fengmei; Hess, Julian; Appelbaum, Elizabeth L.; Bailey, Matthew; Cordes, Matthew G.; Ding, Li; Fronick, Catrina C.; Fulton, Lucinda A.; Fulton, Robert S.; Kandoth, Cyriac; Mardis, Elaine R.; McLellan, Michael D.; Miller, Christopher A.; Schmidt, Heather K.; Wilson, Richard K.; Crain, Daniel; Curley, Erin; Gardner, Johanna; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph; Penny, Robert; Shelton, Candace; Shelton, Troy; Sherman, Mark; Thompson, Eric; Yena, Peggy; Bowen, Jay; Gastier-Foster, Julie M.; Gerken, Mark; Leraas, Kristen M.; Lichtenberg, Tara M.; Ramirez, Nilsa C.; Wise, Lisa; Zmuda, Erik; Corcoran, Niall; Costello, Tony; Hovens, Christopher; Carvalho, Andre L.; de Carvalho, Ana C.; Fregnani, José H.; Longatto-Filho, Adhemar; Reis, Rui M.; Scapulatempo-Neto, Cristovam; Silveira, Henrique C.S.; Vidal, Daniel O.; Burnette, Andrew; Eschbacher, Jennifer; Hermes, Beth; Noss, Ardene; Singh, Rosy; Anderson, Matthew L.; Castro, Patricia D.; Ittmann, Michael; Huntsman, David; Kohl, Bernard; Le, Xuan; Thorp, Richard; Andry, Chris; Duffy, Elizabeth R.; Lyadov, Vladimir; Paklina, Oxana; Setdikova, Galiya; Shabunin, Alexey; Tavobilov, Mikhail; McPherson, Christopher; Warnick, Ronald; Berkowitz, Ross; Cramer, Daniel; Feltmate, Colleen; Horowitz, Neil; Kibel, Adam; Muto, Michael; Raut, Chandrajit P.; Malykh, Andrei; Barnholtz-Sloan, Jill S.; Barrett, Wendi; Devine, Karen; Fulop, Jordonna; Ostrom, Quinn T.; Shimmel, Kristen; Wolinsky, Yingli; Sloan, Andrew E.; De Rose, Agostino; Giuliante, Felice; Goodman, Marc; Karlan, Beth Y.; Hagedorn, Curt H.; Eckman, John; Harr, Jodi; Myers, Jerome; Tucker, Kelinda; Zach, Leigh Anne; Deyarmin, Brenda; Hu, Hai; Kvecher, Leonid; Larson, Caroline; Mural, Richard J.; Somiari, Stella; Vicha, Ales; Zelinka, Tomas; Bennett, Joseph; Iacocca, Mary; Rabeno, Brenda; Swanson, Patricia; Latour, Mathieu; Lacombe, Louis; Têtu, Bernard; Bergeron, Alain; McGraw, Mary; Staugaitis, Susan M.; Chabot, John; Hibshoosh, Hanina; Sepulveda, Antonia; Su, Tao; Wang, Timothy; Potapova, Olga; Voronina, Olga; Desjardins, Laurence; Mariani, Odette; Roman-Roman, Sergio; Sastre, Xavier; Stern, Marc Henri; Cheng, Feixiong; Signoretti, Sabina; Berchuck, Andrew; Bigner, Darell; Lipp, Eric; Marks, Jeffrey; McCall, Shannon; McLendon, Roger; Secord, Angeles; Sharp, Alexis; Behera, Madhusmita; Brat, Daniel J.; Chen, Amy; Delman, Keith; Force, Seth; Khuri, Fadlo; Magliocca, Kelly; Maithel, Shishir; Olson, Jeffrey J.; Owonikoko, Taofeek; Pickens, Alan; Ramalingam, Suresh; Shin, Dong M.; Sica, Gabriel; Van Meir, Erwin G.; Zhang, Hongzheng; Eijckenboom, Wil; Gillis, Ad; Korpershoek, Esther; Looijenga, Leendert; Oosterhuis, Wolter; Stoop, Hans; van Kessel, Kim E.; Zwarthoff, Ellen C.; Calatozzolo, Chiara; Cuppini, Lucia; Cuzzubbo, Stefania; DiMeco, Francesco; Finocchiaro, Gaetano; Mattei, Luca; Perin, Alessandro; Pollo, Bianca; Chen, Chu; Houck, John; Lohavanichbutr, Pawadee; Hartmann, Arndt; Stoehr, Christine; Stoehr, Robert; Taubert, Helge; Wach, Sven; Wullich, Bernd; Kycler, Witold; Murawa, Dawid; Wiznerowicz, Maciej; Chung, Ki; Edenfield, W. Jeffrey; Martin, Julie; Baudin, Eric; Bubley, Glenn; Bueno, Raphael; De Rienzo, Assunta; Richards, William G.; Kalkanis, Steven; Mikkelsen, Tom; Noushmehr, Houtan; Scarpace, Lisa; Girard, Nicolas; Aymerich, Marta; Campo, Elias; Giné, Eva; Guillermo, Armando López; Van Bang, Nguyen; Hanh, Phan Thi; Phu, Bui Duc; Tang, Yufang; Colman, Howard; Evason, Kimberley; Dottino, Peter R.; Martignetti, John A.; Gabra, Hani; Juhl, Hartmut; Akeredolu, Teniola; Stepa, Serghei; Hoon, Dave; Ahn, Keunsoo; Kang, Koo Jeong; Beuschlein, Felix; Breggia, Anne; Birrer, Michael; Bell, Debra; Borad, Mitesh; Bryce, Alan H.; Castle, Erik; Chandan, Vishal; Cheville, John; Copland, John A.; Farnell, Michael; Flotte, Thomas; Giama, Nasra; Ho, Thai; Kendrick, Michael; Kocher, Jean Pierre; Kopp, Karla; Moser, Catherine; Nagorney, David; O'Brien, Daniel; O'Neill, Brian Patrick; Patel, Tushar; Petersen, Gloria; Que, Florencia; Rivera, Michael; Roberts, Lewis; Smallridge, Robert; Smyrk, Thomas; Stanton, Melissa; Thompson, R. Houston; Torbenson, Michael; Yang, Ju Dong; Zhang, Lizhi; Brimo, Fadi; Ajani, Jaffer A.; Gonzalez, Ana Maria Angulo; Behrens, Carmen; Bondaruk, Jolanta; Broaddus, Russell; Czerniak, Bogdan; Esmaeli, Bita; Fujimoto, Junya; Gershenwald, Jeffrey; Guo, Charles; Lazar, Alexander J.; Logothetis, Christopher; Meric-Bernstam, Funda; Moran, Cesar; Ramondetta, Lois; Rice, David; Sood, Anil; Tamboli, Pheroze; Thompson, Timothy; Troncoso, Patricia; Tsao, Anne; Wistuba, Ignacio; Carter, Candace; Haydu, Lauren; Hersey, Peter; Jakrot, Valerie; Kakavand, Hojabr; Kefford, Richard; Lee, Kenneth; Long, Georgina; Mann, Graham; Quinn, Michael; Saw, Robyn; Scolyer, Richard; Shannon, Kerwin; Spillane, Andrew; Stretch, Jonathan; Synott, Maria; Thompson, John; Wilmott, James; Al-Ahmadie, Hikmat; Chan, Timothy A.; Ghossein, Ronald; Gopalan, Anuradha; Levine, Douglas A.; Reuter, Victor; Singer, Samuel; Singh, Bhuvanesh; Tien, Nguyen Viet; Broudy, Thomas; Mirsaidi, Cyrus; Nair, Praveen; Drwiega, Paul; Miller, Judy; Smith, Jennifer; Zaren, Howard; Park, Joong Won; Hung, Nguyen Phi; Kebebew, Electron; Linehan, W. Marston; Metwalli, Adam R.; Pacak, Karel; Pinto, Peter A.; Schiffman, Mark; Schmidt, Laura S.; Vocke, Cathy D.; Wentzensen, Nicolas; Worrell, Robert; Yang, Hannah; Moncrieff, Marc; Goparaju, Chandra; Melamed, Jonathan; Pass, Harvey; Botnariuc, Natalia; Caraman, Irina; Cernat, Mircea; Chemencedji, Inga; Clipca, Adrian; Doruc, Serghei; Gorincioi, Ghenadie; Mura, Sergiu; Pirtac, Maria; Stancul, Irina; Tcaciuc, Diana; Albert, Monique; Alexopoulou, Iakovina; Arnaout, Angel; Bartlett, John; Engel, Jay; Gilbert, Sebastien; Parfitt, Jeremy; Sekhon, Harman; Thomas, George; Rassl, Doris M.; Rintoul, Robert C.; Bifulco, Carlo; Tamakawa, Raina; Urba, Walter; Hayward, Nicholas; Timmers, Henri; Antenucci, Anna; Facciolo, Francesco; Grazi, Gianluca; Marino, Mirella; Merola, Roberta; de Krijger, Ronald; Gimenez-Roqueplo, Anne Paule; Piché, Alain; Chevalier, Simone; McKercher, Ginette; Birsoy, Kivanc; Barnett, Gene; Brewer, Cathy; Farver, Carol; Naska, Theresa; Pennell, Nathan A.; Raymond, Daniel; Schilero, Cathy; Smolenski, Kathy; Williams, Felicia; Morrison, Carl; Borgia, Jeffrey A.; Liptay, Michael J.; Pool, Mark; Seder, Christopher W.; Junker, Kerstin; Omberg, Larsson; Dinkin, Mikhail; Manikhas, George; Alvaro, Domenico; Bragazzi, Maria Consiglia; Cardinale, Vincenzo; Carpino, Guido; Gaudio, Eugenio; Chesla, David; Cottingham, Sandra; Dubina, Michael; Moiseenko, Fedor; Dhanasekaran, Renumathy; Becker, Karl Friedrich; Janssen, Klaus Peter; Slotta-Huspenina, Julia; Abdel-Rahman, Mohamed H.; Aziz, Dina; Bell, Sue; Cebulla, Colleen M.; Davis, Amy; Duell, Rebecca; Elder, J. Bradley; Hilty, Joe; Kumar, Bahavna; Lang, James; Lehman, Norman L.; Mandt, Randy; Nguyen, Phuong; Pilarski, Robert; Rai, Karan; Schoenfield, Lynn; Senecal, Kelly; Wakely, Paul; Hansen, Paul; Lechan, Ronald; Powers, James; Tischler, Arthur; Grizzle, William E.; Sexton, Katherine C.; Kastl, Alison; Henderson, Joel; Porten, Sima; Waldmann, Jens; Fassnacht, Martin; Asa, Sylvia L.; Schadendorf, Dirk; Couce, Marta; Graefen, Markus; Huland, Hartwig; Sauter, Guido; Schlomm, Thorsten; Simon, Ronald; Tennstedt, Pierre; Olabode, Oluwole; Nelson, Mark; Bathe, Oliver; Carroll, Peter R.; Chan, June M.; Disaia, Philip; Glenn, Pat; Kelley, Robin K.; Landen, Charles N.; Phillips, Joanna; Prados, Michael; Simko, Jeffry; Smith-McCune, Karen; VandenBerg, Scott; Roggin, Kevin; Fehrenbach, Ashley; Kendler, Ady; Sifri, Suzanne; Steele, Ruth; Jimeno, Antonio; Carey, Francis; Forgie, Ian; Mannelli, Massimo; Carney, Michael; Hernandez, Brenda; Campos, Benito; Herold-Mende, Christel; Jungk, Christin; Unterberg, Andreas; von Deimling, Andreas; Bossler, Aaron; Galbraith, Joseph; Jacobus, Laura; Knudson, Michael; Knutson, Tina; Ma, Deqin; Milhem, Mohammed; Sigmund, Rita; Godwin, Andrew K.; Madan, Rashna; Rosenthal, Howard G.; Adebamowo, Clement; Adebamowo, Sally N.; Boussioutas, Alex; Beer, David; Giordano, Thomas; Mes-Masson, Anne Marie; Saad, Fred; Bocklage, Therese; Landrum, Lisa; Mannel, Robert; Moore, Kathleen; Moxley, Katherine; Postier, Russel; Walker, Joan; Zuna, Rosemary; Feldman, Michael; Valdivieso, Federico; Dhir, Rajiv; Luketich, James; Pinero, Edna M.Mora; Quintero-Aguilo, Mario; Carlotti, Carlos Gilberto; Dos Santos, Jose Sebastião; Kemp, Rafael; Sankarankuty, Ajith; Tirapelli, Daniela; Catto, James; Agnew, Kathy; Swisher, Elizabeth; Creaney, Jenette; Robinson, Bruce; Shelley, Carl Simon; Godwin, Eryn M.; Kendall, Sara; Shipman, Cassaundra; Bradford, Carol; Carey, Thomas; Haddad, Andrea; Moyer, Jeffey; Peterson, Lisa; Prince, Mark; Rozek, Laura; Wolf, Gregory; Bowman, Rayleen; Fong, Kwun M.; Yang, Ian; Korst, Robert; Rathmell, W. Kimryn; Fantacone-Campbell, J. Leigh; Hooke, Jeffrey A.; Kovatich, Albert J.; Shriver, Craig D.; DiPersio, John; Drake, Bettina; Govindan, Ramaswamy; Heath, Sharon; Ley, Timothy; Van Tine, Brian; Westervelt, Peter; Rubin, Mark A.; Lee, Jung Il; Aredes, Natália D.; Mariamidze, Armaz; Xie, Wen; Yang, Da
2018-01-01
We characterized the epigenetic landscape of genes encoding long noncoding RNAs (lncRNAs) across 6,475 tumors and 455 cancer cell lines. In stark contrast to the CpG island hypermethylation phenotype in cancer, we observed a recurrent hypomethylation of 1,006 lncRNA genes in cancer, including EPIC1
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
Kodama, Takeko; Takamatsu, Hiromu; Asai, Kei; Kobayashi, Kazuo; Ogasawara, Naotake; Watabe, Kazuhito
1999-01-01
The expression of 21 novel genes located in the region from dnaA to abrB of the Bacillus subtilis chromosome was analyzed. One of the genes, yaaH, had a predicted promoter sequence conserved among SigE-dependent genes. Northern blot analysis revealed that yaaH mRNA was first detected from 2 h after the cessation of logarithmic growth (T2) of sporulation in wild-type cells and in spoIIIG (SigG−) and spoIVCB (SigK−) mutants but not in spoIIAC (SigF−) and spoIIGAB (SigE−) mutants. The transcription start point was determined by primer extension analysis; the −10 and −35 regions are very similar to the consensus sequences recognized by SigE-containing RNA polymerase. A YaaH-His tag fusion encoded by a plasmid with a predicted promoter for the yaaH gene was produced from T2 of sporulation in a B. subtilis transformant and extracted from mature spores, indicating that the yaaH gene product is a spore protein. Inactivation of the yaaH gene by insertion of an erythromycin resistance gene did not affect vegetative growth or spore resistance to heat, chloroform, and lysozyme. The germination of yaaH mutant spores in a mixture of l-asparagine, d-glucose, d-fructose, and potassium chloride was almost the same as that of wild-type spores, but the mutant spores were defective in l-alanine-stimulated germination. These results suggest that yaaH is a novel gene encoding a spore protein produced in the mother cell compartment from T2 of sporulation and that it is required for the l-alanine-stimulated germination pathway. PMID:10419957
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A
1998-06-01
We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.
Directory of Open Access Journals (Sweden)
Yi-Li Li
2017-11-01
Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.
RNA amplification for successful gene profiling analysis
Directory of Open Access Journals (Sweden)
Wang Ena
2005-07-01
Full Text Available Abstract The study of clinical samples is often limited by the amount of material available to study. While proteins cannot be multiplied in their natural form, DNA and RNA can be amplified from small specimens and used for high-throughput analyses. Therefore, genetic studies offer the best opportunity to screen for novel insights of human pathology when little material is available. Precise estimates of DNA copy numbers in a given specimen are necessary. However, most studies investigate static variables such as the genetic background of patients or mutations within pathological specimens without a need to assess proportionality of expression among different genes throughout the genome. Comparative genomic hybridization of DNA samples represents a crude exception to this rule since genomic amplification or deletion is compared among different specimens directly. For gene expression analysis, however, it is critical to accurately estimate the proportional expression of distinct RNA transcripts since such proportions directly govern cell function by modulating protein expression. Furthermore, comparative estimates of relative RNA expression at different time points portray the response of cells to environmental stimuli, indirectly informing about broader biological events affecting a particular tissue in physiological or pathological conditions. This cognitive reaction of cells is similar to the detection of electroencephalographic patterns which inform about the status of the brain in response to external stimuli. As our need to understand human pathophysiology at the global level increases, the development and refinement of technologies for high fidelity messenger RNA amplification have become the focus of increasing interest during the past decade. The need to increase the abundance of RNA has been met not only for gene specific amplification, but, most importantly for global transcriptome wide, unbiased amplification. Now gene
Bakour, Sofiane; Alsharapy, Samer Ahmed; Touati, Abdelaziz; Rolain, Jean-Marc
2014-12-01
The aim of this study was to investigate the molecular support of resistance to carbapenems, aminoglycosides, and fluoroquinolones in Acinetobacter baumannii clinical isolates collected from Yemen hospital. Three A. baumannii were isolated in February 2013 from three patients hospitalized at Al-Thawra University Hospital in Sana'a, Yemen. Antibiotic susceptibility testing was performed using the disk diffusion and E-test methods. Carbapenemase production was carried out by the modified Hodge test (MHT) and imipenem-ethylenediaminetetraacetic acid (EDTA) methods. Carbapenem, aminoglycoside, and fluoroquinolone resistance determinants were studied by polymerase chain reaction and sequencing. The epidemiological relatedness of the three strains was studied using multilocus sequence typing (MLST). The isolates were resistant to almost all antibiotics tested with very high imipenem, amikacin, and ciprofloxacin minimum inhibitory concentrations (>32, >256, and >32 mg/L, respectively). The microbiological tests showed that the three A. baumannii were MHT positive, besides, the activity of β-lactamases was not inhibited by EDTA. All the three isolates contained the naturally occurring bla(OXA-51)-like gene and the bla(OXA-23)-like carbapenemase-encoding gene. The 16S rRNA methylase armA gene was detected in the three isolates. In addition, screening for genes encoding the aminoglycoside-modifying enzymes (AMEs) demonstrated that one isolate contained the acetyltransferase gene aac(6')-Ib. Fluoroquinolone resistance was associated with a single mutation Ser83Leu in the quinolone resistance determining region of the gyrA gene in all isolates. The MLST showed that the sequence type (ST) obtained corresponds to ST2 for the three strains. Here we report the first identification of multidrug-resistant A. baumannii isolates harboring the bla(OXA-23)-like gene, AMEs [aac(6')-Ib], and the 16S rRNA methylase (armA) in the Yemen hospital.
