
Sample records for gene encoding ribosomal

  1. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera. (United States)

    Grohmann, L; Brennicke, A; Schuster, W


    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  2. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed. (United States)

    Tornow, J; Santangelo, G M


    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  3. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel


    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  4. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin


    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  5. Sexually dimorphic expression of the genes encoding ribosomal proteins L17 and L37 in the song control nuclei of juvenile zebra finches. (United States)

    Tang, Yu Ping; Wade, Juli


    Studies evaluating the role of steroid hormones in sexual differentiation of the zebra finch song system have produced complicated and at times paradoxical results, and indicate that additional factors may be critical. Therefore, in a previous study we initiated a screen for differential gene expression in the telencephalon of developing male and female zebra finches. The use of cDNA microarrays and real-time quantitative PCR revealed increased expression of the genes encoding ribosomal proteins L17 and L37 (RPL17 and RPL37) in the male forebrain as a whole. Preliminary in situ hybridization data then indicated enhanced expression of both these genes in song control regions. Two experiments in the present study quantified the mRNA expression. The first utilized 25-day-old male and female zebra finches. The second compared a separate set of juveniles to adults of both sexes to both re-confirm enhanced expression in juvenile males and to determine whether it is limited to developing animals. In Experiment 1, males exhibited increased expression of both RPL17 and RPL37 compared to females in Area X, the robust nucleus of the arcopallium (RA), and the ventral ventricular zone (VVZ), which may provide neurons to Area X. Experiment 2 replicated the sexually dimorphic expression of these genes at post-hatching day 25, and documented that the sex differences are eliminated or greatly reduced in adults. The results are consistent with the idea that these ribosomal proteins may influence sexual differentiation of Area X and RA, potentially regulating the genesis and/or survival of neurons.

  6. Ribosomes slide on lysine-encoding homopolymeric A stretches (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel


    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: PMID:25695637

  7. Screening a yeast promoter library leads to the isolation of the RP29/L32 and SNR17B/RPL37A divergent promoters and the discovery of a gene encoding ribosomal protein L37. (United States)

    Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K


    Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).

  8. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.


    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  9. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan


    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  10. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

    KAUST Repository

    Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming


    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  11. A continental-wide perspective: the genepool of nuclear encoded ribosomal DNA and single-copy gene sequences in North American Boechera (Brassicaceae.

    Directory of Open Access Journals (Sweden)

    Christiane Kiefer

    Full Text Available 74 of the currently accepted 111 taxa of the North American genus Boechera (Brassicaceae were subject to pyhlogenetic reconstruction and network analysis. The dataset comprised 911 accessions for which ITS sequences were analyzed. Phylogenetic analyses yielded largely unresolved trees. Together with the network analysis confirming this result this can be interpreted as an indication for multiple, independent, and rapid diversification events. Network analyses were superimposed with datasets describing i geographical distribution, ii taxonomy, iii reproductive mode, and iv distribution history based on phylogeographic evidence. Our results provide first direct evidence for enormous reticulate evolution in the entire genus and give further insights into the evolutionary history of this complex genus on a continental scale. In addition two novel single-copy gene markers, orthologues of the Arabidopsis thaliana genes At2g25920 and At3g18900, were analyzed for subsets of taxa and confirmed the findings obtained through the ITS data.

  12. Several genes encoding ribosomal proteins are over-expressed in prostate-cancer cell lines: confirmation of L7a and L37 over-expression in prostate-cancer tissue samples. (United States)

    Vaarala, M H; Porvari, K S; Kyllönen, A P; Mustonen, M V; Lukkarinen, O; Vihko, P T


    A cDNA library specific for mRNA over-expressed in prostate cancer was generated by subtractive hybridization of transcripts originating from prostatic hyperplasia and cancer tissues. cDNA encoding ribosomal proteins L4, L5, L7a, L23a, L30, L37, S14 and S18 was found to be present among 100 analyzed clones. Levels of ribosomal mRNA were significantly higher at least in one of the prostate-cancer cell lines, LNCaP, DU-145 and PC-3, than in hyperplastic tissue, as determined by slot-blot hybridization. Furthermore, L23a- and S14-transcript levels were significantly elevated in PC-3 cells as compared with those in the normal prostate epithelial cell line PrEC. Generally, dramatic changes in the mRNA content of the ribosomal proteins were not detected, the most evident over-expression being that of L37 mRNA, which was 3.4 times more abundant in LNCaP cells than in hyperplastic prostate tissue. The over-expression of L7a and L37 mRNA was confirmed in prostate-cancer tissue samples by in situ hybridization. Elevated cancer-related expression of L4 and L30 has not been reported, but levels of the other ribosomal proteins are known to be increased in several types of cancers. These results therefore suggest that prostate cancer is comparable with other types of cancers, in that a larger pool of some ribosomal proteins is gained during the transformation process, by an unknown mechanism.

  13. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik


    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  14. Trapping the ribosome to control gene expression. (United States)

    Boehringer, Daniel; Ban, Nenad


    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  15. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae. (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K


    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.


    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  17. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6. (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian


    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  18. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Directory of Open Access Journals (Sweden)

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  19. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.


    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  20. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  1. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)


    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  2. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A


    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  3. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Karpen, G.H.


    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional

  4. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants. (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N


    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  5. Replication and meiotic transmission of yeast ribosomal RNA genes. (United States)

    Brewer, B J; Zakian, V A; Fangman, W L


    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  6. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne


    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  7. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia


    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  8. Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae). (United States)

    Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping


    The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

  9. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription. (United States)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen


    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne


    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  11. Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

    Directory of Open Access Journals (Sweden)

    Ian M Willis


    Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

  12. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

  13. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.


    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  14. Hyper-regulation of pyr-gene expression in Escherichia coli cells with slow ribosomes. Evidence for RNA polymerase pausing in vivo

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank


    UTP-modulated attenuation of transcription is involved in regulating the synthesis of pyrimidine nucleotides in Escherichia coli. Thus, expression of two genes, pyrBI and pyrE, was shown to be under this type of control. The genes encode the two subunits of aspartate transcarbamylase and orotate...... transcription should terminate or continue into the structural genes. This paper described a study of pyrBI and pyrE gene regulation in cells where the ribosomes move slowly as a result of mutation in rpsL. It appears that expression of the two genes is hyper-regulated by the UTP pool in this type of cells...

  15. Evidence for ribosomal frameshifting and a novel overlapping gene in the genomes of insect-specific flaviviruses

    International Nuclear Information System (INIS)

    Firth, Andrew E.; Blitvich, Bradley J.; Wills, Norma M.; Miller, Cathy L.; Atkins, John F.


    Flaviviruses have a positive-sense, single-stranded RNA genome of ∼11 kb, encoding a large polyprotein that is cleaved to produce ∼10 mature proteins. Cell fusing agent virus, Kamiti River virus, Culex flavivirus and several recently discovered flaviviruses have no known vertebrate host and apparently infect only insects. We present compelling bioinformatic evidence for a 253-295 codon overlapping gene (designated fifo) conserved throughout these insect-specific flaviviruses and immunofluorescent detection of its product. Fifo overlaps the NS2A/NS2B coding sequence in the - 1/+ 2 reading frame and is most likely expressed as a trans-frame fusion protein via ribosomal frameshifting at a conserved GGAUUUY slippery heptanucleotide with 3'-adjacent RNA secondary structure (which stimulates efficient frameshifting in vitro). The discovery bears striking parallels to the recently discovered ribosomal frameshifting site in the NS2A coding sequence of the Japanese encephalitis serogroup of flaviviruses and suggests that programmed ribosomal frameshifting may be more widespread in flaviviruses than currently realized.

  16. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome. (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi


    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  17. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.


    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  18. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus. (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc


    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  19. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael


    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  20. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium. (United States)

    Catania, Francesco; Lynch, Michael


    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  1. Extreme expansion of NBS-encoding genes in Rosaceae. (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui


    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  2. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein


    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  3. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)


    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  4. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.


    Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...

  5. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  6. Mitochondrial genome evolution in Alismatales: Size reduction and extensive loss of ribosomal protein genes

    DEFF Research Database (Denmark)

    Petersen, Gitte; Cuenca, Argelia; Zervas, Athanasios


    The order Alismatales is a hotspot for evolution of plant mitochondrial genomes characterized by remarkable differences in genome size, substitution rates, RNA editing, retrotranscription, gene loss and intron loss. Here we have sequenced the complete mitogenomes of Zostera marina and Stratiotes...... aloides, which together with previously sequenced mitogenomes from Butomus and Spirodela, provide new evolutionary evidence of genome size reduction, gene loss and transfer to the nucleus. The Zostera mitogenome includes a large portion of DNA transferred from the plastome, yet it is the smallest known...... mitogenome from a non-parasitic plant. Using a broad sample of the Alismatales, the evolutionary history of ribosomal protein gene loss is analyzed. In Zostera almost all ribosomal protein genes are lost from the mitogenome, but only some can be found in the nucleus....

  7. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis


    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  8. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)



    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  9. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  10. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

    Directory of Open Access Journals (Sweden)

    Mingsheng Yang


    Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

  11. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia


    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  12. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  13. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major. (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago


    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  14. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A


    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  15. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat


    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  16. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne


    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  17. A deep auto-encoder model for gene expression prediction. (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua


    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  18. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda. (United States)

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song


    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  19. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  20. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)


    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  1. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)


    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  2. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.


    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  3. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene]. (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong


    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  4. Active ribosomal genes, translational homeostasis and oxidative stress in the pathogenesis of schizophrenia and autism. (United States)

    Porokhovnik, Lev N; Passekov, Vladimir P; Gorbachevskaya, Nataliya L; Sorokin, Alexander B; Veiko, Nataliya N; Lyapunova, Nataliya A


    Infantile autism and schizophrenia are severe multifactorial disorders with a pronounced genetic predisposition. Their pathogeneses are often associated with oxidative stress in the brain. Previously, we established that a cell's resistance to oxidative stress depended on the copy number of transcriptionally active genes for rRNA (ribosomal genes) in the cell's genome. The feature is measured cytogenetically in cultured lymphocytes derived from patients. It varies from 120 up to 190 copies per diploid genome, with an arithmetic mean of 150±4 (SE) copies in a healthy population (n=239), being considerably lower, according to our previous results, in a sample of patients with rheumatoid arthritis (n=49), another multifactorial disease with a proven significant role of oxidative stress in its pathogenesis: from 115 to 165 copies, with a mean of 140±4 (SE). Conversely, a sample of schizophrenic patients (n=42) previously showed a higher value of copy number of active rRNA genes compared with a healthy population: from 145 to 190 copies, with a mean of 170±4. This fact is of special interest in the context of the well-known, but still unexplained phenomenon of the reduced comorbidity rate of schizophrenia and rheumatoid arthritis. The copy number of active ribosomal genes was estimated in a sample of autistic children (n=51). In contrast with the schizophrenic patients studied previously, we found that the values were significantly lower than those in the healthy population: from 125 to 160 copies, with a mean of 142±5. In this work, we suggest a mathematical model of the oxidative stress dynamics on the basis of Lotka-Volterra's approach to predator-prey interactions. In our model, the 'prey' represents reactive oxygen species, whereas the 'predator' simulates molecules of the antioxidant enzymes. The rate of biosynthesis of the latter is limited by the number of ribosomes available, which, in turn, is determined by the copy number of active rRNA genes. Analysis of

  5. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes. (United States)

    Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver


    In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

  6. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  7. Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

    Directory of Open Access Journals (Sweden)

    Vingron Martin


    Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

  8. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica


    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  9. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari


    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  10. Fungicidal activity of peptides encoded by immunoglobulin genes


    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania


    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  11. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence (United States)

    Ortega, Maya


    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  12. Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer

    DEFF Research Database (Denmark)

    Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck


    Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...

  13. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species]. (United States)

    Piscopo, Sara-Pier; Drouin, Guy


    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  14. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C


    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  15. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU


    Full Text Available Cellobiohydrolases (EC are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC and β-glucosidases (EC Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  16. Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

    International Nuclear Information System (INIS)

    Planello, R.; Martinez-Guitarte, J.L.; Morcillo, G.


    Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

  17. Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

    Energy Technology Data Exchange (ETDEWEB)

    Planello, R. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Martinez-Guitarte, J.L. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Morcillo, G. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain)]. E-mail:


    Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

  18. Characterization of the ovine ribosomal protein SA gene and its pseudogenes

    Directory of Open Access Journals (Sweden)

    Van Zeveren Alex


    Full Text Available Abstract Background The ribosomal protein SA (RPSA, previously named 37-kDa laminin receptor precursor/67-kDa laminin receptor (LRP/LR is a multifunctional protein that plays a role in a number of pathological processes, such as cancer and prion diseases. In all investigated species, RPSA is a member of a multicopy gene family consisting of one full length functional gene and several pseudogenes. Therefore, for studies on RPSA related pathways/pathologies, it is important to characterize the whole family and to address the possible function of the other RPSA family members. The present work aims at deciphering the RPSA family in sheep. Results In addition to the full length functional ovine RPSA gene, 11 other members of this multicopy gene family, all processed pseudogenes, were identified. Comparison between the RPSA transcript and these pseudogenes shows a large variety in sequence identities ranging from 99% to 74%. Only one of the 11 pseudogenes, i.e. RPSAP7, shares the same open reading frame (ORF of 295 amino acids with the RPSA gene, differing in only one amino acid. All members of the RPSA family were annotated by comparative mapping and fluorescence in situ hybridization (FISH localization. Transcription was investigated in the cerebrum, cerebellum, spleen, muscle, lymph node, duodenum and blood, and transcripts were detected for 6 of the 11 pseudogenes in some of these tissues. Conclusions In the present work we have characterized the ovine RPSA family. Our results have revealed the existence of 11 ovine RPSA pseudogenes and provide new data on their structure and sequence. Such information will facilitate molecular studies of the functional RPSA gene taking into account the existence of these pseudogenes in the design of experiments. It remains to be investigated if the transcribed members are functional as regulatory non-coding RNA or as functional proteins.

