Post-transcriptional regulation of ribosome biogenesis in yeast

Directory of Open Access Journals (Sweden)

Isabelle C. Kos-Braun

2017-05-01

Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

Science.gov (United States)

Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

1981-01-01

The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

Energy Technology Data Exchange (ETDEWEB)

Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

2011-09-02

Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

Hyper-regulation of pyr-gene expression in Escherichia coli cells with slow ribosomes. Evidence for RNA polymerase pausing in vivo

DEFF Research Database (Denmark)

Jensen, Kaj Frank

1988-01-01

UTP-modulated attenuation of transcription is involved in regulating the synthesis of pyrimidine nucleotides in Escherichia coli. Thus, expression of two genes, pyrBI and pyrE, was shown to be under this type of control. The genes encode the two subunits of aspartate transcarbamylase and orotate...... transcription should terminate or continue into the structural genes. This paper described a study of pyrBI and pyrE gene regulation in cells where the ribosomes move slowly as a result of mutation in rpsL. It appears that expression of the two genes is hyper-regulated by the UTP pool in this type of cells...

RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

International Nuclear Information System (INIS)

Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia

2016-01-01

The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

Control of ribosome traffic by position-dependent choice of synonymous codons

International Nuclear Information System (INIS)

Mitarai, Namiko; Pedersen, Steen

2013-01-01

Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

Science.gov (United States)

Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

2006-02-01

Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

cDNA, genomic sequence cloning and overexpression of ribosomal ...

African Journals Online (AJOL)

RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

Sequence analysis and over-expression of ribosomal protein S28 ...

African Journals Online (AJOL)

RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

Ubiquitin--conserved protein or selfish gene?

Science.gov (United States)

Catic, André; Ploegh, Hidde L

2005-11-01

The posttranslational modifier ubiquitin is encoded by a multigene family containing three primary members, which yield the precursor protein polyubiquitin and two ubiquitin moieties, Ub(L40) and Ub(S27), that are fused to the ribosomal proteins L40 and S27, respectively. The gene encoding polyubiquitin is highly conserved and, until now, those encoding Ub(L40) and Ub(S27) have been generally considered to be equally invariant. The evolution of the ribosomal ubiquitin moieties is, however, proving to be more dynamic. It seems that the genes encoding Ub(L40) and Ub(S27) are actively maintained by homologous recombination with the invariant polyubiquitin locus. Failure to recombine leads to deterioration of the sequence of the ribosomal ubiquitin moieties in several phyla, although this deterioration is evidently constrained by the structural requirements of the ubiquitin fold. Only a few amino acids in ubiquitin are vital for its function, and we propose that conservation of all three ubiquitin genes is driven not only by functional properties of the ubiquitin protein, but also by the propensity of the polyubiquitin locus to act as a 'selfish gene'.

Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

Directory of Open Access Journals (Sweden)

Deborah Chiabrando

2010-01-01

Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

Expression and RNA Interference of Ribosomal Protein L5 Gene in Nilaparvata lugens (Hemiptera: Delphacidae).

Science.gov (United States)

Zhu, Jiajun; Hao, Peiying; Lu, Chaofeng; Ma, Yan; Feng, Yalin; Yu, Xiaoping

2017-05-01

The ribosomal proteins play important roles in the growth and development of organisms. This study aimed to explore the function of NlRPL5 (GenBank KX379234), a ribosomal protein L5 gene, in the brown planthopper Nilaparvata lugens. The open reading frame of NlRPL5 was cloned from N. lugens based on a previous transcriptome analysis. The results revealed that the open reading frame of NlRPL5 is of 900 bp, encoding 299 amino acid residues. The reverse transcription quantitative PCR results suggested that the expression of NlRPL5 gene was stronger in gravid females, but was relatively low in nymphs, males, and newly emerged females. The expression level of NlRPL5 in the ovary was about twofolds of that in the head, thorax, or fat body. RNAi of dsNlRPL5 resulted in a significant reduction of mRNA levels, ∼50% decrease in comparison with the dsGFP control at day 6. Treatment of dsNlRPL5 significantly restricted the ovarian development, and decreased the number of eggs laid on the rice (Oryza sativa) plants. This study provided a new clue for further study on the function and regulation mechanism of NlRPL5 in N. lugens. © The Author 2017. Published by Oxford University Press on behalf of the Entomological Society of America.

The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

KAUST Repository

Zhao, Huayan

2015-08-13

The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

KAUST Repository

Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

2015-01-01

The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

Science.gov (United States)

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus

DEFF Research Database (Denmark)

Hansen, T S; Andreasen, P H; Dreisig, H

1991-01-01

We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 ...... by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.......We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63...... nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified...

Ribosomal protein gene knockdown causes developmental defects in zebrafish.

Directory of Open Access Journals (Sweden)

Tamayo Uechi

Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

Directory of Open Access Journals (Sweden)

Kirsten Kehrein

2015-02-01

Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

Directory of Open Access Journals (Sweden)

Patrick O McGowan

Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.

Sequence of a cloned cDNA encoding human ribosomal protein S11

Energy Technology Data Exchange (ETDEWEB)

Lott, J B; Mackie, G A

1988-02-11

The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

DEFF Research Database (Denmark)

Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E

2015-01-01

Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

[Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

Science.gov (United States)

Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

2014-06-01

To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

Science.gov (United States)

Catania, Francesco; Lynch, Michael

2010-05-04

In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer

DEFF Research Database (Denmark)

Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck

2009-01-01

Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...

Several genes encoding ribosomal proteins are over-expressed in prostate-cancer cell lines: confirmation of L7a and L37 over-expression in prostate-cancer tissue samples.

Science.gov (United States)

Vaarala, M H; Porvari, K S; Kyllönen, A P; Mustonen, M V; Lukkarinen, O; Vihko, P T

1998-09-25

A cDNA library specific for mRNA over-expressed in prostate cancer was generated by subtractive hybridization of transcripts originating from prostatic hyperplasia and cancer tissues. cDNA encoding ribosomal proteins L4, L5, L7a, L23a, L30, L37, S14 and S18 was found to be present among 100 analyzed clones. Levels of ribosomal mRNA were significantly higher at least in one of the prostate-cancer cell lines, LNCaP, DU-145 and PC-3, than in hyperplastic tissue, as determined by slot-blot hybridization. Furthermore, L23a- and S14-transcript levels were significantly elevated in PC-3 cells as compared with those in the normal prostate epithelial cell line PrEC. Generally, dramatic changes in the mRNA content of the ribosomal proteins were not detected, the most evident over-expression being that of L37 mRNA, which was 3.4 times more abundant in LNCaP cells than in hyperplastic prostate tissue. The over-expression of L7a and L37 mRNA was confirmed in prostate-cancer tissue samples by in situ hybridization. Elevated cancer-related expression of L4 and L30 has not been reported, but levels of the other ribosomal proteins are known to be increased in several types of cancers. These results therefore suggest that prostate cancer is comparable with other types of cancers, in that a larger pool of some ribosomal proteins is gained during the transformation process, by an unknown mechanism.

Expression of ribosomal genes in pea cotyledons at the initial stages of germination

International Nuclear Information System (INIS)

Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

1986-01-01

The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

Directory of Open Access Journals (Sweden)

Milbury Coren A

2010-09-01

Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

Directory of Open Access Journals (Sweden)

Lynch Michael

2010-05-01

Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

Directory of Open Access Journals (Sweden)

Nicholas T. Ingolia

2014-09-01

Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

Analysis of ribosomal protein gene structures: implications for intron evolution.

Directory of Open Access Journals (Sweden)

2006-03-01

Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use.

Science.gov (United States)

Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V

2016-09-06

Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

Science.gov (United States)

Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

2017-07-01

Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

Directory of Open Access Journals (Sweden)

Hui-Yeng Y Yap

Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

Science.gov (United States)

Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

2017-02-21

Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

Mitochondrial genome evolution in Alismatales: Size reduction and extensive loss of ribosomal protein genes

DEFF Research Database (Denmark)

Petersen, Gitte; Cuenca, Argelia; Zervas, Athanasios

2017-01-01

The order Alismatales is a hotspot for evolution of plant mitochondrial genomes characterized by remarkable differences in genome size, substitution rates, RNA editing, retrotranscription, gene loss and intron loss. Here we have sequenced the complete mitogenomes of Zostera marina and Stratiotes...... aloides, which together with previously sequenced mitogenomes from Butomus and Spirodela, provide new evolutionary evidence of genome size reduction, gene loss and transfer to the nucleus. The Zostera mitogenome includes a large portion of DNA transferred from the plastome, yet it is the smallest known...... mitogenome from a non-parasitic plant. Using a broad sample of the Alismatales, the evolutionary history of ribosomal protein gene loss is analyzed. In Zostera almost all ribosomal protein genes are lost from the mitogenome, but only some can be found in the nucleus....

DNA replication stress restricts ribosomal DNA copy number.

Science.gov (United States)

Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

2017-09-01

Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

DNA replication stress restricts ribosomal DNA copy number

Science.gov (United States)

Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

2017-01-01

Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

DNA replication stress restricts ribosomal DNA copy number.

Directory of Open Access Journals (Sweden)

Devika Salim

2017-09-01

Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

Science.gov (United States)

Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

2016-09-16

The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

Histone and ribosomal RNA repetitive gene clusters of the boll weevil are linked in a tandem array.

Science.gov (United States)

Roehrdanz, R; Heilmann, L; Senechal, P; Sears, S; Evenson, P

2010-08-01

Histones are the major protein component of chromatin structure. The histone family is made up of a quintet of proteins, four core histones (H2A, H2B, H3 & H4) and the linker histones (H1). Spacers are found between the coding regions. Among insects this quintet of genes is usually clustered and the clusters are tandemly repeated. Ribosomal DNA contains a cluster of the rRNA sequences 18S, 5.8S and 28S. The rRNA genes are separated by the spacers ITS1, ITS2 and IGS. This cluster is also tandemly repeated. We found that the ribosomal RNA repeat unit of at least two species of Anthonomine weevils, Anthonomus grandis and Anthonomus texanus (Coleoptera: Curculionidae), is interspersed with a block containing the histone gene quintet. The histone genes are situated between the rRNA 18S and 28S genes in what is known as the intergenic spacer region (IGS). The complete reiterated Anthonomus grandis histone-ribosomal sequence is 16,248 bp.

Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

DEFF Research Database (Denmark)

Douthwaite, S; Prince, J B; Noller, H F

1985-01-01

A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

Control of ribosome traffic by position-dependent choice of synonymous codons

DEFF Research Database (Denmark)

Mitarai, Namiko; Pedersen, Steen

2013-01-01

Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

Science.gov (United States)

Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

2004-12-01

The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

Directory of Open Access Journals (Sweden)

Mingsheng Yang

2015-03-01

Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

Science.gov (United States)

Chan, Y L; Paz, V; Olvera, J; Wool, I G

1993-04-30

The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

Science.gov (United States)

Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

2016-08-15

Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

International Nuclear Information System (INIS)

Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

1986-01-01

The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

Science.gov (United States)

Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

2014-01-01

The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

Mutation in ribosomal protein S5 leads to spectinomycin resistance in Neisseria gonorrhoeae.

Directory of Open Access Journals (Sweden)

Elena eIlina

2013-07-01

Full Text Available Spectinomycin remains a useful reserve option for therapy of gonorrhea. The emergence of multidrug-resistant Neisseria gonorrhoeae strains with decreased susceptibility to cefixime and to ceftriaxone makes it the only medicine still effective for treatment of gonorrhea infection in analogous cases. However, adoption of spectinomycin as a routinely used drug of choice was soon followed by reports of spectinomycin resistance. The main molecular mechanism of spectinomycin resistance in N. gonorrhoeae was C1192T substitution in 16S rRNA genes. Here we reported a Thr-24→Pro mutation in ribosomal protein S5 found in spectinomycin resistant clinical N. gonorrhoeae strain, which carried no changes in 16S rRNA. In a series of experiments, the transfer of rpsE gene allele encoding the mutant ribosomal protein S5 to the recipient N. gonorrhoeae strains was analyzed. The relatively high rate of transformation (ca. 10-5 CFUs indicates the possibility of spread of spectinonycin resistance within gonococcal population due to the horizontal gene transfer.

Mutations in ribosomal proteins, RPL4 and RACK1, suppress the phenotype of a thermospermine-deficient mutant of Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Jun-ichi Kakehi

Full Text Available Thermospermine acts in negative regulation of xylem differentiation and its deficient mutant of Arabidopsis thaliana, acaulis5 (acl5, shows excessive xylem formation and severe dwarfism. Studies of two dominant suppressors of acl5, sac51-d and sac52-d, have revealed that SAC51 and SAC52 encode a transcription factor and a ribosomal protein L10 (RPL10, respectively, and these mutations enhance translation of the SAC51 mRNA, which contains conserved upstream open reading frames in the 5' leader. Here we report identification of SAC53 and SAC56 responsible for additional suppressors of acl5. sac53-d is a semi-dominant allele of the gene encoding a receptor for activated C kinase 1 (RACK1 homolog, a component of the 40S ribosomal subunit. sac56-d represents a semi-dominant allele of the gene for RPL4. We show that the GUS reporter activity driven by the CaMV 35S promoter plus the SAC51 5' leader is reduced in acl5 and restored by sac52-d, sac53-d, and sac56-d as well as thermospermine. Furthermore, the SAC51 mRNA, which may be a target of nonsense-mediated mRNA decay, was found to be stabilized in these ribosomal mutants and by thermospermine. These ribosomal proteins are suggested to act in the control of uORF-mediated translation repression of SAC51, which is derepressed by thermospermine.

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

Science.gov (United States)

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

A deep auto-encoder model for gene expression prediction.

Science.gov (United States)

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome.

Science.gov (United States)

Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre

2016-09-01

Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

Science.gov (United States)

Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

2016-12-01

Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

Trapping the ribosome to control gene expression.

Science.gov (United States)

Boehringer, Daniel; Ban, Nenad

2007-09-21

Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

Emerging functions of ribosomal proteins in gene-specific transcription and translation

International Nuclear Information System (INIS)

Lindstroem, Mikael S.

2009-01-01

Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

Cloning, purification, crystallization and preliminary X-ray analysis of the Burkholderia pseudomallei L1 ribosomal protein

International Nuclear Information System (INIS)

Abd Aziz, Abd Ghani; Ruzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Mohamed, Rahmah; Nathan, Sheila; Baker, Patrick J.; Rice, David W.