Zhao, Luyang; Gu, Chenglei; Ye, Mingxia; Zhang, Zhe; Li, Li'an; Fan, Wensheng; Meng, Yuanguang
2018-01-22
The etiology and pathophysiology of endometriosis remain unclear. Accumulating evidence suggests that aberrant microRNA (miRNA) and transcription factor (TF) expression may be involved in the pathogenesis and development of endometriosis. This study therefore aims to survey the key miRNAs, TFs and genes and further understand the mechanism of endometriosis. Paired expression profiling of miRNA and mRNA in ectopic endometria compared with eutopic endometria were determined by high-throughput sequencing techniques in eight patients with ovarian endometriosis. Binary interactions and circuits among the miRNAs, TFs, and corresponding genes were identified by the Pearson correlation coefficients. miRNA-TF-gene regulatory networks were constructed using bioinformatic methods. Eleven selected miRNAs and TFs were validated by quantitative reverse transcription-polymerase chain reaction in 22 patients. Overall, 107 differentially expressed miRNAs and 6112 differentially expressed mRNAs were identified by comparing the sequencing of the ectopic endometrium group and the eutopic endometrium group. The miRNA-TF-gene regulatory network consists of 22 miRNAs, 12 TFs and 430 corresponding genes. Specifically, some key regulators from the miR-449 and miR-34b/c cluster, miR-200 family, miR-106a-363 cluster, miR-182/183, FOX family, GATA family, and E2F family as well as CEBPA, SOX9 and HNF4A were suggested to play vital regulatory roles in the pathogenesis of endometriosis. Integration analysis of the miRNA and mRNA expression profiles presents a unique insight into the regulatory network of this enigmatic disorder and possibly provides clues regarding replacement therapy for endometriosis.
Transfection of tumor-infiltrating T cells with mRNA encoding CXCR2
DEFF Research Database (Denmark)
Idorn, Manja; thor Straten, Eivind Per; Svane, Inge Marie
2016-01-01
Adoptive T-cell therapy based on the infusion of patient’s own immune cells after ex vivo culturing is among the most potent forms of personalized treatment among recent clinical developments for the treatment of cancer. However, despite high rates of successful initial clinical responses, only...... infused T cells migrating to the tumor and the clinical response, but also that only a small fraction of adoptively transferred Tcells reach the tumor site. In this chapter, we describe a protocol for transfection of TILs with mRNA encoding the chemokine receptor CXCR2 transiently redirecting...
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
MicroRNA and gene signature of severe cutaneous drug ...
African Journals Online (AJOL)
Purpose: To build a microRNA and gene signature of severe cutaneous adverse drug reactions (SCAR), including Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). Methods: MicroRNA expression profiles were downloaded from miRNA expression profile of patients' skin suffering from TEN using an ...
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes
Directory of Open Access Journals (Sweden)
Milbury Coren A
2010-09-01
Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.
Saidak, Zuzana; Morisse, Mony Chenda; Chatelain, Denis; Sauzay, Chloé; Houessinon, Aline; Guilain, Nelly; Soyez, Marion; Chauffert, Bruno; Dakpé, Stéphanie; Galmiche, Antoine
2018-03-01
The squamous cell carcinoma antigen (SCCA), encoded by the genes SERPINB3/B4, is a tumour marker produced by head and neck squamous cell carcinoma (HNSCC). We aimed to examine SERPINB3/B4 mRNA levels and its clinical significance in the therapeutic context. We retrieved mRNA expression levels, clinical, pathological and genomic data for 520 HNSCC from The Cancer Genome Atlas (TCGA). HNSCC tumours express high levels of SERPINB3/B4 mRNA. SERPINB3 expression differs depending on Human papillomavirus (HPV) infection status, primary tumour location, grade and differentiation, extension to lymph nodes and extracapsular spread. Interestingly, we observed an association between SERPINB3/B4 and the presence of tumour immune infiltrate as well as the expression of the immune checkpoint regulators PD-L1/PD-L2 that depended on HPV status. Our findings point to potential interest of SERPINB3/B4 for the stratification of HNSCC patients in the therapeutic context. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
About miRNAs, miRNA seeds, target genes and target pathways.
Kehl, Tim; Backes, Christina; Kern, Fabian; Fehlmann, Tobias; Ludwig, Nicole; Meese, Eckart; Lenhof, Hans-Peter; Keller, Andreas
2017-12-05
miRNAs are typically repressing gene expression by binding to the 3' UTR, leading to degradation of the mRNA. This process is dominated by the eight-base seed region of the miRNA. Further, miRNAs are known not only to target genes but also to target significant parts of pathways. A logical line of thoughts is: miRNAs with similar (seed) sequence target similar sets of genes and thus similar sets of pathways. By calculating similarity scores for all 3.25 million pairs of 2,550 human miRNAs, we found that this pattern frequently holds, while we also observed exceptions. Respective results were obtained for both, predicted target genes as well as experimentally validated targets. We note that miRNAs target gene set similarity follows a bimodal distribution, pointing at a set of 282 miRNAs that seems to target genes with very high specificity. Further, we discuss miRNAs with different (seed) sequences that nonetheless regulate similar gene sets or pathways. Most intriguingly, we found miRNA pairs that regulate different gene sets but similar pathways such as miR-6886-5p and miR-3529-5p. These are jointly targeting different parts of the MAPK signaling cascade. The main goal of this study is to provide a general overview on the results, to highlight a selection of relevant results on miRNAs, miRNA seeds, target genes and target pathways and to raise awareness for artifacts in respective comparisons. The full set of information that allows to infer detailed results on each miRNA has been included in miRPathDB, the miRNA target pathway database (https://mpd.bioinf.uni-sb.de).
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
RNA Chimeras as a Gene Signature of Breast Cancer
2013-05-01
www.plosone.org 11 August 2012 | Volume 7 | Issue 8 | e41659 Human genes Human ACTB mRNA: >gi|168480144|ref|NM_001101.3| Homo sapiens actin, beta...TCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGAGTGGGTGGAGGCAGCCAGGGCTTACCTGTACACTGACTTGAGACCAGTTGAATAAA AGTGCACACCTTAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Human GAPDH mRNA: >gi|83641890|ref|NM_002046.4| Homo sapiens ...Homo sapiens hypoxanthine phosphoribosyltransferase 1 (HPRT1), mRNA
Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls
Directory of Open Access Journals (Sweden)
Dilla Mareistia Fassah
2018-04-01
Full Text Available Objective This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Methods Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10 and steers (n = 10 of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Results Castration increased the mRNA (3.6 fold; p<0.01 and protein levels (1.4 fold; p< 0.05 of pyruvate carboxylase and mitochondrial phosphoenolpyruvate carboxykinase genes (1.7 fold; p<0.05. Hepatic mRNA levels of genes encoding the glycolysis enzymes were not changed by castration. Castration increased mRNA levels of both lactate dehydrogenase A (1.5 fold; p<0.05 and lactate dehydrogenase B (2.2 fold; p<0.01 genes for lactate utilization. Castration increased mRNA levels of glycerol kinase (2.7 fold; p<0.05 and glycerol-3-phosphate dehydrogenase 1 (1.5 fold; p<0.05 genes for glycerol utilization. Castration also increased mRNA levels of propionyl-CoA carboxylase beta (mitochondrial (3.5 fold; p<0.01 and acyl-CoA synthetase short chain family member 3 (1.3 fold; p = 0.06 genes for propionate incorporation. Conclusion Castration increases transcription levels of critical genes coding for enzymes involved in irreversible gluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular
Dual function of the McaS small RNA in controlling biofilm formation
DEFF Research Database (Denmark)
Jørgensen, Mikkel Girke; Thomason, Maureen K.; Havelund, Johannes
2013-01-01
, and biofilm formation. Moreover, ectopic McaS expression leads to induction of two additional CsrA-repressed genes encoding diguanylate cyclases. Collectively, our study shows that McaS is a dual-function sRNA with roles in the two major post-transcriptional regulons controlled by the RNA-binding proteins Hfq...
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
Directory of Open Access Journals (Sweden)
Lim Chee Liew
Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.
Qi, Lihua; Song, Yangyang; Chan, Tim Hon Man; Yang, Henry; Lin, Chi Ho; Tay, Daryl Jin Tai; Hong, HuiQi; Tang, Sze Jing; Tan, Kar Tong; Huang, Xi Xiao; Lin, Jaymie Siqi; Ng, Vanessa Hui En; Maury, Julien Jean Pierre; Tenen, Daniel G; Chen, Leilei
2017-10-13
Adenosine-to-inosine (A-to-I) RNA editing, catalyzed by Adenosine DeAminases acting on double-stranded RNA(dsRNA) (ADAR), occurs predominantly in the 3' untranslated regions (3'UTRs) of spliced mRNA. Here we uncover an unanticipated link between ADARs (ADAR1 and ADAR2) and the expression of target genes undergoing extensive 3'UTR editing. Using METTL7A (Methyltransferase Like 7A), a novel tumor suppressor gene with multiple editing sites at its 3'UTR, we demonstrate that its expression could be repressed by ADARs beyond their RNA editing and double-stranded RNA (dsRNA) binding functions. ADARs interact with Dicer to augment the processing of pre-miR-27a to mature miR-27a. Consequently, mature miR-27a targets the METTL7A 3'UTR to repress its expression level. In sum, our study unveils that the extensive 3'UTR editing of METTL7A is merely a footprint of ADAR binding, and there are a subset of target genes that are equivalently regulated by ADAR1 and ADAR2 through their non-canonical RNA editing and dsRNA binding-independent functions, albeit maybe less common. The functional significance of ADARs is much more diverse than previously appreciated and this gene regulatory function of ADARs is most likely to be of high biological importance beyond the best-studied editing function. This non-editing side of ADARs opens another door to target cancer. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Anne Louise Askou
Full Text Available Lentivirus-based gene delivery vectors carrying multiple gene cassettes are powerful tools in gene transfer studies and gene therapy, allowing coexpression of multiple therapeutic factors and, if desired, fluorescent reporters. Current strategies to express transgenes and microRNA (miRNA clusters from a single vector have certain limitations that affect transgene expression levels and/or vector titers. In this study, we describe a novel vector design that facilitates combined expression of therapeutic RNA- and protein-based antiangiogenic factors as well as a fluorescent reporter from back-to-back RNApolII-driven expression cassettes. This configuration allows effective production of intron-embedded miRNAs that are released upon transduction of target cells. Exploiting such multigenic lentiviral vectors, we demonstrate robust miRNA-directed downregulation of vascular endothelial growth factor (VEGF expression, leading to reduced angiogenesis, and parallel impairment of angiogenic pathways by codelivering the gene encoding pigment epithelium-derived factor (PEDF. Notably, subretinal injections of lentiviral vectors reveal efficient retinal pigment epithelium-specific gene expression driven by the VMD2 promoter, verifying that multigenic lentiviral vectors can be produced with high titers sufficient for in vivo applications. Altogether, our results suggest the potential applicability of combined miRNA- and protein-encoding lentiviral vectors in antiangiogenic gene therapy, including new combination therapies for amelioration of age-related macular degeneration.
Directory of Open Access Journals (Sweden)
Song Cai
2011-07-01
Full Text Available Abstract Background Siraitia grosvenorii (Luohanguo is an herbaceous perennial plant native to southern China and most prevalent in Guilin city. Its fruit contains a sweet, fleshy, edible pulp that is widely used in traditional Chinese medicine. The major bioactive constituents in the fruit extract are the cucurbitane-type triterpene saponins known as mogrosides. Among them, mogroside V is nearly 300 times sweeter than sucrose. However, little is known about mogrosides biosynthesis in S. grosvenorii, especially the late steps of the pathway. Results In this study, a cDNA library generated from of equal amount of RNA taken from S. grosvenorii fruit at 50 days after flowering (DAF and 70 DAF were sequenced using Illumina/Solexa platform. More than 48,755,516 high-quality reads from a cDNA library were generated that was assembled into 43,891 unigenes. De novo assembly and gap-filling generated 43,891 unigenes with an average sequence length of 668 base pairs. A total of 26,308 (59.9% unique sequences were annotated and 11,476 of the unique sequences were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes. cDNA sequences for all of the known enzymes involved in mogrosides backbone synthesis were identified from our library. Additionally, a total of eighty-five cytochrome P450 (CYP450 and ninety UDP-glucosyltransferase (UDPG unigenes were identified, some of which appear to encode enzymes responsible for the conversion of the mogroside backbone into the various mogrosides. Digital gene expression profile (DGE analysis using Solexa sequencing was performed on three important stages of fruit development, and based on their expression pattern, seven CYP450s and five UDPGs were selected as the candidates most likely to be involved in mogrosides biosynthesis. Conclusion A combination of RNA-seq and DGE analysis based on the next generation sequencing technology was shown to be a powerful method for identifying
The hypoxic proteome is influenced by gene-specific changes in mRNA translation
International Nuclear Information System (INIS)
Koritzinsky, Marianne; Seigneuric, Renaud; Magagnin, Michael G.; Beucken, Twan van den; Lambin, Philippe; Wouters, Bradly G.
2005-01-01
Background and purpose: Hypoxia causes a rapid reduction in mRNA translation efficiency. This inhibition does not affect all mRNA species to the same extent and can therefore contribute significantly to hypoxia-induced differential protein expression. Our aim in this study was to characterize changes in gene expression during acute hypoxia and evaluate the contribution of regulation via mRNA translation on these changes. For each gene, the contribution of changes in mRNA abundance versus mRNA translation was determined. Materials and methods: DU145 prostate carcinoma cells were exposed to 4 h of hypoxia ( 2 ). Efficiently translated mRNAs were isolated by sedimentation through a sucrose gradient. Affymetrix microarray technology was used to evaluate both the transcriptional and translational contribution to gene expression. Results were validated by quantitative PCR. Results: One hundred and twenty genes were more than 4-fold upregulated by hypoxia in the efficiently translated fraction of mRNA, in comparison to only 76 genes at the level of transcription. Of the 50 genes demonstrating the largest changes in translation, 11 were found to be more than 2-fold over represented in the translated fraction in comparison to their overall transcriptional level. The gene with the highest translational contribution to its induction was CITED-2, which is a negative regulator of HIF-1 transcriptional activity. Conclusions: Gene-specific regulation of mRNA translation contributes significantly to differential gene expression during hypoxia
Divergent regulation of Arabidopsis SAUR genes
Mourik, van Hilda; Dijk, van Aalt D.J.; Stortenbeker, Niek; Angenent, Gerco C.; Bemer, Marian
2017-01-01
Background: Small Auxin-Upregulated RNA (SAUR) genes encode growth regulators that induce cell elongation. Arabidopsis contains more than 70 SAUR genes, of which the growth-promoting function has been unveiled in seedlings, while their role in other tissues remained largely unknown. Here, we
International Nuclear Information System (INIS)
Li, G.C.; Li, Ligeng; Liu, Yunkang; Mak, J.Y.; Chen, Lili; Lee, W.M.F.
1991-01-01
The major heat shock protein hsp70 is synthesized by cells of a wide variety of organisms in response to heat shock or other environmental stresses and is assumed to play an important role in protecting cells from thermal stress. The authors have tested this hypothesis directly by transfecting a constitutively expressed recombinant human hsp70-encoding gene into rat fibroblasts and examining the relationship between the levels of human hsp70 expressed and thermal resistance of the stably transfected rat cells. Successful transfection and expression of the gene for human hsp70 were characterized by RNA hybridization analysis, low-dimensional gel electrophoresis, and immunoblot analysis. When individual cloned cell lines were exposed to 45C and their thermal survivals were determined by colony-formation assay, they found that the expression of human hsp70 conferred heat resistance to the rat cells. These results reinforce the hypothesis that hsp70 has a protective function against thermal stress
Evaluation of tools for highly variable gene discovery from single-cell RNA-seq data.
Yip, Shun H; Sham, Pak Chung; Wang, Junwen
2018-02-21
Traditional RNA sequencing (RNA-seq) allows the detection of gene expression variations between two or more cell populations through differentially expressed gene (DEG) analysis. However, genes that contribute to cell-to-cell differences are not discoverable with RNA-seq because RNA-seq samples are obtained from a mixture of cells. Single-cell RNA-seq (scRNA-seq) allows the detection of gene expression in each cell. With scRNA-seq, highly variable gene (HVG) discovery allows the detection of genes that contribute strongly to cell-to-cell variation within a homogeneous cell population, such as a population of embryonic stem cells. This analysis is implemented in many software packages. In this study, we compare seven HVG methods from six software packages, including BASiCS, Brennecke, scLVM, scran, scVEGs and Seurat. Our results demonstrate that reproducibility in HVG analysis requires a larger sample size than DEG analysis. Discrepancies between methods and potential issues in these tools are discussed and recommendations are made.
Post-transcriptional bursting in genes regulated by small RNA molecules
Rodrigo, Guillermo
2018-03-01
Gene expression programs in living cells are highly dynamic due to spatiotemporal molecular signaling and inherent biochemical stochasticity. Here we study a mechanism based on molecule-to-molecule variability at the RNA level for the generation of bursts of protein production, which can lead to heterogeneity in a cell population. We develop a mathematical framework to show numerically and analytically that genes regulated post transcriptionally by small RNA molecules can exhibit such bursts due to different states of translation activity (on or off), mostly revealed in a regime of few molecules. We exploit this framework to compare transcriptional and post-transcriptional bursting and also to illustrate how to tune the resulting protein distribution with additional post-transcriptional regulations. Moreover, because RNA-RNA interactions are predictable with an energy model, we define the kinetic constants of on-off switching as functions of the two characteristic free-energy differences of the system, activation and formation, with a nonequilibrium scheme. Overall, post-transcriptional bursting represents a distinctive principle linking gene regulation to gene expression noise, which highlights the importance of the RNA layer beyond the simple information transfer paradigm and significantly contributes to the understanding of the intracellular processes from a first-principles perspective.
Hox gene regulation in the central nervous system of Drosophila
Directory of Open Access Journals (Sweden)
Maheshwar eGummalla
2014-04-01
Full Text Available Hox genes specify the structures that form along the anteroposterior (AP axis of bilateria. Within the genome, they often form clusters where, remarkably enough, their position within the clusters reflects the relative positions of the structures they specify along the AP axis. This correspondence between genomic organization and gene expression pattern has been conserved through evolution and provides a unique opportunity to study how chromosomal context affects gene regulation. In Drosophila, a general rule, often called posterior dominance, states that Hox genes specifying more posterior structures repress the expression of more anterior Hox genes. This rule explains the apparent spatial complementarity of Hox gene expression patterns in Drosophila. Here we review a noticeable exception to this rule where the more-posteriorly expressed Abd-B hox gene fails to repress the more-anterior abd-A gene in cells of the central nervous system (CNS. While Abd-B is required to repress ectopic expression of abd-A in the posterior epidermis, abd-A repression in the posterior CNS is accomplished by a different mechanism that involves a large 92kb long non-coding RNA (lncRNA encoded by the intergenic region separating abd-A and Abd-B (the iab8ncRNA. Dissection of this lncRNA revealed that abd-A is repressed by the lncRNA using two redundant mechanisms. The 1st mechanism is mediated by a microRNA (mir-iab-8 encoded by intronic sequence within the large iab8-ncRNA. Meanwhile, the second mechanism seems to involve transcriptional interference by the long iab-8 ncRNA on the abd-A promoter. Recent work demonstrating CNS-specific regulation of genes by ncRNAs in Drosophila, seem to highlight a potential role for the iab-8-ncRNA in the evolution of the Drosophila hox complexes
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Identification of putative noncoding RNA genes in the Burkholderia cenocepacia J2315 genome
DEFF Research Database (Denmark)
Coenye, T.; Drevinek, P.; Mahenthiralingam, E.