  19. Sublethal effects of imidacloprid on targeting muscle and ribosomal protein related genes in the honey bee Apis mellifera L. (United States)

    Wu, Yan-Yan; Luo, Qi-Hua; Hou, Chun-Sheng; Wang, Qiang; Dai, Ping-Li; Gao, Jing; Liu, Yong-Jun; Diao, Qing-Yun


    A sublethal concentration of imidacloprid can cause chronic toxicity in bees and can impact the behavior of honey bees. The nectar- and water-collecting, and climbing abilities of bees are crucial to the survival of the bees and the execution of responsibilities in bee colonies. Besides behavioral impact, data on the molecular mechanisms underlying the toxicity of imidacloprid, especially by the way of RNA-seq at the transcriptomic level, are limited. We treated Apis mellifera L. with sublethal concentrations of imidacloprid (0.1, 1 and 10 ppb) and determined the effect on behaviors and the transcriptomic changes. The sublethal concentrations of imidacloprid had a limited impact on the survival and syrup consumption of bees, but caused a significant increase in water consumption. Moreover, the climbing ability was significantly impaired by 10 ppb imidacloprid at 8 d. In the RNA-seq analysis, gene ontology (GO) term enrichment indicated a significant down-regulation of muscle-related genes, which might contribute to the impairment in climbing ability of bees. The enriched GO terms were attributed to the up-regulated ribosomal protein genes. Considering the ribosomal and extra-ribosomal functions of the ribosomal proteins, we hypothesized that imidacloprid also causes cell dysfunction. Our findings further enhance the understanding of imidacloprid sublethal toxicity.

  20. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)


    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  1. Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

    Directory of Open Access Journals (Sweden)

    Larisa Gunderina


    Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

  2. Characterization of the human gene (TBXAS1) encoding thromboxane synthase. (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T


    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  3. cDNA Cloning, Overexpression, Purification and Pharmacologic Evaluation for Anticancer Activity of Ribosomal Protein L23A Gene (RPL23A from the Giant Panda

    Directory of Open Access Journals (Sweden)

    Si-Nan Zhang


    Full Text Available RPL23A gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins, which is located in the cytoplasm. The purpose of this paper was to explore the structure and anti-cancer function of ribosomal protein L23A (RPL23A gene of the Giant Panda (Ailuropoda melanoleuca. The cDNA of RPL23A was cloned successfully from the Giant Panda using RT-PCR technology. We constructed a recombinant expression vector containing RPL23A cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product obtained was purified by using Ni chelating affinity chromatography. Recombinant protein of RPL23A obtained from the experiment acted on Hep-2 cells and human HepG-2 cells, then the growth inhibitory effect of these cells was observed by MTT (3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide assay. The result indicated that the length of the fragment cloned is 506 bp, and it contains an open-reading frame (ORF of 471 bp encoding 156 amino acids. Primary structure analysis revealed that the molecular weight of the putative RPL23A protein is 17.719 kDa with a theoretical pI 11.16. The molecular weight of the recombinant protein RPL23A is 21.265 kDa with a theoretical pI 10.57. The RPL23A gene can be really expressed in E. coli and the RPL23A protein, fusioned with the N-terminally His-tagged protein, gave rise to the accumulation of an expected 22 KDa polypeptide. The data showed that the recombinant protein RPL23A had a time- and dose-dependency on the cell growth inhibition rate. The data also indicated that the effect at low concentrations was better than at high concentrations on Hep-2 cells, and that the concentration of 0.185 μg/mL had the best rate of growth inhibition of 36.31%. All results of the experiment revealed that the recombinant protein RPL23A exhibited anti-cancer function on the Hep-2 cells. The study provides a scientific basis and aids

  4. Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array. (United States)

    Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P


    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

  5. Chromosomal divergence and evolutionary inferences in Rhodniini based on the chromosomal location of ribosomal genes

    Directory of Open Access Journals (Sweden)

    Sebastian Pita


    Full Text Available In this study, we used fluorescence in situ hybridisation to determine the chromosomal location of 45S rDNA clusters in 10 species of the tribe Rhodniini (Hemiptera: Reduviidae: Triatominae. The results showed striking inter and intraspecific variability, with the location of the rDNA clusters restricted to sex chromosomes with two patterns: either on one (X chromosome or both sex chromosomes (X and Y chromosomes. This variation occurs within a genus that has an unchanging diploid chromosome number (2n = 22, including 20 autosomes and 2 sex chromosomes and a similar chromosome size and genomic DNA content, reflecting a genome dynamic not revealed by these chromosome traits. The rDNA variation in closely related species and the intraspecific polymorphism in Rhodnius ecuadoriensis suggested that the chromosomal position of rDNA clusters might be a useful marker to identify recently diverged species or populations. We discuss the ancestral position of ribosomal genes in the tribe Rhodniini and the possible mechanisms involved in the variation of the rDNA clusters, including the loss of rDNA loci on the Y chromosome, transposition and ectopic pairing. The last two processes involve chromosomal exchanges between both sex chromosomes, in contrast to the widely accepted idea that the achiasmatic sex chromosomes of Heteroptera do not interchange sequences.

  6. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene. (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou


    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  7. Replicative age induces mitotic recombination in the ribosomal RNA gene cluster of Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Derek L Lindstrom


    Full Text Available Somatic mutations contribute to the development of age-associated disease. In earlier work, we found that, at high frequency, aging Saccharomyces cerevisiae diploid cells produce daughters without mitochondrial DNA, leading to loss of respiration competence and increased loss of heterozygosity (LOH in the nuclear genome. Here we used the recently developed Mother Enrichment Program to ask whether aging cells that maintain the ability to produce respiration-competent daughters also experience increased genomic instability. We discovered that this population exhibits a distinct genomic instability phenotype that primarily affects the repeated ribosomal RNA gene array (rDNA array. As diploid cells passed their median replicative life span, recombination rates between rDNA arrays on homologous chromosomes progressively increased, resulting in mutational events that generated LOH at >300 contiguous open reading frames on the right arm of chromosome XII. We show that, while these recombination events were dependent on the replication fork block protein Fob1, the aging process that underlies this phenotype is Fob1-independent. Furthermore, we provide evidence that this aging process is not driven by mechanisms that modulate rDNA recombination in young cells, including loss of cohesion within the rDNA array or loss of Sir2 function. Instead, we suggest that the age-associated increase in rDNA recombination is a response to increasing DNA replication stress generated in aging cells.

  8. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53. (United States)

    Loging, W T; Reisman, D


    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  9. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital


    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami


    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  10. A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

    Directory of Open Access Journals (Sweden)

    Jean-Clement Mars


    Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

  11. Dinoflagellate phylogeny as inferred from heat shock protein 90 and ribosomal gene sequences.

    Directory of Open Access Journals (Sweden)

    Mona Hoppenrath


    Full Text Available Interrelationships among dinoflagellates in molecular phylogenies are largely unresolved, especially in the deepest branches. Ribosomal DNA (rDNA sequences provide phylogenetic signals only at the tips of the dinoflagellate tree. Two reasons for the poor resolution of deep dinoflagellate relationships using rDNA sequences are (1 most sites are relatively conserved and (2 there are different evolutionary rates among sites in different lineages. Therefore, alternative molecular markers are required to address the deeper phylogenetic relationships among dinoflagellates. Preliminary evidence indicates that the heat shock protein 90 gene (Hsp90 will provide an informative marker, mainly because this gene is relatively long and appears to have relatively uniform rates of evolution in different lineages.We more than doubled the previous dataset of Hsp90 sequences from dinoflagellates by generating additional sequences from 17 different species, representing seven different orders. In order to concatenate the Hsp90 data with rDNA sequences, we supplemented the Hsp90 sequences with three new SSU rDNA sequences and five new LSU rDNA sequences. The new Hsp90 sequences were generated, in part, from four additional heterotrophic dinoflagellates and the type species for six different genera. Molecular phylogenetic analyses resulted in a paraphyletic assemblage near the base of the dinoflagellate tree consisting of only athecate species. However, Noctiluca was never part of this assemblage and branched in a position that was nested within other lineages of dinokaryotes. The phylogenetic trees inferred from Hsp90 sequences were consistent with trees inferred from rDNA sequences in that the backbone of the dinoflagellate clade was largely unresolved.The sequence conservation in both Hsp90 and rDNA sequences and the poor resolution of the deepest nodes suggests that dinoflagellates reflect an explosive radiation in morphological diversity in their recent

  12. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  13. Role of blood ribosomal protein S19 in coagulum resorption: a study using Gln137Glu-ribosomal protein S19 gene knock-in mouse. (United States)

    Chen, Jun; Fujino, Rika; Zhao, Rui; Semba, Umeko; Araki, Kimi; Yamamoto, Tetsuro


    Sera of human, guinea pig or mouse contain a strong monocyte chemoattractant capacity that is attributed to the ribosomal protein S19 (RP S19) oligomers generated during blood coagulation. In contrast, sera prepared from Gln137Glu-RP S19 gene knock-in mice contained negligible chemoattractant capacity. When coagula that had been pre-formed from the blood of both the wild type and knock-in mice were intraperitoneally inserted into host mice, after 3 days of recovery, the knock-in mouse coagula remained larger than the wild type mouse coagula. The wild type mouse coagula were covered by multiple macrophage layers at the surface and were infiltrated inside by macrophages. Knock-in mouse coagula exhibited less macrophage involvement. When coagula of knock-in mice and coagula of knock-in mice containing C5a/RP S19, an artificial substitute of the RP S19 oligomers, were intraperitoneally inserted as pairs, the C5a/RP S19 containing coagulum was more rapidly absorbed, concomitant with increased macrophage involvement. Finally, when the knock-in mouse and wild type mouse coagula pairs were inserted into mice in which macrophages had been depleted using clodronate liposome, the size difference of recovered coagula was reversed. These results indicate the importance of the RP S19 oligomer-induced macrophage recruitment in coagulum resorption. © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.

  14. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin


    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  15. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M


    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  16. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang


    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  17. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling. (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian


    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  18. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen


    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  19. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana. (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi


    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  20. Gene conversion of ribosomal DNA in Nicotiana tabacum is associated with undermethylated, decondensed and probably active gene units. (United States)

    Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R


    We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N

  1. Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003. (United States)

    Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe


    Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

  2. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Directory of Open Access Journals (Sweden)

    Olga Fernández-Miragall

    Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  3. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity. (United States)

    Fernández-Miragall, Olga; Hernández, Carmen


    Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  4. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  5. The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia. (United States)

    Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong


    Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

  6. The Proximity of Ribosomal Protein Genes to oriC Enhances Vibrio cholerae Fitness in the Absence of Multifork Replication. (United States)

    Soler-Bistué, Alfonso; Timmermans, Michaël; Mazel, Didier


    Recent works suggest that bacterial gene order links chromosome structure to cell homeostasis. Comparative genomics showed that, in fast-growing bacteria, ribosomal protein genes (RP) locate near the replication origin ( oriC ). We recently showed that Vibrio cholerae employs this positional bias as a growth optimization strategy: under fast-growth conditions, multifork replication increases RP dosage and expression. However, RP location may provide advantages in a dosage-independent manner: for example, the physical proximity of the many ribosomal components, in the context of a crowded cytoplasm, may favor ribosome biogenesis. To uncover putative dosage-independent effects, we studied isogenic V. cholerae derivatives in which the major RP locus, S10-spc-α (S10), was relocated to alternative genomic positions. When bacteria grew fast, bacterial fitness was reduced according to the S10 relative distance to oriC The growth of wild-type V. cholerae could not be improved by additional copies of the locus, suggesting a physiologically optimized genomic location. Slow growth is expected to uncouple RP position from dosage, since multifork replication does not occur. Under these conditions, we detected a fitness impairment when S10 was far from oriC Deep sequencing followed by marker frequency analysis in the absence of multifork replication revealed an up to 30% S10 dosage reduction associated with its relocation that closely correlated with fitness alterations. Hence, the impact of S10 location goes beyond a growth optimization strategy during feast periods. RP location may be important during the whole life cycle of this pathogen. IMPORTANCE The role of gene order within the bacterial chromosome is poorly understood. In fast growers, the location of genes linked with the expression of genetic information (i.e., transcription and translation) is biased toward oriC It was proposed that the location of these genes helps to maximize their expression by recruiting

  7. Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers. (United States)

    Madalena, Christiane Rodriguez Gutierrez; Díez, José Luís; Gorab, Eduardo


    Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs) located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA), allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

  8. Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

    Directory of Open Access Journals (Sweden)

    Christiane Rodriguez Gutierrez Madalena

    Full Text Available Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA, allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

  9. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den


    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  10. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  11. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  12. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family. (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales


    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  13. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.


    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  14. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.


    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  15. Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

    Directory of Open Access Journals (Sweden)

    Hui-Yeng Y Yap

    Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

  16. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun


    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  17. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne


    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  18. Identification of Genes Enriched in GnRH Neurons by Translating Ribosome Affinity Purification and RNAseq in Mice. (United States)

    Burger, Laura L; Vanacker, Charlotte; Phumsatitpong, Chayarndorn; Wagenmaker, Elizabeth R; Wang, Luhong; Olson, David P; Moenter, Suzanne M


    Gonadotropin-releasing hormone (GnRH) neurons are a nexus of fertility regulation. We used translating ribosome affinity purification coupled with RNA sequencing to examine messenger RNAs of GnRH neurons in adult intact and gonadectomized (GDX) male and female mice. GnRH neuron ribosomes were tagged with green fluorescent protein (GFP) and GFP-labeled polysomes isolated by immunoprecipitation, producing one RNA fraction enhanced for GnRH neuron transcripts and one RNA fraction depleted. Complementary DNA libraries were created from each fraction and 50-base, paired-end sequencing done and differential expression (enhanced fraction/depleted fraction) determined with a threshold of >1.5- or <0.66-fold (false discovery rate P ≤ 0.05). A core of ∼840 genes was differentially expressed in GnRH neurons in all treatments, including enrichment for Gnrh1 (∼40-fold), and genes critical for GnRH neuron and/or gonadotrope development. In contrast, non-neuronal transcripts were not enriched or were de-enriched. Several epithelial markers were also enriched, consistent with the olfactory epithelial origins of GnRH neurons. Interestingly, many synaptic transmission pathways were de-enriched, in accordance with relatively low innervation of GnRH neurons. The most striking difference between intact and GDX mice of both sexes was a marked downregulation of genes associated with oxidative phosphorylation and upregulation of glucose transporters in GnRH neurons from GDX mice. This may suggest that GnRH neurons switch to an alternate fuel to increase adenosine triphosphate production in the absence of negative feedback when GnRH release is elevated. Knowledge of the GnRH neuron translatome and its regulation can guide functional studies and can be extended to disease states, such as polycystic ovary syndrome.