2012-01-01

The L1 ribosomal protein from B. pseudomallei has been overexpressed, purified and crystallized in a form suitable for X-ray analysis. The gene encoding the L1 ribosomal protein from Burkholderia pseudomallei strain D286 has been cloned into the pETBLUE-1 vector system, overexpressed in Escherichia coli and purified. Crystals of the native protein were grown by the hanging-drop vapour-diffusion technique using PEG 3350 as a precipitant and diffracted to beyond 1.65 Å resolution. The crystals belonged to space group P2 1 2 1 2, with unit-cell parameters a = 53.6, b = 127.1, c = 31.8 Å and with a single molecule in the asymmetric unit

Replication and meiotic transmission of yeast ribosomal RNA genes.

Science.gov (United States)

Brewer, B J; Zakian, V A; Fangman, W L

1980-11-01

The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

Sublethal effects of imidacloprid on targeting muscle and ribosomal protein related genes in the honey bee Apis mellifera L.

Science.gov (United States)

Wu, Yan-Yan; Luo, Qi-Hua; Hou, Chun-Sheng; Wang, Qiang; Dai, Ping-Li; Gao, Jing; Liu, Yong-Jun; Diao, Qing-Yun

2017-11-21

A sublethal concentration of imidacloprid can cause chronic toxicity in bees and can impact the behavior of honey bees. The nectar- and water-collecting, and climbing abilities of bees are crucial to the survival of the bees and the execution of responsibilities in bee colonies. Besides behavioral impact, data on the molecular mechanisms underlying the toxicity of imidacloprid, especially by the way of RNA-seq at the transcriptomic level, are limited. We treated Apis mellifera L. with sublethal concentrations of imidacloprid (0.1, 1 and 10 ppb) and determined the effect on behaviors and the transcriptomic changes. The sublethal concentrations of imidacloprid had a limited impact on the survival and syrup consumption of bees, but caused a significant increase in water consumption. Moreover, the climbing ability was significantly impaired by 10 ppb imidacloprid at 8 d. In the RNA-seq analysis, gene ontology (GO) term enrichment indicated a significant down-regulation of muscle-related genes, which might contribute to the impairment in climbing ability of bees. The enriched GO terms were attributed to the up-regulated ribosomal protein genes. Considering the ribosomal and extra-ribosomal functions of the ribosomal proteins, we hypothesized that imidacloprid also causes cell dysfunction. Our findings further enhance the understanding of imidacloprid sublethal toxicity.

The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

Science.gov (United States)

Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

2008-07-01

Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

Science.gov (United States)

Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

2012-01-01

Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein l3.

Science.gov (United States)

Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S

2003-09-01

The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

Science.gov (United States)

Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

2013-08-08

Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Differentially expressed genes associated with dormancy or germination of Arabidopsis thaliana seeds

NARCIS (Netherlands)

Toorop, P.E.; Barroco, R.M.; Engler, G.; Groot, S.P.C.; Hilhorst, H.W.M.

2005-01-01

Differential display analysis using dormant and non-dormant Arabidopsis thaliana (L.) Heynh seeds resulted in a set of genes that were associated with either dormancy or germination. Expression of the germination-associated genes AtRPL36B and AtRPL27B, encoding two ribosomal proteins, was

The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

DEFF Research Database (Denmark)

Vester, Birte; Garrett, Roger Antony

1988-01-01

in vivo on a plasmid-encoded rRNA (rrnB) operon and each one yielded dramatically altered phenotypes. Cells exhibiting A2060----C or A2450----C transversions were inviable and it was shown by inserting the mutated genes after a temperature-inducible promoter that the mutant RNAs were directly responsible...... into 50S subunits, but while the two lethal mutant RNAs were strongly selected against in 70S ribosomes, the plasmid-encoded A2503----C RNA was preferred over the chromosome-encoded RNA, contrary to current regulatory theories. The results establish the critical structural and functional importance...

Two Nucleolar Proteins, GDP1 and OLI2, Function As Ribosome Biogenesis Factors and Are Preferentially Involved in Promotion of Leaf Cell Proliferation without Strongly Affecting Leaf Adaxial–Abaxial Patterning in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Koji Kojima

2018-01-01

Full Text Available Leaf abaxial–adaxial patterning is dependent on the mutual repression of leaf polarity genes expressed either adaxially or abaxially. In Arabidopsis thaliana, this process is strongly affected by mutations in ribosomal protein genes and in ribosome biogenesis genes in a sensitized genetic background, such as asymmetric leaves2 (as2. Most ribosome-related mutants by themselves do not show leaf abaxialization, and one of their typical phenotypes is the formation of pointed rather than rounded leaves. In this study, we characterized two ribosome-related mutants to understand how ribosome biogenesis is linked to several aspects of leaf development. Previously, we isolated oligocellula2 (oli2 which exhibits the pointed-leaf phenotype and has a cell proliferation defect. OLI2 encodes a homolog of Nop2 in Saccharomyces cerevisiae, a ribosome biogenesis factor involved in pre-60S subunit maturation. In this study, we found another pointed-leaf mutant that carries a mutation in a gene encoding an uncharacterized protein with a G-patch domain. Similar to oli2, this mutant, named g-patch domain protein1 (gdp1, has a reduced number of leaf cells. In addition, gdp1 oli2 double mutants showed a strong genetic interaction such that they synergistically impaired cell proliferation in leaves and produced markedly larger cells. On the other hand, they showed additive phenotypes when combined with several known ribosomal protein mutants. Furthermore, these mutants have a defect in pre-rRNA processing. GDP1 and OLI2 are strongly expressed in tissues with high cell proliferation activity, and GDP1-GFP and GFP-OLI2 are localized in the nucleolus. These results suggest that OLI2 and GDP1 are involved in ribosome biogenesis. We then examined the effects of gdp1 and oli2 on adaxial–abaxial patterning by crossing them with as2. Interestingly, neither gdp1 nor oli2 strongly enhanced the leaf polarity defect of as2. Similar results were obtained with as2 gdp1 oli2

cDNA Cloning, Overexpression, Purification and Pharmacologic Evaluation for Anticancer Activity of Ribosomal Protein L23A Gene (RPL23A from the Giant Panda

Directory of Open Access Journals (Sweden)

Si-Nan Zhang

2012-02-01

Full Text Available RPL23A gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins, which is located in the cytoplasm. The purpose of this paper was to explore the structure and anti-cancer function of ribosomal protein L23A (RPL23A gene of the Giant Panda (Ailuropoda melanoleuca. The cDNA of RPL23A was cloned successfully from the Giant Panda using RT-PCR technology. We constructed a recombinant expression vector containing RPL23A cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product obtained was purified by using Ni chelating affinity chromatography. Recombinant protein of RPL23A obtained from the experiment acted on Hep-2 cells and human HepG-2 cells, then the growth inhibitory effect of these cells was observed by MTT (3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide assay. The result indicated that the length of the fragment cloned is 506 bp, and it contains an open-reading frame (ORF of 471 bp encoding 156 amino acids. Primary structure analysis revealed that the molecular weight of the putative RPL23A protein is 17.719 kDa with a theoretical pI 11.16. The molecular weight of the recombinant protein RPL23A is 21.265 kDa with a theoretical pI 10.57. The RPL23A gene can be really expressed in E. coli and the RPL23A protein, fusioned with the N-terminally His-tagged protein, gave rise to the accumulation of an expected 22 KDa polypeptide. The data showed that the recombinant protein RPL23A had a time- and dose-dependency on the cell growth inhibition rate. The data also indicated that the effect at low concentrations was better than at high concentrations on Hep-2 cells, and that the concentration of 0.185 μg/mL had the best rate of growth inhibition of 36.31%. All results of the experiment revealed that the recombinant protein RPL23A exhibited anti-cancer function on the Hep-2 cells. The study provides a scientific basis and aids

SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

Science.gov (United States)

Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

2012-07-15

In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

DEFF Research Database (Denmark)

Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

2006-01-01

Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Resistance to the Peptidyl Transferase Inhibitor Tiamulin Caused by Mutation of Ribosomal Protein L3

OpenAIRE

Bøsling, Jacob; Poulsen, Susan M.; Vester, Birte; Long, Katherine S.

2003-01-01

The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ri...

Architecture of the large subunit of the mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

2014-01-23

Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

Science.gov (United States)

Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

2017-07-06

Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

Science.gov (United States)

Wang, Hao; Kingsford, Carl; McManus, C Joel

2018-03-15

Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

Science.gov (United States)

Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

2016-04-16

Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

Science.gov (United States)

Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

2009-11-01

RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients

OpenAIRE

Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A.; French, Deborah; Podsakoff, Gregory M.; Bessler, Monica; Mason, Philip J.

2015-01-01

Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosom...

A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

Directory of Open Access Journals (Sweden)

Jean-Clement Mars

2018-01-01

Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

Science.gov (United States)

Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

2018-04-06

The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

Differential Stoichiometry among Core Ribosomal Proteins

Directory of Open Access Journals (Sweden)

Nikolai Slavov

2015-11-01

Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

Cis-regulatory RNA elements that regulate specialized ribosome activity.

Science.gov (United States)

Xue, Shifeng; Barna, Maria

2015-01-01

Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

Active ribosomal genes, translational homeostasis and oxidative stress in the pathogenesis of schizophrenia and autism.

Science.gov (United States)

Porokhovnik, Lev N; Passekov, Vladimir P; Gorbachevskaya, Nataliya L; Sorokin, Alexander B; Veiko, Nataliya N; Lyapunova, Nataliya A

2015-04-01

Infantile autism and schizophrenia are severe multifactorial disorders with a pronounced genetic predisposition. Their pathogeneses are often associated with oxidative stress in the brain. Previously, we established that a cell's resistance to oxidative stress depended on the copy number of transcriptionally active genes for rRNA (ribosomal genes) in the cell's genome. The feature is measured cytogenetically in cultured lymphocytes derived from patients. It varies from 120 up to 190 copies per diploid genome, with an arithmetic mean of 150±4 (SE) copies in a healthy population (n=239), being considerably lower, according to our previous results, in a sample of patients with rheumatoid arthritis (n=49), another multifactorial disease with a proven significant role of oxidative stress in its pathogenesis: from 115 to 165 copies, with a mean of 140±4 (SE). Conversely, a sample of schizophrenic patients (n=42) previously showed a higher value of copy number of active rRNA genes compared with a healthy population: from 145 to 190 copies, with a mean of 170±4. This fact is of special interest in the context of the well-known, but still unexplained phenomenon of the reduced comorbidity rate of schizophrenia and rheumatoid arthritis. The copy number of active ribosomal genes was estimated in a sample of autistic children (n=51). In contrast with the schizophrenic patients studied previously, we found that the values were significantly lower than those in the healthy population: from 125 to 160 copies, with a mean of 142±5. In this work, we suggest a mathematical model of the oxidative stress dynamics on the basis of Lotka-Volterra's approach to predator-prey interactions. In our model, the 'prey' represents reactive oxygen species, whereas the 'predator' simulates molecules of the antioxidant enzymes. The rate of biosynthesis of the latter is limited by the number of ribosomes available, which, in turn, is determined by the copy number of active rRNA genes. Analysis of

Comparison of protein coding gene contents of the fungal phyla Pezizomycotina and Saccharomycotina

DEFF Research Database (Denmark)

Arvas, Mikko; Kivioja, Teemu; Mitchell, Alex

2007-01-01

Saccharomycotina are slightly better characterised and predicted to encode mainly enzymes. The genes specific to Saccharomycotina are enriched in transcription and mitochondrion related functions. Especially mitochondrial ribosomal proteins seem to have diverged from those of Pezizomycotina. In addition, we...

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

Science.gov (United States)

Loging, W T; Reisman, D

1999-11-01

The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

A highly divergent gene cluster in honey bees encodes a novel silk family.

Science.gov (United States)

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

International Nuclear Information System (INIS)

Planello, R.; Martinez-Guitarte, J.L.; Morcillo, G.

2007-01-01

Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

Energy Technology Data Exchange (ETDEWEB)

Planello, R. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Martinez-Guitarte, J.L. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Morcillo, G. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain)]. E-mail: gmorcillo@ccia.uned.es

2007-02-01

Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

Directory of Open Access Journals (Sweden)

Jeffrey R Johansen

Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

The Order Bacillales Hosts Functional Homologs of the Worrisome cfr Antibiotic Resistance Gene

DEFF Research Database (Denmark)

Hansen, Lykke H.; Planellas, Mercè H.; Long, Katherine S.

2012-01-01

The cfr gene encodes the Cfr methyltransferase that methylates a single adenine in the peptidyl transferase region of bacterial ribosomes. The methylation provides resistance to several classes of antibiotics that include drugs of clinical and veterinary importance. This paper describes a first...

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

Tumor-adjacent tissue co-expression profile analysis reveals pro-oncogenic ribosomal gene signature for prognosis of resectable hepatocellular carcinoma.

Science.gov (United States)

Grinchuk, Oleg V; Yenamandra, Surya P; Iyer, Ramakrishnan; Singh, Malay; Lee, Hwee Kuan; Lim, Kiat Hon; Chow, Pierce Kah-Hoe; Kuznetsov, Vladamir A

2018-01-01

Currently, molecular markers are not used when determining the prognosis and treatment strategy for patients with hepatocellular carcinoma (HCC). In the present study, we proposed that the identification of common pro-oncogenic pathways in primary tumors (PT) and adjacent non-malignant tissues (AT) typically used to predict HCC patient risks may result in HCC biomarker discovery. We examined the genome-wide mRNA expression profiles of paired PT and AT samples from 321 HCC patients. The workflow integrated differentially expressed gene selection, gene ontology enrichment, computational classification, survival predictions, image analysis and experimental validation methods. We developed a 24-ribosomal gene-based HCC classifier (RGC), which is prognostically significant in both PT and AT. The RGC gene overexpression in PT was associated with a poor prognosis in the training (hazard ratio = 8.2, P = 9.4 × 10 -6 ) and cross-cohort validation (hazard ratio = 2.63, P = 0.004) datasets. The multivariate survival analysis demonstrated the significant and independent prognostic value of the RGC. The RGC displayed a significant prognostic value in AT of the training (hazard ratio = 5.0, P = 0.03) and cross-validation (hazard ratio = 1.9, P = 0.03) HCC groups, confirming the accuracy and robustness of the RGC. Our experimental and bioinformatics analyses suggested a key role for c-MYC in the pro-oncogenic pattern of ribosomal biogenesis co-regulation in PT and AT. Microarray, quantitative RT-PCR and quantitative immunohistochemical studies of the PT showed that DKK1 in PT is the perspective biomarker for poor HCC outcomes. The common co-transcriptional pattern of ribosome biogenesis genes in PT and AT from HCC patients suggests a new scalable prognostic system, as supported by the model of tumor-like metabolic redirection/assimilation in non-malignant AT. The RGC, comprising 24 ribosomal genes, is introduced as a robust and reproducible prognostic model for

Gene content and organization of a 281-kbp contig from the genome of the extremely thermophilic archaeon, Sulfolobus solfataricus P2

NARCIS (Netherlands)

Charlebois, R.; Confalonieri, F.; Curtis, B.; Doolittle, W.F.; Duguet, M.; Erauso, G.; Faguy, D.; Gaasterland, T.; Garrett, R.A.; Gordon, P.; Kozera, C.; Medina, N.; Oost, van der J.; Peng, X.; Ragan, M.; She, Q.; Singh, R.K.

