WorldWideScience

Sample records for gene encoding regulatory

  1. Differential roles of two SARP-encoding regulatory genes during tylosin biosynthesis.

    Science.gov (United States)

    Bate, Neil; Stratigopoulos, George; Cundliffe, Eric

    2002-01-01

    The tylosin biosynthetic gene cluster of Streptomyces fradiae is remarkable in harbouring at least five regulatory genes, two of which (tylS and tylT) encode proteins of the Streptomyces antibiotic regulatory protein (SARP) family. The aim of the present work was to assess the respective contributions of TylS and TylT to tylosin production. A combination of targeted gene disruption, fermentation studies and gene expression analysis via reverse transcriptase-polymerase chain reaction (RT-PCR) suggests that tylS is essential for tylosin production and controls the expression of tylR (previously shown to be a global activator of the biosynthetic pathway) plus at least one other gene involved in polyketide metabolism or regulation thereof. This is the first demonstration of a SARP acting to control another regulatory gene during antibiotic biosynthesis. In contrast, tylT is not essential for tylosin production.

  2. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...... and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. Results To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (Ch......IP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression...

  3. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    Science.gov (United States)

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  4. Molecular cloning and chromosomal mapping of the mouse gene encoding cyclin-dependent kinase 5 regulatory subunit p35

    Energy Technology Data Exchange (ETDEWEB)

    Ohshima, Toshio; Kozak, C.A.; Nagle, J.W. [National Institutes of Health, Bethesda, MD (United States)] [and others

    1996-07-15

    A neural-specific activating subunit, p35, of cyclin-dependent kinase 5 (Cdk5) was recently reported to differ from other mammalian cyclins, suggesting a new type of regulatory subunit for Cdk activity. The mouse gene encoding p35, Cdk5r, was isolated from a mouse 129/SvJ genomic library, and the genomic structure of Cdk5r was characterized. The most notable features of Cdk5r are the absence of introns in the amino acid coding region and the high homology of amino acid sequence among species. The 5{prime}-flanking region of Cdk5r contained no canonical TATA or CAAT box but had several putative promoter elements, including Sp1, AP2, MRE, and NGFIA. The mouse Cdk5r transcript was detected only in the brain by Northern blot analysis. Mouse Cdk5r was mapped to a position on mouse chromosome 11. 14 refs., 2 figs.

  5. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed 10-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP g...

  6. Integrative analysis of C. elegans modENCODE ChIP-seq data sets to infer gene regulatory interactions

    Science.gov (United States)

    Van Nostrand, Eric L.; Kim, Stuart K.

    2013-01-01

    The C. elegans modENCODE Consortium has defined in vivo binding sites for a large array of transcription factors by ChIP-seq. In this article, we present examples that illustrate how this compendium of ChIP-seq data can drive biological insights not possible with analysis of individual factors. First, we analyze the number of independent factors bound to the same locus, termed transcription factor complexity, and find that low-complexity sites are more likely to respond to altered expression of a single bound transcription factor. Next, we show that comparison of binding sites for the same factor across developmental stages can reveal insight into the regulatory network of that factor, as we find that the transcription factor UNC-62 has distinct binding profiles at different stages due to distinct cofactor co-association as well as tissue-specific alternative splicing. Finally, we describe an approach to infer potential regulators of gene expression changes found in profiling experiments (such as DNA microarrays) by screening these altered genes to identify significant enrichment for targets of a transcription factor identified in ChIP-seq data sets. After confirming that this approach can correctly identify the upstream regulator on expression data sets for which the regulator was previously known, we applied this approach to identify novel candidate regulators of transcriptional changes with age. The analysis revealed nine candidate aging regulators, of which three were previously known to have a role in longevity. We experimentally showed that two of the new candidate aging regulators can extend lifespan when overexpressed, indicating that this approach can identify novel functional regulators of complex processes. PMID:23531767

  7. CK2(beta)tes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster

    DEFF Research Database (Denmark)

    Kalmykova, Alla I; Shevelyov, Yuri Y; Polesskaya, Oksana O

    2002-01-01

    An earlier described CK2(beta)tes gene of Drosophila melanogaster is shown to encode a male germline specific isoform of regulatory beta subunit of casein kinase 2. Western-analysis using anti-CK2(beta)tes Ig revealed CK2(beta)tes protein in Drosophila testes extract. Expression of a CK2(beta...... and coimmunoprecipitation analysis of protein extract from Drosophila testes, we demonstrated an association between CK2(beta)tes and CK2alpha. Northern-analysis has shown that another regulatory (beta') subunit found recently in D. melanogaster genome is also testis-specific. Thus, we describe the first example of two...

  8. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

    2014-01-01

    . In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites......The Cd247 gene encodes for a transmembrane protein important for the expression and assembly of TCR/CD3 complex on the surface of T lymphocytes. Down-regulation of CD247 has functional consequences in systemic autoimmunity and has been shown to be associated with Type 1 Diabetes in NOD mouse......, supported by histone marks and ChIP-seq data, that specifically have features of an enhancer and a promoter, respectively. We also identified a putative long non-coding RNA from the characteristically long first intron of the Cd247 gene. The long non-coding RNA annotation is supported by manual annotations...

  9. Exome Sequencing and cis-Regulatory Mapping Identify Mutations in MAK, a Gene Encoding a Regulator of Ciliary Length, as a Cause of Retinitis Pigmentosa

    Science.gov (United States)

    Özgül, Rıza Köksal; Siemiatkowska, Anna M.; Yücel, Didem; Myers, Connie A.; Collin, Rob W.J.; Zonneveld, Marijke N.; Beryozkin, Avigail; Banin, Eyal; Hoyng, Carel B.; van den Born, L. Ingeborgh; Bose, Ron; Shen, Wei; Sharon, Dror; Cremers, Frans P.M.; Klevering, B. Jeroen; den Hollander, Anneke I.; Corbo, Joseph C.