  19. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V


    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  20. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P


    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  1. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

    Directory of Open Access Journals (Sweden)

    Ricardo Harakava


    Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

  2. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen


    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  3. A highly divergent gene cluster in honey bees encodes a novel silk family. (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S


    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  4. Nuclear pores and perinuclear expression sites of var and ribosomal DNA genes correspond to physically distinct regions in Plasmodium falciparum. (United States)

    Guizetti, Julien; Martins, Rafael Miyazawa; Guadagnini, Stéphanie; Claes, Aurélie; Scherf, Artur


    The human malaria parasite Plasmodium falciparum modifies the erythrocyte it infects by exporting variant proteins to the host cell surface. The var gene family that codes for a large, variant adhesive surface protein called P. falciparum erythrocyte membrane protein 1 (PfEMP1) plays a particular role in this process, which is linked to pathogenesis and immune evasion. A single member of this gene family is highly transcribed while the other 59 members remain silenced. Importantly, var gene transcription occurs at a spatially restricted, but yet undefined, perinuclear site that is distinct from repressed var gene clusters. To advance our understanding of monoallelic expression, we investigated whether nuclear pores associate with the var gene expression site. To this end, we studied the nuclear pore organization during the asexual blood stage using a specific antibody directed against a subunit of the nuclear pore, P. falciparum Nup116 (PfNup116). Ring and schizont stage parasites showed highly polarized nuclear pore foci, whereas in trophozoite stage nuclear pores redistributed over the entire nuclear surface. Colocalization studies of var transcripts and anti-PfNup116 antibodies showed clear dissociation between nuclear pores and the var gene expression site in ring stage. Similar results were obtained for another differentially transcribed perinuclear gene family, the ribosomal DNA units. Furthermore, we show that in the poised state, the var gene locus is not physically linked to nuclear pores. Our results indicate that P. falciparum does form compartments of high transcriptional activity at the nuclear periphery which are, unlike the case in yeast, devoid of nuclear pores.

  5. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain (United States)

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle


    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  6. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)


    Environmental stresses such as drought, cold and salinity have an enormous ... mechanisms is that a gene must be inducible in response to an external threat, to ..... of CPs known in plants. The others are legumain (C13), calcium-dependent.

  7. New Face for Chromatin-Related Mesenchymal Modulator: n-CHD9 Localizes to Nucleoli and Interacts With Ribosomal Genes. (United States)

    Salomon-Kent, Ronit; Marom, Ronit; John, Sam; Dundr, Miroslav; Schiltz, Louis R; Gutierrez, Jose; Workman, Jerry; Benayahu, Dafna; Hager, Gordon L


    Mesenchymal stem cells' differentiation into several lineages is coordinated by a complex of transcription factors and co-regulators which bind to specific gene promoters. The Chromatin-Related Mesenchymal Modulator, CHD9 demonstrated in vitro its ability for remodeling activity to reposition nucleosomes in an ATP-dependent manner. Epigenetically, CHD9 binds with modified H3-(K9me2/3 and K27me3). Previously, we presented a role for CHD9 with RNA Polymerase II (Pol II)-dependent transcription of tissue specific genes. Far less is known about CHD9 function in RNA Polymerase I (Pol I) related transcription of the ribosomal locus that also drives specific cell fate. We here describe a new form, the nucleolar CHD9 (n-CHD9) that is dynamically associated with Pol I, fibrillarin, and upstream binding factor (UBF) in the nucleoli, as shown by imaging and molecular approaches. Inhibitors of transcription disorganized the nucleolar compartment of transcription sites where rDNA is actively transcribed. Collectively, these findings link n-CHD9 with RNA pol I transcription in fibrillar centers. Using chromatin immunoprecipitation (ChIP) and tilling arrays (ChIP- chip), we find an association of n-CHD9 with Pol I related to rRNA biogenesis. Our new findings support the role for CHD9 in chromatin regulation and association with rDNA genes, in addition to its already known function in transcription control of tissue specific genes. © 2015 Wiley Periodicals, Inc.

  8. The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

    Directory of Open Access Journals (Sweden)

    Ruilin Wang

    Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

  9. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van


    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  10. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O


    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  11. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.


    Hays, Shan M; Swanson, Johanna; Selker, Eric U


    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  12. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production. (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu


    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  13. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages. (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T


    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  14. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  15. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.


    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  16. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins. (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman


    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  17. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  18. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  19. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  20. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)


    such as BRCA1 (a product of a breast cancer-associated gene) and Cb1 ... research has indicated that ubiquitination mediated by the ... environment and is unique to China. Since it is ..... benefit the normal biological function of the plant. We.

  1. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.


    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  2. Role of horizontal gene transfer as a control on the coevolution of ribosomal proteins and the genetic code

    Energy Technology Data Exchange (ETDEWEB)

    Woese, Carl R.; Goldenfeld, Nigel; Luthey-Schulten, Zaida


    Our main goal is to develop the conceptual and computational tools necessary to understand the evolution of the universal processes of translation and replication and to identify events of horizontal gene transfer that occurred within the components. We will attempt to uncover the major evolutionary transitions that accompanied the development of protein synthesis by the ribosome and associated components of the translation apparatus. Our project goes beyond standard genomic approaches to explore homologs that are represented at both the structure and sequence level. Accordingly, use of structural phylogenetic analysis allows us to probe further back into deep evolutionary time than competing approaches, permitting greater resolution of primitive folds and structures. Specifically, our work focuses on the elements of translation, ranging from the emergence of the canonical genetic code to the evolution of specific protein folds, mediated by the predominance of horizontal gene transfer in early life. A unique element of this study is the explicit accounting for the impact of phenotype selection on translation, through a coevolutionary control mechanism. Our work contributes to DOE mission objectives through: (1) sophisticated computer simulation of protein dynamics and evolution, and the further refinement of techniques for structural phylogeny, which complement sequence information, leading to improved annotation of genomic databases; (2) development of evolutionary approaches to exploring cellular function and machinery in an integrated way; and (3) documentation of the phenotype interaction with translation over evolutionary time, reflecting the system response to changing selection pressures through horizontal gene transfer.

  3. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd


    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.


    Wongsawad, Chalobol; Wongsawad, Pheravut; Sukontason, Kom; Phalee, Anawat; Noikong-Phalee, Waraporn; Chai, Jong Yil


    Trematode cercariae are commonly found in many freshwater gastropods. These cercariae can serve to identify the occurrence of such trematodes as Centrocestus formosanus, Haplorchis taichui, Haplorchoides sp, and Stellantchasmus falcatus, which are important parasites in Chiang Mai Province, Thailand. As the species of these cercariae cannot be identified accurately based on morphology, this study employed sequencing of a fragment of 28S ribosomal DNA and phylogenetic analysis to identify the trematode cercariae found in freshwater gastropods in Chiang Mai Province. Eight types of trematode cercariae were identified, namely, distome cercaria (grouped with Philophthalmus spp clade), echinostome cercaria (grouped with Echinostoma spp clade), furcocercous cercaria (grouped with Posthodiplostomum sp/Alaria taxideae/Hysteromorpha triloba clade), monostome cercaria (grouped with Catatropis indicus clade), parapleurolophocercous cercaria (grouped with Haplorchoides sp clade), pleurolophocercous cercaria (grouped with Centrocestusformosanus clade), transversotrema cercaria (grouped with Transversotrema spp clade), and xiphidiocercaria (grouped with Prosthodendrium spp clade). These results provide important information that can be used for identifying these parasites in epidemiological surveys.

  5. Sequence analysis of ribosomal and mitochondrial genes of the giant liver fluke Fascioloides magna (Trematoda: Fasciolidae): intraspecific variation and differentiation from Fasciola hepatica

    Czech Academy of Sciences Publication Activity Database

    Kráľová-Hromadová, I.; Špakulová, M.; Horáčková, Eva; Turčeková, Ĺ.; Novobilský, A.; Beck, R.; Koudela, Břetislav; Marinculić, A.; Rajský, D.; Pybus, M.


    Roč. 94, č. 1 (2008), s. 58-67 ISSN 0022-3395 R&D Projects: GA ČR GD524/03/H133; GA AV ČR IAA6022404 Grant - others:Slovak Research and Development Agency(SK) APVV-51-062205 Institutional research plan: CEZ:AV0Z60220518 Keywords : Fascioloides magna * Fasciola hepatica * ribosomal genes * mitochondrial genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.165, year: 2008

  6. Deletion of the Sm1 encoding motif in the lsm gene results in distinct changes in the transcriptome and enhanced swarming activity of Haloferax cells. (United States)

    Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita


    Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Multicistronic lentiviral vectors containing the FMDV 2A cleavage factor demonstrate robust expression of encoded genes at limiting MOI

    Directory of Open Access Journals (Sweden)

    Margison Geoffrey P


    Full Text Available Abstract Background A number of gene therapy applications would benefit from vectors capable of expressing multiple genes. In this study we explored the feasibility and efficiency of expressing two or three transgenes in HIV-1 based lentiviral vector. Bicistronic and tricistronic self-inactivating lentiviral vectors were constructed employing the internal ribosomal entry site (IRES sequence of encephalomyocarditis virus (EMCV and/or foot-and-mouth disease virus (FMDV cleavage factor 2A. We employed enhanced green fluorescent protein (eGFP, O6-methylguanine-DNA-methyltransferase (MGMT, and homeobox transcription factor HOXB4 as model genes and their expression was detected by appropriate methods including fluorescence microscopy, flow cytometry, immunocytochemistry, biochemical assay, and western blotting. Results All the multigene vectors produced high titer virus and were able to simultaneously express two or three transgenes in transduced cells. However, the level of expression of individual transgenes varied depending on: the transgene itself; its position within the construct; the total number of transgenes expressed; the strategy used for multigene expression and the average copy number of pro-viral insertions. Notably, at limiting MOI, the expression of eGFP in a bicistronic vector based on 2A was ~4 times greater than that of an IRES based vector. Conclusion The small and efficient 2A sequence can be used alone or in combination with an IRES for the construction of multicistronic lentiviral vectors which can express encoded transgenes at functionally relevant levels in cells containing an average of one pro-viral insert.

  8. Smoking, genes encoding dopamine pathway and risk for Parkinson's disease. (United States)

    Gu, Zhuqin; Feng, Xiuli; Dong, Xiumin; Chan, Piu


    Smoking has been reported to be inversely associated with Parkinson's disease (PD) in many studies, but a recent study in China found that smoking increased the risk of PD. Variants in genes associated with dopamine metabolism found to increase the risk for PD have also been associated with smoking behavior. To investigate the association between smoking and PD in a Chinese population and determine whether the genetic variants of genes involved in dopamine metabolism influence the relationship between smoking and risk for PD. Chinese PD patients were recruited from Xuanwu Hospital. Controls were sampled from community. Detailed information on life-long smoking behavior was collected by face-to-face interview. Genotypes were determined for SLC6A3 VNTR, COMT Val108/158Met and MAO-B intron13 A/G polymorphisms by PCR-RFLP, DHPLC and sequencing. Chi-square and logistic regression model were used in the analysis. 176 PD cases and 354 controls were enrolled in this study. 23.9% cases are smokers, compared to 48.0% in controls. Ever smoking is inversely associated with PD (odds ratio=0.14, 95% CI 0.08-0.26, adjusted for age and gender). None of the above-mentioned genetic polymorphisms was associated with PD risk or smoking. When each variant was included in the logistic regression model, the inverse association between smoking and PD remained the same, and the interactions between smoking and variants were not significant in the model. Our data support a reduction of PD risk associated with smoking in a Chinese population. These variants of genes associated with DA uptake and metabolism do not affect the inverse association between smoking and PD. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  9. Activation of the ribosomal RNA genes late in the third cell cycle of porcine embryos

    DEFF Research Database (Denmark)

    Viuff, Dorthe; Greve, Torben; Holm, Peter


    ; there was no silver staining at the sites of the rRNA genes and nucleolus precursor bodies. From 30 hpc onwards, most 4-cell embryos had medium size to large clusters of FITC-labeled areas colocalized with silver staining of rRNA gene clusters and fibrillogranular nucleoli. These observations indicate that r...

  10. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes. (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso


    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  11. A neurotransmitter transporter encoded by the Drosophila inebriated gene (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael


    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  12. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae. (United States)

    Laing, E; Pretorius, I S


    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  13. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene. (United States)

    Jordan, I K; Sutter, B A; McClure, M A


    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  14. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.


    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  15. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome. (United States)

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene


    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile. (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa


    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  17. Genes encoding calmodulin-binding proteins in the Arabidopsis genome (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.


    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  18. Molecular phylogenetic studies on an unnamed bovine Babesia sp. based on small subunit ribosomal RNA gene sequences. (United States)

    Luo, Jianxun; Yin, Hong; Liu, Zhijie; Yang, Dongying; Guan, Guiquan; Liu, Aihong; Ma, Miling; Dang, Shengzhi; Lu, Bingyi; Sun, Caiqin; Bai, Qi; Lu, Wenshun; Chen, Puyan


    The 18S small subunit ribosomal RNA (18S rRNA) gene of an unnamed Babesia species (designated B. U sp.) was sequenced and analyzed in an attempt to distinguish it from other Babesia species in China. The target DNA segment was amplified by polymerase chain reaction (PCR). The PCR product was ligated to the pGEM-T Easy vector for sequencing. It was found that the length of the 18S rRNA gene of all B. U sp. Kashi 1 and B. U sp. Kashi 2 was 1699 bp and 1689 bp. Two phylogenetic trees were, respectively, inferred based on 18S rRNA sequence of the Chinese bovine Babesia isolates and all of Babesia species available in GenBank. The first tree showed that B. U sp. was situated in the branch between B. major Yili and B. bovis Shannxian, and the second tree revealed that B. U sp. was confined to the same group as B. caballi. The percent identity of B. U sp. with other Chinese Babesia species was between 74.2 and 91.8, while the percent identity between two B. U sp. isolates was 99.7. These results demonstrated that this B. U sp. is different from other Babesia species, but that two B. U sp. isolates obtained with nymphal and adultal Hyalomma anatolicum anatolicum tick belong to the same species.