2000-01-01

The sequence of a 281-kbp contig from the crenarchaeote Sulfolobus solfataricus P2 was determined and analysed. Notable features in this region include 29 ribosomal protein genes, 12 tRNA genes (four of which contain archaeal-type introns), operons encoding enzymes of histidine biosynthesis,

Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.

Science.gov (United States)

Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K

1991-09-15

We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Deletion of the Sm1 encoding motif in the lsm gene results in distinct changes in the transcriptome and enhanced swarming activity of Haloferax cells.

Science.gov (United States)

Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita

2015-10-01

Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

A genome-wide analysis of nonribosomal peptide synthetase gene clusters and their peptides in a Planktothrix rubescens strain

Directory of Open Access Journals (Sweden)

Nederbragt Alexander J

2009-08-01

Full Text Available Abstract Background Cyanobacteria often produce several different oligopeptides, with unknown biological functions, by nonribosomal peptide synthetases (NRPS. Although some cyanobacterial NRPS gene cluster types are well described, the entire NRPS genomic content within a single cyanobacterial strain has never been investigated. Here we have combined a genome-wide analysis using massive parallel pyrosequencing ("454" and mass spectrometry screening of oligopeptides produced in the strain Planktothrix rubescens NIVA CYA 98 in order to identify all putative gene clusters for oligopeptides. Results Thirteen types of oligopeptides were uncovered by mass spectrometry (MS analyses. Microcystin, cyanopeptolin and aeruginosin synthetases, highly similar to already characterized NRPS, were present in the genome. Two novel NRPS gene clusters were associated with production of anabaenopeptins and microginins, respectively. Sequence-depth of the genome and real-time PCR data revealed three copies of the microginin gene cluster. Since NRPS gene cluster candidates for microviridin and oscillatorin synthesis could not be found, putative (gene encoded precursor peptide sequences to microviridin and oscillatorin were found in the genes mdnA and oscA, respectively. The genes flanking the microviridin and oscillatorin precursor genes encode putative modifying enzymes of the precursor oligopeptides. We therefore propose ribosomal pathways involving modifications and cyclisation for microviridin and oscillatorin. The microviridin, anabaenopeptin and cyanopeptolin gene clusters are situated in close proximity to each other, constituting an oligopeptide island. Conclusion Altogether seven nonribosomal peptide synthetase (NRPS gene clusters and two gene clusters putatively encoding ribosomal oligopeptide biosynthetic pathways were revealed. Our results demonstrate that whole genome shotgun sequencing combined with MS-directed determination of oligopeptides successfully

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

Science.gov (United States)

Galián, J A; Rosato, M; Rosselló, J A

2012-06-01

In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

Directory of Open Access Journals (Sweden)

Joseph C Sanchez

2017-10-01

Full Text Available A form of dwarfism known as Meier-Gorlin syndrome (MGS is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5. These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45. The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C. We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

Science.gov (United States)

Sanchez, Joseph C; Kwan, Elizabeth X; Pohl, Thomas J; Amemiya, Haley M; Raghuraman, M K; Brewer, Bonita J

2017-10-01

A form of dwarfism known as Meier-Gorlin syndrome (MGS) is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5). These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45). The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C). We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA) locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

The antibiotic thiostrepton inhibits a functional transition within protein L11 at the ribosomal GTPase centre

DEFF Research Database (Denmark)

Porse, B T; Leviev, I; Mankin, A S

1998-01-01

A newly identified class of highly thiostrepton-resistant mutants of the archaeon Halobacterium halobium carry a missense mutation at codon 18 within the gene encoding ribosomal protein L11. In the mutant proteins, a proline, conserved in archaea and bacteria, is converted to either serine...... technique, demonstrated that a general tightening of the C-terminal domain occurred on rRNA binding, while thiostrepton produced a footprint centred on tyrosine 62 at the junction of the N and C-terminal domains of protein L11 complexed to rRNA. The intensity of this protein footprint was strongly reduced...

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Directory of Open Access Journals (Sweden)

Olga Fernández-Miragall

Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Science.gov (United States)

Fernández-Miragall, Olga; Hernández, Carmen

2011-01-01

Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

DEFF Research Database (Denmark)

Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne

2010-01-01

An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

RNA-seq reveals more consistent reference genes for gene expression studies in human non-melanoma skin cancers

Directory of Open Access Journals (Sweden)

Van L.T. Hoang

2017-08-01

Full Text Available Identification of appropriate reference genes (RGs is critical to accurate data interpretation in quantitative real-time PCR (qPCR experiments. In this study, we have utilised next generation RNA sequencing (RNA-seq to analyse the transcriptome of a panel of non-melanoma skin cancer lesions, identifying genes that are consistently expressed across all samples. Genes encoding ribosomal proteins were amongst the most stable in this dataset. Validation of this RNA-seq data was examined using qPCR to confirm the suitability of a set of highly stable genes for use as qPCR RGs. These genes will provide a valuable resource for the normalisation of qPCR data for the analysis of non-melanoma skin cancer.

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

Science.gov (United States)

Su, S; Bird, R C

1995-09-15

A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed

On the control of ribosomal protein biosynthesis in Escherichia coli

International Nuclear Information System (INIS)

Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

1977-01-01

The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

Defective ribosome assembly in Shwachman-Diamond syndrome.

Science.gov (United States)

Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

2011-10-20

Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

A Synthetic Oligo Library and Sequencing Approach Reveals an Insulation Mechanism Encoded within Bacterial σ54 Promoters

Directory of Open Access Journals (Sweden)

Lior Levy

2017-10-01

Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.

Identification of a New Antimicrobial Resistance Gene Provides Fresh Insights Into Pleuromutilin Resistance in Brachyspira hyodysenteriae, Aetiological Agent of Swine Dysentery

Directory of Open Access Journals (Sweden)

Roderick M. Card

2018-06-01

Full Text Available Brachyspira hyodysenteriae is the aetiological agent of swine dysentery, a globally distributed disease that causes profound economic loss, impedes the free trade and movement of animals, and has significant impact on pig health. Infection is generally treated with antibiotics of which pleuromutilins, such as tiamulin, are widely used for this purpose, but reports of resistance worldwide threaten continued effective control. In Brachyspira hyodysenteriae pleuromutilin resistance has been associated with mutations in chromosomal genes encoding ribosome-associated functions, however the dynamics of resistance acquisition are poorly understood, compromising stewardship efforts to preserve pleuromutilin effectiveness. In this study we undertook whole genome sequencing (WGS and phenotypic susceptibility testing of 34 UK field isolates and 3 control strains to investigate pleuromutilin resistance in Brachyspira hyodysenteriae. Genome-wide association studies identified a new pleuromutilin resistance gene, tva(A (tiamulin valnemulin antibiotic resistance, encoding a predicted ABC-F transporter. In vitro culture of isolates in the presence of inhibitory or sub-inhibitory concentrations of tiamulin showed that tva(A confers reduced pleuromutilin susceptibility that does not lead to clinical resistance but facilitates the development of higher-level resistance via mutations in genes encoding ribosome-associated functions. Genome sequencing of antibiotic-exposed isolates identified both new and previously described mutations in chromosomal genes associated with reduced pleuromutilin susceptibility, including the 23S rRNA gene and rplC, which encodes the L3 ribosomal protein. Interesting three antibiotic-exposed isolates harboured mutations in fusA, encoding Elongation Factor G, a gene not previously associated with pleuromutilin resistance. A longitudinal molecular epidemiological examination of two episodes of swine dysentery at the same farm indicated

Selection of antigenic markers on a GFP-Cκ fusion scaffold with high sensitivity by eukaryotic ribosome display

International Nuclear Information System (INIS)

Yang Yongmin; Barankiewicz, Teresa J.; He Mingyue; Taussig, Michael J.; Chen, Swey-Shen

2007-01-01

Ribosome display is a cell-free system permitting gene selection through the physical association of genetic material (mRNA) and its phenotypic (protein) product. While often used to select single-chain antibodies from large libraries by panning against immobilized antigens, we have adapted ribosome display for use in the 'reverse' format in order to select high affinity antigenic determinants against solid-phase antibody. To create an antigenic scaffold, DNA encoding green fluorescent protein (GFP) was fused to a light chain constant domain (Cκ) with stop codon deleted, and with 5' signals (T7 promoter, Kozak) enabling coupled transcription/translation in a eukaryotic cell-free system. Epitopes on either GFP (5') or Cκ (3') were selected by anti-GFP or anti-Cκ antibodies, respectively, coupled to magnetic beads. After selection, mRNA was amplified directly from protein-ribosome-mRNA (PRM) complexes by in situ PCR followed by internal amplification and reassembly PCR. As little as 10 fg of the 1 kb DNA construct, i.e. approximately 7500 molecules, could be recovered following a single round of interaction with solid-phase anti-GFP antibody. This platform is highly specific and sensitive for the antigen-antibody interaction and may permit selection and reshaping of high affinity antigenic variants of scaffold proteins

Simulation and analysis of single-ribosome translation

International Nuclear Information System (INIS)

Tinoco, Ignacio Jr; Wen, Jin-Der

2009-01-01

In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Expression profiling of Ribosomal Protein gene family in dehydration stress responses and characterization of transgenic rice plants overexpressing RPL23A for water-use efficiency and tolerance to drought and salt stresses

Science.gov (United States)

Moin, Mazahar; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.

2017-11-01

Our previous findings on the screening of a large-pool of activation tagged rice plants grown under limited water conditions revealed the activation of Ribosomal Protein Large (RPL) subunit genes, RPL6 and RPL23A in two mutants that exhibited high water-use efficiency (WUE) with the genes getting activated by the integrated 4x enhancers (Moin et al., 2016a). In continuation of these findings, we have comprehensively characterized the Ribosomal Protein (RP) gene family including both small (RPS) and large (RPL) subunits, which have been identified to be encoded by at least 70 representative genes; RP-genes exist as multiple expressed copies with high nucleotide and amino acid sequence similarity. The differential expression of all the representative genes in rice was performed under limited water and drought conditions at progressive time intervals in the present study. More than 50% of the RP genes were upregulated in both shoot and root tissues. Some of them exhibited an overlap in the upregulation under both the treatments indicating that they might have a common role in inducing tolerance under limited water and drought conditions. Among the genes that became significantly upregulated in both the tissues and under both the treatments are RPL6, 7, 23A, 24 and 31 and RPS4, 10 and 18a. To further validate the role of RP genes in WUE and inducing tolerance to other stresses, we have raised transgenic plants overexpressing RPL23A in rice. The high expression lines of RPL23A exhibited low Δ13C, increased quantum efficiency along with suitable growth and yield parameters with respect to negative control under the conditions of limited water availability. The constitutive expression of RPL23A was also associated with transcriptional upregulation of many other RPL and RPS genes. The seedlings of RPL23A high expression lines also showed a significant increase in fresh weight, root length, proline and chlorophyll contents under simulated drought and salt stresses. Taken

Characterization of the ovine ribosomal protein SA gene and its pseudogenes

Directory of Open Access Journals (Sweden)

Van Zeveren Alex

2010-03-01

Full Text Available Abstract Background The ribosomal protein SA (RPSA, previously named 37-kDa laminin receptor precursor/67-kDa laminin receptor (LRP/LR is a multifunctional protein that plays a role in a number of pathological processes, such as cancer and prion diseases. In all investigated species, RPSA is a member of a multicopy gene family consisting of one full length functional gene and several pseudogenes. Therefore, for studies on RPSA related pathways/pathologies, it is important to characterize the whole family and to address the possible function of the other RPSA family members. The present work aims at deciphering the RPSA family in sheep. Results In addition to the full length functional ovine RPSA gene, 11 other members of this multicopy gene family, all processed pseudogenes, were identified. Comparison between the RPSA transcript and these pseudogenes shows a large variety in sequence identities ranging from 99% to 74%. Only one of the 11 pseudogenes, i.e. RPSAP7, shares the same open reading frame (ORF of 295 amino acids with the RPSA gene, differing in only one amino acid. All members of the RPSA family were annotated by comparative mapping and fluorescence in situ hybridization (FISH localization. Transcription was investigated in the cerebrum, cerebellum, spleen, muscle, lymph node, duodenum and blood, and transcripts were detected for 6 of the 11 pseudogenes in some of these tissues. Conclusions In the present work we have characterized the ovine RPSA family. Our results have revealed the existence of 11 ovine RPSA pseudogenes and provide new data on their structure and sequence. Such information will facilitate molecular studies of the functional RPSA gene taking into account the existence of these pseudogenes in the design of experiments. It remains to be investigated if the transcribed members are functional as regulatory non-coding RNA or as functional proteins.

High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

Science.gov (United States)

Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

2015-10-01

Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

Ribosomal trafficking is reduced in Schwann cells following induction of myelination

Directory of Open Access Journals (Sweden)

James M. Love

2015-08-01

Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Global functional analysis of nucleophosmin in Taxol response, cancer, chromatin regulation, and ribosomal DNA transcription

International Nuclear Information System (INIS)

Bergstralh, Daniel T.; Conti, Brian J.; Moore, Chris B.; Brickey, W. June; Taxman, Debra J.; Ting, Jenny P.-Y.

2007-01-01

Analysis of lung cancer response to chemotherapeutic agents showed the accumulation of a Taxol-induced protein that reacted with an anti-phospho-MEK1/2 antibody. Mass spectroscopy identified the protein as nucleophosmin/B23 (NPM), a multifunctional protein with diverse roles: ribosome biosynthesis, p53 regulation, nuclear-cytoplasmic shuttling, and centrosome duplication. Our work demonstrates that following cellular exposure to mitosis-arresting agents, NPM is phosphorylated and its chromatographic property is altered, suggesting changes in function during mitosis. To determine the functional relevance of NPM, its expression in tumor cells was reduced by siRNA. Cells with reduced NPM were treated with Taxol followed by microarray profiling accompanied by gene/protein pathway analyses. These studies demonstrate several expected and unexpected consequences of NPM depletion. The predominant downstream effectors of NPM are genes involved in cell proliferation, cancer, and the cell cycle. In congruence with its role in cancer, NPM is over-expressed in primary malignant lung cancer tissues. We also demonstrate a role for NPM in the expression of genes encoding SET (TAF1β) and the histone methylase SET8. Additionally, we show that NPM is required for a previously unobserved G2/M upregulation of TAF1A, which encodes the rDNA transcription factor TAF I 48. These results demonstrate multi-faceted functions of NPM that can affect cancer cells

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

Mutations in 23S rRNA gene associated with decreased susceptibility to tiamulin and valnemulin in Mycoplasma gallisepticum.