    2011-01-01

    A fundamental challenge in analyzing exome-sequence data is distinguishing pathogenic mutations from background polymorphisms. To address this problem in the context of a genetically heterogeneous disease, retinitis pigmentosa (RP), we devised a candidate-gene prioritization strategy called cis-regulatory mapping that utilizes ChIP-seq data for the photoreceptor transcription factor CRX to rank candidate genes. Exome sequencing combined with this approach identified a homozygous nonsense mutation in male germ cell-associated kinase (MAK) in the single affected member of a consanguineous Turkish family with RP. MAK encodes a cilium-associated mitogen-activated protein kinase whose function is conserved from the ciliated alga, Chlamydomonas reinhardtii, to humans. Mutations in MAK orthologs in mice and other model organisms result in abnormally long cilia and, in mice, rapid photoreceptor degeneration. Subsequent sequence analyses of additional individuals with RP identified five probands with missense mutations in MAK. Two of these mutations alter amino acids that are conserved in all known kinases, and an in vitro kinase assay indicates that these mutations result in a loss of kinase activity. Thus, kinase activity appears to be critical for MAK function in humans. This study highlights a previously underappreciated role for CRX as a direct transcriptional regulator of ciliary genes in photoreceptors. In addition, it demonstrates the effectiveness of CRX-based cis-regulatory mapping in prioritizing candidate genes from exome data and suggests that this strategy should be generally applicable to a range of retinal diseases. PMID:21835304

  10. Candida albicans Lacking the Gene Encoding the Regulatory Subunit of Protein Kinase A Displays a Defect in Hyphal Formation and an Altered Localization of the Catalytic Subunit

    Science.gov (United States)

    Cassola, Alejandro; Parrot, Marc; Silberstein, Susana; Magee, Beatrice B.; Passeron, Susana; Giasson, Luc; Cantore, María L.

    2004-01-01

    The fungal pathogen Candida albicans switches from a yeast-like to a filamentous mode of growth in response to a variety of environmental conditions. We examined the morphogenetic behavior of C. albicans yeast cells lacking the BCY1 gene, which encodes the regulatory subunit of protein kinase A. We cloned the BCY1 gene and generated a bcy1 tpk2 double mutant strain because a homozygous bcy1 mutant in a wild-type genetic background could not be obtained. In the bcy1 tpk2 mutant, protein kinase A activity (due to the presence of the TPK1 gene) was cyclic AMP independent, indicating that the cells harbored an unregulated phosphotransferase activity. This mutant has constitutive protein kinase A activity and displayed a defective germinative phenotype in N-acetylglucosamine and in serum-containing medium. The subcellular localization of a Tpk1-green fluorescent protein (GFP) fusion protein was examined in wild-type, tpk2 null, and bcy1 tpk2 double mutant strains. The fusion protein was observed to be predominantly nuclear in wild-type and tpk2 strains. This was not the case in the bcy1 tpk2 double mutant, where it appeared dispersed throughout the cell. Coimmunoprecipitation of Bcy1p with the Tpk1-GFP fusion protein demonstrated the interaction of these proteins inside the cell. These results suggest that one of the roles of Bcy1p is to tether the protein kinase A catalytic subunit to the nucleus. PMID:14871949

  11. Expression of mRNA Encoding Mcu and Other Mitochondrial Calcium Regulatory Genes Depends on Cell Type, Neuronal Subtype, and Ca2+ Signaling.

    Directory of Open Access Journals (Sweden)

    Nóra M Márkus

    Full Text Available Uptake of Ca2+ into the mitochondrial matrix controls cellular metabolism and survival-death pathways. Several genes are implicated in controlling mitochondrial Ca2+ uptake (mitochondrial calcium regulatory genes, MCRGs, however, less is known about the factors which influence their expression level. Here we have compared MCRG mRNA expression, in neural cells of differing type (cortical neurons vs. astrocytes, differing neuronal subtype (CA3 vs. CA1 hippocampus and in response to Ca2+ influx, using a combination of qPCR and RNA-seq analysis. Of note, we find that the Mcu-regulating Micu gene family profile differs substantially between neurons and astrocytes, while expression of Mcu itself is markedly different between CA3 and CA1 regions in the adult hippocampus. Moreover, dynamic control of MCRG mRNA expression in response to membrane depolarization-induced Ca2+ influx is also apparent, resulting in repression of Letm1, as well as Mcu. Thus, the mRNA expression profile of MCRGs is not fixed, which may cause differences in the coupling between cytoplasmic and mitochondrial Ca2+, as well as diversity of mitochondrial Ca2+ uptake mechanisms.

  12. Exposure of a 23F Serotype Strain of Streptococcus pneumoniae to Cigarette Smoke Condensate Is Associated with Selective Upregulation of Genes Encoding the Two-Component Regulatory System 11 (TCS11)

    Science.gov (United States)

    Herbert, Jenny A.; Mitchell, Timothy J.; Dix-Peek, Thérèse; Dickens, Caroline; Anderson, Ronald; Feldman, Charles

    2014-01-01

    Alterations in whole genome expression profiles following exposure of the pneumococcus (strain 172, serotype 23F) to cigarette smoke condensate (160 μg/mL) for 15 and 60 min have been determined using the TIGR4 DNA microarray chip. Exposure to CSC resulted in the significant (P < 0.014–0.0006) upregulation of the genes encoding the two-component regulatory system 11 (TCS11), consisting of the sensor kinase, hk11, and its cognate response regulator, rr11, in the setting of increased biofilm formation. These effects of cigarette smoke on the pneumococcus may contribute to colonization of the airways by this microbial pathogen. PMID:25013815

  13. Exposure of a 23F Serotype Strain of Streptococcus pneumoniae to Cigarette Smoke Condensate Is Associated with Selective Upregulation of Genes Encoding the Two-Component Regulatory System 11 (TCS11

    Directory of Open Access Journals (Sweden)

    Riana Cockeran

    2014-01-01

    Full Text Available Alterations in whole genome expression profiles following exposure of the pneumococcus (strain 172, serotype 23F to cigarette smoke condensate (160 μg/mL for 15 and 60 min have been determined using the TIGR4 DNA microarray chip. Exposure to CSC resulted in the significant (P<0.014–0.0006 upregulation of the genes encoding the two-component regulatory system 11 (TCS11, consisting of the sensor kinase, hk11, and its cognate response regulator, rr11, in the setting of increased biofilm formation. These effects of cigarette smoke on the pneumococcus may contribute to colonization of the airways by this microbial pathogen.

  14. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  15. Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis.