2007-01-01
Noncoding RNA (ncRNA) genes are not involved in the production of mRNA and proteins, but produce transcripts that function directly as structural or regulatory RNAs. In the present study, the presence of ncRNA genes in the genome of Burkholderia cenocepacia J2315 was evaluated by combining...
Denzler, Rémy; McGeary, Sean E; Title, Alexandra C; Agarwal, Vikram; Bartel, David P; Stoffel, Markus
2016-11-03
Expression changes of competing endogenous RNAs (ceRNAs) have been proposed to influence microRNA (miRNA) activity and thereby regulate other transcripts containing miRNA-binding sites. Here, we find that although miRNA levels define the extent of repression, they have little effect on the magnitude of the ceRNA expression change required to observe derepression. Canonical 6-nt sites, which typically mediate modest repression, can nonetheless compete for miRNA binding, with potency ∼20% of that observed for canonical 8-nt sites. In aggregate, low-affinity/background sites also contribute to competition. Sites with extensive additional complementarity can appear as more potent, but only because they induce miRNA degradation. Cooperative binding of proximal sites for the same or different miRNAs does increase potency. These results provide quantitative insights into the stoichiometric relationship between miRNAs and target abundance, target-site spacing, and affinity requirements for ceRNA-mediated gene regulation, and the unusual circumstances in which ceRNA-mediated gene regulation might be observed. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Zeenia Jagga
Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a
DEFF Research Database (Denmark)
Hermansen, Grith Miriam Maigaard; Sazinas, Pavelas; Kofod, Ditte
2018-01-01
Interspecies interactions between bacterial pathogens and the commensal microbiota can influence disease outcome. In the nasal cavities, Staphylococcus epidermidis has been shown to be a determining factor for Staphylococcus aureus colonization and biofilm formation. However, the interaction...... between S. epidermidis and S. aureus has mainly been described by phenotypic analysis, and little is known about how this interaction modulates gene expression.This study aimed to determine the interactome of nasal S. aureus and S. epidermidis isolates to understand the molecular effect of interaction...... also identified putative non-coding RNAs (ncRNAs) and, interestingly, detected a putative ncRNA transcribed antisense to esp, the serine protease of S. epidermidis, that has previously been shown to inhibit nasal colonization of S. aureus. In our study, the gene encoding Esp and the antisense nc...
Directory of Open Access Journals (Sweden)
Yusuke Ohnishi
Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense
International Nuclear Information System (INIS)
Nakamori, Taizo; Fujimori, Akira; Kinoshita, Keiji; Ban-nai, Tadaaki; Kubota, Yoshihisa; Yoshida, Satoshi
2010-01-01
The gene expression of environmental organisms is useful as a biomarker of environmental pollution. One of its advantages is high sensitivity. We identified the cDNA of a novel cadmium-responsive gene in the soil collembolan Folsomia candida. The deduced protein, designated 'metallothionein-like motif containing protein' (MTC), was cysteine-rich and contained a metallothionein-like motif with similarity to metallothionein, but had a much longer sequence than metallothionein and contained repeated sequences of amino acids. Expression of MTC mRNA was sensitively induced by cadmium exposure at 0.3 mg/kg of dry food, a concentration at which toxic effects are not observed, but expression was not affected by γ-ray exposure (an inducer of oxidative stress). These findings suggest that MTC is involved in cadmium-binding processes rather than in oxidative-stress responses. In conclusion, we suggest that gene expression of MTC may be a candidate biomarker for detecting low levels of cadmium contamination in soil. - The mRNA expression of a gene potentially encoding a metallothionein-like motif containing protein is sensitively induced by cadmium exposure in the soil collembolan Folsomia candida.
Energy Technology Data Exchange (ETDEWEB)
Nakamori, Taizo, E-mail: taizo@ynu.ac.j [Environmental Radiation Effects Research Group, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Fujimori, Akira [Heavy-Ion Radiobiology Research Group, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kinoshita, Keiji [Nagoya University Avian Bioscience Research Centre, Graduate School of Bioagricultural Sciences, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan); Ban-nai, Tadaaki; Kubota, Yoshihisa; Yoshida, Satoshi [Environmental Radiation Effects Research Group, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan)
2010-05-15
The gene expression of environmental organisms is useful as a biomarker of environmental pollution. One of its advantages is high sensitivity. We identified the cDNA of a novel cadmium-responsive gene in the soil collembolan Folsomia candida. The deduced protein, designated 'metallothionein-like motif containing protein' (MTC), was cysteine-rich and contained a metallothionein-like motif with similarity to metallothionein, but had a much longer sequence than metallothionein and contained repeated sequences of amino acids. Expression of MTC mRNA was sensitively induced by cadmium exposure at 0.3 mg/kg of dry food, a concentration at which toxic effects are not observed, but expression was not affected by gamma-ray exposure (an inducer of oxidative stress). These findings suggest that MTC is involved in cadmium-binding processes rather than in oxidative-stress responses. In conclusion, we suggest that gene expression of MTC may be a candidate biomarker for detecting low levels of cadmium contamination in soil. - The mRNA expression of a gene potentially encoding a metallothionein-like motif containing protein is sensitively induced by cadmium exposure in the soil collembolan Folsomia candida.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Directory of Open Access Journals (Sweden)
Sabina Barresi
Full Text Available Oligophrenin-1 (OPHN1 encodes for a Rho-GTPase-activating protein, important for dendritic morphogenesis and synaptic function. Mutations in this gene have been identified in patients with X-linked intellectual disability associated with cerebellar hypoplasia. ADAR enzymes are responsible for A-to-I RNA editing, an essential post-transcriptional RNA modification contributing to transcriptome and proteome diversification. Specifically, ADAR2 activity is essential for brain development and function. Herein, we show that the OPHN1 transcript undergoes post-transcriptional modifications such as A-to-I RNA editing and alternative splicing in human brain and other tissues. We found that OPHN1 editing is detectable already at the 18th week of gestation in human brain with a boost of editing at weeks 20 to 33, concomitantly with OPHN1 expression increase and the appearance of a novel OPHN1 splicing isoform. Our results demonstrate that multiple post-transcriptional events occur on OPHN1, a gene playing an important role in brain function and development.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Xu, W H; Sato, Y; Ikeda, M; Yamashita, O
1995-02-24
Embryonic diapause and sex pheromone biosynthesis in the silkworm, Bombyx mori, are, respectively, induced by diapause hormone (DH) and pheromone biosynthesis activating neuropeptide (PBAN), which are produced in the subesophageal ganglion from a common polyprotein precursor (DH-PBAN precursor) encoded by a single gene (DH-PBAN gene). Using DH-PBAN cDNA as a probe, we quantitatively measured DH-PBAN mRNA content throughout embryonic and postembryonic development and observed the effects of incubation temperature, which is a key factor for determination of diapause, on DH-PBAN gene expression. The silkworm, which is programmed to lay diapause eggs by being incubated at 25 degrees C, showed peaks of DH-PBAN mRNA content at five different stages throughout the life cycle: at the late embryonic stage, at the middle of the fourth and the fifth larval instars, and at early and late stages of pupal-adult development. In the non-diapause type silkworms programmed by a 15 degrees C incubation, only the last peak of DH-PBAN mRNA in pupal-adult development was found, and the other peaks were absent. Furthermore, interruption of the incubation period at 25 degrees C by incubation at 15 degrees C decreased both DH-PBAN mRNA content in mature embryos and in subesophageal ganglia of day 3 pupae and the incidence of diapause eggs. Thus, there were two types of regulatory mechanisms for DH-PBAN gene expression. One is a temperature-controlled expression that is responsible for diapause induction, and the other is a temperature-independent, stage-dependent expression related to pheromone production.
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J
2015-01-01
In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
High throughput 16S rRNA gene amplicon sequencing
DEFF Research Database (Denmark)
Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup
S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...
Evaluating whole transcriptome amplification for gene profiling experiments using RNA-Seq.
Faherty, Sheena L; Campbell, C Ryan; Larsen, Peter A; Yoder, Anne D
2015-07-30
RNA-Seq has enabled high-throughput gene expression profiling to provide insight into the functional link between genotype and phenotype. Low quantities of starting RNA can be a severe hindrance for studies that aim to utilize RNA-Seq. To mitigate this bottleneck, whole transcriptome amplification (WTA) technologies have been developed to generate sufficient sequencing targets from minute amounts of RNA. Successful WTA requires accurate replication of transcript abundance without the loss or distortion of specific mRNAs. Here, we test the efficacy of NuGEN's Ovation RNA-Seq V2 system, which uses linear isothermal amplification with a unique chimeric primer for amplification, using white adipose tissue from standard laboratory rats (Rattus norvegicus). Our goal was to investigate potential biological artifacts introduced through WTA approaches by establishing comparisons between matched raw and amplified RNA libraries derived from biological replicates. We found that 93% of expressed genes were identical between all unamplified versus matched amplified comparisons, also finding that gene density is similar across all comparisons. Our sequencing experiment and downstream bioinformatic analyses using the Tuxedo analysis pipeline resulted in the assembly of 25,543 high-quality transcripts. Libraries constructed from raw RNA and WTA samples averaged 15,298 and 15,253 expressed genes, respectively. Although significant differentially expressed genes (P < 0.05) were identified in all matched samples, each of these represents less than 0.15% of all shared genes for each comparison. Transcriptome amplification is efficient at maintaining relative transcript frequencies with no significant bias when using this NuGEN linear isothermal amplification kit under ideal laboratory conditions as presented in this study. This methodology has broad applications, from clinical and diagnostic, to field-based studies when sample acquisition, or sample preservation, methods prove
Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S
1996-12-01
Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.
Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ.
Mank, Nils N; Berghoff, Bork A; Hermanns, Yannick N; Klug, Gabriele
2012-10-02
The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA.
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Gene expression profiles in BCL11B-siRNA treated malignant T cells
Directory of Open Access Journals (Sweden)
Grabarczyk Piotr
2011-05-01
Full Text Available Abstract Background Downregulation of the B-cell chronic lymphocytic leukemia (CLL/lymphoma11B (BCL11B gene by small interfering RNA (siRNA leads to growth inhibition and apoptosis of the human T-cell acute lymphoblastic leukemia (T-ALL cell line Molt-4. To further characterize the molecular mechanism, a global gene expression profile of BCL11B-siRNA -treated Molt-4 cells was established. The expression profiles of several genes were further validated in the BCL11B-siRNA -treated Molt-4 cells and primary T-ALL cells. Results 142 genes were found to be upregulated and 109 genes downregulated in the BCL11B-siRNA -treated Molt-4 cells by microarray analysis. Among apoptosis-related genes, three pro-apoptotic genes, TNFSF10, BIK, BNIP3, were upregulated and one anti-apoptotic gene, BCL2L1 was downregulated. Moreover, the expression of SPP1 and CREBBP genes involved in the transforming growth factor (TGF-β pathway was down 16-fold. Expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP were also examined by real-time PCR. A similar expression pattern of TNFSF10, BCL2L1, and SPP1 was identified. However, CREBBP was not downregulated in the BLC11B-siRNA -treated Molt-4 cells. Conclusion BCL11B-siRNA treatment altered expression profiles of TNFSF10, BCL2L1, and SPP1 in both Molt-4 T cell line and primary T-ALL cells.
Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes
International Nuclear Information System (INIS)
Zhang, H.; Wang, J.C.; Liu, L.F.
1988-01-01
Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Role of RNase MRP in viral RNA degradation and RNA recombination.
Jaag, Hannah M; Lu, Qiasheng; Schmitt, Mark E; Nagy, Peter D
2011-01-01
RNA degradation, together with RNA synthesis, controls the steady-state level of viral RNAs in infected cells. The endoribonucleolytic cleavage of viral RNA is important not only for viral RNA degradation but for RNA recombination as well, due to the participation of some RNA degradation products in the RNA recombination process. To identify host endoribonucleases involved in degradation of Tomato bushy stunt virus (TBSV) in a Saccharomyces cerevisiae model host, we tested eight known endoribonucleases. Here we report that downregulation of SNM1, encoding a component of the RNase MRP, and a temperature-sensitive mutation in the NME1 gene, coding for the RNA component of RNase MRP, lead to reduced production of the endoribonucleolytically cleaved TBSV RNA in yeast. We also show that the highly purified yeast RNase MRP cleaves the TBSV RNA in vitro, resulting in TBSV RNA degradation products similar in size to those observed in yeast cells. Knocking down the NME1 homolog in Nicotiana benthamiana also led to decreased production of the cleaved TBSV RNA, suggesting that in plants, RNase MRP is involved in TBSV RNA degradation. Altogether, this work suggests a role for the host endoribonuclease RNase MRP in viral RNA degradation and recombination.
Naum-Onganía, Gabriela; Gago-Zachert, Selma; Peña, Eduardo; Grau, Oscar; Garcia, Maria Laura
2003-10-01
Citrus psorosis virus (CPsV), the type member of genus Ophiovirus, has three genomic RNAs. Complete sequencing of CPsV RNA 1 revealed a size of 8184 nucleotides and Northern blot hybridization with chain specific probes showed that its non-coding strand is preferentially encapsidated. The complementary strand of RNA 1 contains two open reading frames (ORFs) separated by a 109-nt intergenic region, one located near the 5'-end potentially encoding a 24K protein of unknown function, and another of 280K containing the core polymerase motifs characteristic of viral RNA-dependent RNA polymerases (RdRp). Comparison of the core RdRp motifs of negative-stranded RNA viruses, supports grouping CPsV, Ranunculus white mottle virus (RWMV) and Mirafiori lettuce virus (MiLV) within the same genus (Ophiovirus), constituting a monophyletic group separated from all other negative-stranded RNA viruses. Furthermore, RNAs 1 of MiLV, CPsV and RWMV are similar in size and those of MiLV and CPsV also in genomic organization and sequence.
Computational prediction and experimental validation of Ciona intestinalis microRNA genes
Directory of Open Access Journals (Sweden)
Pasquinelli Amy E
2007-11-01
Full Text Available Abstract Background This study reports the first collection of validated microRNA genes in the sea squirt, Ciona intestinalis. MicroRNAs are processed from hairpin precursors to ~22 nucleotide RNAs that base pair to target mRNAs and inhibit expression. As a member of the subphylum Urochordata (Tunicata whose larval form has a notochord, the sea squirt is situated at the emergence of vertebrates, and therefore may provide information about the evolution of molecular regulators of early development. Results In this study, computational methods were used to predict 14 microRNA gene families in Ciona intestinalis. The microRNA prediction algorithm utilizes configurable microRNA sequence conservation and stem-loop specificity parameters, grouping by miRNA family, and phylogenetic conservation to the related species, Ciona savignyi. The expression for 8, out of 9 attempted, of the putative microRNAs in the adult tissue of Ciona intestinalis was validated by Northern blot analyses. Additionally, a target prediction algorithm was implemented, which identified a high confidence list of 240 potential target genes. Over half of the predicted targets can be grouped into the gene ontology categories of metabolism, transport, regulation of transcription, and cell signaling. Conclusion The computational techniques implemented in this study can be applied to other organisms and serve to increase the understanding of the origins of non-coding RNAs, embryological and cellular developmental pathways, and the mechanisms for microRNA-controlled gene regulatory networks.
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product
Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham
2015-01-01
Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410
Peng, Hui; Lan, Chaowang; Zheng, Yi; Hutvagner, Gyorgy; Tao, Dacheng; Li, Jinyan
2017-03-24
MicroRNAs always function cooperatively in their regulation of gene expression. Dysfunctions of these co-functional microRNAs can play significant roles in disease development. We are interested in those multi-disease associated co-functional microRNAs that regulate their common dysfunctional target genes cooperatively in the development of multiple diseases. The research is potentially useful for human disease studies at the transcriptional level and for the study of multi-purpose microRNA therapeutics. We designed a computational method to detect multi-disease associated co-functional microRNA pairs and conducted cross disease analysis on a reconstructed disease-gene-microRNA (DGR) tripartite network. The construction of the DGR tripartite network is by the integration of newly predicted disease-microRNA associations with those relationships of diseases, microRNAs and genes maintained by existing databases. The prediction method uses a set of reliable negative samples of disease-microRNA association and a pre-computed kernel matrix instead of kernel functions. From this reconstructed DGR tripartite network, multi-disease associated co-functional microRNA pairs are detected together with their common dysfunctional target genes and ranked by a novel scoring method. We also conducted proof-of-concept case studies on cancer-related co-functional microRNA pairs as well as on non-cancer disease-related microRNA pairs. With the prioritization of the co-functional microRNAs that relate to a series of diseases, we found that the co-function phenomenon is not unusual. We also confirmed that the regulation of the microRNAs for the development of cancers is more complex and have more unique properties than those of non-cancer diseases.
Nerve growth factor mRNA in brain: localization by in situ hybridization
International Nuclear Information System (INIS)
Rennert, P.D.; Heinrich, G.