Science.gov (United States)

Li, Bei-Bei; Shen, Jian-Zhong; Cao, Xing-Yuan; Wang, Yang; Dai, Lei; Huang, Si-Yang; Wu, Cong-Ming

2010-07-01

Mycoplasma gallisepticum is a major etiological agent of chronic respiratory disease (CRD) in chickens and sinusitis in turkeys. The pleuromutilin antibiotics tiamulin and valnemulin are currently used in the treatment of M. gallisepticum infection. We studied the in vitro development of pleuromutilin resistance in M. gallisepticum and investigated the molecular mechanisms involved in this process. Pleuromutilin-resistant mutants were selected by serial passages of M. gallisepticum strains PG31 and S6 in broth medium containing subinhibitory concentrations of tiamulin or valnemulin. A portion of the gene encoding 23S rRNA gene (domain V) and the gene encoding ribosome protein L3 were amplified and sequenced. No mutation could be detected in ribosome protein L3. Mutations were found at nucleotide positions 2058, 2059, 2061, 2447 and 2503 of 23S rRNA gene (Escherichia coli numbering). Although a single mutation could cause elevation of tiamulin and valnemulin MICs, combinations of two or three mutations were necessary to produce high-level resistance. All the mutants were cross-resistant to lincomycin, chloramphenicol and florfenicol. Mutants with the A2058G or the A2059G mutation exhibited cross-resistance to macrolide antibiotics erythromycin, tilmicosin and tylosin.

The nuclear 18S ribosomal RNA gene as a source of phylogenetic information in the genus Taenia.

Science.gov (United States)

Yan, Hongbin; Lou, Zhongzi; Li, Li; Ni, Xingwei; Guo, Aijiang; Li, Hongmin; Zheng, Yadong; Dyachenko, Viktor; Jia, Wanzhong

2013-03-01

Most species of the genus Taenia are of considerable medical and veterinary significance. In this study, complete nuclear 18S rRNA gene sequences were obtained from seven members of genus Taenia [Taenia multiceps, Taenia saginata, Taenia asiatica, Taenia solium, Taenia pisiformis, Taenia hydatigena, and Taenia taeniaeformis] and a phylogeny inferred using these sequences. Most of the variable sites fall within the variable regions, V1-V5. We show that sequences from the nuclear 18S ribosomal RNA gene have considerable promise as sources of phylogenetic information within the genus Taenia. Furthermore, given that almost all the variable sites lie within defined variable portions of that gene, it will be appropriate and economical to sequence only those regions for additional species of Taenia.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

Selection of antigenic markers on a GFP-C{kappa} fusion scaffold with high sensitivity by eukaryotic ribosome display

Energy Technology Data Exchange (ETDEWEB)

Yongmin, Yang [Institute of Genetics, San Diego, CA 92121-2233 (United States); IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States); Barankiewicz, Teresa J [Institute of Genetics, San Diego, CA 92121-2233 (United States); IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States); Mingyue, He [Babraham Institute, Cambridge CB2 4AT (United Kingdom); Taussig, Michael J [Babraham Institute, Cambridge CB2 4AT (United Kingdom); Chen, Swey-Shen [Institute of Genetics, San Diego, CA 92121-2233 (United States) and IgE Therapeutics, Inc., San Diego, CA 92121-2233 (United States)

2007-07-27

Ribosome display is a cell-free system permitting gene selection through the physical association of genetic material (mRNA) and its phenotypic (protein) product. While often used to select single-chain antibodies from large libraries by panning against immobilized antigens, we have adapted ribosome display for use in the 'reverse' format in order to select high affinity antigenic determinants against solid-phase antibody. To create an antigenic scaffold, DNA encoding green fluorescent protein (GFP) was fused to a light chain constant domain (C{kappa}) with stop codon deleted, and with 5' signals (T7 promoter, Kozak) enabling coupled transcription/translation in a eukaryotic cell-free system. Epitopes on either GFP (5') or C{kappa} (3') were selected by anti-GFP or anti-C{kappa} antibodies, respectively, coupled to magnetic beads. After selection, mRNA was amplified directly from protein-ribosome-mRNA (PRM) complexes by in situ PCR followed by internal amplification and reassembly PCR. As little as 10 fg of the 1 kb DNA construct, i.e. approximately 7500 molecules, could be recovered following a single round of interaction with solid-phase anti-GFP antibody. This platform is highly specific and sensitive for the antigen-antibody interaction and may permit selection and reshaping of high affinity antigenic variants of scaffold proteins.

High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

Science.gov (United States)

Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

2016-02-01

Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

Directory of Open Access Journals (Sweden)

Nerea Irigoyen

2016-02-01

Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model

Science.gov (United States)

Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan

2011-01-01

We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250

Prediction of highly expressed genes in microbes based on chromatin accessibility

Directory of Open Access Journals (Sweden)

Ussery David W

2007-02-01

Full Text Available Abstract Background It is well known that gene expression is dependent on chromatin structure in eukaryotes and it is likely that chromatin can play a role in bacterial gene expression as well. Here, we use a nucleosomal position preference measure of anisotropic DNA flexibility to predict highly expressed genes in microbial genomes. We compare these predictions with those based on codon adaptation index (CAI values, and also with experimental data for 6 different microbial genomes, with a particular interest in experimental data from Escherichia coli. Moreover, position preference is examined further in 328 sequenced microbial genomes. Results We find that absolute gene expression levels are correlated with the position preference in many microbial genomes. It is postulated that in these regions, the DNA may be more accessible to the transcriptional machinery. Moreover, ribosomal proteins and ribosomal RNA are encoded by DNA having significantly lower position preference values than other genes in fast-replicating microbes. Conclusion This insight into DNA structure-dependent gene expression in microbes may be exploited for predicting the expression of non-translated genes such as non-coding RNAs that may not be predicted by any of the conventional codon usage bias approaches.

Hypoxic stress-induced changes in ribosomes of maize seedling roots

International Nuclear Information System (INIS)

Bailey-Serres, J.; Freeling, M.

1990-01-01

The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

Science.gov (United States)

Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

2008-03-12

In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Is The Ribosome Targeted By Adaptive Mutations

DEFF Research Database (Denmark)

Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

2015-01-01

Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

NARCIS (Netherlands)

de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

NARCIS (Netherlands)

Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

2006-01-01

A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

The Proximity of Ribosomal Protein Genes to oriC Enhances Vibrio cholerae Fitness in the Absence of Multifork Replication.

Science.gov (United States)

Soler-Bistué, Alfonso; Timmermans, Michaël; Mazel, Didier

2017-02-28

Recent works suggest that bacterial gene order links chromosome structure to cell homeostasis. Comparative genomics showed that, in fast-growing bacteria, ribosomal protein genes (RP) locate near the replication origin ( oriC ). We recently showed that Vibrio cholerae employs this positional bias as a growth optimization strategy: under fast-growth conditions, multifork replication increases RP dosage and expression. However, RP location may provide advantages in a dosage-independent manner: for example, the physical proximity of the many ribosomal components, in the context of a crowded cytoplasm, may favor ribosome biogenesis. To uncover putative dosage-independent effects, we studied isogenic V. cholerae derivatives in which the major RP locus, S10-spc-α (S10), was relocated to alternative genomic positions. When bacteria grew fast, bacterial fitness was reduced according to the S10 relative distance to oriC The growth of wild-type V. cholerae could not be improved by additional copies of the locus, suggesting a physiologically optimized genomic location. Slow growth is expected to uncouple RP position from dosage, since multifork replication does not occur. Under these conditions, we detected a fitness impairment when S10 was far from oriC Deep sequencing followed by marker frequency analysis in the absence of multifork replication revealed an up to 30% S10 dosage reduction associated with its relocation that closely correlated with fitness alterations. Hence, the impact of S10 location goes beyond a growth optimization strategy during feast periods. RP location may be important during the whole life cycle of this pathogen. IMPORTANCE The role of gene order within the bacterial chromosome is poorly understood. In fast growers, the location of genes linked with the expression of genetic information (i.e., transcription and translation) is biased toward oriC It was proposed that the location of these genes helps to maximize their expression by recruiting

High-Resolution Melting Curve Analysis of the 16S Ribosomal Gene to Detect and Identify Pathogenic and Saprophytic Leptospira Species in Colombian Isolates.

Science.gov (United States)

Peláez Sánchez, Ronald G; Quintero, Juan Álvaro López; Pereira, Martha María; Agudelo-Flórez, Piedad

2017-05-01

AbstractIt is important to identify the circulating Leptospira agent to enhance the performance of serodiagnostic tests by incorporating specific antigens of native species, develop vaccines that take into account the species/serovars circulating in different regions, and optimize prevention and control strategies. The objectives of this study were to develop a polymerase chain reaction (PCR)-high-resolution melting (HRM) assay for differentiating between species of the genus Leptospira and to verify its usefulness in identifying unknown samples to species level. A set of primers from the initial region of the 16S ribosomal gene was designed to detect and differentiate the 22 species of Leptospira . Eleven reference strains were used as controls to establish the reference species and differential melting curves. Twenty-five Colombian Leptospira isolates were studied to evaluate the usefulness of the PCR-HRM assay in identifying unknown samples to species level. This identification was confirmed by sequencing and phylogenetic analysis of the 16S ribosomal gene. Eleven Leptospira species were successfully identified, except for Leptospira meyeri / Leptospira yanagawae because the sequences were 100% identical. The 25 isolates from humans, animals, and environmental water sources were identified as Leptospira santarosai (twelve), Leptospira interrogans (nine), and L. meyeri / L. yanagawae (four). The species verification was 100% concordant between PCR-HRM and phylogenetic analysis of the 16S ribosomal gene. The PCR-HRM assay designed in this study is a useful tool for identifying Leptospira species from isolates.

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Science.gov (United States)

Noar, Roslyn D; Daub, Margaret E

2016-01-01

Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Directory of Open Access Journals (Sweden)

Roslyn D Noar

Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

Science.gov (United States)

He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

2009-12-31

We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

Directory of Open Access Journals (Sweden)

Arava Yoav

2007-08-01

Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

Science.gov (United States)

Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

2012-07-13

Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

Multicistronic lentiviral vectors containing the FMDV 2A cleavage factor demonstrate robust expression of encoded genes at limiting MOI

Directory of Open Access Journals (Sweden)

Margison Geoffrey P

2006-03-01

Full Text Available Abstract Background A number of gene therapy applications would benefit from vectors capable of expressing multiple genes. In this study we explored the feasibility and efficiency of expressing two or three transgenes in HIV-1 based lentiviral vector. Bicistronic and tricistronic self-inactivating lentiviral vectors were constructed employing the internal ribosomal entry site (IRES sequence of encephalomyocarditis virus (EMCV and/or foot-and-mouth disease virus (FMDV cleavage factor 2A. We employed enhanced green fluorescent protein (eGFP, O6-methylguanine-DNA-methyltransferase (MGMT, and homeobox transcription factor HOXB4 as model genes and their expression was detected by appropriate methods including fluorescence microscopy, flow cytometry, immunocytochemistry, biochemical assay, and western blotting. Results All the multigene vectors produced high titer virus and were able to simultaneously express two or three transgenes in transduced cells. However, the level of expression of individual transgenes varied depending on: the transgene itself; its position within the construct; the total number of transgenes expressed; the strategy used for multigene expression and the average copy number of pro-viral insertions. Notably, at limiting MOI, the expression of eGFP in a bicistronic vector based on 2A was ~4 times greater than that of an IRES based vector. Conclusion The small and efficient 2A sequence can be used alone or in combination with an IRES for the construction of multicistronic lentiviral vectors which can express encoded transgenes at functionally relevant levels in cells containing an average of one pro-viral insert.

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

Science.gov (United States)

Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

2015-01-01

Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

Think big--giant genes in bacteria.

Science.gov (United States)

Reva, Oleg; Tümmler, Burkhard

2008-03-01

Long genes should be rare in archaea and eubacteria because of the demanding costs of time and resources for protein production. The search in 580 sequenced prokaryotic genomes, however, revealed 0.2% of all genes to be longer than 5 kb (absolute number: 3732 genes). Eighty giant bacterial genes of more than 20 kb in length were identified in 47 taxa that belong to the phyla Thermotogae (1), Chlorobi (3), Planctomycetes (1), Cyanobacteria (2), Firmicutes (7), Actinobacteria (9), Proteobacteria (23) or Euryarchaeota (1) (number of taxa in brackets). Giant genes are strain-specific, differ in their tetranucleotide usage from the bulk genome and occur preferentially in non-pathogenic environmental bacteria. The two longest bacterial genes known to date were detected in the green sulfur bacterium Chlorobium chlorochromatii CaD3 encoding proteins of 36 806 and 20 647 amino acids, being surpassed in length only by the human titin coding sequence. More than 90% of bacterial giant genes either encode a surface protein or a polyketide/non-ribosomal peptide synthetase. Most surface proteins are acidic, threonine-rich, lack cystein and harbour multiple amino acid repeats. Giant proteins increase bacterial fitness by the production of either weapons towards or shields against animate competitors or hostile environments.