    Science.gov (United States)

    Lee, M M; Schiefelbein, J

    2001-05-01

    The duplication and divergence of developmental control genes is thought to have driven morphological diversification during the evolution of multicellular organisms. To examine the molecular basis of this process, we analyzed the functional relationship between two paralogous MYB transcription factor genes, WEREWOLF (WER) and GLABROUS1 (GL1), in Arabidopsis. The WER and GL1 genes specify distinct cell types and exhibit non-overlapping expression patterns during Arabidopsis development. Nevertheless, reciprocal complementation experiments with a series of gene fusions showed that WER and GL1 encode functionally equivalent proteins, and their unique roles in plant development are entirely due to differences in their cis-regulatory sequences. Similar experiments with a distantly related MYB gene (MYB2) showed that its product cannot functionally substitute for WER or GL1. Furthermore, an analysis of the WER and GL1 proteins shows that conserved sequences correspond to specific functional domains. These results provide new insights into the evolution of the MYB gene family in Arabidopsis, and, more generally, they demonstrate that novel developmental gene function may arise solely by the modification of cis-regulatory sequences.

  16. Identification of functional elements and regulatory circuits by Drosophila modENCODE.

    Science.gov (United States)

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L; Landolin, Jane M; Bristow, Christopher A; Ma, Lijia; Lin, Michael F; Washietl, Stefan; Arshinoff, Bradley I; Ay, Ferhat; Meyer, Patrick E; Robine, Nicolas; Washington, Nicole L; Di Stefano, Luisa; Berezikov, Eugene; Brown, Christopher D; Candeias, Rogerio; Carlson, Joseph W; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y; Will, Sebastian; Alekseyenko, Artyom A; Artieri, Carlo; Booth, Benjamin W; Brooks, Angela N; Dai, Qi; Davis, Carrie A; Duff, Michael O; Feng, Xin; Gorchakov, Andrey A; Gu, Tingting; Henikoff, Jorja G; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K; Riddle, Nicole C; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E; Schwartz, Yuri B; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E; Brent, Michael R; Cherbas, Lucy; Elgin, Sarah C R; Gingeras, Thomas R; Grossman, Robert; Hoskins, Roger A; Kaufman, Thomas C; Kent, William; Kuroda, Mitzi I; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J; Celniker, Susan E; Henikoff, Steven; Karpen, Gary H; Lai, Eric C; MacAlpine, David M; Stein, Lincoln D; White, Kevin P; Kellis, Manolis

    2010-12-24

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation.

  17. Identification of functional elements and regulatory circuits by Drosophila modENCODE

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

    2010-12-22

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

  18. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  19. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  20. A study of bacterial gene regulatory mechanisms

    DEFF Research Database (Denmark)

    Hansen, Sabine

    the different regulatory mechanisms affect system dynamics. We have designed a synthetic gene regulatory network (GRN) in bacterial cells that enables us to study the dynamics of GRNs. The results presented in this PhD thesis show that model equations based on the established mechanisms of action of each...... of a particular type of regulatory mechanism. The synthetic system presented in this thesis is, to our knowledge, the first of its kind to allow a direct comparison of the dynamic behaviors of gene regulatory networks that employ different mechanisms of regulation. In addition to studying the dynamic behavior...... switch off the expression of unfavorable proteins. This dynamic regulation requires a coordinated effort by a network of regulatory factors. The regulatory mechanisms employed by bacterial cell to regulate their protein expression have been extensively studied. However, little is known about how...

  1. Evolving chromosomes and gene regulatory networks

    Indian Academy of Sciences (India)

    Aswin

    Gene expression level unilateral. Other genes epistatic. Collateral damage. Page 25. ok.. is there a phenotype? $ % #. Page 26. Can the regulatory network of. E. coli lacking the xenogene silencing system evolve towards greater fitness? Page 27. Many mutations emerge in a dynamic genome. Inactivation of the global ...

  2. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  3. Isolation and characterization of the rat gene encoding glutamate dehydrogenase

    NARCIS (Netherlands)

    Das, A. T.; Arnberg, A. C.; Malingré, H.; Moerer, P.; Charles, R.; Moorman, A. F.; Lamers, W. H.

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  4. Deconstructing the pluripotency gene regulatory network

    KAUST Repository

    Li, Mo

    2018-04-04

    Pluripotent stem cells can be isolated from embryos or derived by reprogramming. Pluripotency is stabilized by an interconnected network of pluripotency genes that cooperatively regulate gene expression. Here we describe the molecular principles of pluripotency gene function and highlight post-transcriptional controls, particularly those induced by RNA-binding proteins and alternative splicing, as an important regulatory layer of pluripotency. We also discuss heterogeneity in pluripotency regulation, alternative pluripotency states and future directions of pluripotent stem cell research.

  5. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  6. Current approaches to gene regulatory network modelling

    Directory of Open Access Journals (Sweden)

    Brazma Alvis

    2007-09-01

    Full Text Available Abstract Many different approaches have been developed to model and simulate gene regulatory networks. We proposed the following categories for gene regulatory network models: network parts lists, network topology models, network control logic models, and dynamic models. Here we will describe some examples for each of these categories. We will study the topology of gene regulatory networks in yeast in more detail, comparing a direct network derived from transcription factor binding data and an indirect network derived from genome-wide expression data in mutants. Regarding the network dynamics we briefly describe discrete and continuous approaches to network modelling, then describe a hybrid model called Finite State Linear Model and demonstrate that some simple network dynamics can be simulated in this model.

  7. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  8. Evolution of evolvability in gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Anton Crombach

    Full Text Available Gene regulatory networks are perhaps the most important organizational level in the cell where signals from the cell state and the outside environment are integrated in terms of activation and inhibition of genes. For the last decade, the study of such networks has been fueled by large-scale experiments and renewed attention from the theoretical field. Different models have been proposed to, for instance, investigate expression dynamics, explain the network topology we observe in bacteria and yeast, and for the analysis of evolvability and robustness of such networks. Yet how these gene regulatory networks evolve and become evolvable remains an open question. An individual-oriented evolutionary model is used to shed light on this matter. Each individual has a genome from which its gene regulatory network is derived. Mutations, such as gene duplications and deletions, alter the genome, while the resulting network determines the gene expression pattern and hence fitness. With this protocol we let a population of individuals evolve under Darwinian selection in an environment that changes through time. Our work demonstrates that long-term evolution of complex gene regulatory networks in a changing environment can lead to a striking increase in the efficiency of generating beneficial mutations. We show that the population evolves towards genotype-phenotype mappings that allow for an orchestrated network-wide change in the gene expression pattern, requiring only a few specific gene indels. The genes involved are hubs of the networks, or directly influencing the hubs. Moreover, throughout the evolutionary trajectory the networks maintain their mutational robustness. In other words, evolution in an alternating environment leads to a network that is sensitive to a small class of beneficial mutations, while the majority of mutations remain neutral: an example of evolution of evolvability.