1986-01-01
Nerve Growth Factor is a 118 amino acid polypeptide that plays an important role in the differentiation and survival of neurons. The recent discovery that a mRNA that encodes beta Nerve Growth Factor is present in brain suggests that the Nerve Growth Factor gene may not only regulate gene expression of peripheral but also of central neurons. To identify the site(s) of Nerve Growth Factor mRNA production in the brain and to determine which cells express the Nerve Growth Factor gene, the technique of in situ hybridization was employed. A 32P-labeled RNA probe complementary to Nerve Growth Factor mRNA hybridized to cells in the stratum granulosum of the dentate gyrus and the stratum pyramidale of the hippocampus. These observations identify for the first time cellular sites of Nerve Growth Factor gene expression in the central nervous system, and suggest that Nerve Growth Factor mRNA is produced by neurons
Directory of Open Access Journals (Sweden)
Gustavo Gómez
Full Text Available Communication between chloroplasts and the nucleus is one of the milestones of the evolution of plants on earth. Proteins encoded by ancestral chloroplast-endogenous genes were transferred to the nucleus during the endosymbiotic evolution and originated this communication, which is mainly dependent on specific transit-peptides. However, the identification of nuclear-encoded proteins targeted to the chloroplast lacking these canonical signals suggests the existence of an alternative cellular pathway tuning this metabolic crosstalk. Non-coding RNAS (NcRNAs are increasingly recognized as regulators of gene expression as they play roles previously believed to correspond to proteins. Avsunviroidae family viroids are the only noncoding functional RNAs that have been reported to traffic inside the chloroplasts. Elucidating mechanisms used by these pathogens to enter this organelle will unearth novel transport pathways in plant cells. Here we show that a viroid-derived NcRNA acting as a 5'UTR-end mediates the functional import of Green Fluorescent Protein (GFP mRNA into chloroplast. This claim is supported by the observation at confocal microscopy of a selective accumulation of GFP in the chloroplast of the leaves expressing the chimeric vd-5'UTR/GFP and by the detection of the GFP mRNA in chloroplasts isolated from cells expressing this construct. These results support the existence of an alternative signaling mechanism in plants between the host cell and chloroplasts, where an ncRNA functions as a key regulatory molecule to control the accumulation of nuclear-encoded proteins in this organelle. In addition, our findings provide a conceptual framework to develop new biotechnological tools in systems using plant chloroplast as bioreactors. Finally, viroids of the family Avsunviroidae have probably evolved to subvert this signaling mechanism to regulate their differential traffic into the chloroplast of infected cells.
Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J
2014-02-13
Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.
Tajaddod, Mansoureh; Tanzer, Andrea; Licht, Konstantin; Wolfinger, Michael T; Badelt, Stefan; Huber, Florian; Pusch, Oliver; Schopoff, Sandy; Janisiw, Michael; Hofacker, Ivo; Jantsch, Michael F
2016-10-25
Short interspersed elements (SINEs) represent the most abundant group of non-long-terminal repeat transposable elements in mammalian genomes. In primates, Alu elements are the most prominent and homogenous representatives of SINEs. Due to their frequent insertion within or close to coding regions, SINEs have been suggested to play a crucial role during genome evolution. Moreover, Alu elements within mRNAs have also been reported to control gene expression at different levels. Here, we undertake a genome-wide analysis of insertion patterns of human Alus within transcribed portions of the genome. Multiple, nearby insertions of SINEs within one transcript are more abundant in tandem orientation than in inverted orientation. Indeed, analysis of transcriptome-wide expression levels of 15 ENCODE cell lines suggests a cis-repressive effect of inverted Alu elements on gene expression. Using reporter assays, we show that the negative effect of inverted SINEs on gene expression is independent of known sensors of double-stranded RNAs. Instead, transcriptional elongation seems impaired, leading to reduced mRNA levels. Our study suggests that there is a bias against multiple SINE insertions that can promote intramolecular base pairing within a transcript. Moreover, at a genome-wide level, mRNAs harboring inverted SINEs are less expressed than mRNAs harboring single or tandemly arranged SINEs. Finally, we demonstrate a novel mechanism by which inverted SINEs can impact on gene expression by interfering with RNA polymerase II.
Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago
2016-12-01
Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Directory of Open Access Journals (Sweden)
Sha Lu
Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
mRNA Transcript Diversity Creates New Opportunities for Pharmacological Intervention
Barrie, Elizabeth S.; Smith, Ryan M.; Sanford, Jonathan C.; Sadee, Wolfgang
2012-01-01
Most protein coding genes generate multiple RNA transcripts through alternative splicing, variable 3′ and 5′UTRs, and RNA editing. Although drug design typically targets the main transcript, alternative transcripts can have profound physiological effects, encoding proteins with distinct functions or regulatory properties. Formation of these alternative transcripts is tissue-selective and context-dependent, creating opportunities for more effective and targeted therapies with reduced adverse e...
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L
2009-11-01
Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance
Rubisco activity and gene expression of tropical tree species under ...
African Journals Online (AJOL)
Young
2013-05-15
May 15, 2013 ... Proteomics analysis associated with gene expression of plants reveal .... Consequently, Rubisco enzyme plays a role in assi- milating into ... technique for examining gene expression encoded at the. mRNA level .... Ammonia.
RNA preparation and characterization for gene expression studies
DEFF Research Database (Denmark)
Stangegaard, Michael
2009-01-01
Much information can be obtained from knowledge of the relative expression level of each gene in the transcriptome. With the current advances in technology as little as a single cell is required as starting material for gene expression experiments. The mRNA from a single cell may be linearly...
Use of tiling array data and RNA secondary structure predictions to identify noncoding RNA genes
DEFF Research Database (Denmark)
Weile, Christian; Gardner, Paul P; Hedegaard, Mads M
2007-01-01
neuroblastoma cell line SK-N-AS. Using this strategy, we identify thousands of human candidate RNA genes. To further verify the expression of these genes, we focused on candidate genes that had a stable hairpin structures or a high level of covariance. Using northern blotting, we verify the expression of 2 out...
Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression
Xiong, Li-Ping; Ma, Yu-Qiang; Tang, Lei-Han
2010-09-01
Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if working solely, only leads to monostability. Within the stochastic framework, the base pairing strength between sRNA and mRNA plays an important role in controlling the transition time between on and off states. The noise strength of protein number in the off state approaches 1 and is smaller than that in the on state. The noise strength also depends on which parameters, the feedback strength or the synthesis rate of small RNA, are tuned in switching the gene expression on and off. Our findings may provide a new insight into gene-regulation mechanism and can be applied in synthetic biology.
Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression
International Nuclear Information System (INIS)
Li-Ping, Xiong; Yu-Qiang, Ma; Lei-Han, Tang
2010-01-01
Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if working solely, only leads to monostability. Within the stochastic framework, the base pairing strength between sRNA and mRNA plays an important role in controlling the transition time between on and off states. The noise strength of protein number in the off state approaches 1 and is smaller than that in the on state. The noise strength also depends on which parameters, the feedback strength or the synthesis rate of small RNA, are tuned in switching the gene expression on and off. Our findings may provide a new insight into gene-regulation mechanism and can be applied in synthetic biology
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
Directory of Open Access Journals (Sweden)
Xinhua eZhang
2015-09-01
Full Text Available Santalum album (sandalwood is one of the economically important plant species in the Santalaceae for its production of highly valued perfume oils. Sandalwood is also a hemiparasitic tree that obtains some of its water and simple nutrients by tapping into other plants through haustoria which are highly specialized organs in parasitic angiosperms. However, an understanding of the molecular mechanisms involved in haustorium development is limited. In this study, RNA sequencing (RNA-seq analyses were performed to identify changes in gene expression and metabolic pathways associated with the development of the S. album haustorium. A total of 56,011 non-redundant contigs with a mean contig size of 618 bp were obtained by de novo assembly of the transcriptome of haustoria and non-haustorial seedling roots. A substantial number of the identified differentially expressed genes were involved in cell wall metabolism and protein metabolism, as well as mitochondrial electron transport functions. Phytohormone-mediated regulation might play an important role during haustorial development. Especially, auxin signaling is likely to be essential for haustorial initiation, and genes related to cytokinin and gibberellin biosynthesis and metabolism are involved in haustorial development. Our results suggest that genes encoding nodulin-like proteins may be important for haustorial morphogenesis in S. album. The obtained sequence data will become a rich resource for future research in this interesting species. This information improves our understanding of haustorium development in root hemiparasitic species and will allow further exploration of the detailed molecular mechanisms underlying plant parasitism.
Analysis of gene expression in normal and neoplastic human testis: new roles of RNA
DEFF Research Database (Denmark)
Novotny, G W; Nielsen, J E; Sonne, Si Brask
2007-01-01
Large-scale methods for analysing gene expression, such as microarrays, have yielded a wealth of information about gene expression at the mRNA level. However, expression of alternative transcripts, together with the presence of a wide range of largely undescribed RNA transcripts combined with reg......Large-scale methods for analysing gene expression, such as microarrays, have yielded a wealth of information about gene expression at the mRNA level. However, expression of alternative transcripts, together with the presence of a wide range of largely undescribed RNA transcripts combined...
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
Ramírez, Manuel; Velázquez, Rocío; Maqueda, Matilde; López-Piñeiro, Antonio; Ribas, Juan C.
2015-01-01
Wine Torulaspora delbrueckii strains producing a new killer toxin (Kbarr-1) were isolated and selected for wine making. They killed all the previously known Saccharomyces cerevisiae killer strains, in addition to other non-Saccharomyces yeasts. The Kbarr-1 phenotype is encoded by a medium-size 1.7 kb dsRNA, TdV-Mbarr-1, which seems to depend on a large-size 4.6 kb dsRNA virus (TdV-LAbarr) for stable maintenance and replication. The TdV-Mbarr-1 dsRNA was sequenced by new generation sequencing techniques. Its genome structure is similar to those of S. cerevisiae killer M dsRNAs, with a 5′-end coding region followed by an internal A-rich sequence and a 3′-end non-coding region. Mbarr-1 RNA positive strand carries cis acting signals at its 5′ and 3′ termini for transcription and replication respectively, similar to those RNAs of yeast killer viruses. The ORF at the 5′ region codes for a putative preprotoxin with an N-terminal secretion signal, potential Kex2p/Kexlp processing sites, and N-glycosylation sites. No relevant sequence identity was found either between the full sequence of Mbarr-1 dsRNA and other yeast M dsRNAs, or between their respective toxin-encoded proteins. However, a relevant identity of TdV-Mbarr-1 RNA regions to the putative replication and packaging signals of most of the M-virus RNAs suggests that they are all evolutionarily related. PMID:26441913
International Nuclear Information System (INIS)
Eki, T.
2004-01-01
Gene function suppression nematodes were produced by systematic RNA interference process (RNAi) of genes which included helicase gene group. Some of high sensitivity genes were identified by the result of function screening for X-ray sensitivity of the function suppression nematode. A complete length of cDNA was separated from the two novel genes, and all the base sequences were determined. It was cleared that one of the novel genes encodes RNA helicases protein which consists of 1,119 amino acids, and the other one encodes chromatin modeling ATPase protein which consists of 3,035 and 3,201 amino acids. Candidacy genes of about 14 pieces for the RNA helicase protein were identified by yeast two-hybrid process as the results of research for nematode protein which showed protein interaction. (M. Suetake)
Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis
2018-01-01
The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.
Prevalence of 16S rRNA methylase genes among β-lactamase ...
African Journals Online (AJOL)
Background: Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and ...
Directory of Open Access Journals (Sweden)
Małgorzata Kapral
2013-01-01
Full Text Available Transforming growth factor β (TGF-β is a multifunctional cytokine recognized as an important regulator of inflammatory responses. The effect of inositol hexaphosphate (IP6, a naturally occurring phytochemical, on the mRNA expression of TGF-β1, TGF-β2, TGF-β3 and TβRI, TβRII, and TβRIII receptors stimulated with bacterial lipopolysaccharides (Escherichia coli and Salmonella typhimurium and IL-1β in intestinal cells Caco-2 for 3 and 12 h was investigated. Real-time qRT-PCR was used to validate mRNAs level of examined genes. Bacterial endotoxin promoted differential expression of TGF-βs and their receptors in a time-dependent manner. IL-1β upregulated mRNA levels of all TGF-βs and receptors at both 3 h and 12 h. IP6 elicited the opposed to LPS effect by increasing downregulated transcription of the examined genes and suppressing the expression of TGF-β1 at 12 h. IP6 counteracted the stimulatory effect of IL-1β on TGF-β1 and receptors expression by decreasing their mRNA levels. IP6 enhanced LPS- and IL-1β-stimulated mRNA expression of TGF-β2 and -β3. Based on these studies it may be concluded that IP6 present in the intestinal milieu may exert immunoregulatory effects and chemopreventive activity on colonic epithelium under inflammatory conditions or during microbe-induced infection/inflammation by modulating the expression of genes encoding TGF-βs and their receptors at transcriptional level.
Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1
Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.
2012-01-01
Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes
Directory of Open Access Journals (Sweden)
Yan Yang
2017-04-01
Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.
Chino-Flores, Concepción; Dantán-González, Edgar; Vázquez-Ramos, Alejandra; Tinoco-Valencia, Raunel; Díaz-Méndez, Rafael; Sánchez-Salinas, Enrique; Castrejón-Godínez, Maria Luisa; Ramos-Quintana, Fernando; Ortiz-Hernández, Maria Laura
2012-06-01
Microbial enzymes that can hydrolyze organophosphorus compounds have been isolated, identified and characterized from different microbial species in order to use them in biodegradation of organophosphorus compounds. We isolated a bacterial strain Cons002 from an agricultural soil bacterial consortium, which can hydrolyze methyl-parathion (MP) and other organophosphate pesticides. HPLC analysis showed that strain Cons002 is capable of degrading pesticides MP, parathion and phorate. Pulsed-field gel electrophoresis and 16S rRNA amplification were performed for strain characterization and identification, respectively, showing that the strain Cons002 is related to the genus Enterobacter sp. which has a single chromosome of 4.6 Mb and has no plasmids. Genomic library was constructed from DNA of Enterobacter sp. Cons002. A gene called opdE (Organophosphate Degradation from Enterobacter) consists of 753 bp and encodes a protein of 25 kDa, which was isolated using activity methods. This gene opdE had no similarity to any genes reported to degrade organophosphates. When kanamycin-resistance cassette was placed in the gene opdE, hydrolase activity was suppressed and Enterobacter sp. Cons002 had no growth with MP as a nutrients source.
Gene Ranking of RNA-Seq Data via Discriminant Non-Negative Matrix Factorization.
Jia, Zhilong; Zhang, Xiang; Guan, Naiyang; Bo, Xiaochen; Barnes, Michael R; Luo, Zhigang
2015-01-01
RNA-sequencing is rapidly becoming the method of choice for studying the full complexity of transcriptomes, however with increasing dimensionality, accurate gene ranking is becoming increasingly challenging. This paper proposes an accurate and sensitive gene ranking method that implements discriminant non-negative matrix factorization (DNMF) for RNA-seq data. To the best of our knowledge, this is the first work to explore the utility of DNMF for gene ranking. When incorporating Fisher's discriminant criteria and setting the reduced dimension as two, DNMF learns two factors to approximate the original gene expression data, abstracting the up-regulated or down-regulated metagene by using the sample label information. The first factor denotes all the genes' weights of two metagenes as the additive combination of all genes, while the second learned factor represents the expression values of two metagenes. In the gene ranking stage, all the genes are ranked as a descending sequence according to the differential values of the metagene weights. Leveraging the nature of NMF and Fisher's criterion, DNMF can robustly boost the gene ranking performance. The Area Under the Curve analysis of differential expression analysis on two benchmarking tests of four RNA-seq data sets with similar phenotypes showed that our proposed DNMF-based gene ranking method outperforms other widely used methods. Moreover, the Gene Set Enrichment Analysis also showed DNMF outweighs others. DNMF is also computationally efficient, substantially outperforming all other benchmarked methods. Consequently, we suggest DNMF is an effective method for the analysis of differential gene expression and gene ranking for RNA-seq data.
A mitochondrial tRNA(His) gene mutation causing pigmentary retinopathy and neurosensorial deafness.
Crimi, M; Galbiati, S; Perini, M P; Bordoni, A; Malferrari, G; Sciacco, M; Biunno, I; Strazzer, S; Moggio, M; Bresolin, N; Comi, G P
2003-04-08
We have identified a heteroplasmic G to A mutation at position 12,183 of the mitochondrial transfer RNA Histidine (tRNA(His)) gene in three related patients. These phenotypes varied according to mutation heteroplasmy: one had severe pigmentary retinopathy, neurosensorial deafness, testicular dysfunction, muscle hypotrophy, and ataxia; the other two had only retinal and inner ear involvement. The mutation is in a highly conserved region of the T(psi)C stem of the tRNA(His) gene and may alter secondary structure formation. This is the first described pathogenic, maternally inherited mutation of the mitochondrial tRNA(His) gene.
Cumbie, Jason S; Kimbrel, Jeffrey A; Di, Yanming; Schafer, Daniel W; Wilhelm, Larry J; Fox, Samuel E; Sullivan, Christopher M; Curzon, Aron D; Carrington, James C; Mockler, Todd C; Chang, Jeff H
2011-01-01
GENE-counter is a complete Perl-based computational pipeline for analyzing RNA-Sequencing (RNA-Seq) data for differential gene expression. In addition to its use in studying transcriptomes of eukaryotic model organisms, GENE-counter is applicable for prokaryotes and non-model organisms without an available genome reference sequence. For alignments, GENE-counter is configured for CASHX, Bowtie, and BWA, but an end user can use any Sequence Alignment/Map (SAM)-compliant program of preference. To analyze data for differential gene expression, GENE-counter can be run with any one of three statistics packages that are based on variations of the negative binomial distribution. The default method is a new and simple statistical test we developed based on an over-parameterized version of the negative binomial distribution. GENE-counter also includes three different methods for assessing differentially expressed features for enriched gene ontology (GO) terms. Results are transparent and data are systematically stored in a MySQL relational database to facilitate additional analyses as well as quality assessment. We used next generation sequencing to generate a small-scale RNA-Seq dataset derived from the heavily studied defense response of Arabidopsis thaliana and used GENE-counter to process the data. Collectively, the support from analysis of microarrays as well as the observed and substantial overlap in results from each of the three statistics packages demonstrates that GENE-counter is well suited for handling the unique characteristics of small sample sizes and high variability in gene counts.
Directory of Open Access Journals (Sweden)
Jason S Cumbie
Full Text Available GENE-counter is a complete Perl-based computational pipeline for analyzing RNA-Sequencing (RNA-Seq data for differential gene expression. In addition to its use in studying transcriptomes of eukaryotic model organisms, GENE-counter is applicable for prokaryotes and non-model organisms without an available genome reference sequence. For alignments, GENE-counter is configured for CASHX, Bowtie, and BWA, but an end user can use any Sequence Alignment/Map (SAM-compliant program of preference. To analyze data for differential gene expression, GENE-counter can be run with any one of three statistics packages that are based on variations of the negative binomial distribution. The default method is a new and simple statistical test we developed based on an over-parameterized version of the negative binomial distribution. GENE-counter also includes three different methods for assessing differentially expressed features for enriched gene ontology (GO terms. Results are transparent and data are systematically stored in a MySQL relational database to facilitate additional analyses as well as quality assessment. We used next generation sequencing to generate a small-scale RNA-Seq dataset derived from the heavily studied defense response of Arabidopsis thaliana and used GENE-counter to process the data. Collectively, the support from analysis of microarrays as well as the observed and substantial overlap in results from each of the three statistics packages demonstrates that GENE-counter is well suited for handling the unique characteristics of small sample sizes and high variability in gene counts.
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.
Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok
2018-03-16
Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.
Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.
2018-01-01
In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717
Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls.