Karyotype characterization of Mugil incilis Hancock, 1830 (Mugiliformes: Mugilidae, including a description of an unusual co-localization of major and minor ribosomal genes in the family

Directory of Open Access Journals (Sweden)

Anne Kathrin Hett

Full Text Available This study reports the description of the karyotype of Mugil incilis from Venezuela. The chromosome complement is composed of 48 acrocentric chromosomes, which uniformly decrease in size. Therefore, the homologues can not be clearly identified, with the exception of one of the largest chromosome pairs, classified as number 1, whose homologues may show a subcentromeric secondary constriction, and of chromosome pair number 24, which is considerably smaller than the others. C-banding showed heterochromatic blocks at the centromeric/pericentromeric regions of all chromosomes, which were more conspicuous on chromosomes 1, given the C-positive signals include the secondary constrictions. AgNO3 and fluorescent in situ hybridization (FISH with 45S rDNA demonstrated that the nucleolus organizer regions are indeed located on the secondary constrictions of chromosome pair number 1. FISH with 5S rDNA revealed that the minor ribosomal genes are located on this same chromosome pair, near the NORs, though signals are closer to the centromeres and of smaller size, compared to those of the major ribosomal gene clusters. This is the first description of co-localization of major and minor ribosomal genes in the family. Data are discussed from a cytotaxonomic and phylogenetic perspective.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Characteristic differences between the promoters of intron-containing and intronless ribosomal protein genes in yeast

Directory of Open Access Journals (Sweden)

Vingron Martin

2008-10-01

Full Text Available Abstract Background More than two thirds of the highly expressed ribosomal protein (RP genes in Saccharomyces cerevisiae contain introns, which is in sharp contrast to the genome-wide five percent intron-containing genes. It is well established that introns carry regulatory sequences and that the transcription of RP genes is extensively and coordinately regulated. Here we test the hypotheses that introns are innately associated with heavily transcribed genes and that introns of RP genes contribute regulatory TF binding sequences. Moreover, we investigate whether promoter features are significantly different between intron-containing and intronless RP genes. Results We find that directly measured transcription rates tend to be lower for intron-containing compared to intronless RP genes. We do not observe any specifically enriched sequence motifs in the introns of RP genes other than those of the branch point and the two splice sites. Comparing the promoters of intron-containing and intronless RP genes, we detect differences in number and position of Rap1-binding and IFHL motifs. Moreover, the analysis of the length distribution and the folding free energies suggest that, at least in a sub-population of RP genes, the 5' untranslated sequences are optimized for regulatory function. Conclusion Our results argue against the direct involvement of introns in the regulation of transcription of highly expressed genes. Moreover, systematic differences in motif distributions suggest that RP transcription factors may act differently on intron-containing and intronless gene promoters. Thus, our findings contribute to the decoding of the RP promoter architecture and may fuel the discussion on the evolution of introns.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Microarray analysis reveals key genes and pathways in Tetralogy of Fallot

Science.gov (United States)

He, Yue-E; Qiu, Hui-Xian; Jiang, Jian-Bing; Wu, Rong-Zhou; Xiang, Ru-Lian; Zhang, Yuan-Hai

2017-01-01

The aim of the present study was to identify key genes that may be involved in the pathogenesis of Tetralogy of Fallot (TOF) using bioinformatics methods. The GSE26125 microarray dataset, which includes cardiovascular tissue samples derived from 16 children with TOF and five healthy age-matched control infants, was downloaded from the Gene Expression Omnibus database. Differential expression analysis was performed between TOF and control samples to identify differentially expressed genes (DEGs) using Student's t-test, and the R/limma package, with a log2 fold-change of >2 and a false discovery rate of <0.01 set as thresholds. The biological functions of DEGs were analyzed using the ToppGene database. The ReactomeFIViz application was used to construct functional interaction (FI) networks, and the genes in each module were subjected to pathway enrichment analysis. The iRegulon plugin was used to identify transcription factors predicted to regulate the DEGs in the FI network, and the gene-transcription factor pairs were then visualized using Cytoscape software. A total of 878 DEGs were identified, including 848 upregulated genes and 30 downregulated genes. The gene FI network contained seven function modules, which were all comprised of upregulated genes. Genes enriched in Module 1 were enriched in the following three neurological disorder-associated signaling pathways: Parkinson's disease, Alzheimer's disease and Huntington's disease. Genes in Modules 0, 3 and 5 were dominantly enriched in pathways associated with ribosomes and protein translation. The Xbox binding protein 1 transcription factor was demonstrated to be involved in the regulation of genes encoding the subunits of cytoplasmic and mitochondrial ribosomes, as well as genes involved in neurodegenerative disorders. Therefore, dysfunction of genes involved in signaling pathways associated with neurodegenerative disorders, ribosome function and protein translation may contribute to the pathogenesis of TOF

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

Directory of Open Access Journals (Sweden)

Mariën J

2008-03-01

Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

Mutations in the NOT Genes or in the Translation Machinery Similarly Display Increased Resistance to Histidine Starvation

Directory of Open Access Journals (Sweden)

Martine A. Collart

2017-05-01

Full Text Available The NOT genes encode subunits of the conserved Ccr4-Not complex, a global regulator of gene expression, and in particular of mRNA metabolism. They were originally identified in a selection for increased resistance to histidine starvation in the yeast S. cerevisiae. Recent work indicated that the Not5 subunit, ortholog of mammalian CNOT3, determines global translation levels by defining binding of the Ccr4-Not scaffold protein Not1 to ribosomal mRNAs during transcription. This is needed for optimal translation of ribosomal proteins. In this work we searched for mutations in budding yeast that were resistant to histidine starvation using the same selection that originally led to the isolation of the NOT genes. We thereby isolated mutations in ribosome-related genes. This common phenotype of ribosome mutants and not mutants is in good agreement with the positive role of the Not proteins for translation. In this regard, it is interesting that frequent mutations in RPL5 and RPL10 or in CNOT3 have been observed to accumulate in adult T-cell acute lymphoblastic leukemia (T-ALL. This suggests that in metazoans a common function implicating ribosome subunits and CNOT3 plays a role in the development of cancer. In this perspective we suggest that the Ccr4-Not complex, according to translation levels and fidelity, could itself be involved in the regulation of amino acid biosynthesis levels. We discuss how this could explain why mutations have been identified in many cancers.

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Sequence analysis of ribosomal and mitochondrial genes of the giant liver fluke Fascioloides magna (Trematoda: Fasciolidae): intraspecific variation and differentiation from Fasciola hepatica

Czech Academy of Sciences Publication Activity Database

Kráľová-Hromadová, I.; Špakulová, M.; Horáčková, Eva; Turčeková, Ĺ.; Novobilský, A.; Beck, R.; Koudela, Břetislav; Marinculić, A.; Rajský, D.; Pybus, M.

2008-01-01

Roč. 94, č. 1 (2008), s. 58-67 ISSN 0022-3395 R&D Projects: GA ČR GD524/03/H133; GA AV ČR IAA6022404 Grant - others:Slovak Research and Development Agency(SK) APVV-51-062205 Institutional research plan: CEZ:AV0Z60220518 Keywords : Fascioloides magna * Fasciola hepatica * ribosomal genes * mitochondrial genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.165, year: 2008

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

Directory of Open Access Journals (Sweden)

Malcolm S Hill

Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

Science.gov (United States)

Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

2013-01-01

Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

The ribosome uses two active mechanisms to unwind messenger RNA during translation.

Science.gov (United States)

Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

2011-07-06

The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

OpenAIRE

Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

2017-01-01

Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

International Nuclear Information System (INIS)

Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

2016-01-01

Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

Energy Technology Data Exchange (ETDEWEB)

Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

2016-04-22

Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Identification of Genes Enriched in GnRH Neurons by Translating Ribosome Affinity Purification and RNAseq in Mice.

Science.gov (United States)

Burger, Laura L; Vanacker, Charlotte; Phumsatitpong, Chayarndorn; Wagenmaker, Elizabeth R; Wang, Luhong; Olson, David P; Moenter, Suzanne M

2018-04-01

Gonadotropin-releasing hormone (GnRH) neurons are a nexus of fertility regulation. We used translating ribosome affinity purification coupled with RNA sequencing to examine messenger RNAs of GnRH neurons in adult intact and gonadectomized (GDX) male and female mice. GnRH neuron ribosomes were tagged with green fluorescent protein (GFP) and GFP-labeled polysomes isolated by immunoprecipitation, producing one RNA fraction enhanced for GnRH neuron transcripts and one RNA fraction depleted. Complementary DNA libraries were created from each fraction and 50-base, paired-end sequencing done and differential expression (enhanced fraction/depleted fraction) determined with a threshold of >1.5- or <0.66-fold (false discovery rate P ≤ 0.05). A core of ∼840 genes was differentially expressed in GnRH neurons in all treatments, including enrichment for Gnrh1 (∼40-fold), and genes critical for GnRH neuron and/or gonadotrope development. In contrast, non-neuronal transcripts were not enriched or were de-enriched. Several epithelial markers were also enriched, consistent with the olfactory epithelial origins of GnRH neurons. Interestingly, many synaptic transmission pathways were de-enriched, in accordance with relatively low innervation of GnRH neurons. The most striking difference between intact and GDX mice of both sexes was a marked downregulation of genes associated with oxidative phosphorylation and upregulation of glucose transporters in GnRH neurons from GDX mice. This may suggest that GnRH neurons switch to an alternate fuel to increase adenosine triphosphate production in the absence of negative feedback when GnRH release is elevated. Knowledge of the GnRH neuron translatome and its regulation can guide functional studies and can be extended to disease states, such as polycystic ovary syndrome.

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

2015-04-17

Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

Science.gov (United States)

Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

2017-09-01

Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

Science.gov (United States)

Al-Hadid, Qais; White, Jonelle; Clarke, Steven

2016-02-12

A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

Science.gov (United States)

Poirot, Olivier; Timsit, Youri

2016-05-01

From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

Science.gov (United States)

Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

2010-08-16

In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

Science.gov (United States)

Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

2016-06-01

The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex.

Science.gov (United States)

Xie, Ping

2015-10-09

Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Sex- and age-related differences in ribosomal proteins L17 and L37, as well as androgen receptor protein, in the song control system of zebra finches.

Science.gov (United States)

Tang, Y P; Wade, J

2010-12-29

The zebra finch song system is sexually dimorphic--only males sing, and the morphology of forebrain regions controlling the learning and production of this song is greatly enhanced in males compared to females. Masculinization appears to involve effects of steroid hormones as well as other factors, perhaps including the expression of sex chromosome genes (males: ZZ, females: ZW). The present study investigated three proteins--two encoded by Z-linked genes, ribosomal proteins L17 and L37 (RPL17 and RPL37), including their co-localization with androgen receptor (AR), from post-hatching day 25 to adulthood. Extensive co-expression of AR with the ribosomal proteins was detected in the three song nuclei investigated (HVC, robust nucleus of the arcopallium (RA), and Area X) across these ages. In general, more cells expressed each of these proteins in males compared to females, and the sex differences increased as animals matured. Specific patterns differed across regions and between RPL17 and RPL37, which suggest potential roles of one or both of these proteins in the incorporation and/or differentiation of song system cells. Copyright © 2010 IBRO. Published by Elsevier Ltd. All rights reserved.

[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

Science.gov (United States)

Ortega, Maya

2010-01-01

My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

Sex-related differences in gene expression in human skeletal muscle.

Directory of Open Access Journals (Sweden)

Stephen Welle

2008-01-01

Full Text Available There is sexual dimorphism of skeletal muscle, the most obvious feature being the larger muscle mass of men. The molecular basis for this difference has not been clearly defined. To identify genes that might contribute to the relatively greater muscularity of men, we compared skeletal muscle gene expression profiles of 15 normal men and 15 normal women by using comprehensive oligonucleotide microarrays. Although there were sex-related differences in expression of several hundred genes, very few of the differentially expressed genes have functions that are obvious candidates for explaining the larger muscle mass of men. The men tended to have higher expression of genes encoding mitochondrial proteins, ribosomal proteins, and a few translation initiation factors. The women had >2-fold greater expression than the men (P<0.0001 of two genes that encode proteins in growth factor pathways known to be important in regulating muscle mass: growth factor receptor-bound 10 (GRB10 and activin A receptor IIB (ACVR2B. GRB10 encodes a protein that inhibits insulin-like growth factor-1 (IGF-1 signaling. ACVR2B encodes a myostatin receptor. Quantitative RT-PCR confirmed higher expression of GRB10 and ACVR2B genes in these women. In an independent microarray study of 10 men and 9 women with facioscapulohumeral dystrophy, women had higher expression of GRB10 (2.7-fold, P<0.001 and ACVR2B (1.7-fold, P<0.03. If these sex-related differences in mRNA expression lead to reduced IGF-1 activity and increased myostatin activity, they could contribute to the sex difference in muscle size.

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

Science.gov (United States)

Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

2018-03-15

Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

Production of Active Nonglycosylated Recombinant B-Chain of Type-2 Ribosome-Inactivating Protein from Viscum articulatum and Its Biological Effects on Peripheral Blood Mononuclear Cells

Directory of Open Access Journals (Sweden)

Tzu-Li Lu

2011-01-01

Full Text Available Type-2 ribosome-inactivating proteins, composed of a toxic A-chain and lectin-like B-chain, display various biological functions, including cytotoxicity and immunomodulation. We here cloned the lectin-like B-chain encoding fragment of a newly identified type-2 RIP gene, articulatin gene, from Viscum articulatum, into a bacterial expression vector to obtain nonglycosylated recombinant protein expressed in inclusion bodies. After purification and protein refolding, soluble refolded recombinant articulatin B-chain (rATB showed lectin activity specific toward galactoside moiety and was stably maintained while stored in low ionic strength solution. Despite lacking glycosylation, rATB actively bound leukocytes with preferential binding to monocytes and in vitro stimulated PBMCs to release cytokines without obvious cytotoxicity. These results implicated such a B-chain fragment as a potential immunomodulator.

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

Science.gov (United States)

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

Science.gov (United States)

Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

2009-01-01

Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

The Insect Pathogen Serratia marcescens Db10 Uses a Hybrid Non-Ribosomal Peptide Synthetase-Polyketide Synthase to Produce the Antibiotic Althiomycin

Science.gov (United States)

Challis, Gregory L.; Stanley-Wall, Nicola R.; Coulthurst, Sarah J.

2012-01-01

There is a continuing need to discover new bioactive natural products, such as antibiotics, in genetically-amenable micro-organisms. We observed that the enteric insect pathogen, Serratia marcescens Db10, produced a diffusible compound that inhibited the growth of Bacillis subtilis and Staphyloccocus aureus. Mapping the genetic locus required for this activity revealed a putative natural product biosynthetic gene cluster, further defined to a six-gene operon named alb1–alb6. Bioinformatic analysis of the proteins encoded by alb1–6 predicted a hybrid non-ribosomal peptide synthetase-polyketide synthase (NRPS-PKS) assembly line (Alb4/5/6), tailoring enzymes (Alb2/3) and an export/resistance protein (Alb1), and suggested that the machinery assembled althiomycin or a related molecule. Althiomycin is a ribosome-inhibiting antibiotic whose biosynthetic machinery had been elusive for decades. Chromatographic and spectroscopic analyses confirmed that wild type S. marcescens produced althiomycin and that production was eliminated on disruption of the alb gene cluster. Construction of mutants with in-frame deletions of specific alb genes demonstrated that Alb2–Alb5 were essential for althiomycin production, whereas Alb6 was required for maximal production of the antibiotic. A phosphopantetheinyl transferase enzyme required for althiomycin biosynthesis was also identified. Expression of Alb1, a predicted major facilitator superfamily efflux pump, conferred althiomycin resistance on another, sensitive, strain of S. marcescens. This is the first report of althiomycin production outside of the Myxobacteria or Streptomyces and paves the way for future exploitation of the biosynthetic machinery, since S. marcescens represents a convenient and tractable producing organism. PMID:23028578

Radioactive probes for human gene localisation by in situ hybridisation

International Nuclear Information System (INIS)

Fennell, S.J.