  19. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease. (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J


    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  20. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    DEFF Research Database (Denmark)

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E


    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

  1. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  2. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  3. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J


    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  4. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers. (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M


    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  5. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson


    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  6. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)



    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  7. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba. (United States)

    Galián, J A; Rosato, M; Rosselló, J A


    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  8. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana. (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V


    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  9. Expression profiling of Ribosomal Protein gene family in dehydration stress responses and characterization of transgenic rice plants overexpressing RPL23A for water-use efficiency and tolerance to drought and salt stresses (United States)

    Moin, Mazahar; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.


    Our previous findings on the screening of a large-pool of activation tagged rice plants grown under limited water conditions revealed the activation of Ribosomal Protein Large (RPL) subunit genes, RPL6 and RPL23A in two mutants that exhibited high water-use efficiency (WUE) with the genes getting activated by the integrated 4x enhancers (Moin et al., 2016a). In continuation of these findings, we have comprehensively characterized the Ribosomal Protein (RP) gene family including both small (RPS) and large (RPL) subunits, which have been identified to be encoded by at least 70 representative genes; RP-genes exist as multiple expressed copies with high nucleotide and amino acid sequence similarity. The differential expression of all the representative genes in rice was performed under limited water and drought conditions at progressive time intervals in the present study. More than 50% of the RP genes were upregulated in both shoot and root tissues. Some of them exhibited an overlap in the upregulation under both the treatments indicating that they might have a common role in inducing tolerance under limited water and drought conditions. Among the genes that became significantly upregulated in both the tissues and under both the treatments are RPL6, 7, 23A, 24 and 31 and RPS4, 10 and 18a. To further validate the role of RP genes in WUE and inducing tolerance to other stresses, we have raised transgenic plants overexpressing RPL23A in rice. The high expression lines of RPL23A exhibited low Δ13C, increased quantum efficiency along with suitable growth and yield parameters with respect to negative control under the conditions of limited water availability. The constitutive expression of RPL23A was also associated with transcriptional upregulation of many other RPL and RPS genes. The seedlings of RPL23A high expression lines also showed a significant increase in fresh weight, root length, proline and chlorophyll contents under simulated drought and salt stresses. Taken

  10. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed


    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  11. Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes

    International Nuclear Information System (INIS)

    Zhang, H.; Wang, J.C.; Liu, L.F.


    Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role

  12. Development of molecular cytogenetics and physical mapping of ribosomal RNA genes in Lupinus

    Czech Academy of Sciences Publication Activity Database

    Naganowska, B.; Doležel, Jaroslav; Swiecicki, W. K.


    Roč. 46, - (2003), s. 211-215 ISSN 0006-3134 R&D Projects: GA ČR GA521/03/0595 Institutional research plan: CEZ:AV0Z5038910 Keywords : fluorescent in situ hybridization * Lupinus sp. * rRNA genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.919, year: 2003

  13. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.


    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  14. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422. (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G


    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  15. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period. (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping


    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  16. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi


    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  17. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others


    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  18. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  19. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species. (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto


    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  20. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes]. (United States)

    Kuznedelov, K D; Timoshkin, O A


    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  1. Ellagic Acid-Changed Epigenome of Ribosomal Genes and Condensed RPA194-Positive Regions of Nucleoli in Tumour Cells. (United States)

    Legartová, S; Sbardella, G; Kozubek, S; Bártová, E


    We studied the effect of ellagic acid (EA) on the morphology of nucleoli and on the pattern of major proteins of the nucleolus. After EA treatment of HeLa cells, we observed condensation of nucleoli as documented by the pattern of argyrophilic nucleolar organizer regions (AgNORs). EA also induced condensation of RPA194-positive nucleolar regions, but no morphological changes were observed in nucleolar compartments positive for UBF1/2 proteins or fibrillarin. Studied morphological changes induced by EA were compared with the morphology of control, non-treated cells and with pronounced condensation of all nucleolar domains caused by actinomycin D (ACT-D) treatment. Similarly as ACT-D, but in a lesser extent, EA induced an increased number of 53BP1-positive DNA lesions. However, the main marker of DNA lesions, γH2AX, was not accumulated in body-like nuclear structures. An increased level of γH2AX was found by immunofluorescence and Western blots only after EA treatment. Intriguingly, the levels of fibrillarin, UBF1/2 and γH2AX were increased at the promoters of ribosomal genes, while 53BP1 and CARM1 levels were decreased by EA treatment at these genomic regions. In the entire genome, EA reduced H3R17 dimethylation. Taken together, ellagic acid is capable of significantly changing the nucleolar morphology and protein levels inside the nucleolus.

  2. An ancient spliceosomal intron in the ribosomal protein L7a gene (Rpl7a of Giardia lamblia

    Directory of Open Access Journals (Sweden)

    Gray Michael W


    Full Text Available Abstract Background Only one spliceosomal-type intron has previously been identified in the unicellular eukaryotic parasite, Giardia lamblia (a diplomonad. This intron is only 35 nucleotides in length and is unusual in possessing a non-canonical 5' intron boundary sequence, CT, instead of GT. Results We have identified a second spliceosomal-type intron in G. lamblia, in the ribosomal protein L7a gene (Rpl7a, that possesses a canonical GT 5' intron boundary sequence. A comparison of the two known Giardia intron sequences revealed extensive nucleotide identity at both the 5' and 3' intron boundaries, similar to the conserved sequence motifs recently identified at the boundaries of spliceosomal-type introns in Trichomonas vaginalis (a parabasalid. Based on these observations, we searched the partial G. lamblia genome sequence for these conserved features and identified a third spliceosomal intron, in an unassigned open reading frame. Our comprehensive analysis of the Rpl7a intron in other eukaryotic taxa demonstrates that it is evolutionarily conserved and is an ancient eukaryotic intron. Conclusion An analysis of the phylogenetic distribution and properties of the Rpl7a intron suggests its utility as a phylogenetic marker to evaluate particular eukaryotic groupings. Additionally, analysis of the G. lamblia introns has provided further insight into some of the conserved and unique features possessed by the recently identified spliceosomal introns in related organisms such as T. vaginalis and Carpediemonas membranifera.

  3. Discrimination between ovine Babesia and Theileria species in China based on the ribosomal protein S8 (RPS8) gene. (United States)

    Tian, Zhancheng; Liu, Guangyuan; Yin, Hong; Luo, Jianxun; Guan, Guiquan; Luo, Jin; Xie, Junren; Zheng, Jinfeng; Yuan, Xiaosong; Wang, Fangfang; Shen, Hui; Tian, Meiyuan


    Ovine babesiosis and theileriosis are important hemoprotozoal diseases of sheep and goats in tropical and subtropical regions that lead to economic losses in these animals. PCR-restriction fragment length polymorphism (PCR-RFLP) is a reliable molecular diagnostic tool for discriminating Theileria or Babesia species in the same host. In this study, the DNA sequences of a ribosomal protein S8 (RPS8) gene from four species of piroplasms in China were used to develop a species-specific PCR-RFLP diagnostic tool. The sensitivity of the PCR assays was 0.1 pg DNA for B. motasi and 1 pg DNA for T. uilenbergi and 10 pg DNA for Babesia sp. Xinjiang-2005 and T. luwenshuni. The clear size difference of the PCR products allowed for a direct discrimination for B. motasi, Babesia sp. Xinjiang-2005 and ovine Theileria species (T. uilenbergi and T. luwenshuni), except that the mixed infection between T. uilenbergi and T. luwenshuni may be difficult to distinguish, simply after the electrophoretic separation of the amplification products. Further T. uilenbergi and T. luwenshuni diagnoses were made by digesting the PCR product with SacI. The established method could be applicable for the survey of parasite dynamics, and epidemiological studies as well as prevention and control of the disease. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species. (United States)

    Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I


    All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  5. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae]. (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A


    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  6. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma


    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  7. NINJA-OPS: Fast Accurate Marker Gene Alignment Using Concatenated Ribosomes.

    Directory of Open Access Journals (Sweden)

    Gabriel A Al-Ghalith


    Full Text Available The explosion of bioinformatics technologies in the form of next generation sequencing (NGS has facilitated a massive influx of genomics data in the form of short reads. Short read mapping is therefore a fundamental component of next generation sequencing pipelines which routinely match these short reads against reference genomes for contig assembly. However, such techniques have seldom been applied to microbial marker gene sequencing studies, which have mostly relied on novel heuristic approaches. We propose NINJA Is Not Just Another OTU-Picking Solution (NINJA-OPS, or NINJA for short, a fast and highly accurate novel method enabling reference-based marker gene matching (picking Operational Taxonomic Units, or OTUs. NINJA takes advantage of the Burrows-Wheeler (BW alignment using an artificial reference chromosome composed of concatenated reference sequences, the "concatesome," as the BW input. Other features include automatic support for paired-end reads with arbitrary insert sizes. NINJA is also free and open source and implements several pre-filtering methods that elicit substantial speedup when coupled with existing tools. We applied NINJA to several published microbiome studies, obtaining accuracy similar to or better than previous reference-based OTU-picking methods while achieving an order of magnitude or more speedup and using a fraction of the memory footprint. NINJA is a complete pipeline that takes a FASTA-formatted input file and outputs a QIIME-formatted taxonomy-annotated BIOM file for an entire MiSeq run of human gut microbiome 16S genes in under 10 minutes on a dual-core laptop.

  8. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria. (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A


    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  9. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.


    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  10. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations. (United States)

    Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C


    Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans


    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa


    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  12. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)


    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou


    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  13. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.


    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  14. High-Resolution Melting Curve Analysis of the 16S Ribosomal Gene to Detect and Identify Pathogenic and Saprophytic Leptospira Species in Colombian Isolates. (United States)

    Peláez Sánchez, Ronald G; Quintero, Juan Álvaro López; Pereira, Martha María; Agudelo-Flórez, Piedad


    AbstractIt is important to identify the circulating Leptospira agent to enhance the performance of serodiagnostic tests by incorporating specific antigens of native species, develop vaccines that take into account the species/serovars circulating in different regions, and optimize prevention and control strategies. The objectives of this study were to develop a polymerase chain reaction (PCR)-high-resolution melting (HRM) assay for differentiating between species of the genus Leptospira and to verify its usefulness in identifying unknown samples to species level. A set of primers from the initial region of the 16S ribosomal gene was designed to detect and differentiate the 22 species of Leptospira . Eleven reference strains were used as controls to establish the reference species and differential melting curves. Twenty-five Colombian Leptospira isolates were studied to evaluate the usefulness of the PCR-HRM assay in identifying unknown samples to species level. This identification was confirmed by sequencing and phylogenetic analysis of the 16S ribosomal gene. Eleven Leptospira species were successfully identified, except for Leptospira meyeri / Leptospira yanagawae because the sequences were 100% identical. The 25 isolates from humans, animals, and environmental water sources were identified as Leptospira santarosai (twelve), Leptospira interrogans (nine), and L. meyeri / L. yanagawae (four). The species verification was 100% concordant between PCR-HRM and phylogenetic analysis of the 16S ribosomal gene. The PCR-HRM assay designed in this study is a useful tool for identifying Leptospira species from isolates.

  15. Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

    Directory of Open Access Journals (Sweden)

    Anne Kathrin Hett

    Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.

  16. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin


    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  17. Genes involved in translation of Mycoplasma hyopneumoniae and Mycoplasma synoviae

    Directory of Open Access Journals (Sweden)

    Mônica de Oliveira Santos


    Full Text Available This is a report on the analysis of genes involved in translation of the complete genomes of Mycoplasma hyopneumoniae strain J and 7448 and Mycoplasma synoviae. In both genomes 31 ORFs encoding large ribosomal subunit proteins and 19 ORFs encoding small ribosomal subunit proteins were found. Ten ribosomal protein gene clusters encoding 42 ribosomal proteins were found in M. synoviae, while 8 clusters encoding 39 ribosomal proteins were found in both M. hyopneumoniae strains. The L33 gene of the M. hyopneumoniae strain 7448 presented two copies in different locations. The genes encoding initiation factors (IF-1, IF-2 and IF-3, elongation factors (EF-G, EF-Tu, EF-Ts and EF-P, and the genes encoding the ribosome recycling factor (frr and one polypeptide release factor (prfA were present in the genomes of M. hyopneumoniae and M. synoviae. Nineteen aminoacyl-tRNA synthases had been previously identified in both mycoplasmas. In the two strains of M. hyopneumoniae, J and 7448, only one set of 5S, 16S and 23S rRNAs had been identified. Two sets of 16S and 23S rRNA genes and three sets of 5S rRNA genes had been identified in the M. synoviae genome.

  18. Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes. (United States)

    Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai


    Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

  19. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica. (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui


    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  20. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family. (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J


    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  1. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin


    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  2. Accessibility of ribosomal genes to trimethyl psoralen in nuclei of Physarum polycephalum

    International Nuclear Information System (INIS)

    Judelson, H.S.; Vogt, V.M.


    The authors have probed the accessibility of the genes for rRNA in Physarum polycephalum by using the photoreactive DNA cross-linking agent 4,5',8-trimethyl psoralen. Nuclei isolated from actively growing Physarum were treated with trimethyl psoralen and irradiated with 360-nm light in order to form cross-links. The palindromic, extrachromosomal rDNA then was isolated, and the positions of cross-links were determined by electron microscopy of the DNA under totally denaturing conditions. The results indicate that the frequency of cross-linking, after correction for base sequence bias of the reaction, is up to sixfold higher in the transcribed regions than in the central or the terminal spacer regions. There is no detectable heterogeneity among the different rDNA molecules or between the halves of a single molecule. Cross-linked molecules invariably occur in a linear as opposed to a cruciform structure. The preferential cross-linking of the transcribed region is nearly eliminated in spherules, a dormant transcriptionally inactive form in the Physarum life cycle

  3. 5-Methyldeoxycytidine in the Physarum minichromosome containing the ribosomal RNA genes. (United States)

    Cooney, C A; Matthews, H R; Bradbury, E M


    5-Methyldeoxycytidine (5MC) was analyzed by high pressure liquid chromatography (HPLC) and by restriction enzyme digestion in rDNA isolated from Physarum polycephalum. rDNA from Physarum M3C strain microplasmodia has a significant 5MC content (about half that of the whole genomic DNA). This rDNA contains many C5MCGG sites because it is clearly digested further by Msp I than by Hpa II. However, most 5MC is in other sites. In particular, alternating CG sequences appear to be highly methylated. HPLC of deoxyribonucleosides shows tha most of the transcribed regions contain little or no 5MC. Restriction digestion indicates that there is little or no 5MC in any of the transcribed regions including the transcription origin and adjacent sequences. Over 90% of the total 5MC is in or near the central nontranscribed spacer and most methylated restriction sites are in inverted repeats of this spacer. rDNA is very heterogeneous with respect to 5MC. The 5MC pattern doesn't appear to change with inactivation of the rRNA genes during reversible differentiation from microplasmodia (growing) to microsclerotia (dormant), showing that inactivation is due to changes in other chromatin variables. The 5MC pattern is different between Physarum strains. The possible involvement of this 5MC in rDNA chromatin structure and in cruciform and Z-DNA formation is discussed. Images PMID:6322108

  4. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.