  9. Robustness Analysis of Gene Regulatory Networks

    Science.gov (United States)

    Kadelka, Claus T.

    Cells generally manage to maintain stable phenotypes in the face of widely varying environmental conditions. This fact is particularly surprising since the key step of gene expression is fundamentally a stochastic process. Many hypotheses have been suggested to explain this robustness. First, the special topology of gene regulatory networks (GRNs) seems to be an important factor as they possess feedforward loops and certain other topological features much more frequently than expected. Second, genes often regulate each other in a canalizing fashion: there exists a dominance order amidst the regulators of a gene, which in silico leads to very robust phenotypes. Lastly, an entirely novel gene regulatory mechanism, discovered and studied during the last two decades, which is believed to play an important role in cancer, is shedding some light on how canalization may in fact take place as part of a cell's gene regulatory program. Short segments of single-stranded RNA, so-called microRNAs, which are embedded in several different types of feedforward loops, help smooth out noise and generate canalizing effects in gene regulation by overriding the effect of certain genes on others. Boolean networks and their multi-state extensions have been successfully used to model GRNs for many years. In this dissertation, GRNs are represented in the time- and state-discrete framework of Stochastic Discrete Dynamical Systems (SDDS), which captures the cell-inherent stochasticity. Each gene has finitely many different concentration levels and its concentration at the next time step is determined by a gene-specific update rule that depends on the current concentration of the gene's regulators. The update rules in published gene regulatory networks are often nested canalizing functions. In Chapter 2, this class of functions is introduced, generalized and analyzed with respect to its potential to confer robustness. Chapter 3 describes a simulation study, which supports the hypothesis that

  10. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  11. Gene cluster encoding cholate catabolism in Rhodococcus spp.

    Science.gov (United States)

    Mohn, William W; Wilbrink, Maarten H; Casabon, Israël; Stewart, Gordon R; Liu, Jie; van der Geize, Robert; Eltis, Lindsay D

    2012-12-01

    Bile acids are highly abundant steroids with important functions in vertebrate digestion. Their catabolism by bacteria is an important component of the carbon cycle, contributes to gut ecology, and has potential commercial applications. We found that Rhodococcus jostii RHA1 grows well on cholate, as well as on its conjugates, taurocholate and glycocholate. The transcriptome of RHA1 growing on cholate revealed 39 genes upregulated on cholate, occurring in a single gene cluster. Reverse transcriptase quantitative PCR confirmed that selected genes in the cluster were upregulated 10-fold on cholate versus on cholesterol. One of these genes, kshA3, encoding a putative 3-ketosteroid-9α-hydroxylase, was deleted and found essential for growth on cholate. Two coenzyme A (CoA) synthetases encoded in the cluster, CasG and CasI, were heterologously expressed. CasG was shown to transform cholate to cholyl-CoA, thus initiating side chain degradation. CasI was shown to form CoA derivatives of steroids with isopropanoyl side chains, likely occurring as degradation intermediates. Orthologous gene clusters were identified in all available Rhodococcus genomes, as well as that of Thermomonospora curvata. Moreover, Rhodococcus equi 103S, Rhodococcus ruber Chol-4 and Rhodococcus erythropolis SQ1 each grew on cholate. In contrast, several mycolic acid bacteria lacking the gene cluster were unable to grow on cholate. Our results demonstrate that the above-mentioned gene cluster encodes cholate catabolism and is distinct from a more widely occurring gene cluster encoding cholesterol catabolism.

  12. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    2016-10-26

    Oct 26, 2016 ... The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the.

  13. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  14. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    Cloning, expression and characterisation of a novel gene encoding a chemosensory protein from Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) ... The BtabCSP amino acid residues deduced from the respective full-length cDNA shares four conserved cysteine motifs with known CSPs from other insects. Homology ...

  15. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  16. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    Molecular cloning and characterization of a gene encoding RING zinc finger ankyrin protein from drought-tolerant Artemisia desertorum. XIUHONG YANG, CHAO SUN, YUANLEI HU and ZHONGPING LIN. *. College of Life Sciences, National Key Laboratory of Protein Engineering and Plant Genetic Engineering, Peking.

  17. Overexpression of maize anthocyanin regulatory gene Lc affects rice fertility.

    Science.gov (United States)

    Li, Yuan; Zhang, Tao; Shen, Zhong-Wei; Xu, Yu; Li, Jian-Yue

    2013-01-01

    Seventeen independent transgenic rice plants with the maize anthocyanin regulatory gene Lc under control of the CaMV 35S promoter were obtained and verified by molecular identification. Ten plants showed red spikelets during early development of florets, and the degenerate florets were still red after heading. Additionally, these plants exhibited intense pigmentation on the surface of the anther and the bottom of the ovary. They were unable to properly bloom and were completely sterile. Following pollination with normal pollen, these plants yielded red caryopses but did not mature normally. QRT-PCR analysis indicated that mRNA accumulation of the CHS-like gene encoding a chalcone synthase-related protein was increased significantly in the sterile plant. This is the first report to suggest that upregulation of the CHS gene expression may result in rice sterility and affect the normal development of rice seeds.