1980-07-01

Radioactive probes of high specific activity have been used for human gene localisation on metaphase chromosome preparations. Human 5S ribosomal RNA was used as a model system, as a probe for the localisation of human 5S ribosomal genes. 125 I-labelled mouse 5S ribosomal RNA was used to study the 5S ribosomal gene content and arrangement in families with translocations on the long arm of chromosome 1 close to or containing the 5S ribosomal RNA locus, by in situ hybridisation to human metaphase chromosomes from peripheral blood cultures. This confirmed the chromosomal assignment of 5S ribosomal genes to 1q 42-43. In situ hybridisation probes were also prepared from recombinant plasmids containing Xenopus laevis oocyte 5S or 28S/18S gene sequences to give [ 3 H]-labelled cRNA and [ 3 H]-labelled nick-translated plasmid DNA. Studies on the kinetics of hybridisation of plasmid probes with and without ribosomal gene sequences questioned the role of plasmid DNA for amplification of signal during gene localisation. Gene localisation was obtained with nick-translated plasmid DNA containing the 28S/18S ribosomal DNA insert after short exposure times, but poor results were obtained using a [ 3 H]-labelled cRNA probe transcribed from the plasmid with the 5S gene insert. (author)

Defining the bacteroides ribosomal binding site.

Science.gov (United States)

Wegmann, Udo; Horn, Nikki; Carding, Simon R

2013-03-01

The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

Transcriptome sequencing of Mycosphaerella fijiensis during association with Musa acuminata reveals candidate pathogenicity genes.

Science.gov (United States)

Noar, Roslyn D; Daub, Margaret E

2016-08-30

Mycosphaerella fijiensis, causative agent of the black Sigatoka disease of banana, is considered the most economically damaging banana disease. Despite its importance, the genetics of pathogenicity are poorly understood. Previous studies have characterized polyketide pathways with possible roles in pathogenicity. To identify additional candidate pathogenicity genes, we compared the transcriptome of this fungus during the necrotrophic phase of infection with that during saprophytic growth in medium. Transcriptome analysis was conducted, and the functions of differentially expressed genes were predicted by identifying conserved domains, Gene Ontology (GO) annotation and GO enrichment analysis, Carbohydrate-Active EnZymes (CAZy) annotation, and identification of genes encoding effector-like proteins. The analysis showed that genes commonly involved in secondary metabolism have higher expression in infected leaf tissue, including genes encoding cytochrome P450s, short-chain dehydrogenases, and oxidoreductases in the 2-oxoglutarate and Fe(II)-dependent oxygenase superfamily. Other pathogenicity-related genes with higher expression in infected leaf tissue include genes encoding salicylate hydroxylase-like proteins, hydrophobic surface binding proteins, CFEM domain-containing proteins, and genes encoding secreted cysteine-rich proteins characteristic of effectors. More genes encoding amino acid transporters, oligopeptide transporters, peptidases, proteases, proteinases, sugar transporters, and proteins containing Domain of Unknown Function (DUF) 3328 had higher expression in infected leaf tissue, while more genes encoding inhibitors of peptidases and proteinases had higher expression in medium. Sixteen gene clusters with higher expression in leaf tissue were identified including clusters for the synthesis of a non-ribosomal peptide. A cluster encoding a novel fusicoccane was also identified. Two putative dispensable scaffolds were identified with a large proportion of

Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

Science.gov (United States)

Madalena, Christiane Rodriguez Gutierrez; Díez, José Luís; Gorab, Eduardo

2012-01-01

Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs) located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA), allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

Chromatin structure of ribosomal RNA genes in dipterans and its relationship to the location of nucleolar organizers.

Directory of Open Access Journals (Sweden)

Christiane Rodriguez Gutierrez Madalena

Full Text Available Nucleoli, nuclear organelles in which ribosomal RNA is synthesized and processed, emerge from nucleolar organizers (NORs located in distinct chromosomal regions. In polytene nuclei of dipterans, nucleoli of some species can be observed under light microscopy exhibiting distinctive morphology: Drosophila and chironomid species display well-formed nucleoli in contrast to the fragmented and dispersed nucleoli seen in sciarid flies. The available data show no apparent relationship between nucleolar morphology and location of NORs in Diptera. The regulation of rRNA transcription involves controlling both the transcription rate per gene as well as the proportion of rRNA genes adopting a proper chromatin structure for transcription, since active and inactive rRNA gene copies coexist in NORs. Transcription units organized in nucleosomes and those lacking canonical nucleosomes can be analyzed by the method termed psoralen gel retarding assay (PGRA, allowing inferences on the ratio of active to inactive rRNA gene copies. In this work, possible connections between chromosomal location of NORs and proportion of active rRNA genes were studied in Drosophila melanogaster, and in chironomid and sciarid species. The data suggested a link between location of NORs and proportion of active rRNA genes since the copy number showing nucleosomal organization predominates when NORs are located in the pericentric heterochromatin. The results presented in this work are in agreement with previous data on the chromatin structure of rRNA genes from distantly related eukaryotes, as assessed by the PGRA.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

Science.gov (United States)

Delihas, N.; Fox, G. E.

1987-01-01

In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

DEFF Research Database (Denmark)

Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

2008-01-01

indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism.

Science.gov (United States)

Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul

2015-08-18

Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

Directory of Open Access Journals (Sweden)

Anirban Chakraborty

Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

Science.gov (United States)

Gregory, Steven T.

2018-03-01

Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

Thermo-Regulation of Genes Mediating Motility and Plant Interactions in Pseudomonas syringae

Science.gov (United States)

Hockett, Kevin L.; Burch, Adrien Y.; Lindow, Steven E.

2013-01-01

Pseudomonas syringae is an important phyllosphere colonist that utilizes flagellum-mediated motility both as a means to explore leaf surfaces, as well as to invade into leaf interiors, where it survives as a pathogen. We found that multiple forms of flagellum-mediated motility are thermo-suppressed, including swarming and swimming motility. Suppression of swarming motility occurs between 28° and 30°C, which coincides with the optimal growth temperature of P. syringae. Both fliC (encoding flagellin) and syfA (encoding a non-ribosomal peptide synthetase involved in syringafactin biosynthesis) were suppressed with increasing temperature. RNA-seq revealed 1440 genes of the P. syringae genome are temperature sensitive in expression. Genes involved in polysaccharide synthesis and regulation, phage and IS elements, type VI secretion, chemosensing and chemotaxis, translation, flagellar synthesis and motility, and phytotoxin synthesis and transport were generally repressed at 30°C, while genes involved in transcriptional regulation, quaternary ammonium compound metabolism and transport, chaperone/heat shock proteins, and hypothetical genes were generally induced at 30°C. Deletion of flgM, a key regulator in the transition from class III to class IV gene expression, led to elevated and constitutive expression of fliC regardless of temperature, but did not affect thermo-regulation of syfA. This work highlights the importance of temperature in the biology of P. syringae, as many genes encoding traits important for plant-microbe interactions were thermo-regulated. PMID:23527276

The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan.

Science.gov (United States)

Mittal, Nitish; Guimaraes, Joao C; Gross, Thomas; Schmidt, Alexander; Vina-Vilaseca, Arnau; Nedialkova, Danny D; Aeschimann, Florian; Leidel, Sebastian A; Spang, Anne; Zavolan, Mihaela

2017-09-06

In Saccharomyces cerevisiae, deletion of large ribosomal subunit protein-encoding genes increases the replicative lifespan in a Gcn4-dependent manner. However, how Gcn4, a key transcriptional activator of amino acid biosynthesis genes, increases lifespan, is unknown. Here we show that Gcn4 acts as a repressor of protein synthesis. By analyzing the messenger RNA and protein abundance, ribosome occupancy and protein synthesis rate in various yeast strains, we demonstrate that Gcn4 is sufficient to reduce protein synthesis and increase yeast lifespan. Chromatin immunoprecipitation reveals Gcn4 binding not only at genes that are activated, but also at genes, some encoding ribosomal proteins, that are repressed upon Gcn4 overexpression. The promoters of repressed genes contain Rap1 binding motifs. Our data suggest that Gcn4 is a central regulator of protein synthesis under multiple perturbations, including ribosomal protein gene deletions, calorie restriction, and rapamycin treatment, and provide an explanation for its role in longevity and stress response.The transcription factor Gcn4 is known to regulate yeast amino acid synthesis. Here, the authors show that Gcn4 also acts as a repressor of protein biosynthesis in a range of conditions that enhance yeast lifespan, such as ribosomal protein knockout, calorie restriction or mTOR inhibition.

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

Science.gov (United States)

Yu, Shoukai; Lemos, Bernardo

2016-12-31

Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Characteristics of the Lotus japonicus gene repertoire deduced from large-scale expressed sequence tag (EST) analysis.

Science.gov (United States)

Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi

2004-02-01

To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

Science.gov (United States)

Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

2014-10-29

Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients.

Directory of Open Access Journals (Sweden)

Bai-Wei Gu

Full Text Available Dyskeratosis congenita (DC is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed "corrected" lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells

Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients.

Science.gov (United States)

Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A; French, Deborah; Podsakoff, Gregory M; Bessler, Monica; Mason, Philip J

2015-01-01

Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA) processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS) cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed "corrected" lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells from human

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

Phylogenomic analysis of secondary metabolism genes sheds light on their evolution in Aspergilli

DEFF Research Database (Denmark)

Theobald, Sebastian; Vesth, Tammi Camilla; Rasmussen, Jane Lind Nybo

.Natural products are encoded by genes located in close proximity, called secondary metabolic gene clusters, which makes them interesting targets for genomic analysis. We use a modified version of the Secondary Metabolite Unique Regions Finder (SMURF) algorithm, combined with InterPro annotations to create...... approximate maximum likelihood trees of conserved domains from secondary metabolic genes across 56 species, giving insights into the secondary metabolism gene diversity and evolution.In this study we can describe the evolution of non ribosomal peptide synthetases (NRPS), polyketide synthases (PKS) and hybrids.......In the aspMine project, we are sequencing and analyzing over 300 species of Aspergilli, agroup of filamentous fungi rich in natural compounds. The vast amount of data obtained from these species challenges the way we were mining for products and requires new pipelines for secondary metabolite analysis...

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

Directory of Open Access Journals (Sweden)

Larisa Gunderina

2015-05-01

Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

5S rRNA and ribosome.

Science.gov (United States)

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

In vitro degradation of ribosomes.

Science.gov (United States)

Mora, G; Rivas, A

1976-12-01

The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

International Nuclear Information System (INIS)

Gravel, M.; Melancon, P.; Barkier-Gingras, L.

1987-01-01

[ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions

Energy Technology Data Exchange (ETDEWEB)

Jiang, Hongbing; Franz, Carl J.; Wu, Guang; Renshaw, Hilary; Zhao, Guoyan [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States); Firth, Andrew E. [Department of Pathology, University of Cambridge, Cambridge CB2 1QP (United Kingdom); Wang, David, E-mail: davewang@borcim.wustl.edu [Departments of Molecular Microbiology and Pathology and Immunology, Washington University in St. Louis School of Medicine, St. Louis, MO 63110 (United States)

2014-02-15

Orsay virus is the first identified virus that is capable of naturally infecting Caenorhabditis elegans. Although it is most closely related to nodaviruses, Orsay virus differs from nodaviruses in its genome organization. In particular, the Orsay virus RNA2 segment encodes a putative novel protein of unknown function, termed delta, which is absent from all known nodaviruses. Here we present evidence that Orsay virus utilizes a ribosomal frameshifting strategy to express a novel fusion protein from the viral capsid (alpha) and delta ORFs. Moreover, the fusion protein was detected in purified virus fractions, demonstrating that it is most likely incorporated into Orsay virions. Furthermore, N-terminal sequencing of both the fusion protein and the capsid protein demonstrated that these proteins must be translated from a non-canonical initiation site. While the function of the alpha–delta fusion remains cryptic, these studies provide novel insights into the fundamental properties of this new clade of viruses. - Highlights: • Orsay virus encodes a novel fusion protein by a ribosomal frameshifting mechanism. • Orsay capsid and fusion protein is translated from a non-canonical initiation site. • The fusion protein is likely incorporated into Orsay virions.

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

Directory of Open Access Journals (Sweden)

Borchardt Stephanie M

2006-07-01

Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

Science.gov (United States)

Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

2017-07-07

Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanyo, A.; Majiwa, P.W.

2006-01-01

Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

International Nuclear Information System (INIS)

Burkhardt, N.

1997-01-01

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

Common changes in global gene expression induced by RNA polymerase inhibitors in Shigella flexneri.

Directory of Open Access Journals (Sweden)

Hua Fu

Full Text Available Characterization of expression profile of organisms in response to antimicrobials provides important information on the potential mechanism of action of the drugs. The special expression signature can be used to predict whether other drugs act on the same target. Here, the common response of Shigella flexneri to two inhibitors of RNA polymerase was examined using gene expression profiling. Consistent with similar effects of the two drugs, the gene expression profiles indicated that responses of the bacteria to these drugs were roughly the same, with 225 genes affected commonly. Of them, 88 were induced and 137 were repressed. Real-time PCR was performed for selected genes to verify the microarray results. Analysis of the expression data revealed that more than 30% of the plasmid-encoded genes on the array were up-regulated by the antibiotics including virF regulon, other virulence-related genes, and genes responsible for plasmid replication, maintenance, and transfer. In addition, some chromosome-encoded genes involved in virulence and genes acquired from horizontal transfer were also significantly up-regulated. However, the expression of genes encoding the beta-subunit of RNA polymerase was increased moderately. The repressed genes include those that code for products associated with the ribosome, citrate cycle, glycolysis, thiamine biosynthesis, purine metabolism, fructose metabolism, mannose metabolism, and cold shock proteins. This study demonstrates that the two antibiotics induce rapid cessation of RNA synthesis resulting in inhibition of translation components. It also indicates that the production of virulence factors involved in intercellular dissemination, tissue invasion and inflammatory destruction may be enhanced through derepressing horizontal transfer genes by the drugs.

Spatial regulation of a common precursor from two distinct genes generates metabolite diversity

Energy Technology Data Exchange (ETDEWEB)

Guo, Chun-Jun; Sun, Wei-Wen; Bruno, Kenneth S.; Oakley, Berl R.; Keller, Nancy P.; Wang, Clay C.