    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  5. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment. (United States)

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T


    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  6. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R


    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  7. The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles. (United States)

    Keebaugh, Alaine C; Thomas, James W


    Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

  8. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

  9. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes. (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G


    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  10. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))


    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  11. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period


    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping


    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  12. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase. (United States)

    Sugimura; Sawabe; Ezura


    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  13. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem. (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A


    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  14. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi


    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  15. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger. (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P


    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  16. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.


    Hahn, F M; Baker, J A; Poulter, C D


    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  17. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan


    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  18. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat


    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  19. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  20. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel


    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  1. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.


    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  2. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

    DEFF Research Database (Denmark)

    Douthwaite, S; Prince, J B; Noller, H F


    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

  3. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei


    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  4. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.


    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  5. Tumor-adjacent tissue co-expression profile analysis reveals pro-oncogenic ribosomal gene signature for prognosis of resectable hepatocellular carcinoma. (United States)

    Grinchuk, Oleg V; Yenamandra, Surya P; Iyer, Ramakrishnan; Singh, Malay; Lee, Hwee Kuan; Lim, Kiat Hon; Chow, Pierce Kah-Hoe; Kuznetsov, Vladamir A


    Currently, molecular markers are not used when determining the prognosis and treatment strategy for patients with hepatocellular carcinoma (HCC). In the present study, we proposed that the identification of common pro-oncogenic pathways in primary tumors (PT) and adjacent non-malignant tissues (AT) typically used to predict HCC patient risks may result in HCC biomarker discovery. We examined the genome-wide mRNA expression profiles of paired PT and AT samples from 321 HCC patients. The workflow integrated differentially expressed gene selection, gene ontology enrichment, computational classification, survival predictions, image analysis and experimental validation methods. We developed a 24-ribosomal gene-based HCC classifier (RGC), which is prognostically significant in both PT and AT. The RGC gene overexpression in PT was associated with a poor prognosis in the training (hazard ratio = 8.2, P = 9.4 × 10 -6 ) and cross-cohort validation (hazard ratio = 2.63, P = 0.004) datasets. The multivariate survival analysis demonstrated the significant and independent prognostic value of the RGC. The RGC displayed a significant prognostic value in AT of the training (hazard ratio = 5.0, P = 0.03) and cross-validation (hazard ratio = 1.9, P = 0.03) HCC groups, confirming the accuracy and robustness of the RGC. Our experimental and bioinformatics analyses suggested a key role for c-MYC in the pro-oncogenic pattern of ribosomal biogenesis co-regulation in PT and AT. Microarray, quantitative RT-PCR and quantitative immunohistochemical studies of the PT showed that DKK1 in PT is the perspective biomarker for poor HCC outcomes. The common co-transcriptional pattern of ribosome biogenesis genes in PT and AT from HCC patients suggests a new scalable prognostic system, as supported by the model of tumor-like metabolic redirection/assimilation in non-malignant AT. The RGC, comprising 24 ribosomal genes, is introduced as a robust and reproducible prognostic model for

  6. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi


    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  7. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies. (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B


    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  8. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene. (United States)

    Sudagidan, Mert; Aydin, Ali


    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  9. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions. (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade


    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  10. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity. (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K


    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae). (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou


    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  12. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun


    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  13. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique


    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  14. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes. (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos


    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  15. Comparison of protein coding gene contents of the fungal phyla Pezizomycotina and Saccharomycotina

    DEFF Research Database (Denmark)

    Arvas, Mikko; Kivioja, Teemu; Mitchell, Alex


    Saccharomycotina are slightly better characterised and predicted to encode mainly enzymes. The genes specific to Saccharomycotina are enriched in transcription and mitochondrion related functions. Especially mitochondrial ribosomal proteins seem to have diverged from those of Pezizomycotina. In addition, we...

  16. Activation of ribosomal RNA genes in porcine embryos produced in vitro or by somatic cell nuclear transfer

    DEFF Research Database (Denmark)

    Bjerregaard, Bolette; Pedersen, Hanne Gervi; Jakobsen, Anne Sørig


    The onset of ribosomal RNA (rRNA) synthesis occurs during the second half of the third cell cycle, that is, at the four-cell stage, in porcine embryos developed in vivo. In the present study the onset of rRNA synthesis was investigated in porcine embryos produced in vitro (IVP) or by somatic cell...

  17. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén


    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  18. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui


    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  19. Identification and Removal of Contaminant Sequences From Ribosomal Gene Databases: Lessons From the Census of Deep Life. (United States)

    Sheik, Cody S; Reese, Brandi Kiel; Twing, Katrina I; Sylvan, Jason B; Grim, Sharon L; Schrenk, Matthew O; Sogin, Mitchell L; Colwell, Frederick S


    Earth's subsurface environment is one of the largest, yet least studied, biomes on Earth, and many questions remain regarding what microorganisms are indigenous to the subsurface. Through the activity of the Census of Deep Life (CoDL) and the Deep Carbon Observatory, an open access 16S ribosomal RNA gene sequence database from diverse subsurface environments has been compiled. However, due to low quantities of biomass in the deep subsurface, the potential for incorporation of contaminants from reagents used during sample collection, processing, and/or sequencing is high. Thus, to understand the ecology of subsurface microorganisms (i.e., the distribution, richness, or survival), it is necessary to minimize, identify, and remove contaminant sequences that will skew the relative abundances of all taxa in the sample. In this meta-analysis, we identify putative contaminants associated with the CoDL dataset, recommend best practices for removing contaminants from samples, and propose a series of best practices for subsurface microbiology sampling. The most abundant putative contaminant genera observed, independent of evenness across samples, were Propionibacterium , Aquabacterium , Ralstonia , and Acinetobacter . While the top five most frequently observed genera were Pseudomonas , Propionibacterium , Acinetobacter , Ralstonia , and Sphingomonas . The majority of the most frequently observed genera (high evenness) were associated with reagent or potential human contamination. Additionally, in DNA extraction blanks, we observed potential archaeal contaminants, including methanogens, which have not been discussed in previous contamination studies. Such contaminants would directly affect the interpretation of subsurface molecular studies, as methanogenesis is an important subsurface biogeochemical process. Utilizing previously identified contaminant genera, we found that ∼27% of the total dataset were identified as contaminant sequences that likely originate from DNA

  20. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.


    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  1. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana. (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E


    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  2. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    International Nuclear Information System (INIS)

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.


    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  3. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua


    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  4. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John


    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  5. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando


    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  6. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.


    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  7. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.


    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  8. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae* (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko


    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  9. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression. (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine


    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  10. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum. (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane


    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  11. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  12. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  13. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve. (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe


    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  14. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  15. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy


    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  16. Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Takuya Kamio

    Full Text Available MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA and in 5q- myelodysplastic syndrome (MDS. DBA and 5q- MDS are associated with inherited (DBA or acquired (5q- MDS haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F, retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM, these mice showed a significant decrease in Ter119hi cells compared to wild type (WT littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01. This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko. Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK cells, accompanied by significant decreases in multipotent progenitor (MPP cells (p < 0.01. Competitive BM repopulation experiments

  17. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  18. GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML. (United States)

    Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas


    GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from General information on GRN2SBML, examples and tutorials are available at the tool's web page.

  19. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton


    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  20. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool. (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J


    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at Supplementary material is available at Bioinformatics online.

  1. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda


    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  2. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites. (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro


    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  3. Isolation and identification of the immune-relevant ribosomal protein L10 (RPL10/QM-like gene) from the large yellow croaker Pseudosciaena crocea (Pisces: Sciaenidae). (United States)

    Chen, X; Su, Y Q; Wang, J; Liu, M; Niu, S F; Zhong, S P; Qiu, F


    In order to investigate the immune role of ribosomal protein L10 (RPL10/QM-like gene) in marine fish, we challenged the large yellow croaker Pseudosciaena (= Larimichthys) crocea, the most important marine fish culture species in China, by injection with a mixture of the bacteria Vibrio harveyi and V. parahaemolyticus (3:1 in volume). Microarray analysis and real-time PCR were performed 24 and 48 h post-challenge to isolate and identify the QM-like gene from the gill P. crocea (designated PcQM). The expression level of the PcQM gene did not changed significantly at 24 h post-challenge, but was significantly downregulated at 48 h post-challenge, suggesting that the gene had an immune-modulatory effect in P. crocea. Full-length PcQM cDNA and genomic sequences were obtained by rapid amplification of cDNA ends (RACE)-PCR. The sequence of the PcQM gene clustered together with those of other QM-like genes from other aquatic organisms, indicating that the QM-like gene is highly conserved in teleosts.

  4. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins. (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L


    The Chloroplast 2010 Project ( identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center ( Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  5. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project ( identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center ( Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  6. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18 (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan


    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  7. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif. (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G


    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  8. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.


    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  9. DNA replication stress restricts ribosomal DNA copy number (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin


    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  10. DNA replication stress restricts ribosomal DNA copy number. (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L


    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  11. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim


    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  12. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor]. (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin


    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  13. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients. (United States)

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine


    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon


    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  15. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal


    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  16. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients. (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J


    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  17. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s). (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar


    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  18. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R


    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  19. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins. (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben


    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  20. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors. (United States)

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D


    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  1. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li


    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  2. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny


    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  3. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  4. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang


    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  5. Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis. (United States)

    Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y


    The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

  6. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase. (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval


    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  7. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven


    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...


    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin


    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  9. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly


    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  10. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O


    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  11. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa. (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica


    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  12. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia. (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang


    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates. (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S


    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  14. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L


    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  15. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl


    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  16. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I. (United States)

    Roten, C A; Brandt, C; Karamata, D


    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  17. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods


    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  18. An evolutionarily conserved gene family encodes proton-selective ion channels. (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R


    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  19. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.


    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  20. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean. (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C


    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  1. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate (United States)

    Yusuf, Y.; Hidayati, W.


    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  2. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription. (United States)

    Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom


    Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin

  3. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    Directory of Open Access Journals (Sweden)

    Chelsea Herdman


    Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state

  4. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh


    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  5. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase. (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J


    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  6. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  7. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham


    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  8. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    International Nuclear Information System (INIS)

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin


    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy

  9. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans. (United States)

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa


    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  10. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.). (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G


    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  11. Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

    Directory of Open Access Journals (Sweden)

    Anne Kathrin Hett


    Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.Se presenta la primera descripción del cariotipo de Mugil incilis de Venezuela. El complemento cromosómico está compuesto por 48 cromosomas acrocéntricos uniformemente decrecientes en tamaño. Por lo tanto, los homólogos no pueden ser claramente identificados, con excepción de uno de los pares de mayor tamaño, clasificado como número 1, cuyos homólogos poseen una constricción secundaria subcentromérica, y el par de cromosomas número 24, considerablemente más pequeño que los otros. El bandeo-C reveló bloques heterocromáticos en las regiones centroméricas/pericentroméricas de todos los cromosomas, más conspicuas en el cromosoma 1 en el que las señales C

  12. The Serratia gene cluster encoding biosynthesis of the red antibiotic, prodigiosin, shows species- and strain-dependent genome context variation

    DEFF Research Database (Denmark)

    Harris, Abigail K P; Williamson, Neil R; Slater, Holly


    The prodigiosin biosynthesis gene cluster (pig cluster) from two strains of Serratia (S. marcescens ATCC 274 and Serratia sp. ATCC 39006) has been cloned, sequenced and expressed in heterologous hosts. Sequence analysis of the respective pig clusters revealed 14 ORFs in S. marcescens ATCC 274...... and 15 ORFs in Serratia sp. ATCC 39006. In each Serratia species, predicted gene products showed similarity to polyketide synthases (PKSs), non-ribosomal peptide synthases (NRPSs) and the Red proteins of Streptomyces coelicolor A3(2). Comparisons between the two Serratia pig clusters and the red cluster...... from Str. coelicolor A3(2) revealed some important differences. A modified scheme for the biosynthesis of prodigiosin, based on the pathway recently suggested for the synthesis of undecylprodigiosin, is proposed. The distribution of the pig cluster within several Serratia sp. isolates is demonstrated...

  13. Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1. (United States)

    Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi


    The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

  14. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.


    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  15. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.


    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  16. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R]. (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo


    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  17. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas


    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  18. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L. (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming


    Proline dehydrogenase (ProDH) (EC is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  19. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E


    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  20. Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa. (United States)

    Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz


    Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Amtyr1: characterization of a gene from honeybee (Apis mellifera) brain encoding a functional tyramine receptor. (United States)

    Blenau, W; Balfanz, S; Baumann, A


    Biogenic amine receptors are involved in the regulation and modulation of various physiological and behavioral processes in both vertebrates and invertebrates. We have cloned a member of this gene family from the CNS of the honeybee, Apis mellifera. The deduced amino acid sequence is homologous to tyramine receptors cloned from Locusta migratoria and Drosophila melanogaster as well as to an octopamine receptor cloned from Heliothis virescens. Functional properties of the honeybee receptor were studied in stably transfected human embryonic kidney 293 cells. Tyramine reduced forskolin-induced cyclic AMP production in a dose-dependent manner with an EC50 of approximately 130 nM. A similar effect of tyramine was observed in membrane homogenates of honeybee brains. Octopamine also reduced cyclic AMP production in the transfected cell line but was both less potent (EC50 of approximately 3 microM) and less efficacious than tyramine. Receptor-encoding mRNA has a wide-spread distribution in the brain and subesophageal ganglion of the honeybee, suggesting that this tyramine receptor is involved in sensory signal processing as well as in higher-order brain functions.