  18. Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway

    Science.gov (United States)

    Baumann, Sascha; Sander, Adrianne; Gurnon, James R.; Yanai-Balser, Giane; VanEtten, James L.; Piotrowski, Markus

    2007-01-01

    Two genes encoding the putative polyamine biosynthetic enzymes agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase (CPA) were cloned from the chloroviruses PBCV-1, NY-2A and MT325. They were expressed in Escherichia coli to form C-terminal (His)6-tagged proteins and the recombinant proteins were purified by Ni2+- binding affinity chromatography. The biochemical properties of the two enzymes are similar to AIH and CPA enzymes from Arabidopsis thaliana and Pseudomonas aeruginosa. Together with the previously known virus genes encoding ornithine/arginine decarboxlyase (ODC/ADC) and homospermidine synthase, the chloroviruses have genes that encode a complete set of functional enzymes that synthesize the rare polyamine homospermidine from arginine via agmatine, N-carbamoylputrescine and putrescine. The PBCV-1 aih and cpa genes are expressed early during virus infection together with the odc/adc gene, suggesting that biosynthesis of putrescine is important in early stages of viral replication. The aih and cpa genes are widespread in the chlorella viruses. PMID:17101165

  19. Identification of key player genes in gene regulatory networks.

    Science.gov (United States)

    Nazarieh, Maryam; Wiese, Andreas; Will, Thorsten; Hamed, Mohamed; Helms, Volkhard

    2016-09-06

    Identifying the gene regulatory networks governing the workings and identity of cells is one of the main challenges in understanding processes such as cellular differentiation, reprogramming or cancerogenesis. One particular challenge is to identify the main drivers and master regulatory genes that control such cell fate transitions. In this work, we reformulate this problem as the optimization problems of computing a Minimum Dominating Set and a Minimum Connected Dominating Set for directed graphs. Both MDS and MCDS are applied to the well-studied gene regulatory networks of the model organisms E. coli and S. cerevisiae and to a pluripotency network for mouse embryonic stem cells. The results show that MCDS can capture most of the known key player genes identified so far in the model organisms. Moreover, this method suggests an additional small set of transcription factors as novel key players for governing the cell-specific gene regulatory network which can also be investigated with regard to diseases. To this aim, we investigated the ability of MCDS to define key drivers in breast cancer. The method identified many known drug targets as members of the MDS and MCDS. This paper proposes a new method to identify key player genes in gene regulatory networks. The Java implementation of the heuristic algorithm explained in this paper is available as a Cytoscape plugin at http://apps.cytoscape.org/apps/mcds . The SageMath programs for solving integer linear programming formulations used in the paper are available at https://github.com/maryamNazarieh/KeyRegulatoryGenes and as supplementary material.

  20. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  1. A provisional regulatory gene network for specification of endomesoderm in the sea urchin embryo

    Science.gov (United States)

    Davidson, Eric H.; Rast, Jonathan P.; Oliveri, Paola; Ransick, Andrew; Calestani, Cristina; Yuh, Chiou-Hwa; Minokawa, Takuya; Amore, Gabriele; Hinman, Veronica; Arenas-Mena, Cesar; hide

    2002-01-01

    We present the current form of a provisional DNA sequence-based regulatory gene network that explains in outline how endomesodermal specification in the sea urchin embryo is controlled. The model of the network is in a continuous process of revision and growth as new genes are added and new experimental results become available; see http://www.its.caltech.edu/mirsky/endomeso.htm (End-mes Gene Network Update) for the latest version. The network contains over 40 genes at present, many newly uncovered in the course of this work, and most encoding DNA-binding transcriptional regulatory factors. The architecture of the network was approached initially by construction of a logic model that integrated the extensive experimental evidence now available on endomesoderm specification. The internal linkages between genes in the network have been determined functionally, by measurement of the effects of regulatory perturbations on the expression of all relevant genes in the network. Five kinds of perturbation have been applied: (1) use of morpholino antisense oligonucleotides targeted to many of the key regulatory genes in the network; (2) transformation of other regulatory factors into dominant repressors by construction of Engrailed repressor domain fusions; (3) ectopic expression of given regulatory factors, from genetic expression constructs and from injected mRNAs; (4) blockade of the beta-catenin/Tcf pathway by introduction of mRNA encoding the intracellular domain of cadherin; and (5) blockade of the Notch signaling pathway by introduction of mRNA encoding the extracellular domain of the Notch receptor. The network model predicts the cis-regulatory inputs that link each gene into the network. Therefore, its architecture is testable by cis-regulatory analysis. Strongylocentrotus purpuratus and Lytechinus variegatus genomic BAC recombinants that include a large number of the genes in the network have been sequenced and annotated. Tests of the cis-regulatory predictions of

  2. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    this antigen is a good candidate for development as a vaccine to prevent or control P. carinii infection. We have cloned and sequenced seven related but unique genes encoding the major surface glycoprotein of rat P. carinii. Partial amino acid sequencing confirmed the identity of these genes. Based on Southern...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  3. Identification and use of genes encoding amatoxin and phallotoxin

    Energy Technology Data Exchange (ETDEWEB)

    Hallen, Heather E.; Walton, Jonathan D.; Luo, Hong; Scott-Craig, John S.

    2016-12-13

    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptide toxins and toxin production in mushrooms. In particular, the present invention relates to using genes and proteins from Amanita species encoding Amanita peptides, specifically relating to amatoxins and phallotoxins. In a preferred embodiment, the present invention also relates to methods for detecting Amanita peptide toxin genes for identifying Amanita peptide-producing mushrooms and for diagnosing suspected cases of mushroom poisoning. Further, the present inventions relate to providing kits for diagnosing and monitoring suspected cases of mushroom poisoning in patients.

  4. Mutational robustness of gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Aalt D J van Dijk

    Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

  5. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  6. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  7. Automated Identification of Core Regulatory Genes in Human Gene Regulatory Networks.

    Directory of Open Access Journals (Sweden)

    Vipin Narang

    Full Text Available Human gene regulatory networks (GRN can be difficult to interpret due to a tangle of edges interconnecting thousands of genes. We constructed a general human GRN from extensive transcription factor and microRNA target data obtained from public databases. In a subnetwork of this GRN that is active during estrogen stimulation of MCF-7 breast cancer cells, we benchmarked automated algorithms for identifying core regulatory genes (transcription factors and microRNAs. Among these algorithms, we identified K-core decomposition, pagerank and betweenness centrality algorithms as the most effective for discovering core regulatory genes in the network evaluated based on previously known roles of these genes in MCF-7 biology as well as in their ability to explain the up or down expression status of up to 70% of the remaining genes. Finally, we validated the use of K-core algorithm for organizing the GRN in an easier to interpret layered hierarchy where more influential regulatory genes percolate towards the inner layers. The integrated human gene and miRNA network and software used in this study are provided as supplementary materials (S1 Data accompanying this manuscript.