2015-07-13

In secondary metabolite biosynthesis, core synthetic genes such as polyketide synthase genes or non-ribosomal peptide synthase genes usually encode proteins that generate various backbone precursors. These precursors are modified by other tailoring enzymes to yield a large variety of different secondary metabolites. The number of core synthesis genes in a given species correlates, therefore, with the number of types of secondary metabolites the organism can produce. In our study, heterologous expression of all the A. terreus NRPS-like genes showed that two NRPS-like proteins, encoded by atmelA and apvA, release the same natural product, aspulvinone E. More interestingly, further experiments revealed that the aspulvinone E produced by two different genes accumulates in different fungal compartments. And this spatial control of aspulvinone E production is likely to be regulated by their own specific promoters. Comparative genomics indicates that atmelA and apvA might share a same ancestral gene and the gene apvA is inserted in a highly conserved region in Aspergillus species that contains genes coding for life-essential proteins. The study also identified one trans-prenyltransferase AbpB which is capable of prenylating two different substrates aspulvinones and butyrolactones. In total, our study shows the first example in which the locally distribution of the same natural product could lead to its incorporation into different SM pathways.

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

Science.gov (United States)

Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

2016-01-15

The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

Directory of Open Access Journals (Sweden)

Bani Kumar Pathak

Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

Concerted evolution of sea anemone neurotoxin genes is revealed through analysis of the Nematostella vectensis genome.

Science.gov (United States)

Moran, Yehu; Weinberger, Hagar; Sullivan, James C; Reitzel, Adam M; Finnerty, John R; Gurevitz, Michael

2008-04-01

Gene families, which encode toxins, are found in many poisonous animals, yet there is limited understanding of their evolution at the nucleotide level. The release of the genome draft sequence for the sea anemone Nematostella vectensis enabled a comprehensive study of a gene family whose neurotoxin products affect voltage-gated sodium channels. All gene family members are clustered in a highly repetitive approximately 30-kb genomic region and encode a single toxin, Nv1. These genes exhibit extreme conservation at the nucleotide level which cannot be explained by purifying selection. This conservation greatly differs from the toxin gene families of other animals (e.g., snakes, scorpions, and cone snails), whose evolution was driven by diversifying selection, thereby generating a high degree of genetic diversity. The low nucleotide diversity at the Nv1 genes is reminiscent of that reported for DNA encoding ribosomal RNA (rDNA) and 2 hsp70 genes from Drosophila, which have evolved via concerted evolution. This evolutionary pattern was experimentally demonstrated in yeast rDNA and was shown to involve unequal crossing-over. Through sequence analysis of toxin genes from multiple N. vectensis populations and 2 other anemone species, Anemonia viridis and Actinia equina, we observed that the toxin genes for each sea anemone species are more similar to one another than to those of other species, suggesting they evolved by manner of concerted evolution. Furthermore, in 2 of the species (A. viridis and A. equina) we found genes that evolved under diversifying selection, suggesting that concerted evolution and accelerated evolution may occur simultaneously.

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Individual members of the light-harvesting complex II chlorophyll a/b-binding protein gene family in pea (Pisum sativum) show differential responses to ultraviolet-B radiation

International Nuclear Information System (INIS)

Mackerness, A.H.S.; Liu, L.; Thomas, B.; Thompson, W.F.; Jordan, B.R.; White, M.J.

1998-01-01

In the present work, UV-B-repressible and UV-B-inducible genes were identified in the pea, Pisum sativum L., by rapid amplification of 3′ cDNA ends through use of the polymerase chain reaction. Of the UV-B-repressible clones, psUVRub and psUVDeh represent genes encoding Rubisco activase and dehydrin, respectively. A third clone, psUVZinc, did not correspond closely in overall nucleotide sequence to any gene registered in GenBank; however, a short deduced peptide shared similarity with the photosystem-II reaction center X protein of the chlorophyll a+c-containing alga, Odontella sinensis. The UV-B-inducible clones, psUVGluc, psUVAux and psUVRib, were related to genes encoding β-1, 3-glucanase, auxin-repressed protein, and a 40S ribosomal protein, respectively. The modulation of these pea genes indicates how UV-B, through its actions as a physical stressor, affects several important physiological processes in plants. (author)

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

Science.gov (United States)

Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

2016-04-15

We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

Science.gov (United States)

Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

2000-07-01

The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

Of blood, bones, and ribosomes: is Swachman-Diamond syndrome a ribosomopathy?

Science.gov (United States)

Johnson, Arlen W; Ellis, Steve R

2011-05-01

Mutations in the human SBDS (Shwachman-Bodian-Diamond syndrome) gene are the most common cause of Shwachman-Diamond syndrome, an inherited bone marrow failure syndrome. In this issue of Genes & Development, Finch and colleagues (pp. 917-929) establish that SBDS functions in ribosome synthesis by promoting the recycling of eukaryotic initiation factor 6 (eIF6) in a GTP-dependent manner. This work supports the idea that a ribosomopathy may underlie this syndrome.

Of blood, bones, and ribosomes: is Swachman-Diamond syndrome a ribosomopathy?

OpenAIRE

Johnson, Arlen W.; Ellis, Steve R.

2011-01-01

Mutations in the human SBDS (Shwachman-Bodian-Diamond syndrome) gene are the most common cause of Shwachman-Diamond syndrome, an inherited bone marrow failure syndrome. In this issue of Genes & Development, Finch and colleagues (pp. 917–929) establish that SBDS functions in ribosome synthesis by promoting the recycling of eukaryotic initiation factor 6 (eIF6) in a GTP-dependent manner. This work supports the idea that a ribosomopathy may underlie this syndrome.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

DEFF Research Database (Denmark)

Abildgaard, L; Engberg, RM; Pedersen, Karl

2009-01-01

The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

International Nuclear Information System (INIS)

Hayat, S.; Cheng, Z.; Chen, X.

2016-01-01

The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

Directory of Open Access Journals (Sweden)

Ghaffari Novin M.

2015-06-01

Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

Directory of Open Access Journals (Sweden)

Jacqueline Schmuckli-Maurer

Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

Science.gov (United States)

Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

2012-04-17

Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

2017-01-01

The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

An evolutionarily conserved gene family encodes proton-selective ion channels.

Science.gov (United States)

Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

2018-03-02

Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

Science.gov (United States)

Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

2015-06-01

Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

Directory of Open Access Journals (Sweden)

Kouji Shimoda

2002-01-01

Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

DEFF Research Database (Denmark)

Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

2018-01-01

The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

Diversity of 23S rRNA genes within individual prokaryotic genomes.

Directory of Open Access Journals (Sweden)

Anna Pei

Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

Science.gov (United States)

Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

Directory of Open Access Journals (Sweden)

Ruilin Wang

Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

A ribosome without RNA

Directory of Open Access Journals (Sweden)

Harold S Bernhardt

2015-11-01

Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

Science.gov (United States)

Pyne, C; Bognar, A L

1992-03-01

The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

Science.gov (United States)

Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

2017-12-26

The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Science.gov (United States)

Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

2013-01-01

The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Directory of Open Access Journals (Sweden)

Linda J Savage

Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

NARCIS (Netherlands)

Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

2015-01-01

Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

DEFF Research Database (Denmark)

Grankowski, N; Gasior, E; Issinger, O G

1993-01-01

Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

Directory of Open Access Journals (Sweden)

Cory Ann Leonard

2016-01-01

Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

Science.gov (United States)

Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

2005-01-01

Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

Science.gov (United States)

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

DEFF Research Database (Denmark)

Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

2016-01-01

genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

Ribosomal elongation factor 4 promotes cell death associated with lethal stress.

Science.gov (United States)

Li, Liping; Hong, Yuzhi; Luan, Gan; Mosel, Michael; Malik, Muhammad; Drlica, Karl; Zhao, Xilin

2014-12-09

Ribosomal elongation factor 4 (EF4) is highly conserved among bacteria, mitochondria, and chloroplasts. However, the EF4-encoding gene, lepA, is nonessential and its deficiency shows no growth or fitness defect. In purified systems, EF4 back-translocates stalled, posttranslational ribosomes for efficient protein synthesis; consequently, EF4 has a protective role during moderate stress. We were surprised to find that EF4 also has a detrimental role during severe stress: deletion of lepA increased Escherichia coli survival following treatment with several antimicrobials. EF4 contributed to stress-mediated lethality through reactive oxygen species (ROS) because (i) the protective effect of a ΔlepA mutation against lethal antimicrobials was eliminated by anaerobic growth or by agents that block hydroxyl radical accumulation and (ii) the ΔlepA mutation decreased ROS levels stimulated by antimicrobial stress. Epistasis experiments showed that EF4 functions in the same genetic pathway as the MazF toxin, a stress response factor implicated in ROS-mediated cell death. The detrimental action of EF4 required transfer-messenger RNA (tmRNA, which tags truncated proteins for degradation and is known to be inhibited by EF4) and the ClpP protease. Inhibition of a protective, tmRNA/ClpP-mediated degradative activity would allow truncated proteins to indirectly perturb the respiratory chain and thereby provide a potential link between EF4 and ROS. The connection among EF4, MazF, tmRNA, and ROS expands a pathway leading from harsh stress to bacterial self-destruction. The destructive aspect of EF4 plus the protective properties described previously make EF4 a bifunctional factor in a stress response that promotes survival or death, depending on the severity of stress. Translation elongation factor 4 (EF4) is one of the most conserved proteins in nature, but it is dispensable. Lack of strong phenotypes for its genetic knockout has made EF4 an enigma. Recent biochemical work has

Identification and functional analysis of gene cluster involvement in biosynthesis of the cyclic lipopeptide antibiotic pelgipeptin produced by Paenibacillus elgii

Directory of Open Access Journals (Sweden)

Qian Chao-Dong

2012-09-01

Full Text Available Abstract Background Pelgipeptin, a potent antibacterial and antifungal agent, is a non-ribosomally synthesised lipopeptide antibiotic. This compound consists of a β-hydroxy fatty acid and nine amino acids. To date, there is no information about its biosynthetic pathway. Results A potential pelgipeptin synthetase gene cluster (plp was identified from Paenibacillus elgii B69 through genome analysis. The gene cluster spans 40.8 kb with eight open reading frames. Among the genes in this cluster, three large genes, plpD, plpE, and plpF, were shown to encode non-ribosomal peptide synthetases (NRPSs, with one, seven, and one module(s, respectively. Bioinformatic analysis of the substrate specificity of all nine adenylation domains indicated that the sequence of the NRPS modules is well collinear with the order of amino acids in pelgipeptin. Additional biochemical analysis of four recombinant adenylation domains (PlpD A1, PlpE A1, PlpE A3, and PlpF A1 provided further evidence that the plp gene cluster involved in pelgipeptin biosynthesis. Conclusions In this study, a gene cluster (plp responsible for the biosynthesis of pelgipeptin was identified from the genome sequence of Paenibacillus elgii B69. The identification of the plp gene cluster provides an opportunity to develop novel lipopeptide antibiotics by genetic engineering.

A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

Science.gov (United States)

Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

2015-01-01

This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

Science.gov (United States)

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-12-12

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Meng Sun

2014-12-01

Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

OpenAIRE

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-01-01

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

Directory of Open Access Journals (Sweden)

Ashley L Waldron

Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

Science.gov (United States)

Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

2015-11-05

The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

Mice with a Mutation in the Mdm2 Gene That Interferes with MDM2/Ribosomal Protein Binding Develop a Defect in Erythropoiesis.

Directory of Open Access Journals (Sweden)

Takuya Kamio

Full Text Available MDM2, an E3 ubiquitin ligase, is an important negative regulator of tumor suppressor p53. In turn the Mdm2 gene is a transcriptional target of p53, forming a negative feedback loop that is important in cell cycle control. It has recently become apparent that the ubiquitination of p53 by MDM2 can be inhibited when certain ribosomal proteins, including RPL5 and RPL11, bind to MDM2. This inhibition, and the resulting increase in p53 levels has been proposed to be responsible for the red cell aplasia seen in Diamond-Blackfan anemia (DBA and in 5q- myelodysplastic syndrome (MDS. DBA and 5q- MDS are associated with inherited (DBA or acquired (5q- MDS haploinsufficiency of ribosomal proteins. A mutation in Mdm2 causing a C305F amino acid substitution blocks the binding of ribosomal proteins. Mice harboring this mutation (Mdm2C305F, retain a normal p53 response to DNA damage, but lack the p53 response to perturbations in ribosome biogenesis. While studying the interaction between RP haploinsufficiency and the Mdm2C305F mutation we noticed that Mdm2C305F homozygous mice had altered hematopoiesis. These mice developed a mild macrocytic anemia with reticulocytosis. In the bone marrow (BM, these mice showed a significant decrease in Ter119hi cells compared to wild type (WT littermates, while no decrease in the number of mature erythroid cells (Ter119hiCD71low was found in the spleen, which showed compensated bone marrow hematopoiesis. In methylcellulose cultures, BFU-E colonies from the mutant mice were slightly reduced in number and there was a significant reduction in CFU-E colony numbers in mutant mice compared with WT controls (p < 0.01. This erythropoietic defect was abrogated by concomitant p53 deficiency (Trp53ko/ko. Further investigation revealed that in Mdm2C305F animals, there was a decrease in Lin-Sca-1+c-Kit+ (LSK cells, accompanied by significant decreases in multipotent progenitor (MPP cells (p < 0.01. Competitive BM repopulation experiments

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Novel reference genes for quantifying transcriptional responses of Escherichia coli to protein overexpression by quantitative PCR

Directory of Open Access Journals (Sweden)

Zou Ruiyang

2011-04-01

Full Text Available Abstract Background Accurate interpretation of quantitative PCR (qPCR data requires normalization using constitutively expressed reference genes. Ribosomal RNA is often used as a reference gene for transcriptional studies in E. coli. However, the choice of reliable reference genes has not been systematically validated. The objective of this study is to identify a set of reliable reference genes for transcription analysis in recombinant protein over-expression studies in E. coli. Results In this study, the meta-analysis of 240 sets of single-channel Affymetrix microarray data representing over-expressions of 63 distinct recombinant proteins in various E. coli strains identified twenty candidate reference genes that were stably expressed across all conditions. The expression of these twenty genes and two commonly used reference genes, rrsA encoding ribosomal RNA 16S and ihfB, was quantified by qPCR in E. coli cells over-expressing four genes of the 1-Deoxy-D-Xylulose 5-Phosphate pathway. From these results, two independent statistical algorithms identified three novel reference genes cysG, hcaT, and idnT but not rrsA and ihfB as highly invariant in two E. coli strains, across different growth temperatures and induction conditions. Transcriptomic data normalized by the geometric average of these three genes demonstrated that genes of the lycopene synthetic pathway maintained steady expression upon enzyme overexpression. In contrast, the use of rrsA or ihfB as reference genes led to the mis-interpretation that lycopene pathway genes were regulated during enzyme over-expression. Conclusion This study identified cysG/hcaT/idnT to be reliable novel reference genes for transcription analysis in recombinant protein producing E. coli.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

Science.gov (United States)

Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

2016-12-06

Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

Nuclear pores and perinuclear expression sites of var and ribosomal DNA genes correspond to physically distinct regions in Plasmodium falciparum.