  2. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov


    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  3. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert


    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.


    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo


    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  5. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm. (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes


    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  6. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata. (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S


    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  7. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation. (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie


    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  8. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane


    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  9. Expression of the double-stranded RNA of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Tortricidae) ribosomal protein P0 gene enhances the resistance of transgenic soybean plants. (United States)

    Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin


    The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  10. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T


    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

  11. Translational Control of Host Gene Expression by a Cys-Motif Protein Encoded in a Bracovirus.

    Directory of Open Access Journals (Sweden)

    Eunseong Kim

    Full Text Available Translational control is a strategy that various viruses use to manipulate their hosts to suppress acute antiviral response. Polydnaviruses, a group of insect double-stranded DNA viruses symbiotic to some endoparasitoid wasps, are divided into two genera: ichnovirus (IV and bracovirus (BV. In IV, some Cys-motif genes are known as host translation-inhibitory factors (HTIF. The genome of endoparasitoid wasp Cotesia plutellae contains a Cys-motif gene (Cp-TSP13 homologous to an HTIF known as teratocyte-secretory protein 14 (TSP14 of Microplitis croceipes. Cp-TSP13 consists of 129 amino acid residues with a predicted molecular weight of 13.987 kDa and pI value of 7.928. Genomic DNA region encoding its open reading frame has three introns. Cp-TSP13 possesses six conserved cysteine residues as other Cys-motif genes functioning as HTIF. Cp-TSP13 was expressed in Plutella xylostella larvae parasitized by C. plutellae. C. plutellae bracovirus (CpBV was purified and injected into non-parasitized P. xylostella that expressed Cp-TSP13. Cp-TSP13 was cloned into a eukaryotic expression vector and used to infect Sf9 cells to transiently express Cp-TSP13. The synthesized Cp-TSP13 protein was detected in culture broth. An overlaying experiment showed that the purified Cp-TSP13 entered hemocytes. It was localized in the cytosol. Recombinant Cp-TSP13 significantly inhibited protein synthesis of secretory proteins when it was added to in vitro cultured fat body. In addition, the recombinant Cp-TSP13 directly inhibited the translation of fat body mRNAs in in vitro translation assay using rabbit reticulocyte lysate. Moreover, the recombinant Cp-TSP13 significantly suppressed cellular immune responses by inhibiting hemocyte-spreading behavior. It also exhibited significant insecticidal activities by both injection and feeding routes. These results indicate that Cp-TSP13 is a viral HTIF.

  12. Controlled hydrostatic pressure stress downregulates the expression of ribosomal genes in preimplantation embryos: a possible protection mechanism? (United States)

    Bock, I; Raveh-Amit, H; Losonczi, E; Carstea, A C; Feher, A; Mashayekhi, K; Matyas, S; Dinnyes, A; Pribenszky, C


    The efficiency of various assisted reproductive techniques can be improved by preconditioning the gametes and embryos with sublethal hydrostatic pressure treatment. However, the underlying molecular mechanism responsible for this protective effect remains unknown and requires further investigation. Here, we studied the effect of optimised hydrostatic pressure treatment on the global gene expression of mouse oocytes after embryonic genome activation. Based on a gene expression microarray analysis, a significant effect of treatment was observed in 4-cell embryos derived from treated oocytes, revealing a transcriptional footprint of hydrostatic pressure-affected genes. Functional analysis identified numerous genes involved in protein synthesis that were downregulated in 4-cell embryos in response to hydrostatic pressure treatment, suggesting that regulation of translation has a major role in optimised hydrostatic pressure-induced stress tolerance. We present a comprehensive microarray analysis and further delineate a potential mechanism responsible for the protective effect of hydrostatic pressure treatment.

  13. 16S Ribosomal Ribonucleic Acid Gene Polymerase Chain Reaction in the Diagnosis of Bloodstream Infections: A Systematic Review and Meta-Analysis. (United States)

    Su, Guoming; Fu, Zhuqing; Hu, Liren; Wang, Yueying; Zhao, Zuguo; Yang, Weiqing


    We aim to evaluate the accuracy of the 16S ribosomal ribonucleic acid (rRNA) gene polymerase chain reaction (PCR) test in the diagnosis of bloodstream infections through a systematic review and meta-analysis. A computerized literature search was conducted to identify studies that assessed the diagnostic value of 16S rRNA gene PCR test for bloodstream infections. Study quality was assessed using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. We calculated the sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR) and their 95% confidence intervals (95% CI) for each study. Summary receiver operating characteristic (SROC) curve was used to summarize overall test performance. Statistical analysis was performed in Meta-DiSc 1.4 and Stata/SE 12.0 software. Twenty-eight studies were included in our meta-analysis. Using random-effect model analysis, the pooled sensitivity, specificity, PLR, NLR, and DOR were 0.87 (95% CI, 0.85-0.89), 0.94 (95% CI, 0.93-0.95), 12.65 (95% CI, 8.04-19.90), 0.14 (95% CI, 0.08-0.24), and 116.76 (95% CI, 52.02-262.05), respectively. The SROC curve indicated that the area under the curve (AUC) was 0.9690 and the maximum joint sensitivity and specificity (Q*) was 0.9183. In addition, heterogeneity was statistically significant but was not caused by the threshold effect. Existing data suggest that 16S rRNA gene PCR test is a practical tool for the rapid screening of sepsis. Further prospective studies are needed to assess the diagnostic value of PCR amplification and DNA microarray hybridization of 16S rRNA gene in the future.

  14. Ribosome reinitiation at leader peptides increases translation of bacterial proteins. (United States)

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A


    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  15. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.


    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  16. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne


    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  17. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch


    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  18. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  19. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.


    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  20. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes. (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O


    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  1. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes. (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V


    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Molecular characterization of tlyA gene product, Rv1694 of Mycobacterium tuberculosis: A non-conventional hemolysin and a ribosomal RNA methyl transferase

    Directory of Open Access Journals (Sweden)

    Ahmed Neesar


    Full Text Available Abstract Background Mycobacterium tuberculosis is a virulent bacillus causing tuberculosis, a disease responsible for million deaths each year worldwide. In order to understand its mechanism of pathogenesis in humans and to help control tuberculosis, functions of numerous Mycobacterium tuberculosis genes are being characterized. In this study we report the dual functionality of tlyA gene product of Mycobacterium tuberculosis annotated as Rv1694, a 268 amino acid long basic protein. Results The recombinant purified Rv1694 protein was found to exhibit hemolytic activity in vitro. It showed concentration and time-dependent hemolysis of rabbit and human erythrocytes. Multiple oligomeric forms (dimers to heptamers of this protein were seen on the membranes of the lysed erythrocytes. Like the oligomers of conventional, well-known, pore-forming toxins, the oligomers of Rv1694 were found to be resistant to heat and SDS, but were susceptible to reducing agents like β-mercaptoethanol as it had abolished the hemolytic activity of Rv1694 indicating the role of disulfide bond(s. The Rv1694 generated de novo by in vitro transcription and translation also exhibited unambiguous hemolysis confirming the self assembly and oligomerization properties of this protein. Limited proteolytic digestion of this protein has revealed that the amino terminus is susceptible while in solution but is protected in presence of membrane. Striking feature of Rv1694 is its presence on the cell wall of E. coli as visualized by confocal microscopy. The surface expression is consistent with the contact dependent haemolytic ability of E. coli expressing this protein. Also, immune serum specific to this protein inhibits the contact dependent hemolysis. Moreover, Rv1694 protein binds to and forms stable oligomers on the macrophage phagosomal membranes. In addition to all these properties, E. coli expressing Rv1694 was found to be susceptible to the antibiotic capreomycin as its growth

  3. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica. (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J


    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  4. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey. (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H


    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  5. The Down regulated in Adenoma (dra) gene encodes an intestine-specific membrane sulfate transport protein. (United States)

    Silberg, D G; Wang, W; Moseley, R H; Traber, P G


    A gene has been described, Down Regulated in Adenoma (dra), which is expressed in normal colon but is absent in the majority of colon adenomas and adenocarcinomas. However, the function of this protein is unknown. Because of sequence similarity to a recently cloned membrane sulfate transporter in rat liver, the transport function of Dra was examined. We established that dra encodes for a Na(+)-independent transporter for both sulfate and oxalate using microinjected Xenopus oocytes as an assay system. Sulfate transport was sensitive to the anion exchange inhibitor DIDS (4,4'-diisothiocyano-2,2' disulfonic acid stilbene). Using an RNase protection assay, we found that dra mRNA expression is limited to the small intestine and colon in mouse, therefore identifying Dra as an intestine-specific sulfate transporter. dra also had a unique pattern of expression during intestinal development. Northern blot analysis revealed a low level of expression in colon at birth with a marked increase in the first 2 postnatal weeks. In contrast, there was a lower, constant level of expression in small intestine in the postnatal period. Caco-2 cells, a colon carcinoma cell line that differentiates over time in culture, demonstrated a marked induction of dra mRNA as cells progressed from the preconfluent (undifferentiated) to the postconfluent (differentiated) state. These results show that Dra is an intestine-specific Na(+)-independent sulfate transporter that has differential expression during colonic development. This functional characterization provides the foundation for investigation of the role of Dra in intestinal sulfate transport and in the malignant phenotype.

  6. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)


    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  7. Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients


    Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A.; French, Deborah; Podsakoff, Gregory M.; Bessler, Monica; Mason, Philip J.


    Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosom...

  8. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  9. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.


    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  10. Histone and Ribosomal RNA Repetitive Gene Clusters of the Boll Weevil are Linked in a Tandem Array (United States)

    Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and ...

  11. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki


    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  12. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  13. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes. (United States)

    Tzagoloff, A; Shtanko, A


    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  14. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil. (United States)

    de Oliveira, Valéria Maia; Manfio, Gilson Paulo; da Costa Coutinho, Heitor Luiz; Keijzer-Wolters, Anneke Christina; van Elsas, Jan Dirk


    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was followed by specific amplification of (1) sequences affiliated with Rhizobium leguminosarum "sensu lato" and (2) R. tropici. Using analysis of the amplified sequences in clone libraries obtained on the basis of soil DNA, this two-sided method was shown to be very specific for rhizobial subpopulations in soil. It was then further validated as a direct fingerprinting tool of the target rhizobia based on denaturing gradient gel electrophoresis (DGGE). The PCR-DGGE approach was applied to soils from fields in Brazil cultivated with common bean (Phaseolus vulgaris) under conventional or no-tillage practices. The community fingerprints obtained allowed the direct analysis of the respective rhizobial community structures in soil samples from the two contrasting agricultural practices. Data obtained with both primer sets revealed clustering of the community structures of the target rhizobial types along treatment. Moreover, the DGGE profiles obtained with the R. tropici primer set indicated that the abundance and diversity of these organisms were favoured under NT practices. These results suggest that the R. leguminosarum-as well as R. tropici-targeted IGS-based nested PCR and DGGE are useful tools for monitoring the effect of agricultural practices on these and related rhizobial subpopulations in soils.

  15. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis. (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide


    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.


    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  17. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013


    Steven Steven; Yoni F Syukriani; Julius B Dewanto


    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  18. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben


    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  19. Evolution of blue-flowered species of genus Linum based on high-throughput sequencing of ribosomal RNA genes. (United States)

    Bolsheva, Nadezhda L; Melnikova, Nataliya V; Kirov, Ilya V; Speranskaya, Anna S; Krinitsina, Anastasia A; Dmitriev, Alexey A; Belenikin, Maxim S; Krasnov, George S; Lakunina, Valentina A; Snezhkina, Anastasiya V; Rozhmina, Tatiana A; Samatadze, Tatiana E; Yurkevich, Olga Yu; Zoshchuk, Svyatoslav A; Amosova, Аlexandra V; Kudryavtseva, Anna V; Muravenko, Olga V


    The species relationships within the genus Linum have already been studied several times by means of different molecular and phylogenetic approaches. Nevertheless, a number of ambiguities in phylogeny of Linum still remain unresolved. In particular, the species relationships within the sections Stellerolinum and Dasylinum need further clarification. Also, the question of independence of the species of the section Adenolinum still remains unanswered. Moreover, the relationships of L. narbonense and other species of the section Linum require further clarification. Additionally, the origin of tetraploid species of the section Linum (2n = 30) including the cultivated species L. usitatissimum has not been explored. The present study examines the phylogeny of blue-flowered species of Linum by comparisons of 5S rRNA gene sequences as well as ITS1 and ITS2 sequences of 35S rRNA genes. High-throughput sequencing has been used for analysis of multicopy rRNA gene families. In addition to the molecular phylogenetic analysis, the number and chromosomal localization of 5S and 35S rDNA sites has been determined by FISH. Our findings confirm that L. stelleroides forms a basal branch from the clade of blue-flowered flaxes which is independent of the branch formed by species of the sect. Dasylinum. The current molecular phylogenetic approaches, the cytogenetic analysis as well as different genomic DNA fingerprinting methods applied previously did not discriminate certain species within the sect. Adenolinum. The allotetraploid cultivated species L. usitatissimum and its wild ancestor L. angustifolium (2n = 30) could originate either as the result of hybridization of two diploid species (2n = 16) related to the modern L. gandiflorum and L. decumbens, or hybridization of a diploid species (2n = 16) and a diploid ancestor of modern L. narbonense (2n = 14). High-throughput sequencing of multicopy rRNA gene families allowed us to make several adjustments to the

  20. Architecture of the large subunit of the mammalian mitochondrial ribosome. (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad


    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  1. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M


    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  2. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi. (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F


    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  3. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M


    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  4. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo


    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  5. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use. (United States)

    Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V


    Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus. (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung


    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  7. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others


    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  8. A lepidopteran-specific gene family encoding valine-rich midgut proteins.

    Directory of Open Access Journals (Sweden)

    Jothini Odman-Naresh

    Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran

  9. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre


    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  10. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony


    in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...