Fassah, Dilla Mareistia; Jeong, Jin Young; Baik, Myunggi
2018-04-01
This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10) and steers (n = 10) of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Castration increased the mRNA (3.6 fold; pcastration. Castration increased mRNA levels of both lactate dehydrogenase A (1.5 fold; pCastration increased mRNA levels of glycerol kinase (2.7 fold; pCastration also increased mRNA levels of propionyl-CoA carboxylase beta (mitochondrial) (3.5 fold; pCastration increases transcription levels of critical genes coding for enzymes involved in irreversible gluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular fat deposition.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Uesaka, Masahiro; Agata, Kiyokazu; Oishi, Takao; Nakashima, Kinichi; Imamura, Takuya
2017-01-01
Background Recent transcriptome analyses have shown that long non-coding RNAs (ncRNAs) play extensive roles in transcriptional regulation. In particular, we have reported that promoter-associated ncRNAs (pancRNAs) activate the partner gene expression via local epigenetic changes. Results Here, we identify thousands of genes under pancRNA-mediated transcriptional activation in five mammalian species in common. In the mouse, 1) pancRNA-partnered genes confined their expression pattern to certai...
A family of related proteins is encoded by the major Drosophila heat shock gene family
International Nuclear Information System (INIS)
Wadsworth, S.C.
1982-01-01
At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
International Nuclear Information System (INIS)
Pallant, A.; Eskenazi, A.; Frelinger, J.G.; Mattei, M.G.; Fournier, R.E.K.; Carlsson, S.R.; Fukuda, M.
1989-01-01
The authors describe the isolation and characterization of cDNA clones encoding human leukosialin, a major sialoglycoprotein of human leukocytes. Leukosialin is very closely related or identical to the sialophorin molecule, which is involved in T-cell proliferation and whose expression is altered in Wiskott-Aldrich syndrome (WAS), an X-chromosome-linked immunodeficiency disease. Using a rabbit antiserum to leukosialin, a cDNA clone was isolated from a λgt11 cDNA library constructed from human peripheral blood cells. The λgt11 clone was used to isolate longer cDNA clones that correspond to the entire coding sequence of leukosialin. DNA sequence analysis reveals three domains in the predicted mature protein. The extracellular domain is enriched for Ser, Thr, and Pro and contains four contiguous 18-amino acid repeats. The transmembrane and intracellular domains of the human leukosialin molecule are highly homologous to the rat W3/13 molecule. RNA gel blot analysis reveals two polyadenylylated species of 2.3 and 8 kilobases. Southern blot analysis suggests that human leukosialin is a single-copy gene. Analysis of monochromosomal cell hybrids indicates that the leukosialin gene is not X chromosome linked and in situ hybridization shows leukosialin is located on chromosome 16. These findings demonstrate that the primary mutation in WAS is not a defect in the structural gene for leukosialin
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Sadakierska-Chudy, Anna; Frankowska, Małgorzata; Jastrzębska, Joanna; Wydra, Karolina; Miszkiel, Joanna; Sanak, Marek; Filip, Małgorzata
2017-07-01
Chronic exposure to cocaine, craving, and relapse are attributed to long-lasting changes in gene expression arising through epigenetic and transcriptional mechanisms. Although several brain regions are involved in these processes, the prefrontal cortex seems to play a crucial role not only in motivation and decision-making but also in extinction and seeking behavior. In this study, we applied cocaine self-administration and extinction training procedures in rats with a yoked triad to determine differentially expressed genes in prefrontal cortex. Microarray analysis showed significant upregulation of several genes encoding histone modification enzymes during early extinction training. Subsequent real-time PCR testing of these genes following cocaine self-administration or early (third day) and late (tenth day) extinction revealed elevated levels of their transcripts. Interestingly, we found the enrichment of Brd1 messenger RNA in rats self-administering cocaine that lasted until extinction training during cocaine withdrawal with concomitant increased acetylation of H3K9 and H4K8. However, despite elevated levels of methyl- and demethyltransferase-encoded transcripts, no changes in global di- and tri-methylation of histone H3 at lysine 4, 9, 27, and 79 were observed. Surprisingly, at the end of extinction training (10 days of cocaine withdrawal), most of the analyzed genes in the rats actively and passively administering cocaine returned to the control level. Together, the alterations identified in the rat prefrontal cortex may suggest enhanced chromatin remodeling and transcriptional activity induced by early cocaine abstinence; however, to know whether they are beneficial or not for the extinction of drug-seeking behavior, further in vivo evaluation is required.
Investigation of the Mitochondrial ATPase 6/8 and tRNA(Lys) Genes Mutations in Autism.
Piryaei, Fahimeh; Houshmand, Massoud; Aryani, Omid; Dadgar, Sepideh; Soheili, Zahra-Soheila
2012-01-01
Autism results from developmental factors that affect many or all functional brain systems. Brain is one of tissues which are crucially in need of adenosine triphosphate (ATP). Autism is noticeably affected by mitochondrial dysfunction which impairs energy metabolism. Considering mutations within ATPase 6, ATPase 8 and tRNA(Lys) genes, associated with different neural diseases, and the main role of ATPase 6/8 in energy generation, we decided to investigate mutations on these mtDNA-encoded genes to reveal their roles in autism pathogenesis. In this experimental study, mutation analysis for the mentioned genes were performed in a cohort of 24 unrelated patients with idiopathic autism by employing amplicon sequencing of mtDNA fragments. In this study, 12 patients (50%) showed point mutations that represent a significant correlation between autism and mtDNA variations. Most of the identified substitutions (55.55%) were observed on MT-ATP6, altering some conserved amino acids to other ones which could potentially affect ATPase 6 function. Mutations causing amino acid replacement denote involvement of mtDNA genes, especially ATPase 6 in autism pathogenesis. MtDNA mutations in relation with autism could be remarkable to realize an understandable mechanism of pathogenesis in order to achieve therapeutic solutions.
miRNA genes of an invasive vector mosquito, Aedes albopictus.
Directory of Open Access Journals (Sweden)
Jinbao Gu
Full Text Available Aedes albopictus, a vector of Dengue and Chikungunya viruses, is a robust invasive species in both tropical and temperate environments. MicroRNAs (miRNAs regulate gene expression and biological processes including embryonic development, innate immunity and infection. While a number of miRNAs have been discovered in some mosquitoes, no comprehensive effort has been made to characterize them from different developmental stages from a single species. Systematic analysis of miRNAs in Ae. albopictus will improve our understanding of its basic biology and inform novel strategies to prevent virus transmission. Between 10-14 million Illumina sequencing reads per sample were obtained from embryos, larvae, pupae, adult males, sugar-fed and blood-fed adult females. A total of 119 miRNA genes represented by 215 miRNA or miRNA star (miRNA* sequences were identified, 15 of which are novel. Eleven, two, and two of the newly-discovered miRNA genes appear specific to Aedes, Culicinae, and Culicidae, respectively. A number of miRNAs accumulate predominantly in one or two developmental stages and the large number that showed differences in abundance following a blood meal likely are important in blood-induced mosquito biology. Gene Ontology (GO analysis of the targets of all Ae. albopictus miRNAs provides a useful starting point for the study of their functions in mosquitoes. This study is the first systematic analysis of miRNAs based on deep-sequencing of small RNA samples of all developmental stages of a mosquito species. A number of miRNAs are related to specific physiological states, most notably, pre- and post-blood feeding. The distribution of lineage-specific miRNAs is consistent with mosquito phylogeny and the presence of a number of Aedes-specific miRNAs likely reflects the divergence between the Aedes and Culex genera.
IQCJ-SCHIP1, a novel fusion transcript encoding a calmodulin-binding IQ motif protein
International Nuclear Information System (INIS)
Kwasnicka-Crawford, Dorota A.; Carson, Andrew R.; Scherer, Stephen W.
2006-01-01
The existence of transcripts that span two adjacent, independent genes is considered rare in the human genome. This study characterizes a novel human fusion gene named IQCJ-SCHIP1. IQCJ-SCHIP1 is the longest isoform of a complex transcriptional unit that bridges two separate genes that encode distinct proteins, IQCJ, a novel IQ motif containing protein and SCHIP1, a schwannomin interacting protein that has been previously shown to interact with the Neurofibromatosis type 2 (NF2) protein. IQCJ-SCHIP1 is located on the chromosome 3q25 and comprises a 1692-bp transcript encompassing 11 exons spanning 828 kb of the genomic DNA. We show that IQCJ-SCHIP1 mRNA is highly expressed in the brain. Protein encoded by the IQCJ-SCHIP1 gene was localized to cytoplasm and actin-rich regions and in differentiated PC12 cells was also seen in neurite extensions
Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao
2011-10-01
Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Directory of Open Access Journals (Sweden)
Herington Adrian C
2008-10-01
Full Text Available Abstract Background The peptide hormone ghrelin has many important physiological and pathophysiological roles, including the stimulation of growth hormone (GH release, appetite regulation, gut motility and proliferation of cancer cells. We previously identified a gene on the opposite strand of the ghrelin gene, ghrelinOS (GHRLOS, which spans the promoter and untranslated regions of the ghrelin gene (GHRL. Here we further characterise GHRLOS. Results We have described GHRLOS mRNA isoforms that extend over 1.4 kb of the promoter region and 106 nucleotides of exon 4 of the ghrelin gene, GHRL. These GHRLOS transcripts initiate 4.8 kb downstream of the terminal exon 4 of GHRL and are present in the 3' untranslated exon of the adjacent gene TATDN2 (TatD DNase domain containing 2. Interestingly, we have also identified a putative non-coding TATDN2-GHRLOS chimaeric transcript, indicating that GHRLOS RNA biogenesis is extremely complex. Moreover, we have discovered that the 3' region of GHRLOS is also antisense, in a tail-to-tail fashion to a novel terminal exon of the neighbouring SEC13 gene, which is important in protein transport. Sequence analyses revealed that GHRLOS is riddled with stop codons, and that there is little nucleotide and amino-acid sequence conservation of the GHRLOS gene between vertebrates. The gene spans 44 kb on 3p25.3, is extensively spliced and harbours multiple variable exons. We have also investigated the expression of GHRLOS and found evidence of differential tissue expression. It is highly expressed in tissues which are emerging as major sites of non-coding RNA expression (the thymus, brain, and testis, as well as in the ovary and uterus. In contrast, very low levels were found in the stomach where sense, GHRL derived RNAs are highly expressed. Conclusion GHRLOS RNA transcripts display several distinctive features of non-coding (ncRNA genes, including 5' capping, polyadenylation, extensive splicing and short open reading
Regression Analysis of Combined Gene Expression Regulation in Acute Myeloid Leukemia
Li, Yue; Liang, Minggao; Zhang, Zhaolei
2014-01-01
Gene expression is a combinatorial function of genetic/epigenetic factors such as copy number variation (CNV), DNA methylation (DM), transcription factors (TF) occupancy, and microRNA (miRNA) post-transcriptional regulation. At the maturity of microarray/sequencing technologies, large amounts of data measuring the genome-wide signals of those factors became available from Encyclopedia of DNA Elements (ENCODE) and The Cancer Genome Atlas (TCGA). However, there is a lack of an integrative model to take full advantage of these rich yet heterogeneous data. To this end, we developed RACER (Regression Analysis of Combined Expression Regulation), which fits the mRNA expression as response using as explanatory variables, the TF data from ENCODE, and CNV, DM, miRNA expression signals from TCGA. Briefly, RACER first infers the sample-specific regulatory activities by TFs and miRNAs, which are then used as inputs to infer specific TF/miRNA-gene interactions. Such a two-stage regression framework circumvents a common difficulty in integrating ENCODE data measured in generic cell-line with the sample-specific TCGA measurements. As a case study, we integrated Acute Myeloid Leukemia (AML) data from TCGA and the related TF binding data measured in K562 from ENCODE. As a proof-of-concept, we first verified our model formalism by 10-fold cross-validation on predicting gene expression. We next evaluated RACER on recovering known regulatory interactions, and demonstrated its superior statistical power over existing methods in detecting known miRNA/TF targets. Additionally, we developed a feature selection procedure, which identified 18 regulators, whose activities clustered consistently with cytogenetic risk groups. One of the selected regulators is miR-548p, whose inferred targets were significantly enriched for leukemia-related pathway, implicating its novel role in AML pathogenesis. Moreover, survival analysis using the inferred activities identified C-Fos as a potential AML
Gene expression analysis of FABP4 in gastric cancer
Directory of Open Access Journals (Sweden)
Abdulkarim Yasin Karim
2016-06-01
Full Text Available Purpose: Gastric cancer has high incidence and mortality rate in several countries and is still one of the most frequent and lethal disease. In this study, we aimed to determine diagnostic markers in gastric cancer by molecular techniques; include mRNA expression analysis of FABP4 gene. Fatty acid binding protein 4 (FABP4 gene encodes the fatty acid binding protein found in adipocytes. The protein encoded by FABP4 are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Material and Methods: Total RNA were extracted from paired tumor and normal tissues of 47 gastric cancer. The mRNA expression level of FABP4 was measured employing semi- quantitative reverse transcription- polymerase chain reaction (RT- PCR. Results: The mRNA expression level of FABP4 was significantly decreased (down- regulated. Conclusion: Down-regulation of FABP4 gene seems to occur at the initial steps of gastric cancer development. In order to confirm the relationship between the gastric tumor and FABP4 gene, further analysis like immunohistochemistry and epigenetc techniques are necessary. [Cukurova Med J 2016; 41(2.000: 248-252
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
BRAKER1: Unsupervised RNA-Seq-Based Genome Annotation with GeneMark-ET and AUGUSTUS.
Hoff, Katharina J; Lange, Simone; Lomsadze, Alexandre; Borodovsky, Mark; Stanke, Mario
2016-03-01
Gene finding in eukaryotic genomes is notoriously difficult to automate. The task is to design a work flow with a minimal set of tools that would reach state-of-the-art performance across a wide range of species. GeneMark-ET is a gene prediction tool that incorporates RNA-Seq data into unsupervised training and subsequently generates ab initio gene predictions. AUGUSTUS is a gene finder that usually requires supervised training and uses information from RNA-Seq reads in the prediction step. Complementary strengths of GeneMark-ET and AUGUSTUS provided motivation for designing a new combined tool for automatic gene prediction. We present BRAKER1, a pipeline for unsupervised RNA-Seq-based genome annotation that combines the advantages of GeneMark-ET and AUGUSTUS. As input, BRAKER1 requires a genome assembly file and a file in bam-format with spliced alignments of RNA-Seq reads to the genome. First, GeneMark-ET performs iterative training and generates initial gene structures. Second, AUGUSTUS uses predicted genes for training and then integrates RNA-Seq read information into final gene predictions. In our experiments, we observed that BRAKER1 was more accurate than MAKER2 when it is using RNA-Seq as sole source for training and prediction. BRAKER1 does not require pre-trained parameters or a separate expert-prepared training step. BRAKER1 is available for download at http://bioinf.uni-greifswald.de/bioinf/braker/ and http://exon.gatech.edu/GeneMark/ katharina.hoff@uni-greifswald.de or borodovsky@gatech.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Hoorig Nassanian
2007-08-01
Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.
Sousa, C; Johansson, C; Charon, C; Manyani, H; Sautter, C; Kondorosi, A; Crespi, M
2001-01-01
A diversity of mRNAs containing only short open reading frames (sORF-RNAs; encoding less than 30 amino acids) have been shown to be induced in growth and differentiation processes. The early nodulin gene enod40, coding for a 0.7-kb sORF-RNA, is expressed in the nodule primordium developing in the root cortex of leguminous plants after infection by symbiotic bacteria. Ballistic microtargeting of this gene into Medicago roots induced division of cortical cells. Translation of two sORFs (I and II, 13 and 27 amino acids, respectively) present in the conserved 5' and 3' regions of enod40 was required for this biological activity. These sORFs may be translated in roots via a reinitiation mechanism. In vitro translation products starting from the ATG of sORF I were detectable by mutating enod40 to yield peptides larger than 38 amino acids. Deletion of a Medicago truncatula enod40 region between the sORFs, spanning a predicted RNA structure, did not affect their translation but resulted in significantly decreased biological activity. Our data reveal a complex regulation of enod40 action, pointing to a role of sORF-encoded peptides and structured RNA signals in developmental processes involving sORF-RNAs.
The Persistent Contributions of RNA to Eukaryotic Gen(om)e Architecture and Cellular Function
Brosius, Jürgen
2014-01-01
Currently, the best scenario for earliest forms of life is based on RNA molecules as they have the proven ability to catalyze enzymatic reactions and harbor genetic information. Evolutionary principles valid today become apparent in such models already. Furthermore, many features of eukaryotic genome architecture might have their origins in an RNA or RNA/protein (RNP) world, including the onset of a further transition, when DNA replaced RNA as the genetic bookkeeper of the cell. Chromosome maintenance, splicing, and regulatory function via RNA may be deeply rooted in the RNA/RNP worlds. Mostly in eukaryotes, conversion from RNA to DNA is still ongoing, which greatly impacts the plasticity of extant genomes. Raw material for novel genes encoding protein or RNA, or parts of genes including regulatory elements that selection can act on, continues to enter the evolutionary lottery. PMID:25081515
YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407
DEFF Research Database (Denmark)
Andersen, Niels Møller; Douthwaite, Stephen
2006-01-01
generally require specific enzymes, and only one m5C rRNA methyltransferase, RsmB (formerly Fmu) that methylates nucleotide C967, has previously been identified. BLAST searches of the E.coli genome revealed a single gene, yebU, with sufficient similarity to rsmB to encode a putative m5C RNA...... methyltransferase. This suggested that the yebU gene product modifies C1407 and/or C1962. Here, we analysed the E.coli rRNAs by matrix assisted laser desorption/ionization mass spectrometry and show that inactivation of the yebU gene leads to loss of methylation at C1407 in 16 S rRNA, but does not interfere...
The miR-10 microRNA precursor family
DEFF Research Database (Denmark)
Tehler, Disa; Høyland-Kroghsbo, Nina Molin; Lund, Anders H
2011-01-01
The miR-10 microRNA precursor family encodes a group of short non-coding RNAs involved in gene regulation. The miR-10 family is highly conserved and has sparked the interest of many research groups because of the genomic localization in the vicinity of, coexpression with and regulation of the Hox...... gene developmental regulators. Here, we review the current knowledge of the evolution, physiological function and involvement in cancer of this family of microRNAs....
DEFF Research Database (Denmark)
Vester, Birte; Garrett, Roger Antony
1988-01-01
in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...
Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon
2010-01-01
Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.
Directory of Open Access Journals (Sweden)
Georgina L Ryland
Full Text Available MicroRNAs are key regulators of gene expression and have been shown to have altered expression in a variety of cancer types, including epithelial ovarian cancer. MiRNA function is most often achieved through binding to the 3'-untranslated region of the target protein coding gene. Mutation screening using massively-parallel sequencing of 712 miRNA genes in 86 ovarian cancer cases identified only 5 mutated miRNA genes, each in a different case. One mutation was located in the mature miRNA, and three mutations were predicted to alter the secondary structure of the miRNA transcript. Screening of the 3'-untranslated region of 18 candidate cancer genes identified one mutation in each of AKT2, EGFR, ERRB2 and CTNNB1. The functional effect of these mutations is unclear, as expression data available for AKT2 and EGFR showed no increase in gene transcript. Mutations in miRNA genes and 3'-untranslated regions are thus uncommon in ovarian cancer.