Science.gov (United States)

Guizetti, Julien; Martins, Rafael Miyazawa; Guadagnini, Stéphanie; Claes, Aurélie; Scherf, Artur

2013-05-01

The human malaria parasite Plasmodium falciparum modifies the erythrocyte it infects by exporting variant proteins to the host cell surface. The var gene family that codes for a large, variant adhesive surface protein called P. falciparum erythrocyte membrane protein 1 (PfEMP1) plays a particular role in this process, which is linked to pathogenesis and immune evasion. A single member of this gene family is highly transcribed while the other 59 members remain silenced. Importantly, var gene transcription occurs at a spatially restricted, but yet undefined, perinuclear site that is distinct from repressed var gene clusters. To advance our understanding of monoallelic expression, we investigated whether nuclear pores associate with the var gene expression site. To this end, we studied the nuclear pore organization during the asexual blood stage using a specific antibody directed against a subunit of the nuclear pore, P. falciparum Nup116 (PfNup116). Ring and schizont stage parasites showed highly polarized nuclear pore foci, whereas in trophozoite stage nuclear pores redistributed over the entire nuclear surface. Colocalization studies of var transcripts and anti-PfNup116 antibodies showed clear dissociation between nuclear pores and the var gene expression site in ring stage. Similar results were obtained for another differentially transcribed perinuclear gene family, the ribosomal DNA units. Furthermore, we show that in the poised state, the var gene locus is not physically linked to nuclear pores. Our results indicate that P. falciparum does form compartments of high transcriptional activity at the nuclear periphery which are, unlike the case in yeast, devoid of nuclear pores.

Isolation and identification of the immune-relevant ribosomal protein L10 (RPL10/QM-like gene) from the large yellow croaker Pseudosciaena crocea (Pisces: Sciaenidae).

Science.gov (United States)

Chen, X; Su, Y Q; Wang, J; Liu, M; Niu, S F; Zhong, S P; Qiu, F

2012-10-15

In order to investigate the immune role of ribosomal protein L10 (RPL10/QM-like gene) in marine fish, we challenged the large yellow croaker Pseudosciaena (= Larimichthys) crocea, the most important marine fish culture species in China, by injection with a mixture of the bacteria Vibrio harveyi and V. parahaemolyticus (3:1 in volume). Microarray analysis and real-time PCR were performed 24 and 48 h post-challenge to isolate and identify the QM-like gene from the gill P. crocea (designated PcQM). The expression level of the PcQM gene did not changed significantly at 24 h post-challenge, but was significantly downregulated at 48 h post-challenge, suggesting that the gene had an immune-modulatory effect in P. crocea. Full-length PcQM cDNA and genomic sequences were obtained by rapid amplification of cDNA ends (RACE)-PCR. The sequence of the PcQM gene clustered together with those of other QM-like genes from other aquatic organisms, indicating that the QM-like gene is highly conserved in teleosts.

New Face for Chromatin-Related Mesenchymal Modulator: n-CHD9 Localizes to Nucleoli and Interacts With Ribosomal Genes.

Science.gov (United States)

Salomon-Kent, Ronit; Marom, Ronit; John, Sam; Dundr, Miroslav; Schiltz, Louis R; Gutierrez, Jose; Workman, Jerry; Benayahu, Dafna; Hager, Gordon L

2015-09-01

Mesenchymal stem cells' differentiation into several lineages is coordinated by a complex of transcription factors and co-regulators which bind to specific gene promoters. The Chromatin-Related Mesenchymal Modulator, CHD9 demonstrated in vitro its ability for remodeling activity to reposition nucleosomes in an ATP-dependent manner. Epigenetically, CHD9 binds with modified H3-(K9me2/3 and K27me3). Previously, we presented a role for CHD9 with RNA Polymerase II (Pol II)-dependent transcription of tissue specific genes. Far less is known about CHD9 function in RNA Polymerase I (Pol I) related transcription of the ribosomal locus that also drives specific cell fate. We here describe a new form, the nucleolar CHD9 (n-CHD9) that is dynamically associated with Pol I, fibrillarin, and upstream binding factor (UBF) in the nucleoli, as shown by imaging and molecular approaches. Inhibitors of transcription disorganized the nucleolar compartment of transcription sites where rDNA is actively transcribed. Collectively, these findings link n-CHD9 with RNA pol I transcription in fibrillar centers. Using chromatin immunoprecipitation (ChIP) and tilling arrays (ChIP- chip), we find an association of n-CHD9 with Pol I related to rRNA biogenesis. Our new findings support the role for CHD9 in chromatin regulation and association with rDNA genes, in addition to its already known function in transcription control of tissue specific genes. © 2015 Wiley Periodicals, Inc.

Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

Directory of Open Access Journals (Sweden)

Yuepeng eHan

2015-04-01

Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

Science.gov (United States)

Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

2015-10-06

The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

Science.gov (United States)

Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

2009-01-01

There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

Energy Technology Data Exchange (ETDEWEB)

Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

1997-12-31

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

Energy Technology Data Exchange (ETDEWEB)

Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

1998-12-31

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

International Nuclear Information System (INIS)

Reynolds, P.; Weber, S.; Prakash, L.

1985-01-01

The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

DEFF Research Database (Denmark)

Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

2004-01-01

Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

Human ribosomal protein L37 has motifs predicting serine/threonine phosphorylation and a zinc-finger domain.

Science.gov (United States)

Barnard, G F; Staniunas, R J; Puder, M; Steele, G D; Chen, L B

1994-08-02

Ribosomal protein L37 mRNA is overexpressed in colon cancer. The nucleotide sequences of human L37 from several tumor and normal, colon and liver cDNA sources were determined to be identical. L37 mRNA was approximately 375 nucleotides long encoding 97 amino acids with M(r) = 11,070, pI = 12.6, multiple potential serine/threonine phosphorylation sites and a zinc-finger domain. The human sequence is compared to other species.

AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

Science.gov (United States)

Lu, Y P; Li, Z S; Rea, P A

1997-07-22

Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

Science.gov (United States)

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

Gene conversion of ribosomal DNA in Nicotiana tabacum is associated with undermethylated, decondensed and probably active gene units.

Science.gov (United States)

Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R

2000-06-01

We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N

Control of ribosome formation in rat heart

International Nuclear Information System (INIS)

Russo, L.A.

1987-01-01

Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

DEFF Research Database (Denmark)

Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

2015-01-01

at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

DEFF Research Database (Denmark)

Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

2012-01-01

additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

Science.gov (United States)

Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

2002-05-25

All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

Science.gov (United States)

Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

2012-01-01

We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

Science.gov (United States)

Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

2015-01-13

Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

Crystallization of ribosomes from Thermus thermophilus

International Nuclear Information System (INIS)

Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

1987-01-01

An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22.

Directory of Open Access Journals (Sweden)

Jennifer L Houmani

Full Text Available The ribosomal protein L22 is a component of the 60S eukaryotic ribosomal subunit. As an RNA-binding protein, it has been shown to interact with both cellular and viral RNAs including 28S rRNA and the Epstein-Barr virus encoded RNA, EBER-1. L22 is localized to the cell nucleus where it accumulates in nucleoli. Although previous studies demonstrated that a specific amino acid sequence is required for nucleolar localization, the RNA-binding domain has not been identified. Here, we investigated the hypothesis that the nucleolar accumulation of L22 is linked to its ability to bind RNA. To address this hypothesis, mutated L22 proteins were generated to assess the contribution of specific amino acids to RNA binding and protein localization. Using RNA-protein binding assays, we demonstrate that basic amino acids 80-93 are required for high affinity binding of 28S rRNA and EBER-1 by L22. Fluorescence localization studies using GFP-tagged mutated L22 proteins further reveal that basic amino acids 80-93 are critical for nucleolar accumulation and for incorporation into ribosomes. Our data support the growing consensus that the nucleolar accumulation of ribosomal proteins may not be mediated by a defined localization signal, but rather by specific interaction with established nucleolar components such as rRNA.

Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells.

Science.gov (United States)

Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose

2017-07-25

Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

Science.gov (United States)

Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

2013-01-01

Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

[Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

Science.gov (United States)

Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

2008-01-01

The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

NARCIS (Netherlands)

Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

2008-01-01

The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

Ribosomal history reveals origins of modern protein synthesis.

Directory of Open Access Journals (Sweden)

Ajith Harish

Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

Directory of Open Access Journals (Sweden)

Lukasz Michal Szafron

Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

Predicting the minimal translation apparatus: lessons from the reductive evolution of mollicutes.

Directory of Open Access Journals (Sweden)

Henri Grosjean

2014-05-01

Full Text Available Mollicutes is a class of parasitic bacteria that have evolved from a common Firmicutes ancestor mostly by massive genome reduction. With genomes under 1 Mbp in size, most Mollicutes species retain the capacity to replicate and grow autonomously. The major goal of this work was to identify the minimal set of proteins that can sustain ribosome biogenesis and translation of the genetic code in these bacteria. Using the experimentally validated genes from the model bacteria Escherichia coli and Bacillus subtilis as input, genes encoding proteins of the core translation machinery were predicted in 39 distinct Mollicutes species, 33 of which are culturable. The set of 260 input genes encodes proteins involved in ribosome biogenesis, tRNA maturation and aminoacylation, as well as proteins cofactors required for mRNA translation and RNA decay. A core set of 104 of these proteins is found in all species analyzed. Genes encoding proteins involved in post-translational modifications of ribosomal proteins and translation cofactors, post-transcriptional modifications of t+rRNA, in ribosome assembly and RNA degradation are the most frequently lost. As expected, genes coding for aminoacyl-tRNA synthetases, ribosomal proteins and initiation, elongation and termination factors are the most persistent (i.e. conserved in a majority of genomes. Enzymes introducing nucleotides modifications in the anticodon loop of tRNA, in helix 44 of 16S rRNA and in helices 69 and 80 of 23S rRNA, all essential for decoding and facilitating peptidyl transfer, are maintained in all species. Reconstruction of genome evolution in Mollicutes revealed that, beside many gene losses, occasional gains by horizontal gene transfer also occurred. This analysis not only showed that slightly different solutions for preserving a functional, albeit minimal, protein synthetizing machinery have emerged in these successive rounds of reductive evolution but also has broad implications in guiding the

A nuclear-encoded chloroplast protein harboring a single CRM domain plays an important role in the Arabidopsis growth and stress response.

Science.gov (United States)

Lee, Kwanuk; Lee, Hwa Jung; Kim, Dong Hyun; Jeon, Young; Pai, Hyun-Sook; Kang, Hunseung

2014-04-16

Although several chloroplast RNA splicing and ribosome maturation (CRM) domain-containing proteins have been characterized for intron splicing and rRNA processing during chloroplast gene expression, the functional role of a majority of CRM domain proteins in plant growth and development as well as chloroplast RNA metabolism remains largely unknown. Here, we characterized the developmental and stress response roles of a nuclear-encoded chloroplast protein harboring a single CRM domain (At4g39040), designated CFM4, in Arabidopsis thaliana. Analysis of CFM4-GFP fusion proteins revealed that CFM4 is localized to chloroplasts. The loss-of-function T-DNA insertion mutants for CFM4 (cfm4) displayed retarded growth and delayed senescence, suggesting that CFM4 plays a role in growth and development of plants under normal growth conditions. In addition, cfm4 mutants showed retarded seed germination and seedling growth under stress conditions. No alteration in the splicing patterns of intron-containing chloroplast genes was observed in the mutant plants, but the processing of 16S and 4.5S rRNAs was abnormal in the mutant plants. Importantly, CFM4 was determined to possess RNA chaperone activity. These results suggest that the chloroplast-targeted CFM4, one of two Arabidopsis genes encoding a single CRM domain-containing protein, harbors RNA chaperone activity and plays a role in the Arabidopsis growth and stress response by affecting rRNA processing in chloroplasts.

Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

Science.gov (United States)

Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

2015-01-01

For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba skin biopsies

Directory of Open Access Journals (Sweden)

Casini Silvia

2006-09-01

among the studied samples and appear as less suitable reference genes for data normalization. Conclusion In this work, we have provided essential background information for the selection of control genes in qRT-PCR studies of cetacean skin biopsies, as a molecular technique to investigate ecotoxicological hazard in marine mammals. Of 10 HKGs tested, those encoding for YWHAZ and GAPDH appear as the most reliable control genes for the normalization of qRT-PCR data in the analysis of striped dolphin skin biopsies. Potentially useful reference genes are also those encoding for ribosomal proteins L4 and S18.

Ribosomal Antibiotics: Contemporary Challenges

Directory of Open Access Journals (Sweden)

Tamar Auerbach-Nevo

2016-06-01

Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

Age-dependent change in the morphology of nucleoli and methylation of genes of the Nucleolar Organizer Region in Japanese quail Coturnix japonica) model (Temminck and Schlegel, 1849) (Galliformes: Aves).

Science.gov (United States)

Andraszek, Katarzyna; Gryzińska, Magdalena; Wójcik, Ewa; Knaga, Sebastian; Smalec, Elżbieta

2014-01-01

Nucleoli are the product of the activity of nucleolar organizer regions (NOR) in certain chromosomes. Their main functions are the formation of ribosomal subunits from ribosomal protein molecules and the transcription of genes encoding rRNA. The aim of the study was to determine the shape of nucleoli and analyse methylation in the gene RN28S in the spermatocytes of male Japanese quail (Coturnixjaponica) in two age groups. Nucleoli were analysed in cells of the first meiotic prophase. Their number and shape were determined and they were classified as regular, irregular or defragmented. In the cells of the young birds no defragmented nucleoli were observed, with regular and irregular nucleoli accounting for 97% and 3%, respectively. In the cells of older birds no regular nucleoli were observed, while irregular and defragmented nucleoli accounted for 37% and 67%, respectively. MSP (methylation-specific PCR) showed that the gene RN28S is methylated in both 15-week-old and 52-week-old quails. In recent years an association has been established between nucleolus morphology and cellular ageing processes.

The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

Science.gov (United States)

Santiago, Margarita; Gardner, Richard C

2015-07-01

Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

International Nuclear Information System (INIS)

Singh, H.; Bishop, J.