  8. The gene encoding acyl-CoA-binding protein is subject to metabolic regulation by both sterol regulatory element-binding protein and peroxisome proliferator-activated receptor alpha in hepatocytes

    DEFF Research Database (Denmark)

    Sandberg, Maria B; Bloksgaard, Maria; Duran-Sandoval, Daniel

    2005-01-01

    that ACBP expression is significantly lower in livers from PPARalpha knock-out mice than in livers from wild type mice. In conclusion, expression of ACBP in rodent hepatocytes is subject to dual metabolic regulation by PPARalpha and SREBP-1c, which may reflect the need for ACBP during lipogenic as well...... observation that ACBP expression in rodent liver is down-regulated by fasting, and we show that insulin but not glucose is the inducer of ACBP expression in primary rat hepatocytes. In keeping with the regulation by insulin, we show that ACBP is a sterol regulatory element-binding protein 1c (SREBP-1c) target...

  9. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development...... of novel approaches to the control of this pathogen....

  10. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae

    Energy Technology Data Exchange (ETDEWEB)

    Parke, D.; Ornston, L.N.

    1993-03-01

    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the [beta]-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novel regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate [beta]-carboxy-cis,cis-muconate. [beta]-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for [beta]-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to [beta]-carboxy-cis,cis-muconate.

  11. Asymmetrical distribution of non-conserved regulatory sequences at PHOX2B is reflected at the ENCODE loci and illuminates a possible genome-wide trend

    Directory of Open Access Journals (Sweden)

    McCallion Andrew S

    2009-01-01

    Full Text Available Abstract Background Transcriptional regulatory elements are central to development and interspecific phenotypic variation. Current regulatory element prediction tools rely heavily upon conservation for prediction of putative elements. Recent in vitro observations from the ENCODE project combined with in vivo analyses at the zebrafish phox2b locus suggests that a significant fraction of regulatory elements may fall below commonly applied metrics of conservation. We propose to explore these observations in vivo at the human PHOX2B locus, and also evaluate the potential evidence for genome-wide applicability of these observations through a novel analysis of extant data. Results Transposon-based transgenic analysis utilizing a tiling path proximal to human PHOX2B in zebrafish recapitulates the observations at the zebrafish phox2b locus of both conserved and non-conserved regulatory elements. Analysis of human sequences conserved with previously identified zebrafish phox2b regulatory elements demonstrates that the orthologous sequences exhibit overlapping regulatory control. Additionally, analysis of non-conserved sequences scattered over 135 kb 5' to PHOX2B, provides evidence of non-conserved regulatory elements positively biased with close proximity to the gene. Furthermore, we provide a novel analysis of data from the ENCODE project, finding a non-uniform distribution of regulatory elements consistent with our in vivo observations at PHOX2B. These observations remain largely unchanged when one accounts for the sequence repeat content of the assayed intervals, when the intervals are sub-classified by biological role (developmental versus non-developmental, or by gene density (gene desert versus non-gene desert. Conclusion While regulatory elements frequently display evidence of evolutionary conservation, a fraction appears to be undetected by current metrics of conservation. In vivo observations at the PHOX2B locus, supported by our analyses of in

  12. Gene regulatory mechanisms in infected fish

    DEFF Research Database (Denmark)

    Schyth, Brian Dall; Hajiabadi, Seyed Amir Hossein Jalali; Kristensen, Lasse Bøgelund Juel

    2011-01-01

    This talk will highlight the regulatory mechanisms of gene expression especially the programmed form of mRNA decay which is known as RNA interference (RNAi) and how this and other mechanisms contribute to the regulation of genes involved in immunity. In the RNAi mechanism small double stranded RNA...... with viral hemorrhagic septicemia virus (VHSV), and a genomic upstream sequence which we believe contains their promoter. Particular transcription factor binding motifs inside this potential promoter area point to its use in dsRNA induced antiviral defence. Other sites point to a role in leukocyte...... molecules produced by the eukaryotic cell is used to program the RNA Induced Silencing Complex (RISC) for cleavage of specific mRNA transcripts and/or translational repression in the cytoplasm or even chromatin methylation in the nucleus. All processes leading to silencing of the target gene. MicroRNAs (or...

  13. Fan-out in gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Sauro Herbert M

    2010-12-01

    Full Text Available Abstract Background In synthetic biology, gene regulatory circuits are often constructed by combining smaller circuit components. Connections between components are achieved by transcription factors acting on promoters. If the individual components behave as true modules and certain module interface conditions are satisfied, the function of the composite circuits can in principle be predicted. Results In this paper, we investigate one of the interface conditions: fan-out. We quantify the fan-out, a concept widely used in electrical engineering, to indicate the maximum number of the downstream inputs that an upstream output transcription factor can regulate. The fan-out is shown to be closely related to retroactivity studied by Del Vecchio, et al. An efficient operational method for measuring the fan-out is proposed and shown to be applied to various types of module interfaces. The fan-out is also shown to be enhanced by self-inhibitory regulation on the output. The potential role of an inhibitory regulation is discussed. Conclusions The proposed estimation method for fan-out not only provides an experimentally efficient way for quantifying the level of modularity in gene regulatory circuits but also helps characterize and design module interfaces, enabling the modular construction of gene circuits.

  14. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  15. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  16. Isolation and sequence analysis of the gene encoding triose phosphate isomerase from Zygosaccharomyces bailii.

    Science.gov (United States)

    Merico, A; Rodrigues, F; Côrte-Real, M; Porro, D; Ranzi, B M; Compagno, C

    2001-06-30

    The ZbTPI1 gene encoding triose phosphate isomerase (TIM) was cloned from a Zygosaccharomyces bailii genomic library by complementation of the Saccharomyces cerevisiae tpi1 mutant strain. The nucleotide sequence of a 1.5 kb fragment showed an open reading frame (ORF) of 746 bp, encoding a protein of 248 amino acid residues. The deduced amino acid sequence shares a high degree of homology with TIMs from other yeast species, including some highly conserved regions. The analysis of the promoter sequence of the ZbTPI1 revealed the presence of putative motifs known to have regulatory functions in S. cerevisiae. The GenBank Accession No. of ZbTPI1 is AF325852. Copyright 2001 John Wiley & Sons, Ltd.