A small RNA activates CFA synthase by isoform-specific mRNA stabilization.
Fröhlich, Kathrin Sophie; Papenfort, Kai; Fekete, Agnes; Vogel, Jörg
2013-11-13
Small RNAs use a diversity of well-characterized mechanisms to repress mRNAs, but how they activate gene expression at the mRNA level remains not well understood. The predominant activation mechanism of Hfq-associated small RNAs has been translational control whereby base pairing with the target prevents the formation of an intrinsic inhibitory structure in the mRNA and promotes translation initiation. Here, we report a translation-independent mechanism whereby the small RNA RydC selectively activates the longer of two isoforms of cfa mRNA (encoding cyclopropane fatty acid synthase) in Salmonella enterica. Target activation is achieved through seed pairing of the pseudoknot-exposed, conserved 5' end of RydC to an upstream region of the cfa mRNA. The seed pairing stabilizes the messenger, likely by interfering directly with RNase E-mediated decay in the 5' untranslated region. Intriguingly, this mechanism is generic such that the activation is equally achieved by seed pairing of unrelated small RNAs, suggesting that this mechanism may be utilized in the design of RNA-controlled synthetic circuits. Physiologically, RydC is the first small RNA known to regulate membrane stability.
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.
Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.
How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?
International Nuclear Information System (INIS)
Pelczar, P.; Fiett, J.; Bartnik, E.
1994-01-01
We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig
Lee, Kwanuk; Lee, Hwa Jung; Kim, Dong Hyun; Jeon, Young; Pai, Hyun-Sook; Kang, Hunseung
2014-04-16
Although several chloroplast RNA splicing and ribosome maturation (CRM) domain-containing proteins have been characterized for intron splicing and rRNA processing during chloroplast gene expression, the functional role of a majority of CRM domain proteins in plant growth and development as well as chloroplast RNA metabolism remains largely unknown. Here, we characterized the developmental and stress response roles of a nuclear-encoded chloroplast protein harboring a single CRM domain (At4g39040), designated CFM4, in Arabidopsis thaliana. Analysis of CFM4-GFP fusion proteins revealed that CFM4 is localized to chloroplasts. The loss-of-function T-DNA insertion mutants for CFM4 (cfm4) displayed retarded growth and delayed senescence, suggesting that CFM4 plays a role in growth and development of plants under normal growth conditions. In addition, cfm4 mutants showed retarded seed germination and seedling growth under stress conditions. No alteration in the splicing patterns of intron-containing chloroplast genes was observed in the mutant plants, but the processing of 16S and 4.5S rRNAs was abnormal in the mutant plants. Importantly, CFM4 was determined to possess RNA chaperone activity. These results suggest that the chloroplast-targeted CFM4, one of two Arabidopsis genes encoding a single CRM domain-containing protein, harbors RNA chaperone activity and plays a role in the Arabidopsis growth and stress response by affecting rRNA processing in chloroplasts.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Directory of Open Access Journals (Sweden)
Kira C. M. Neller
2018-05-01
Full Text Available The American pokeweed plant, Phytolacca americana, displays broad-spectrum resistance to plant viruses and is a heavy metal hyperaccumulator. However, little is known about the regulation of biotic and abiotic stress responses in this non-model plant. To investigate the control of miRNAs in gene expression, we sequenced the small RNA transcriptome of pokeweed treated with jasmonic acid (JA, a hormone that mediates pathogen defense and stress tolerance. We predicted 145 miRNAs responsive to JA, most of which were unique to pokeweed. These miRNAs were low in abundance and condition-specific, with discrete expression change. Integration of paired mRNA-Seq expression data enabled us to identify correlated, novel JA-responsive targets that mediate hormone biosynthesis, signal transduction, and pathogen defense. The expression of approximately half the pairs was positively correlated, an uncommon finding that we functionally validated by mRNA cleavage. Importantly, we report that a pokeweed-specific miRNA targets the transcript of OPR3, novel evidence that a miRNA regulates a JA biosynthesis enzyme. This first large-scale small RNA study of a Phytolaccaceae family member shows that miRNA-mediated control is a significant component of the JA response, associated with widespread changes in expression of genes required for stress adaptation.
International Nuclear Information System (INIS)
Wilson, M.S.; Bakermans, C.; Madsen, E.L.
1999-01-01
The authors developed procedures for isolating and characterizing in situ-transcribed mRNA from groundwater microorganisms catabolizing naphthalene at a coal tar waste-contaminated site. Groundwater was pumped through 0.22-microm-pore-size filters, which were then frozen to dry ice-ethanol. RNA was extracted from the frozen filters by boiling sodium dodecyl sulfate lysis and acidic phenol-chloroform extraction. Transcript characterization was performed with a series of PCR primers designed to amplify nahAc homologs. Several primer pairs were found to amplify nahAc homologs representing the entire diversity of the naphthalene-degrading genes. The environmental RNA extract was reverse transcribed, and the resultant mixture of cDNAs was amplified by PCR. A digoxigenin-labeled probe mixture was produced by PCR amplification of groundwater cDNA. This probe mixture hybridized under stringent conditions with the corresponding PCR products from naphthalene-degrading bacteria carrying a variety of nahAc homologs, indicating that diverse dioxygenase transcripts had been retrieved from groundwater. Diluted and undiluted cDNA preparations were independently amplified, and 28 of the resulting PCR products were cloned and sequenced. Sequence comparisons revealed two major groups related to the dioxygenase genes ndoB and dntAc, previously cloned from Pseudomonas putida NCIB 9816-4 and Burkholderia sp. strain DNT, respectively. A distinctive subgroup of sequences was found only in experiments performed with the undiluted cDNA preparation. To the authors' knowledge, these results are the first to directly document in situ transcription of genes encoding naphthalene catabolism at a contaminated site by indigenous microorganisms. The retrieved sequences represent greater diversity than has been detected at the study site by culture-based approaches
Effects of Argonaute on Gene Expression in Thermus thermophilus.
Directory of Open Access Journals (Sweden)
Daan C Swarts
Full Text Available Eukaryotic Argonaute proteins mediate RNA-guided RNA interference, allowing both regulation of host gene expression and defense against invading mobile genetic elements. Recently, it has become evident that prokaryotic Argonaute homologs mediate DNA-guided DNA interference, and play a role in host defense. Argonaute of the bacterium Thermus thermophilus (TtAgo targets invading plasmid DNA during and after transformation. Using small interfering DNA guides, TtAgo can cleave single and double stranded DNAs. Although TtAgo additionally has been demonstrated to cleave RNA targets complementary to its DNA guide in vitro, RNA targeting by TtAgo has not been demonstrated in vivo.To investigate if TtAgo also has the potential to control RNA levels, we analyzed RNA-seq data derived from cultures of four T. thermophilus strain HB27 variants: wild type, TtAgo knockout (Δago, and either strain transformed with a plasmid. Additionally we determined the effect of TtAgo on expression of plasmid-encoded RNA and plasmid DNA levels.In the absence of exogenous DNA (plasmid, TtAgo presence or absence had no effect on gene expression levels. When plasmid DNA is present, TtAgo reduces plasmid DNA levels 4-fold, and a corresponding reduction of plasmid gene transcript levels was observed. We therefore conclude that TtAgo interferes with plasmid DNA, but not with plasmid-encoded RNA. Interestingly, TtAgo presence stimulates expression of specific endogenous genes, but only when exogenous plasmid DNA was present. Specifically, the presence of TtAgo directly or indirectly stimulates expression of CRISPR loci and associated genes, some of which are involved in CRISPR adaptation. This suggests that TtAgo-mediated interference with plasmid DNA stimulates CRISPR adaptation.
Alam, Tanvir
2014-10-02
Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptional regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.
Two distinct genes for ADP/ATP translocase are expressed at the mRNA level in adult human liver
International Nuclear Information System (INIS)
Houldsworth, J.; Attardi, G.
1988-01-01
Several clones hybridizing with a bovine ADP/ATP translocase cDNA were isolated from an adult human liver cDNA library in the vector pEX1. DNA sequence analysis revealed that these clones encode two distinct forms of translocase. In particular, two clones specifying the COOH-end-proximal five-sixths of the protein exhibit a 9% amino acid sequence divergence and totally dissimilar 3' untranslated regions. One of these cDNAs is nearly identical in sequence to an ADP/ATP translocase clone (hp2F1) recently isolated from a human fibroblast cDNA library with three amino acid changes and a few differences in the 3' untranslated region. Another clone isolated from the pEX1 library contains a reading frame encoding the remaining, NH 2 -end-proximal, 37 amino acids of the translocase. This sequence differs significantly (14% amino acid sequence divergence) from the corresponding segment of hp2F1, and the 5' untranslated regions of the two clones are totally dissimilar. RNA transfer hybridization experiments utilizing the clones isolated from the pEX1 library revealed the presence in HeLa cells of three distinct mRNA species. The pattern of hybridization and the sizes of these mRNAs suggest a greater complexity of organization and expression of the ADP/ATP translocase genes in human cells than indicated by the analysis of the cDNA clones
DEFF Research Database (Denmark)
Gerdes, K; Helin, K; Christensen, O W
1988-01-01
The parB locus of plasmid R1, which mediates plasmid stability via postsegregational killing of plasmid-free cells, encodes two genes, hok and sok. The hok gene product is a potent cell-killing protein. The hok gene is regulated at the translational level by the sok gene-encoded repressor, a small...
Josephson, Anna; Trifunovski, Alexandra; Widmer, Hans Ruedi; Widenfalk, Johan; Olson, Lars; Spenger, Christian
2002-11-18
Nogo (reticulon-4) is a myelin-associated protein that is expressed in three different splice variants, Nogo-A, Nogo-B, and Nogo-C. Nogo-A inhibits neurite regeneration in the central nervous system. Messenger RNA encoding Nogo is expressed in oligodendrocytes and central and peripheral neurons, but not in astrocytes or Schwann cells. Nogo is a transmembraneous protein; the extracellular domain is termed Nogo-66, and a Nogo-66-receptor (Nogo-R) has been identified. We performed in situ hybridization in human and mouse nervous tissues to map the cellular distribution of Nogo-R gene activity patterns in fetal and adult human spinal cord and sensory ganglia, adult human brain, and the nervous systems of developing and adult mice. In the human fetus Nogo-R was transcribed in the ventral horn of the spinal cord and in dorsal root ganglia. In adult human tissues Nogo-R gene activity was found in neocortex, hippocampus, amygdala, and a subset of large and medium-sized neurons of the dorsal root ganglia. Nogo-R mRNA was not expressed in the adult human spinal cord at detectable levels. In the fetal mouse, Nogo-R was diffusely expressed in brain, brainstem, trigeminal ganglion, spinal cord, and dorsal root ganglia at all stages. In the adult mouse strong Nogo-R mRNA expression was found in neurons in neocortex, hippocampus, amygdala, habenula, thalamic nuclei, brainstem, the granular cell layer of cerebellum, and the mitral cell layer of the olfactory bulb. Neurons in the adult mouse striatum, the medial septal nucleus, and spinal cord did not express Nogo-R mRNA at detectable levels. In summary, Nogo-66-R mRNA expression in humans and mice was observed in neurons of the developing nervous system Expression was downregulated in the adult spinal cord of both species, and specific expression patterns were seen in the adult brain. Copyright 2002 Wiley-Liss, Inc.
He, Xian-hui; Xu, Li-hui; Liu, Yi
2005-04-01
To investigate the expression and regulation of PD-1 ligand 1 (PD-L1) in peripheral blood mononuclear cells (PBMC). The cDNA encoding human PD-L1 precursor was cloned from the total RNA extracted from the resting and phorbol dibutyrate plus ionomycin- or phytohemagglutinin-activated PBMC, by reverse transcription polymerase chain reaction (RT-PCR), and independent clones were sequenced and analyzed. The expression and subcellular localization were examined in transiently transfected cells. The PD-L1 gene expression in different PBMC was also analyzed by RT-PCR. A novel human PD-L1 splice variant was identified from the activated PBMC. It was generated by splicing out exon? encoding an immunoglobulin variable domain (Igv)-like domain but retaining all other exons without a frame-shift. Consequently, the putative translated protein contained all other domains including the transmembrane region except for the Igv-like domain. Furthermore, the conventional isoform was expressed on the plasma surface whereas the novel isoform showed a pattern of intracellular membrane distribution in transiently transfected K562 cells. In addition, the expression pattern of the PD-L1 splice variant was variable in different individuals and in different cellular status. PD-L1 expression may be regulated at the posttranscriptional level through alternative splicing, and modulation of the PD-L1 isoform expression may influence the outcome of specific immune responses in the peripheral tissues.
International Nuclear Information System (INIS)
Wang, S.Z.
1985-01-01
Gamma-zein, a proline-rich protein from corn endosperm, was investigated at the molecular level. Immunological and electrophoretic data indicated that gamma-zein was deposited into protein bodies in corn endosperm. Both isolated polysomes and poly(A) + mRNA were found to direct into vitro synthesis of gamma-zein in a wheat germ system. In vitro synthesized gamma-zein was immunoprecipitated from the total in vitro translation products. A cDNA expression library was constructed by reverse transcription of total poly(A) + mRNA using pUC8 plasmid as vector and E. coli strain DH1 as host. The library was screened for the expression of gamma-zein and alpha-zein by specific antibodies. The library was also screened with 32 P-labeled gamma-zein and alpha-zein cDNA probes. The results indicated that gamma-zein and its fragments were readily expressed in E. coli while alpha-zein was not. Seven independently selected clones, six of which were selected by antibody and one by a cDNA probe, were sequenced. A comparison of sequence information from seven clones revealed that their overlapping regions were identical. This suggests that gamma-zein is encoded by a single gene. This finding is in conflict with what was expected on the basis of extensive charge heterogeneity of gamma-zein in isoelectric focusing. Individual bands cut from an IEF gel were rerun and shown to give several bands suggesting that the charge heterogeneity of gamma-zein may be an artifact. Sequence information of gamma-zein indicated that the gene encodes a mature protein whose primary structure includes 204 amino acids and has a molecular weight of 21,824 daltons
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Morimoto, Shimpei; Yahara, Koji
2018-03-01
Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes ( ADC17 and KIN1 ) that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning) that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after accounting for potential
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Di Martino, Maria Letizia; Romilly, Cédric; Wagner, E Gerhart H; Colonna, Bianca; Prosseda, Gianni
2016-11-08
VirF, an AraC-like activator, is required to trigger a regulatory cascade that initiates the invasive program of Shigella spp., the etiological agents of bacillary dysentery in humans. VirF expression is activated upon entry into the host and depends on many environmental signals. Here, we show that the virF mRNA is translated into two proteins, the major form, VirF 30 (30 kDa), and the shorter VirF 21 (21 kDa), lacking the N-terminal segment. By site-specific mutagenesis and toeprint analysis, we identified the translation start sites of VirF 30 and VirF 21 and showed that the two different forms of VirF arise from differential translation. Interestingly, in vitro and in vivo translation experiments showed that VirF 21 is also translated from a leaderless mRNA (llmRNA) whose 5' end is at position +309/+310, only 1 or 2 nucleotides upstream of the ATG84 start codon of VirF 21 The llmRNA is transcribed from a gene-internal promoter, which we identified here. Functional analysis revealed that while VirF 30 is responsible for activation of the virulence system, VirF 21 negatively autoregulates virF expression itself. Since VirF 21 modulates the intracellular VirF levels, this suggests that transcription of the llmRNA might occur when the onset of the virulence program is not required. We speculate that environmental cues, like stress conditions, may promote changes in virF mRNA transcription and preferential translation of llmRNA. Shigella spp. are a major cause of dysentery in humans. In bacteria of this genus, the activation of the invasive program involves a multitude of signals that act on all layers of the gene regulatory hierarchy. By controlling the essential genes for host cell invasion, VirF is the key regulator of the switch from the noninvasive to the invasive phenotype. Here, we show that the Shigella virF gene encodes two proteins of different sizes, VirF 30 and VirF 21 , that are functionally distinct. The major form, VirF 30 , activates the genes
Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species.
Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I
2013-05-01
All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Reciprocal regulation of A-to-I RNA editing and the vertebrate nervous system
Directory of Open Access Journals (Sweden)
Andrew Charles Penn
2013-04-01
Full Text Available The fine control of molecules mediating communication in the nervous system is key to adjusting neuronal responsiveness during development and in maintaining the stability of established networks in the face of altered sensory input. To prevent culmination of pathological recurrent network excitation or debilitating periods of quiescence, adaptive alterations occur in the signalling molecules and ion channels that control membrane excitability and synaptic transmission. However, rather than encoding (and thus ‘hardwiring’ modified gene copies, the nervous systems of metazoa have opted for expanding on post-transcriptional pre-mRNA splicing by altering key encoded amino acids using a conserved mechanism of A-to-I RNA editing: the enzymatic deamination of adenosine resulting in a change in the nucleotide to inosine. Inosine exhibits similar base-pairing properties to guanosine with respect to tRNA codon recognition, replication by polymerases and RNA secondary structure forming capacity. In addition to recoding within the open reading frame, adenosine deamination also occurs with high frequency throughout the non-coding transcriptome, where it affects multiple aspects of RNA metabolism and gene expression. We will describe here the recoding function of key RNA editing targets in the mammalian central nervous system (CNS and their potential to be regulated. We will then discuss how interactions of A-to-I editing with gene expression and alternative splicing could play a wider role in regulating the neuronal transcriptome. Finally, we will highlight the increasing complexity of this multifaceted control hub by summarising new findings from high-throughput studies.
Directory of Open Access Journals (Sweden)
Siti Aisyah Mualif
Full Text Available Relative ease in handling and manipulation of Escherichia coli strains make them primary candidate to express proteins heterologously. Overexpression of heterologous genes that contain codons infrequently used by E. coli is related with difficulties such as mRNA instability, early termination of transcription and/or translation, deletions and/or misincorporation, and cell growth inhibition. These codon bias -associated problems are addressed by co-expressing ColE1-compatible, rare tRNA expressing helper plasmids. However, this approach has inadequacies, which we have addressed by engineering an expression vector that concomitantly expresses the heterologous protein of interest, and rare tRNA genes in E. coli. The expression vector contains three (argU, ileY, leuW rare tRNA genes and a useful multiple cloning site for easy in-frame cloning. To maintain the overall size of the parental plasmid vector, the rare tRNA genes replaced the non-essential DNA segments in the vector. The cloned gene is expressed under the control of T7 promoter and resulting recombinant protein has a C-terminal 6His tag for IMAC-mediated purification. We have evaluated the usefulness of this expression vector by expressing three HIV-1 genes namely HIV-1 p27 (nef, HIV-1 p24 (ca, and HIV-1 vif in NiCo21(DE3 E.coli and demonstrated the advantages of using expression vector that concomitantly expresses rare tRNA and heterologous genes.