  11. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  12. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan


    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  13. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  14. Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

    Directory of Open Access Journals (Sweden)

    Moysés Elias-Neto


    Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

  15. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  16. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide. (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K


    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  17. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression. (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm


    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  18. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast


    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  19. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses (United States)

    Shukla, Avi; Chatterjee, Anirvan


    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  20. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto


    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  1. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene. (United States)

    Lu, Y P; Li, Z S; Rea, P A


    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  2. Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum. (United States)

    Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B


    The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  3. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    International Nuclear Information System (INIS)

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.


    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  4. Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran. (United States)

    Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda


    Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

  5. A novel gene encoding xanthan lyase of Paenibacillus alginolyticus strain XL-1

    NARCIS (Netherlands)

    Ruijssenaars, H.J.; Hartmans, S.; Verdoes, J.C.


    Xanthan-modifying enzymes are powerful tools in studying structure-function relationships of this polysaccharide. One of these modifying enzymes is xanthan lyase, which removes the terminal side chain residue of xanthan. In this paper, the cloning and sequencing of the first xanthan lyase-encoding

  6. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel


    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  7. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass. (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A


    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  8. Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid. (United States)

    Naito, Keisuke; Yamasaki, Kei; Yatera, Kazuhiro; Akata, Kentaro; Noguchi, Shingo; Kawanami, Toshinori; Fukuda, Kazumasa; Kido, Takashi; Ishimoto, Hiroshi; Mukae, Hiroshi


    Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF) of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83) and healthcare-associated pneumonia (94) between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT) images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177), mild in 36.2% (64/177), moderate in 10.2% (18/177), and severe in 6.2% (11/177). Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The detection rates of Haemophilus influenzae and Pseudomonas aeruginosa were unrelated to the severity of pulmonary emphysematous changes, and Streptococcus species - except for the S. anginosus group and S. pneumoniae - were detected more frequently using the molecular method we used for the BALF of patients with pneumonia than using culture methods. Our findings suggest that M. catarrhalis is more frequently detected in pneumonia patients with moderate or

  9. Erythroblast differentiation at spleen in Q137E mutant ribosomal protein S19 gene knock-in C57BL/6J mice. (United States)

    Yamanegi, Koji; Yamada, Naoko; Nakasho, Keiji; Nishiura, Hiroshi


    We recently found that erythroblast-like cells derived from human leukaemia K562 cells express C5a receptor (C5aR) and produce its antagonistic and agonistic ligand ribosomal protein S19 (RP S19) polymer, which is cross-linked between K122 and Q137 by tissue transglutaminases. RP S19 polymer binds to the reciprocal C5aRs on erythroblast-like cells and macrophage-like cells derived from human monocytic THP-1 cells and promotes differentiation into reticulocyte-like cells through enucleation in vitro. To examine the roles of RP S19 polymer in mouse erythropoiesis, we prepared Q137E mutant RP S19 gene knock-in C57BL/6J mice. In contrast to wild-type mice, erythroblast numbers at the preliminary stage (CD71 high /TER119 low ) in spleen based on transferrin receptor (CD71) and glycophorin A (TER119) values and erythrocyte numbers in orbital artery bloods were not largely changed in knock-in mice. Conversely, erythroblast numbers at the early stage (CD71 high /TER119 high ) were significantly decreased in spleen by knock-in mice. The reduction of early erythroblast numbers in spleen was enhanced by the phenylhydrazine-induced pernicious anemia model knock-in mice and was rescued by a functional analogue of RP S19 dimer S-tagged C5a/RP S19. These data indicated that RP S19 polymer plays the roles in the early erythroblast differentiation of C57BL/6J mouse spleen. Copyright © 2017 Elsevier GmbH. All rights reserved.

  10. Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L. (United States)

    Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A


    The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

  11. A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease. (United States)

    Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing


    Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

  12. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono


    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  13. Methods for the Isolation of Genes Encoding Novel PHA Metabolism Enzymes from Complex Microbial Communities. (United States)

    Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C


    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  14. Methods for the isolation of genes encoding novel PHB cycle enzymes from complex microbial communities. (United States)

    Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C


    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  15. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi


    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  16. Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster. (United States)

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji


    All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  17. Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides. (United States)

    Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor


    In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  18. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei


    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  19. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities. (United States)

    Vouille, V; Amiche, M; Nicolas, P


    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  20. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L


    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  1. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans. (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István


    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation. (United States)

    Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S


    Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

  3. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100 (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.


    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  4. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus

    DEFF Research Database (Denmark)

    Hansen, T S; Andreasen, P H; Dreisig, H


    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 ...... by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.......We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63...... nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified...

  5. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro. (United States)

    Pyne, C; Bognar, A L


    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  6. Expression of genes encoding F-1-ATPase results in uncoupling of glycolysis from biomass production in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Pedersen, M.B.


    of the genes encoding F-1-ATPase was found to decrease the intracellular energy level and resulted in a decrease in the growth rate. The yield of biomass also decreased, which showed that the incorporated F-1-ATPase activity caused glycolysis to be uncoupled from biomass production. The increase in ATPase...... threefold in nongrowing cells resuspended in buffer, but in steadily growing cells no increase in flux was observed. The latter result shows that glycolysis occurs close to its maximal capacity and indicates that control of the glycolytic flux under these conditions resides in the glycolytic reactions...

  7. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther


    ). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  8. A Drosophila gene encoding a protein resembling the human β-amyloid protein precursor

    International Nuclear Information System (INIS)

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K.


    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human β-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human β-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development

  9. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.


    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H


    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  10. Resistance to the Peptidyl Transferase Inhibitor Tiamulin Caused by Mutation of Ribosomal Protein L3


    Bøsling, Jacob; Poulsen, Susan M.; Vester, Birte; Long, Katherine S.


    The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ri...

  11. The antibiotic thiostrepton inhibits a functional transition within protein L11 at the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Porse, B T; Leviev, I; Mankin, A S


    A newly identified class of highly thiostrepton-resistant mutants of the archaeon Halobacterium halobium carry a missense mutation at codon 18 within the gene encoding ribosomal protein L11. In the mutant proteins, a proline, conserved in archaea and bacteria, is converted to either serine...... technique, demonstrated that a general tightening of the C-terminal domain occurred on rRNA binding, while thiostrepton produced a footprint centred on tyrosine 62 at the junction of the N and C-terminal domains of protein L11 complexed to rRNA. The intensity of this protein footprint was strongly reduced...

  12. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity (United States)

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.


    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

  13. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil. (United States)

    Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso


    Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

  14. Comparative structural and functional analysis of genes encoding pectin methylesterases in Phytophthora spp. (United States)

    Mingora, Christina; Ewer, Jason; Ospina-Giraldo, Manuel


    We have scanned the Phytophthora infestans, P. ramorum, and P. sojae genomes for the presence of putative pectin methylesterase genes and conducted a sequence analysis of all gene models found. We also searched for potential regulatory motifs in the promoter region of the proposed P. infestans models, and investigated the gene expression levels throughout the course of P. infestans infection on potato plants, using in planta and detached leaf assays. We found that genes located on contiguous chromosomal regions contain similar motifs in the promoter region, indicating the possibility of a shared regulatory mechanism. Results of our investigations also suggest that, during the pathogenicity process, the expression levels of some of the analyzed genes vary considerably when compared to basal expression observed in in vitro cultures of non-sporulating mycelium. These results were observed both in planta and in detached leaf assays. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  16. The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase. (United States)

    Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M


    Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

  17. Cloning and analysis of the genes encoding the type IIS restriction-modification system HphI from Haemophilus parahaemolyticus. (United States)

    Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A


    The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.

  18. Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat. (United States)

    Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T


    A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

  19. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt


    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  20. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang


    This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

  1. A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation. (United States)

    Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S


    we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

  2. Thermal response of rat fibroblasts stably transfected with the human 70-kDa heat shock protein-encoding gene

    International Nuclear Information System (INIS)

    Li, G.C.; Li, Ligeng; Liu, Yunkang; Mak, J.Y.; Chen, Lili; Lee, W.M.F.


    The major heat shock protein hsp70 is synthesized by cells of a wide variety of organisms in response to heat shock or other environmental stresses and is assumed to play an important role in protecting cells from thermal stress. The authors have tested this hypothesis directly by transfecting a constitutively expressed recombinant human hsp70-encoding gene into rat fibroblasts and examining the relationship between the levels of human hsp70 expressed and thermal resistance of the stably transfected rat cells. Successful transfection and expression of the gene for human hsp70 were characterized by RNA hybridization analysis, low-dimensional gel electrophoresis, and immunoblot analysis. When individual cloned cell lines were exposed to 45C and their thermal survivals were determined by colony-formation assay, they found that the expression of human hsp70 conferred heat resistance to the rat cells. These results reinforce the hypothesis that hsp70 has a protective function against thermal stress

  3. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens. (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter


    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  4. Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

    International Nuclear Information System (INIS)

    Menaa, F.


    Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

  5. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S


    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  6. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase. (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine


    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  7. The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues. (United States)

    Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra


    Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

  8. Differentially expressed genes associated with dormancy or germination of Arabidopsis thaliana seeds

    NARCIS (Netherlands)

    Toorop, P.E.; Barroco, R.M.; Engler, G.; Groot, S.P.C.; Hilhorst, H.W.M.


    Differential display analysis using dormant and non-dormant Arabidopsis thaliana (L.) Heynh seeds resulted in a set of genes that were associated with either dormancy or germination. Expression of the germination-associated genes AtRPL36B and AtRPL27B, encoding two ribosomal proteins, was

  9. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta


    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  10. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA. (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio


    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. A highly divergent gene cluster in honey bees encodes a novel silk family


    Sutherland, Tara D.; Campbell, Peter M.; Weisman, Sarah; Trueman, Holly E.; Sriskantha, Alagacone; Wanjura, Wolfgang J.; Haritos, Victoria S.


    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1–4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-r...

  12. The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

  13. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  14. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway. (United States)

    Bassler, B L; Wright, M; Silverman, M R


    Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.

  15. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§ (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro


    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

  16. Expression of the rgMT gene, encoding for a rice metallothionein ...

    Indian Academy of Sciences (India)

    the rice rgMT gene in transgenic yeast and Arabidopsis is implicated in improving their tolerance for .... possible by the use of a microscope with UV optics that ... Abiotic stress factors that induced the expression of the ..... Arabidopsis mutant.

  17. Cloning and expression of gene encoding P23 protein from Cryptosporidium parvum

    Directory of Open Access Journals (Sweden)

    Dinh Thi Bich Lan


    Full Text Available We cloned the cp23 gene coding P23 (glycoprotein from Cryptosporidium parvum isolated from Thua Thien Hue province, Vietnam. The coding region of cp23 gene from C. parvum is 99% similar with cp23 gene deposited in NCBI (accession number: U34390. SDS-PAGE and Western blot analysis showed that the cp23 gene in E. coli BL21 StarTM (DE3 produced polypeptides with molecular weights of approximately 37, 40 and 49 kDa. These molecules may be non-glycosylated or glycosylated P23 fusion polypeptides. Recombinant P23 protein purified by GST (glutathione S-transferase affinity chromatography can be used as an antigen for C. parvum antibody production as well as to develop diagnostic kit for C. parvum.

  18. Molecular cloning and expression of gene encoding aromatic amino acid decarboxylase in 'Vidal blanc' grape berries. (United States)

    Pan, Qiu-Hong; Chen, Fang; Zhu, Bao-Qing; Ma, Li-Yan; Li, Li; Li, Jing-Ming


    The pleasantly fruity and floral 2-phenylethanol are a dominant aroma compound in post-ripening 'Vidal blanc' grapes. However, to date little has been reported about its synthetic pathway in grapevine. In the present study, a full-length cDNA of VvAADC (encoding aromatic amino acid decarboxylase) was firstly cloned from the berries of 'Vidal blanc', an interspecific hybrid variety of Vitis vinifera × Vitis riparia. This sequence encodes a complete open reading frame of 482 amino acids with a calculated molecular mass of 54 kDa and isoelectric point value (pI) of 5.73. The amino acid sequence deduced shared about 79% identity with that of aromatic L: -amino acid decarboxylases (AADCs) from tomato. Real-time PCR analysis indicated that VvAADC transcript abundance presented a small peak at 110 days after full bloom and then a continuous increase at the berry post-ripening stage, which was consistent with the accumulation of 2-phenylethanol, but did not correspond to the trends of two potential intermediates, phenethylamine and 2-phenylacetaldehyde. Furthermore, phenylalanine still exhibited a continuous increase even in post-ripening period. It is thus suggested that 2-phenylethanol biosynthetic pathway mediated by AADC exists in grape berries, but it has possibly little contribution to a considerable accumulation of 2-phenylethanol in post-ripening 'Vidal blanc' grapes.

  19. Seventeen copies of the human 37 kDa laminin receptor precursor/p40 ribosome-associated protein gene are processed pseudogenes arisen from retropositional events

    DEFF Research Database (Denmark)

    Jackers, P; Clausse, N; Fernandez, M


    A cDNA coding for a 37 kDa polypeptide has been identified in several species as both the potential precursor of the 67 kDa laminin receptor (37LRP) and a putative ribosome-associated protein (p40). Interestingly, increased expression of this polypeptide (37LRP/p40) is consistently observed...

  20. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor. (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing


    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  1. Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii) (United States)

    Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi


    Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

  2. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146 (United States)

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul


    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

  3. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

    Directory of Open Access Journals (Sweden)

    Shumeng Kou


    Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

  4. Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid

    Directory of Open Access Journals (Sweden)

    Naito K


    Full Text Available Keisuke Naito,1 Kei Yamasaki,1 Kazuhiro Yatera,1 Kentaro Akata,1 Shingo Noguchi,1 Toshinori Kawanami,1 Kazumasa Fukuda,2 Takashi Kido,1 Hiroshi Ishimoto,3 Hiroshi Mukae3 1Department of Respiratory Medicine, 2Department of Microbiology, University of Occupational and Environmental Health, Japan, Kitakyushu City, Fukuoka, 3Second Department of Internal Medicine, Nagasaki University School of Medicine, Nagasaki City, Nagasaki, Japan Abstract: Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83 and healthcare-associated pneumonia (94 between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177, mild in 36.2% (64/177, moderate in 10.2% (18/177, and severe in 6.2% (11/177. Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The

  5. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial. (United States)

    Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B


    Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs) identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya , Desmonostoc muscorum , and Microcoleus steenstrupii . The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ); the most (relative) abundant being uncharacterized species within the genera Methylobacillus , Solirubrobacter , and Ohtaekwangia . Three metal treatment alone resulted in identification of 22 OTUs (genera or species) which were not detected in control soil, notably including Yonghaparkia alkaliphila , Pedobacter steynii , Pseudolabrys taiwanensis , Methylophilus

  6. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium. (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R


    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  7. Analysis of the CYP51 gene and encoded protein in propiconazole-resistant isolates of Mycosphaerella fijiensis. (United States)

    Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael


    Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.