  17. Simple mathematical models of gene regulatory dynamics

    CERN Document Server

    Mackey, Michael C; Tyran-Kamińska, Marta; Zeron, Eduardo S

    2016-01-01

    This is a short and self-contained introduction to the field of mathematical modeling of gene-networks in bacteria. As an entry point to the field, we focus on the analysis of simple gene-network dynamics. The notes commence with an introduction to the deterministic modeling of gene-networks, with extensive reference to applicable results coming from dynamical systems theory. The second part of the notes treats extensively several approaches to the study of gene-network dynamics in the presence of noise—either arising from low numbers of molecules involved, or due to noise external to the regulatory process. The third and final part of the notes gives a detailed treatment of three well studied and concrete examples of gene-network dynamics by considering the lactose operon, the tryptophan operon, and the lysis-lysogeny switch. The notes contain an index for easy location of particular topics as well as an extensive bibliography of the current literature. The target audience of these notes are mainly graduat...

  18. Organization of the gene encoding human lysosomal beta-galactosidase.

    Science.gov (United States)

    Morreau, H; Bonten, E; Zhou, X Y; D'Azzo, A

    1991-09-01

    Human beta-galactosidase precursor mRNA is alternatively spliced into an abundant 2.5-kb transcript and a minor 2.0-kb species. These templates direct the synthesis of the classic lysosomal beta-D-galactosidase enzyme and of a beta-galactosidase-related protein with no enzymatic activity. Mutations in the beta-galactosidase gene result in the lysosomal storage disorders GM1-gangliosidosis and Morquio B syndrome. To analyze the genetic lesions underlying these syndromes we have isolated the human beta-galactosidase gene and determined its organization. The gene spans greater than 62.5 kb and contains 16 exons. Promoter activity is located on a 236-bp Pst I fragment which works in a direction-independent manner. A second Pst I fragment of 851 bp located upstream from the first negatively regulates initiation of transcription. The promoter has characteristics of a housekeeping gene with GC-rich stretches and five potential SP1 transcription elements on two strands. We identified multiple cap sites of the mRNA, the major of which maps 53 bp upstream from the translation initiation codon. The portion of the human pre-mRNA undergoing alternative splicing is encoded by exons II-VII. Sequence analysis of equivalent mouse exons showed an identical genomic organization. However, translation of the corresponding differentially spliced murine transcript is interrupted in its reading frame. Thus, the mouse gene cannot encode a beta-galactosidase-related protein in a manner similar to the human counterpart. Differential expression of the murine beta-galactosidase transcript is observed in different mouse tissues.

  19. Semi-supervised prediction of gene regulatory networks using ...

    Indian Academy of Sciences (India)

    2015-09-28

    Sep 28, 2015 ... [Patel N and Wang JTL 2015 Semi-supervised prediction of gene regulatory networks using machine learning algorithms. J. Biosci. 40 731–740]. DOI 10.1007/s12038-015-9558-9. 1. Introduction. 1.1 Background. Using gene expression data to infer gene regulatory net- works (GRNs) is a key approach to ...

  20. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  1. Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia ...

    Indian Academy of Sciences (India)

    YINGJUN LI

    Identification of NBS-encodings and gene family classification of kiwi fruit. Kiwi fruit (A. chinensis) assembly and annotation ... There were three criteria to classify gene family. Both the coverage (aligned sequence/gene lengths) and iden- ... Number of identified NBS-encoding genes in kiwi fruit. Predicted protein domain.

  2. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  3. Heterologous expression of the pneumococcal serotype 14 polysaccharide in Lactococcus lactis requires lactococcal epsABC regulatory genes

    NARCIS (Netherlands)

    Nierop Groot, M.N.; Godefrooij, J.; Kleerebezem, M.

    2008-01-01

    The pneumococcal serotype 14 polysaccharide was produced in Lactococcus lactis by coexpressing pneumococcal polysaccharide type 14-specific genes (cpsFGHIJKL(14)) with the lactococcal regulatory and priming glucosyltransferase-encoding genes specific for B40 polysaccharide (epsABCD(B40)). The

  4. What makes the lac-pathway switch : identifying the fluctuations that trigger phenotype switching in gene regulatory systems

    NARCIS (Netherlands)

    Bhogale, Prasanna M; Sorg, Robin A; Veening, Jan-Willem; Berg, Johannes

    2014-01-01

    Multistable gene regulatory systems sustain different levels of gene expression under identical external conditions. Such multistability is used to encode phenotypic states in processes including nutrient uptake and persistence in bacteria, fate selection in viral infection, cell-cycle control and

  5. Gene regulatory networks governing lung specification.

    Science.gov (United States)

    Rankin, Scott A; Zorn, Aaron M

    2014-08-01

    The epithelial lining of the respiratory system originates from a small group of progenitor cells in the ventral foregut endoderm of the early embryo. Research in the last decade has revealed a number of paracrine signaling pathways that are critical for the development of these respiratory progenitors. In the post-genomic era the challenge now is to figure out at the genome wide level how these different signaling pathways and their downstream transcription factors interact in a complex "gene regulatory network" (GRN) to orchestrate early lung development. In this prospective, we review our growing understanding of the GRN governing lung specification. We discuss key gaps in our knowledge and describe emerging opportunities that will soon provide an unprecedented understanding of lung development and accelerate our ability to apply this knowledge to regenerative medicine. © 2014 Wiley Periodicals, Inc.

  6. Gene-Regulatory Activity of α-Tocopherol

    Directory of Open Access Journals (Sweden)

    John K. Lodge

    2010-03-01

    Full Text Available Vitamin E is an essential vitamin and a lipid soluble antioxidant, at least, under in vitro conditions. The antioxidant properties of vitamin E are exerted through its phenolic hydroxyl group, which donates hydrogen to peroxyl radicals, resulting in the formation of stable lipid species. Beside an antioxidant role, important cell signalling properties of vitamin E have been described. By using gene chip technology we have identified α-tocopherol sensitive molecular targets in vivo including christmas factor (involved in the blood coagulation and 5α-steroid reductase type 1 (catalyzes the conversion of testosterone to 5α-dihydrotestosterone being upregulated and γ-glutamyl-cysteinyl synthetase (the rate limiting enzyme in GSH synthesis being downregulated due to a-tocopherol deficiency. α-Tocopherol regulates signal transduction cascades not only at the mRNA but also at the miRNA level since miRNA 122a (involved in lipid metabolism and miRNA 125b (involved in inflammation are downregulated by α-tocopherol. Genetic polymorphisms may determine the biological and gene-regulatory activity of a-tocopherol. In this context we have recently shown that genes encoding for proteins involved in peripheral α-tocopherol transport and degradation are significantly affected by the apoE genotype.