Directory of Open Access Journals (Sweden)
Yuping Zhang
Full Text Available Heat shock proteins (Hsps are highly conserved molecular chaperones that are synthesized in response to stress. In this study, we cloned the full-length sequences of the Grp78 (glucose-regulated protein 78, Hsp70, Hsp90, and Hsp40 genes from the Chinese rice grasshopper Oxya chinensis. The full-length cDNA sequences of OcGrp78, OcHsp70, OcHsp90, and OcHsp40 contain open reading frames of 1947, 1920, 2172, and 1042 bp that encode proteins of 649, 640, 724, and 347 amino acids, respectively. Fluorescent real-time quantitative PCR (RT-qPCR was performed to quantify the relative transcript levels of these Hsp genes in different tissues and developmental stages. The mRNAs encoding these four Hsp genes were present at all developmental stages and in all tissues examined but were expressed at varying levels. Additionally, we investigated the mRNA expression profiles of these four Hsps in O. chinensis subjected to Cadmium (Cd stress. OcGrp78, OcHsp70, OcHsp90, and OcHsp40 mRNA expression was induced under acute Cd stress; the levels reached a maximum within a short time (6 h, were reduced significantly at 12 h, and were lowered to or below control levels by 48 h. Regarding induction efficiency, OcHsp70 was the most sensitive gene to acute Cd stress. Chronic Cd exposure showed that dietary Cd treatment induced increased OcGrp78, OcHsp90, and OcHsp40 expression. However, dietary Cd induced a significant reduction of OcHsp70 expression. In the period tested, no significant difference in the mortality of the grasshoppers was observed. Our results suggest that these four Hsps genes, especially OcHsp70, are sensitive to acute Cd stress and could be used as molecular markers for toxicology studies. However, our results also indicate that OcHsp70 is not suitable for use as a molecular marker of chronic Cd contamination.
Zhang, Yuping; Liu, Yaoming; Zhang, Jianzhen; Guo, Yaping; Ma, Enbo
2015-01-01
Heat shock proteins (Hsps) are highly conserved molecular chaperones that are synthesized in response to stress. In this study, we cloned the full-length sequences of the Grp78 (glucose-regulated protein 78), Hsp70, Hsp90, and Hsp40 genes from the Chinese rice grasshopper Oxya chinensis. The full-length cDNA sequences of OcGrp78, OcHsp70, OcHsp90, and OcHsp40 contain open reading frames of 1947, 1920, 2172, and 1042 bp that encode proteins of 649, 640, 724, and 347 amino acids, respectively. Fluorescent real-time quantitative PCR (RT-qPCR) was performed to quantify the relative transcript levels of these Hsp genes in different tissues and developmental stages. The mRNAs encoding these four Hsp genes were present at all developmental stages and in all tissues examined but were expressed at varying levels. Additionally, we investigated the mRNA expression profiles of these four Hsps in O. chinensis subjected to Cadmium (Cd) stress. OcGrp78, OcHsp70, OcHsp90, and OcHsp40 mRNA expression was induced under acute Cd stress; the levels reached a maximum within a short time (6 h), were reduced significantly at 12 h, and were lowered to or below control levels by 48 h. Regarding induction efficiency, OcHsp70 was the most sensitive gene to acute Cd stress. Chronic Cd exposure showed that dietary Cd treatment induced increased OcGrp78, OcHsp90, and OcHsp40 expression. However, dietary Cd induced a significant reduction of OcHsp70 expression. In the period tested, no significant difference in the mortality of the grasshoppers was observed. Our results suggest that these four Hsps genes, especially OcHsp70, are sensitive to acute Cd stress and could be used as molecular markers for toxicology studies. However, our results also indicate that OcHsp70 is not suitable for use as a molecular marker of chronic Cd contamination.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
RNA-seq reveals transcriptome changes in goats following myostatin gene knockout
Cai, Bei; Zhou, Shiwei; Zhu, Haijing; Qu, Lei; Wang, Xiaolong
2017-01-01
Myostatin (MSTN) is a powerful negative regulator of skeletal muscle mass in mammalian species that is primarily expressed in skeletal muscles, and mutations of its encoding gene can result in the double-muscling trait. In this study, the CRISPR/Cas9 technique was used to edit MSTN in Shaanbei Cashmere goats and generate knockout animals. RNA sequencing was used to determine and compare the transcriptome profiles of the muscles from three wild-type (WT) goats, three fibroblast growth factor 5 (FGF5) knockout goats (FGF5+/- group) and three goats with disrupted expression of both the FGF5 and MSTN genes (FM+/- group). The sequence reads were obtained using the Illumina HiSeq 2000 system and mapped to the Capra hircus reference genome using TopHat (v2.0.9). In total, 68.93, 62.04 and 66.26 million clean sequencing reads were obtained from the WT, FM+/- and FGF5+/- groups, respectively. There were 201 differentially expressed genes (DEGs) between the WT and FGF5+/- groups, with 86 down- and 115 up-regulated genes in the FGF5+/- group. Between the WT and FM+/- groups, 121 DEGs were identified, including 81 down- and 40 up-regulated genes in the FM+/- group. A total of 198 DEGs were detected between the FGF5+/- group and FM+/- group, with 128 down- and 70 up-regulated genes in the FM+/- group. At the transcriptome level, we found substantial changes in genes involved in fatty acid metabolism and the biosynthesis of unsaturated fatty acids, such as stearoyl-CoA dehydrogenase, 3-hydroxyacyl-CoA dehydratase 2, ELOVL fatty acid elongase 6 and fatty acid synthase, suggesting that the expression levels of these genes may be directly regulated by MSTN and that these genes are likely downstream targets of MSTN with potential roles in lipid metabolism in goats. Moreover, five randomly selected DEGs were further validated with qRT-PCR, and the results were consistent with the transcriptome analysis. The present study provides insight into the unique transcriptome profile of the
Directory of Open Access Journals (Sweden)
Zhipeng Su
Full Text Available Actinobacillus pleuropneumoniae is the pathogen of porcine contagious pleuropneumoniae, a highly contagious respiratory disease of swine. Although the genome of A. pleuropneumoniae was sequenced several years ago, limited information is available on the genome-wide transcriptional analysis to accurately annotate the gene structures and regulatory elements. High-throughput RNA sequencing (RNA-seq has been applied to study the transcriptional landscape of bacteria, which can efficiently and accurately identify gene expression regions and unknown transcriptional units, especially small non-coding RNAs (sRNAs, UTRs and regulatory regions. The aim of this study is to comprehensively analyze the transcriptome of A. pleuropneumoniae by RNA-seq in order to improve the existing genome annotation and promote our understanding of A. pleuropneumoniae gene structures and RNA-based regulation. In this study, we utilized RNA-seq to construct a single nucleotide resolution transcriptome map of A. pleuropneumoniae. More than 3.8 million high-quality reads (average length ~90 bp from a cDNA library were generated and aligned to the reference genome. We identified 32 open reading frames encoding novel proteins that were mis-annotated in the previous genome annotations. The start sites for 35 genes based on the current genome annotation were corrected. Furthermore, 51 sRNAs in the A. pleuropneumoniae genome were discovered, of which 40 sRNAs were never reported in previous studies. The transcriptome map also enabled visualization of 5'- and 3'-UTR regions, in which contained 11 sRNAs. In addition, 351 operons covering 1230 genes throughout the whole genome were identified. The RNA-Seq based transcriptome map validated annotated genes and corrected annotations of open reading frames in the genome, and led to the identification of many functional elements (e.g. regions encoding novel proteins, non-coding sRNAs and operon structures. The transcriptional units
Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan
2015-04-01
Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite
Seeing the forest for the trees: annotating small RNA producing genes in plants.
Coruh, Ceyda; Shahid, Saima; Axtell, Michael J
2014-04-01
A key goal in genomics is the complete annotation of the expressed regions of the genome. In plants, substantial portions of the genome make regulatory small RNAs produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins. These include miRNAs and various types of endogenous siRNAs. Small RNA-seq, enabled by cheap and fast DNA sequencing, has produced an enormous volume of data on plant miRNA and siRNA expression in recent years. In this review, we discuss recent progress in using small RNA-seq data to produce stable and reliable annotations of miRNA and siRNA genes in plants. In addition, we highlight key goals for the future of small RNA gene annotation in plants. Copyright © 2014 Elsevier Ltd. All rights reserved.
Kim, Hong-Il; Kim, Jong-Hyeon; Park, Young-Jin
2016-03-09
Corynebacterium glutamicum is widely used for amino acid production. In the present study, 543 genes showed a significant change in their mRNA expression levels in L-lysine-producing C. glutamicum ATCC21300 than that in the wild-type C. glutamicum ATCC13032. Among these 543 differentially expressed genes (DEGs), 28 genes were up- or downregulated. In addition, 454 DEGs were functionally enriched and categorized based on BLAST sequence homologies and gene ontology (GO) annotations using the Blast2GO software. Interestingly, NCgl0071 (bioB, encoding biotin synthase) was expressed at levels ~20-fold higher in the L-lysine-producing ATCC21300 strain than that in the wild-type ATCC13032 strain. Five other genes involved in biotin metabolism or transport--NCgl2515 (bioA, encoding adenosylmethionine-8-amino-7-oxononanoate aminotransferase), NCgl2516 (bioD, encoding dithiobiotin synthetase), NCgl1883, NCgl1884, and NCgl1885--were also expressed at significantly higher levels in the L-lysine-producing ATCC21300 strain than that in the wild-type ATCC13032 strain, which we determined using both next-generation RNA sequencing and quantitative real-time PCR analysis. When we disrupted the bioB gene in C. glutamicum ATCC21300, L-lysine production decreased by approximately 76%, and the three genes involved in biotin transport (NCgl1883, NCgl1884, and NCgl1885) were significantly downregulated. These results will be helpful to improve our understanding of C. glutamicum for industrial amino acid production.
A long and abundant non-coding RNA in Lactobacillus salivarius.
Cousin, Fabien J; Lynch, Denise B; Chuat, Victoria; Bourin, Maxence J B; Casey, Pat G; Dalmasso, Marion; Harris, Hugh M B; McCann, Angela; O'Toole, Paul W
2017-09-01
Lactobacillus salivarius , found in the intestinal microbiota of humans and animals, is studied as an example of the sub-dominant intestinal commensals that may impart benefits upon their host. Strains typically harbour at least one megaplasmid that encodes functions contributing to contingency metabolism and environmental adaptation. RNA sequencing (RNA-seq)transcriptomic analysis of L. salivarius strain UCC118 identified the presence of a novel unusually abundant long non-coding RNA (lncRNA) encoded by the megaplasmid, and which represented more than 75 % of the total RNA-seq reads after depletion of rRNA species. The expression level of this 520 nt lncRNA in L. salivarius UCC118 exceeded that of the 16S rRNA, it accumulated during growth, was very stable over time and was also expressed during intestinal transit in a mouse. This lncRNA sequence is specific to the L. salivarius species; however, among 45 L . salivarius genomes analysed, not all (only 34) harboured the sequence for the lncRNA. This lncRNA was produced in 27 tested L. salivarius strains, but at strain-specific expression levels. High-level lncRNA expression correlated with high megaplasmid copy number. Transcriptome analysis of a deletion mutant lacking this lncRNA identified altered expression levels of genes in a number of pathways, but a definitive function of this new lncRNA was not identified. This lncRNA presents distinctive and unique properties, and suggests potential basic and applied scientific developments of this phenomenon.
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
DEFF Research Database (Denmark)
Auxilien, Sylvie; El Khadali, Fatima; Rasmussen, Anette
2007-01-01
Members of the archease superfamily of proteins are represented in all three domains of life. Archease genes are generally located adjacent to genes encoding proteins involved in DNA or RNA processing. Archease have therefore been predicted to play a modulator or chaperone role in selected steps...
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder
2016-03-01
Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016
Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes.
Directory of Open Access Journals (Sweden)
Thomas Birkballe Hansen
Full Text Available BACKGROUND: miRNAs are key players in gene expression regulation. To fully understand the complex nature of cellular differentiation or initiation and progression of disease, it is important to assess the expression patterns of as many miRNAs as possible. Thereby, identifying novel miRNAs is an essential prerequisite to make possible a comprehensive and coherent understanding of cellular biology. METHODOLOGY/PRINCIPAL FINDINGS: Based on two extensive, but previously published, small RNA sequence datasets from human embryonic stem cells and human embroid bodies, respectively [1], we identified 112 novel miRNA-like structures and were able to validate miRNA processing in 12 out of 17 investigated cases. Several miRNA candidates were furthermore substantiated by including additional available small RNA datasets, thereby demonstrating the power of combining datasets to identify miRNAs that otherwise may be assigned as experimental noise. CONCLUSIONS/SIGNIFICANCE: Our analysis highlights that existing datasets are not yet exhaustedly studied and continuous re-analysis of the available data is important to uncover all features of small RNA sequencing.
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Directory of Open Access Journals (Sweden)
Brett A McKinney
Full Text Available Relief-F is a nonparametric, nearest-neighbor machine learning method that has been successfully used to identify relevant variables that may interact in complex multivariate models to explain phenotypic variation. While several tools have been developed for assessing differential expression in sequence-based transcriptomics, the detection of statistical interactions between transcripts has received less attention in the area of RNA-seq analysis. We describe a new extension and assessment of Relief-F for feature selection in RNA-seq data. The ReliefSeq implementation adapts the number of nearest neighbors (k for each gene to optimize the Relief-F test statistics (importance scores for finding both main effects and interactions. We compare this gene-wise adaptive-k (gwak Relief-F method with standard RNA-seq feature selection tools, such as DESeq and edgeR, and with the popular machine learning method Random Forests. We demonstrate performance on a panel of simulated data that have a range of distributional properties reflected in real mRNA-seq data including multiple transcripts with varying sizes of main effects and interaction effects. For simulated main effects, gwak-Relief-F feature selection performs comparably to standard tools DESeq and edgeR for ranking relevant transcripts. For gene-gene interactions, gwak-Relief-F outperforms all comparison methods at ranking relevant genes in all but the highest fold change/highest signal situations where it performs similarly. The gwak-Relief-F algorithm outperforms Random Forests for detecting relevant genes in all simulation experiments. In addition, Relief-F is comparable to the other methods based on computational time. We also apply ReliefSeq to an RNA-Seq study of smallpox vaccine to identify gene expression changes between vaccinia virus-stimulated and unstimulated samples. ReliefSeq is an attractive tool for inclusion in the suite of tools used for analysis of mRNA-Seq data; it has power to
Directory of Open Access Journals (Sweden)
Frédéric Pontvianne
2010-11-01
Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.
Self-Amplifying Replicon RNA Vaccine Delivery to Dendritic Cells by Synthetic Nanoparticles
Directory of Open Access Journals (Sweden)
Kenneth C. McCullough
2014-10-01
Full Text Available Dendritic cells (DC play essential roles determining efficacy of vaccine delivery with respect to immune defence development and regulation. This renders DCs important targets for vaccine delivery, particularly RNA vaccines. While delivery of interfering RNA oligonucleotides to the appropriate intracellular sites for RNA-interference has proven successful, the methodologies are identical for RNA vaccines, which require delivery to RNA translation sites. Delivery of mRNA has benefitted from application of cationic entities; these offer value following endocytosis of RNA, when cationic or amphipathic properties can promote endocytic vesicle membrane perturbation to facilitate cytosolic translocation. The present review presents how such advances are being applied to the delivery of a new form of RNA vaccine, replicons (RepRNA carrying inserted foreign genes of interest encoding vaccine antigens. Approaches have been developed for delivery to DCs, leading to the translation of the RepRNA and encoded vaccine antigens both in vitro and in vivo. Potential mechanisms favouring efficient delivery leading to translation are discussed with respect to the DC endocytic machinery, showing the importance of cytosolic translocation from acidifying endocytic structures. The review relates the DC endocytic pathways to immune response induction, and the potential advantages for these self-replicating RNA vaccines in the near future.
Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.
Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli
2012-01-01
RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.
Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.
Directory of Open Access Journals (Sweden)
Sara Kangaspeska
Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.
Regulation of gene expression in Escherichia coli and its bacteriophage
International Nuclear Information System (INIS)
Higgins, C.F.
1986-01-01
This chapter reviews the study of prokaryotic gene expression beginning with a look at the regulation of the lactose operon and the mechanism of attenuation in the tryptophan operon to the more recent development of recombinant DNA technology. The chapter deals almost entirely with escherichia coli and its bacteriophage. The only experimental technique which the authors explore in some detail is the construction and use of gene and operon fusions which have revolutionized the study of gene expression. Various mechanisms by which E. Coli regulate the cellular levels of individual messenger-RNA species are described. Translational regulation of the cellular levels of messenger-RNA include signals encoded within the messenger-RNA molecule itself and regulatory molecules which interact with the messenger-RNA and alter it translational efficiency
Common features of microRNA target prediction tools
Directory of Open Access Journals (Sweden)
Sarah M. Peterson
2014-02-01
Full Text Available The human genome encodes for over 1800 microRNAs, which are short noncoding RNA molecules that function to regulate gene expression post-transcriptionally. Due to the potential for one microRNA to target multiple gene transcripts, microRNAs are recognized as a major mechanism to regulate gene expression and mRNA translation. Computational prediction of microRNA targets is a critical initial step in identifying microRNA:mRNA target interactions for experimental validation. The available tools for microRNA target prediction encompass a range of different computational approaches, from the modeling of physical interactions to the incorporation of machine learning. This review provides an overview of the major computational approaches to microRNA target prediction. Our discussion highlights three tools for their ease of use, reliance on relatively updated versions of miRBase, and range of capabilities, and these are DIANA-microT-CDS, miRanda-mirSVR, and TargetScan. In comparison across all microRNA target prediction tools, four main aspects of the microRNA:mRNA target interaction emerge as common features on which most target prediction is based: seed match, conservation, free energy, and site accessibility. This review explains these features and identifies how they are incorporated into currently available target prediction tools. MicroRNA target prediction is a dynamic field with increasing attention on development of new analysis tools. This review attempts to provide a comprehensive assessment of these tools in a manner that is accessible across disciplines. Understanding the basis of these prediction methodologies will aid in user selection of the appropriate tools and interpretation of the tool output.
Novel microRNA-like viral small regulatory RNAs arising during human hepatitis A virus infection.