  8. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.


    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  9. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.


    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  10. Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase (United States)

    Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

  11. Cloning and Expression Analysis of MEP Pathway Enzyme-encoding Genes in Osmanthus fragrans

    Directory of Open Access Journals (Sweden)

    Chen Xu


    Full Text Available The 2-C-methyl-d-erythritol 4-phosphate (MEP pathway is responsible for the biosynthesis of many crucial secondary metabolites, such as carotenoids, monoterpenes, plastoquinone, and tocopherols. In this study, we isolated and identified 10 MEP pathway genes in the important aromatic plant sweet osmanthus (Osmanthus fragrans. Multiple sequence alignments revealed that 10 MEP pathway genes shared high identities with other reported proteins. The genes showed distinctive expression profiles in various tissues, or at different flower stages and diel time points. The qRT-PCR results demonstrated that these genes were highly expressed in inflorescences, which suggested a tissue-specific transcript pattern. Our results also showed that OfDXS1, OfDXS2, and OfHDR1 had a clear diurnal oscillation pattern. The isolation and expression analysis provides a strong foundation for further research on the MEP pathway involved in gene function and molecular evolution, and improves our understanding of the molecular mechanism underlying this pathway in plants.

  12. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A


    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  13. Mutations in genes encoding condensin complex proteins cause microcephaly through decatenation failure at mitosis. (United States)

    Martin, Carol-Anne; Murray, Jennie E; Carroll, Paula; Leitch, Andrea; Mackenzie, Karen J; Halachev, Mihail; Fetit, Ahmed E; Keith, Charlotte; Bicknell, Louise S; Fluteau, Adeline; Gautier, Philippe; Hall, Emma A; Joss, Shelagh; Soares, Gabriela; Silva, João; Bober, Michael B; Duker, Angela; Wise, Carol A; Quigley, Alan J; Phadke, Shubha R; Wood, Andrew J; Vagnarelli, Paola; Jackson, Andrew P


    Compaction of chromosomes is essential for accurate segregation of the genome during mitosis. In vertebrates, two condensin complexes ensure timely chromosome condensation, sister chromatid disentanglement, and maintenance of mitotic chromosome structure. Here, we report that biallelic mutations in NCAPD2, NCAPH, or NCAPD3, encoding subunits of these complexes, cause microcephaly. In addition, hypomorphic Ncaph2 mice have significantly reduced brain size, with frequent anaphase chromatin bridge formation observed in apical neural progenitors during neurogenesis. Such DNA bridges also arise in condensin-deficient patient cells, where they are the consequence of failed sister chromatid disentanglement during chromosome compaction. This results in chromosome segregation errors, leading to micronucleus formation and increased aneuploidy in daughter cells. These findings establish "condensinopathies" as microcephalic disorders, with decatenation failure as an additional disease mechanism for microcephaly, implicating mitotic chromosome condensation as a key process ensuring mammalian cerebral cortex size. © 2016 Martin et al.; Published by Cold Spring Harbor Laboratory Press.

  14. Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins


    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel


    Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

  15. Trypanosoma cruzi has not lost its S-adenosylmethionine decarboxylase: characterization of the gene and the encoded enzyme. (United States)

    Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O


    All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309

  16. Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima. (United States)

    Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A


    Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

  17. Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D. (United States)

    Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C


    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.

  18. The Cremeomycin Biosynthetic Gene Cluster Encodes a Pathway for Diazo Formation. (United States)

    Waldman, Abraham J; Pechersky, Yakov; Wang, Peng; Wang, Jennifer X; Balskus, Emily P


    Diazo groups are found in a range of natural products that possess potent biological activities. Despite longstanding interest in these metabolites, diazo group biosynthesis is not well understood, in part because of difficulties in identifying specific genes linked to diazo formation. Here we describe the discovery of the gene cluster that produces the o-diazoquinone natural product cremeomycin and its heterologous expression in Streptomyces lividans. We used stable isotope feeding experiments and in vitro characterization of biosynthetic enzymes to decipher the order of events in this pathway and establish that diazo construction involves late-stage N-N bond formation. This work represents the first successful production of a diazo-containing metabolite in a heterologous host, experimentally linking a set of genes with diazo formation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Identifying the Viral Genes Encoding Envelope Glycoproteins for Differentiation of Cyprinid herpesvirus 3 Isolates

    Directory of Open Access Journals (Sweden)

    Se Chang Park


    Full Text Available Cyprinid herpes virus 3 (CyHV-3 diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio. Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116 of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116. In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies.

  20. Identifying the Viral Genes Encoding Envelope Glycoproteins for Differentiation of Cyprinid herpesvirus 3 Isolates (United States)

    Han, Jee Eun; Kim, Ji Hyung; Renault, Tristan; Choresca, Casiano; Shin, Sang Phil; Jun, Jin Woo; Park, Se Chang


    Cyprinid herpes virus 3 (CyHV-3) diseases have been reported around the world and are associated with high mortalities of koi (Cyprinus carpio). Although little work has been conducted on the molecular analysis of this virus, glycoprotein genes identified in the present study seem to be valuable targets for genetic comparison of this virus. Three envelope glycoprotein genes (ORF25, 65 and 116) of the CyHV-3 isolates from the USA, Israel, Japan and Korea were compared, and interestingly, sequence insertions or deletions were observed in these target regions. In addition, polymorphisms were presented in microsatellite zones from two glycoprotein genes (ORF65 and 116). In phylogenetic tree analysis, the Korean isolate was remarkably distinguished from USA, Israel, Japan isolates. These findings may be suitable for many applications including isolates differentiation and phylogeny studies. PMID:23435236

  1. Population structuring of multi-copy, antigen-encoding genes in Plasmodium falciparum (United States)

    Artzy-Randrup, Yael; Rorick, Mary M; Day, Karen; Chen, Donald; Dobson, Andrew P; Pascual, Mercedes


    The coexistence of multiple independently circulating strains in pathogen populations that undergo sexual recombination is a central question of epidemiology with profound implications for control. An agent-based model is developed that extends earlier ‘strain theory’ by addressing the var gene family of Plasmodium falciparum. The model explicitly considers the extensive diversity of multi-copy genes that undergo antigenic variation via sequential, mutually exclusive expression. It tracks the dynamics of all unique var repertoires in a population of hosts, and shows that even under high levels of sexual recombination, strain competition mediated through cross-immunity structures the parasite population into a subset of coexisting dominant repertoires of var genes whose degree of antigenic overlap depends on transmission intensity. Empirical comparison of patterns of genetic variation at antigenic and neutral sites supports this role for immune selection in structuring parasite diversity. DOI: PMID:23251784

  2. Transformation of pickling cucumber with chitinase-encoding genes using Agrobacterium tumefaciens. (United States)

    Raharjo, S H; Hernandez, M O; Zhang, Y Y; Punja, Z K


    Transformation of cucumber cv. Endeavor was attempted using three Agrobacterium tumefaciens strains (a supervirulent leucinopine type, an octopine type and a nopaline type), each harbouring one of three binary vectors which contained an acidic chitinase gene from petunia, and basic chitinase genes from tobacco and bean, respectively, driven by the CaMV 35S promoter. Petiole explants were inoculated with a bacterial suspension (10(8) cells·ml(-1)), cocultivated for 48-96 h and placed on Murashige and Skoog (MS) medium with 5.0 μM each of 2,4-D and BA, 50 mg·l(-1) kanamycin and 500 mg·l(-1) carbenicillin. The frequency of embryogenic callus formation ranged from 0 to 12%, depending on strains/vectors used and length of cocultivation, with the highest being obtained using the leucinopine strain with petunia acidic chitinase gene. The kanamycin-resistant embryogenic calli were used to initiate suspension cultures (in liquid MS medium with 1.0/1.0 μM 2,4-D/BA, 50 mg·l(-1) kanamycin) for multiplication of embryogenic cell aggregates. Upon plating of cell aggregates onto solid MS medium with 1.0/1.0 μM NAA/BA and 50 mg·l(-1) kanamycin, calli continued to grow and later differentiated into plantlets. Transformation by the leucinopine strain and all three vectors was confirmed by PCR amplification of the NPT II gene in transgenic calli and plants, in addition to Southern analysis. Expression of the acidic chitinase gene (from petunia) and both basic chitinase genes (from tobacco and bean) in different transgenic cucumber lines was confirmed by Western analyses.

  3. Evaluation of 10 genes encoding cardiac proteins in Doberman Pinschers with dilated cardiomyopathy. (United States)

    O'Sullivan, M Lynne; O'Grady, Michael R; Pyle, W Glen; Dawson, John F


    To identify a causative mutation for dilated cardiomyopathy (DCM) in Doberman Pinschers by sequencing the coding regions of 10 cardiac genes known to be associated with familial DCM in humans. 5 Doberman Pinschers with DCM and congestive heart failure and 5 control mixed-breed dogs that were euthanized or died. RNA was extracted from frozen ventricular myocardial samples from each dog, and first-strand cDNA was synthesized via reverse transcription, followed by PCR amplification with gene-specific primers. Ten cardiac genes were analyzed: cardiac actin, α-actinin, α-tropomyosin, β-myosin heavy chain, metavinculin, muscle LIM protein, myosinbinding protein C, tafazzin, titin-cap (telethonin), and troponin T. Sequences for DCM-affected and control dogs and the published canine genome were compared. None of the coding sequences yielded a common causative mutation among all Doberman Pinscher samples. However, 3 variants were identified in the α-actinin gene in the DCM-affected Doberman Pinschers. One of these variants, identified in 2 of the 5 Doberman Pinschers, resulted in an amino acid change in the rod-forming triple coiled-coil domain. Mutations in the coding regions of several genes associated with DCM in humans did not appear to consistently account for DCM in Doberman Pinschers. However, an α-actinin variant was detected in some Doberman Pinschers that may contribute to the development of DCM given its potential effect on the structure of this protein. Investigation of additional candidate gene coding and noncoding regions and further evaluation of the role of α-actinin in development of DCM in Doberman Pinschers are warranted.

  4. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences. (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou


    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  5. Mutations in ribosomal proteins, RPL4 and RACK1, suppress the phenotype of a thermospermine-deficient mutant of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Jun-ichi Kakehi

    Full Text Available Thermospermine acts in negative regulation of xylem differentiation and its deficient mutant of Arabidopsis thaliana, acaulis5 (acl5, shows excessive xylem formation and severe dwarfism. Studies of two dominant suppressors of acl5, sac51-d and sac52-d, have revealed that SAC51 and SAC52 encode a transcription factor and a ribosomal protein L10 (RPL10, respectively, and these mutations enhance translation of the SAC51 mRNA, which contains conserved upstream open reading frames in the 5' leader. Here we report identification of SAC53 and SAC56 responsible for additional suppressors of acl5. sac53-d is a semi-dominant allele of the gene encoding a receptor for activated C kinase 1 (RACK1 homolog, a component of the 40S ribosomal subunit. sac56-d represents a semi-dominant allele of the gene for RPL4. We show that the GUS reporter activity driven by the CaMV 35S promoter plus the SAC51 5' leader is reduced in acl5 and restored by sac52-d, sac53-d, and sac56-d as well as thermospermine. Furthermore, the SAC51 mRNA, which may be a target of nonsense-mediated mRNA decay, was found to be stabilized in these ribosomal mutants and by thermospermine. These ribosomal proteins are suggested to act in the control of uORF-mediated translation repression of SAC51, which is derepressed by thermospermine.

  6. Regulation of the alpha-glucuronidase-encoding gene (aguA) from Aspergillus niger

    NARCIS (Netherlands)

    Vries, de R.P.; Vondervoort, van de P.J.I.; Hendriks, L.; Belt, van de M.; Visser, J.


    The !-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR.

  7. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.


    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  8. 6-Desaturase-Like Encoding Gene Introduction in Catfish (Clarias gariepinus

    Directory of Open Access Journals (Sweden)

    Anny Hary Ayu


    Full Text Available African catfish (Clarias gariepinus is one of the economically valuable aquaculture fish species in Indonesia. This research was aimed to produce F0 transgenic catfish carrying masou salmon Δ6-desaturase-like (OmΔ6FAD gene. The Δ6-desaturase enzyme is involved in highly unsaturated fatty acid biosynthesis. Transgenic catfish was produced by sperm-mediated gene transfer using electroporation method. In this study, as the first step, sperms were electroporated with three different OmΔ6FAD concentration (25, 50, and 100 µg mL-1 to have the highest sperm viability after electroporation (125 V/cm, pulse frequency 5 times, pulse length 30 millisecond, pulse interval 0.1 second. The highest sperm viability and sperm carrying OmΔ6FAD were obtain at 100 µg mL-1. This concentration was then used to produce F0 transgenic catfish in the second step. Sperm motility, sperm viability, fertilization rate, hatching rate, and larval survival at 14 days after hatching were the same as the controls (p>0.05. Genomic DNA was extracted from caudal fin and then used as template to identify transgenic F0 by PCR method using specific primer for OmΔ6FAD gene. The PCR result showed that 53.84% of F0 carried OmΔ6FAD gene. The result of fatty acid analysis showed that EPA and DHA contents of F0 transgenic fish and non-transgenic fish were similar.   Keywords: catfish, Δ6-desaturase-like gene, fatty acids, electroporation

  9. Cis-regulatory RNA elements that regulate specialized ribosome activity. (United States)

    Xue, Shifeng; Barna, Maria


    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  10. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata (United States)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar


    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  11. Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana. (United States)

    Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor


    The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

  12. The arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier (United States)

    Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.


    Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the r