Shi, Jiandong; Sun, Jing; Wang, Bin; Wu, Meini; Zhang, Jing; Duan, Zhiqing; Wang, Haixuan; Hu, Ningzhu; Hu, Yunzhang
2014-10-01
MicroRNAs (miRNAs), including host miRNAs and viral miRNAs, play vital roles in regulating host-virus interactions. DNA viruses encode miRNAs that regulate the viral life cycle. However, it is generally believed that cytoplasmic RNA viruses do not encode miRNAs, owing to inaccessible cellular miRNA processing machinery. Here, we provide a comprehensive genome-wide analysis and identification of miRNAs that were derived from hepatitis A virus (HAV; Hu/China/H2/1982), which is a typical cytoplasmic RNA virus. Using deep-sequencing and in silico approaches, we identified 2 novel virally encoded miRNAs, named hav-miR-1-5p and hav-miR-2-5p. Both of the novel virally encoded miRNAs were clearly detected in infected cells. Analysis of Dicer enzyme silencing demonstrated that HAV-derived miRNA biogenesis is Dicer dependent. Furthermore, we confirmed that HAV mature miRNAs were generated from viral miRNA precursors (pre-miRNAs) in host cells. Notably, naturally derived HAV miRNAs were biologically and functionally active and induced post-transcriptional gene silencing (PTGS). Genomic location analysis revealed novel miRNAs located in the coding region of the viral genome. Overall, our results show that HAV naturally generates functional miRNA-like small regulatory RNAs during infection. This is the first report of miRNAs derived from the coding region of genomic RNA of a cytoplasmic RNA virus. These observations demonstrate that a cytoplasmic RNA virus can naturally generate functional miRNAs, as DNA viruses do. These findings also contribute to improved understanding of host-RNA virus interactions mediated by RNA virus-derived miRNAs. © FASEB.
Energy Technology Data Exchange (ETDEWEB)
Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)
2013-10-15
Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.
International Nuclear Information System (INIS)
Wu, Yongyan; Ai, Zhiying; Yao, Kezhen; Cao, Lixia; Du, Juan; Shi, Xiaoyan; Guo, Zekun; Zhang, Yong
2013-01-01
Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR
DEFF Research Database (Denmark)
Nielsen, Mathilde
MicroRNAs are small single stranded non-coding RNA molecules which contributes to the regulation of gene expression by primarily binding to the 3´end of protein coding mRNA, hereby inhibiting the translation process or promting degradation of the mRNA. The main focus of this PhD project was to ex......MicroRNAs are small single stranded non-coding RNA molecules which contributes to the regulation of gene expression by primarily binding to the 3´end of protein coding mRNA, hereby inhibiting the translation process or promting degradation of the mRNA. The main focus of this PhD project...
EsrE-A yigP Locus-Encoded Transcript-Is a 3′ UTR sRNA Involved in the Respiratory Chain of E. coli
Directory of Open Access Journals (Sweden)
Hui Xia
2017-08-01
Full Text Available The yigP locus is widely conserved among γ-proteobacteria. Mutation of the yigP locus impacts aerobic growth of Gram-negative bacteria. However, the underlying mechanism of how the yigP locus influences aerobic growth remains largely unknown. Here, we demonstrated that the yigP locus in Escherichia coli encodes two transcripts; the mRNA of ubiquinone biosynthesis protein, UbiJ, and the 3′ untranslated region small regulatory RNA (sRNA, EsrE. EsrE is an independent transcript that is transcribed using an internal promoter of the yigP locus. Surprisingly, we found that both the EsrE sRNA and UbiJ protein were required for Q8 biosynthesis, and were sufficient to rescue the growth defect ascribed to deletion of the yigP locus. Moreover, our data showed that EsrE targeted multiple mRNAs involved in several cellular processes including murein biosynthesis and the tricarboxylic acid cycle. Among these targets, sdhD mRNA that encodes one subunit of succinate dehydrogenase (SDH, was significantly activated. Our findings provided an insight into the important function of EsrE in bacterial adaptation to various environments, as well as coordinating different aspects of bacterial physiology.
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Chakraborty, Sandeep; Britton, Monica; Martínez-García, P J; Dandekar, Abhaya M
2016-03-01
Deep RNA-Seq profiling, a revolutionary method used for quantifying transcriptional levels, often includes non-specific transcripts from other co-existing organisms in spite of stringent protocols. Using the recently published walnut genome sequence as a filter, we present a broad analysis of the RNA-Seq derived transcriptome profiles obtained from twenty different tissues to extract the biodiversity and possible plant-microbe interactions in the walnut ecosystem in California. Since the residual nature of the transcripts being analyzed does not provide sufficient information to identify the exact strain, inferences made are constrained to the genus level. The presence of the pathogenic oomycete Phytophthora was detected in the root through the presence of a glyceraldehyde-3-phosphate dehydrogenase. Cryptococcus, the causal agent of cryptococcosis, was found in the catkins and vegetative buds, corroborating previous work indicating that the plant surface supported the sexual cycle of this human pathogen. The RNA-Seq profile revealed several species of the endophytic nitrogen fixing Actinobacteria. Another bacterial species implicated in aerobic biodegradation of methyl tert-butyl ether (Methylibium petroleiphilum) is also found in the root. RNA encoding proteins from the pea aphid were found in the leaves and vegetative buds, while a serine protease from mosquito with significant homology to a female reproductive tract protease from Drosophila mojavensis in the vegetative bud suggests egg-laying activities. The comprehensive analysis of RNA-seq data present also unraveled detailed, tissue-specific information of ~400 transcripts encoded by the largest family of resistance (R) genes (NBS-LRR), which possibly rationalizes the resistance of the specific walnut plant to the pathogens detected. Thus, we elucidate the biodiversity and possible plant-microbe interactions in several walnut (Juglans regia) tissues in California using deep RNA-Seq profiling.
Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping
2017-08-15
Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N
Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.
2011-01-01
Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395
Directory of Open Access Journals (Sweden)
Shimpei Morimoto
2018-03-01
Full Text Available Protein expression is regulated by the production and degradation of mRNAs and proteins but the specifics of their relationship are controversial. Although technological advances have enabled genome-wide and time-series surveys of mRNA and protein abundance, recent studies have shown paradoxical results, with most statistical analyses being limited to linear correlation, or analysis of variance applied separately to mRNA and protein datasets. Here, using recently analyzed genome-wide time-series data, we have developed a statistical analysis framework for identifying which types of genes or biological gene groups have significant correlation between mRNA and protein abundance after accounting for potential time delays. Our framework stratifies all genes in terms of the extent of time delay, conducts gene clustering in each stratum, and performs a non-parametric statistical test of the correlation between mRNA and protein abundance in a gene cluster. Consequently, we revealed stronger correlations than previously reported between mRNA and protein abundance in two metabolic pathways. Moreover, we identified a pair of stress responsive genes (ADC17 and KIN1 that showed a highly similar time series of mRNA and protein abundance. Furthermore, we confirmed robustness of the analysis framework by applying it to another genome-wide time-series data and identifying a cytoskeleton-related gene cluster (keratin 18, keratin 17, and mitotic spindle positioning that shows similar correlation. The significant correlation and highly similar changes of mRNA and protein abundance suggests a concerted role of these genes in cellular stress response, which we consider provides an answer to the question of the specific relationships between mRNA and protein in a cell. In addition, our framework for studying the relationship between mRNAs and proteins in a cell will provide a basis for studying specific relationships between mRNA and protein abundance after
Rastorguev, S M; Nedoluzhko, A V; Sharko, F S; Boulygina, E S; Sokolov, A S; Gruzdeva, N M; Skryabin, K G; Prokhortchouk, E B
2016-11-01
The three-spined stickleback (Gasterosteus aculeatus L.) is an important model organism for studying the molecular mechanisms of speciation and adaptation to salinity. Despite increased interest to microRNA discovery and recent publication on microRNA prediction in the three-spined stickleback using bioinformatics approaches, there is still a lack of experimental support for these data. In this paper, high-throughput sequencing technology was applied to identify microRNA genes in gills of the three-spined stickleback. In total, 595 miRNA genes were discovered; half of them were predicted in previous computational studies and were confirmed here as microRNAs expressed in gill tissue. Moreover, 298 novel microRNA genes were identified. The presence of miRNA genes in selected 'divergence islands' was analysed and 10 miRNA genes were identified as not randomly located in 'divergence islands'. Regulatory regions of miRNA genes were found enriched with selective SNPs that may play a role in freshwater adaptation. © 2016 John Wiley & Sons Ltd.
Tatti, Enrico; McKew, Boyd A; Whitby, Corrine; Smith, Cindy J
2016-06-11
Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.
International Nuclear Information System (INIS)
Vakhitov, V.A.; Gimalov, F.R.; Nikonorov, Yu.M.
1986-01-01
The number of 5s-rRNA and tRNA genes has been studied in 43 species of wheat and Aegilops differing in ploidy level, genomic composition and origin. It has been demonstrated that the repeatability of the 5s-rRNA and tRNA genes increases in wheat with increasing ploidy level, but not in proportion to the genome size. In Aegilops, in distinction from wheat, the relative as well as absolute number of 5s-RNA genes increases with increasing ploidy level. The proportion of the sequences coding for tRNA in the dipoloid and polyploid Aegilops species is practically similar, while the number of tRNA genes increases almost 2-3 times with increasing ploidy level. Large variability has been recorded between the species with similar genomic composition and ploidy level in respect of the number of the 5s-rRNA and tRNA genes. It has been demonstrated that integration of the initial genomes of the amphidiploids is accompanied by elimination of a particular part of these genomes. It has been concluded that the mechanisms of establishment and evolution of genomes in the intra- and intergeneric allopolyploids are not identical
Mandal, Chanchal; Kim, Sun Hwa; Chai, Jin Choul; Oh, Seon Mi; Lee, Young Seek; Jung, Kyoung Hwa; Chai, Young Gyu
2016-01-01
Fetal alcohol spectrum disorder is a collective term representing fetal abnormalities associated with maternal alcohol consumption. Prenatal alcohol exposure and related anomalies are well characterized, but the molecular mechanism behind this phenomenon is not well characterized. In this present study, our aim is to profile important genes that regulate cellular development during fetal development. Human embryonic carcinoma cells (NCCIT) are cultured to form embryoid bodies and then treated in the presence and absence of ethanol (50 mM). We employed RNA sequencing to profile differentially expressed genes in the ethanol-treated embryoid bodies from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH data sets. A total of 632, 205 and 517 differentially expressed genes were identified from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH, respectively. Functional annotation using bioinformatics tools reveal significant enrichment of differential cellular development and developmental disorders. Furthermore, a group of 42, 15 and 35 transcription factor-encoding genes are screened from all of the differentially expressed genes obtained from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH, respectively. We validated relative gene expression levels of several transcription factors from these lists by quantitative real-time PCR. We hope that our study substantially contributes to the understanding of the molecular mechanism underlying the pathology of alcohol-mediated anomalies and ease further research.
Hatoum-Aslan, Asma; Maniv, Inbal; Marraffini, Luciano A
2011-12-27
Precise RNA processing is fundamental to all small RNA-mediated interference pathways. In prokaryotes, clustered, regularly interspaced, short palindromic repeats (CRISPR) loci encode small CRISPR RNAs (crRNAs) that protect against invasive genetic elements by antisense targeting. CRISPR loci are transcribed as a long precursor that is cleaved within repeat sequences by CRISPR-associated (Cas) proteins. In many organisms, this primary processing generates crRNA intermediates that are subject to additional nucleolytic trimming to render mature crRNAs of specific lengths. The molecular mechanisms underlying this maturation event remain poorly understood. Here, we defined the genetic requirements for crRNA primary processing and maturation in Staphylococcus epidermidis. We show that changes in the position of the primary processing site result in extended or diminished maturation to generate mature crRNAs of constant length. These results indicate that crRNA maturation occurs by a ruler mechanism anchored at the primary processing site. We also show that maturation is mediated by specific cas genes distinct from those genes involved in primary processing, showing that this event is directed by CRISPR/Cas loci.
Lee, Jung-Bok; Kim, Hyun Soo; Park, Youngjin
2017-02-01
Chitin synthase (CHS) is an important enzymatic component, which is required for chitin formation in the cuticles and cuticular linings of other tissues in insects. CHSs have been divided into two classes, classes A and B, based on their amino acid sequence similarities and functions. Class A CHS (CHS-A) is specifically expressed in the epidermis and related ectodermal cells such as tracheal cells, while class B CHS (CHS-B) is expressed in gut epithelial cells that produce peritrophic matrices. In this study, we cloned the CHS-A gene from the beet armyworm, Spodoptera exigua (SeCHS-A). The SeCHS-A contains an open reading frame of 4,698 nucleotides, encoding a protein of 1,565 amino acids with a predicted molecular mass of approximately 177.8 kDa. The SeCHS-A mRNA was expressed in all developmental stages and specifically in the epidermis and tracheae tissue by quantitative real-time-PCR analysis. Expression of SeCHS-A gene was suppressed by feeding double-stranded RNA (dsCHS-A, 400 ng/larva) in the third instar larvae of S. exigua. Suppression of the SeCHS-A gene expression significantly increased 35% of mortality on pupation of S. exigua. Also, the third instar larvae fed with dsCHS-A significantly increased susceptibility to entomopathogenic fungi, Beauveria bassiana ANU1 at 3 days after treatment. These results suggest that the SeCHS-A gene plays an important role in development of S. exigua and RNA interference may apply to effective pest control with B. bassiana. © 2017 Wiley Periodicals, Inc.
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
A renaissance for the pioneering 16S rRNA gene
Energy Technology Data Exchange (ETDEWEB)
Tringe, Susannah; Hugenholtz, Philip
2008-09-07
Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.
A renaissance for the pioneering 16S rRNA gene.
Tringe, Susannah G; Hugenholtz, Philip
2008-10-01
Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the past quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata, and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.
Xiao, Meng; Kong, Fanrong; Sorrell, Tania C; Cao, Yongyan; Lee, Ok Cha; Liu, Ying; Sintchenko, Vitali; Chen, Sharon C A
2010-02-01
Although 16S rRNA gene sequence analysis is employed most often for the definitive identification of Nocardia species, alternate molecular methods and polymorphisms in other gene targets have also enabled species determinations. We evaluated a combined Nocardia PCR-based reverse line blot (RLB) hybridization assay based on 16S and 16S-23S rRNA gene spacer region polymorphisms to identify 12 American Type Culture Collection and 123 clinical Nocardia isolates representing 14 species; results were compared with results from 16S rRNA gene sequencing. Thirteen 16S rRNA gene-based (two group-specific and 11 species-specific) and five 16S-23S spacer-targeted (two taxon-specific and three species-specific) probes were utilized. 16S rRNA gene-based probes correctly identified 124 of 135 isolates (sensitivity, 92%) but were unable to identify Nocardia paucivorans strains (n = 10 strains) and a Nocardia asteroides isolate with a novel 16S rRNA gene sequence. Nocardia farcinica and Nocardia cyriacigeorgica strains were identified by the sequential use of an N. farcinica-"negative" probe and a combined N. farcinica/N. cyriacigeorgica probe. The assay specificity was high (99%) except for weak cross-reactivity between the Nocardia brasiliensis probe with the Nocardia thailandica DNA product; however, cross-hybridization with closely related nontarget species may occur. The incorporation of 16S-23S rRNA gene spacer-based probes enabled the identification of all N. paucivorans strains. The overall sensitivity using both probe sets was >99%. Both N. farcinica-specific 16S-23S rRNA gene spacer-directed probes were required to identify all N. farcinica stains by using this probe set. The study demonstrates the utility of a combined PCR/RLB assay for the identification of clinically relevant Nocardia species and its potential for studying subtypes of N. farcinica. Where species assignment is ambiguous or not possible, 16S rRNA gene sequencing is recommended.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.
Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E
1999-09-01
Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.
International Nuclear Information System (INIS)
Johnston, C.J.; Piedboeuf, B.; Finkelstein, J.N.; Baggs, R.; Rubin, P.
1995-01-01
Fibrosis, characterized by the accumulation of collagen, is a late result of thoracic irradiation. The purpose of this study was to determine if extracellular matrix protein and transforming growth factor β mRNA expression are altered late in the course of pulmonary fibrosis after irradiation, and then to determine if these changes differ between two strains of mice which vary in their sensitivity to radiation. Radiation-sensitive (C57BL/6) and radiation-resistant (C3H/HeJ) mice were irradiated with a single dose of 5 or 12.5 Gy to the thorax. Total lung RNA was prepared and immobilized by Northern and slot blotting and hybridized with radiolabeled cDNA probes for collagens I, III and IV, fibronectin, and transforming growth factor β 1 and β 3 . Autoradiographic data were quantified by video densitometry and results normalized to a control probe encoding for glyceralde-hyde-3-phosphate dehydrogenase. Alterations in mRNA abundance were observed in the sensitive mice at all times, while levels in the resistant mice were unaffected until 26 weeks after irradiation. The relationship between extracellular matrix protein per se and increased mRNA abundance suggests that late matrix protein accumulation may be a function of gene expression. Differences in levels of transforming growth factor βmRNA may lead to strain-dependent variation in fibrotic response and may also contribute to the radiation-induced component of pulmonary fibrosis. 32 refs., 5 figs
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
DEFF Research Database (Denmark)
Nagasawa, T; Zhang, Q; Raghunath, P N
2006-01-01
To understand better T-cell lymphomagenesis, we examined promoter CpG methylation and mRNA expression of closely related genes encoding p16, p15, and p14 tumor suppressor genes in cultured malignant T-cells that were derived from cutaneous, adult type, and anaplastic lymphoma kinase (ALK)-express...
Directory of Open Access Journals (Sweden)
Bernd Wemheuer
2013-01-01
Full Text Available Volcanic regions contain a variety of environments suitable for extremophiles. This study was focused on assessing and exploiting the prokaryotic diversity of two microbial communities derived from different Kamchatkian thermal springs by metagenomic approaches. Samples were taken from a thermoacidophilic spring near the Mutnovsky Volcano and from a thermophilic spring in the Uzon Caldera. Environmental DNA for metagenomic analysis was isolated from collected sediment samples by direct cell lysis. The prokaryotic community composition was examined by analysis of archaeal and bacterial 16S rRNA genes. A total number of 1235 16S rRNA gene sequences were obtained and used for taxonomic classification. Most abundant in the samples were members of Thaumarchaeota, Thermotogae, and Proteobacteria. The Mutnovsky hot spring was dominated by the Terrestrial Hot Spring Group, Kosmotoga, and Acidithiobacillus. The Uzon Caldera was dominated by uncultured members of the Miscellaneous Crenarchaeotic Group and Enterobacteriaceae. The remaining 16S rRNA gene sequences belonged to the Aquificae, Dictyoglomi, Euryarchaeota, Korarchaeota, Thermodesulfobacteria, Firmicutes, and some potential new phyla. In addition, the recovered DNA was used for generation of metagenomic libraries, which were subsequently mined for genes encoding lipolytic and proteolytic enzymes. Three novel genes conferring lipolytic and one gene conferring proteolytic activity were identified.
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2