  7. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis

    Directory of Open Access Journals (Sweden)

    González Mauricio

    2009-09-01

    recovered a substantial number of unknown genes encoding putative secreted and transmembrane proteins, suggesting new components of signaling pathways that might be incorporated within the existing regulatory networks controlling D. melanogaster embryogenesis. These genes are also good candidates for additional targeted functional analyses similar to those we conducted for CG6234. See related minireview by Vichas and Zallen: http://www.jbiol.com/content/8/8/76

  8. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis.

    Science.gov (United States)

    Zúñiga, Alejandro; Hödar, Christian; Hanna, Patricia; Ibáñez, Freddy; Moreno, Pablo; Pulgar, Rodrigo; Pastenes, Luis; González, Mauricio; Cambiazo, Verónica

    2009-09-22

    Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we recovered a substantial number of unknown genes encoding

  9. Co-transcriptional folding is encoded within RNA genes

    Directory of Open Access Journals (Sweden)

    Miklós István

    2004-08-01

    Full Text Available Abstract Background Most of the existing RNA structure prediction programs fold a completely synthesized RNA molecule. However, within the cell, RNA molecules emerge sequentially during the directed process of transcription. Dedicated experiments with individual RNA molecules have shown that RNA folds while it is being transcribed and that its correct folding can also depend on the proper speed of transcription. Methods The main aim of this work is to study if and how co-transcriptional folding is encoded within the primary and secondary structure of RNA genes. In order to achieve this, we study the known primary and secondary structures of a comprehensive data set of 361 RNA genes as well as a set of 48 RNA sequences that are known to differ from the originally transcribed sequence units. We detect co-transcriptional folding by defining two measures of directedness which quantify the extend of asymmetry between alternative helices that lie 5' and those that lie 3' of the known helices with which they compete. Results We show with statistical significance that co-transcriptional folding strongly influences RNA sequences in two ways: (1 alternative helices that would compete with the formation of the functional structure during co-transcriptional folding are suppressed and (2 the formation of transient structures which may serve as guidelines for the co-transcriptional folding pathway is encouraged. Conclusions These findings have a number of implications for RNA secondary structure prediction methods and the detection of RNA genes.

  10. The ROOT HAIRLESS 1 gene encodes a nuclear protein required for root hair initiation in Arabidopsis.

    Science.gov (United States)

    Schneider, K; Mathur, J; Boudonck, K; Wells, B; Dolan, L; Roberts, K

    1998-07-01

    The epidermis of Arabidopsis wild-type primary roots, in which some cells grow hairs and others remain hairless in a position-dependent manner, has become an established model system to study cell differentiation. Here we present a molecular analysis of the RHL1 (ROOT HAIRLESS 1) gene that, if mutated, prevents the formation of hairs on primary roots and causes a seedling lethal phenotype. We have cloned the RHL1 gene by use of a T-DNA-tagged mutant and found that it encodes a protein that appears to be plant specific. The predicted RHL1 gene product is a small hydrophilic protein (38.9 kD) containing putative nuclear localization signals and shows no significant homology to any known amino acid sequence. We demonstrate that a 78-amino-acid sequence at its amino terminus is capable of directing an RHL1-GFP fusion protein to the nucleus. The RHL1 transcript is present throughout the wild-type plant and in suspension culture cells, but in very low amounts, suggesting a regulatory function for the RHL1 protein. Structural evidence suggests a role for the RHL1 gene product in the nucleolus. We have examined the genetic relationship between RHL1 and GL2, an inhibitor of root hair initiation in non-hair cells. Our molecular and genetic data with double mutants, together with the expression analysis of a GL2 promoter-GUS reporter gene construct, indicate that the RHL1 gene acts independently of GL2.

  11. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  12. A Regulatory Network Analysis of Orphan Genes in Arabidopsis Thaliana

    Science.gov (United States)

    Singh, Pramesh; Chen, Tianlong; Arendsee, Zebulun; Wurtele, Eve S.; Bassler, Kevin E.

    Orphan genes, which are genes unique to each particular species, have recently drawn significant attention for their potential usefulness for organismal robustness. Their origin and regulatory interaction patterns remain largely undiscovered. Recently, methods that use the context likelihood of relatedness to infer a network followed by modularity maximizing community detection algorithms on the inferred network to find the functional structure of regulatory networks were shown to be effective. We apply improved versions of these methods to gene expression data from Arabidopsis thaliana, identify groups (clusters) of interacting genes with related patterns of expression and analyze the structure within those groups. Focusing on clusters that contain orphan genes, we compare the identified clusters to gene ontology (GO) terms, regulons, and pathway designations and analyze their hierarchical structure. We predict new regulatory interactions and unravel the structure of the regulatory interaction patterns of orphan genes. Work supported by the NSF through Grants DMR-1507371 and IOS-1546858.

  13. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

    Science.gov (United States)

    Jarvis, Eric E.; Roessler, Paul G.

    1999-01-01

    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

  14. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  15. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  16. Transient receptor potential (TRP gene superfamily encoding cation channels

    Directory of Open Access Journals (Sweden)

    Pan Zan

    2011-01-01

    Full Text Available Abstract Transient receptor potential (TRP non-selective cation channels constitute a superfamily, which contains 28 different genes. In mammals, this superfamily is divided into six subfamilies based on differences in amino acid sequence homology between the different gene products. Proteins within a subfamily aggregate to form heteromeric or homomeric tetrameric configurations. These different groupings have very variable permeability ratios for calcium versus sodium ions. TRP expression is widely distributed in neuronal tissues, as well as a host of other tissues, including epithelial and endothelial cells. They are activated by environmental stresses that include tissue injury, changes in temperature, pH and osmolarity, as well as volatile chemicals, cytokines and plant compounds. Their activation induces, via intracellular calcium signalling, a host of responses, including stimulation of cell proliferation, migration, regulatory volume behaviour and the release of a host of cytokines. Their activation is greatly potentiated by phospholipase C (PLC activation mediated by coupled GTP-binding proteins and tyrosine receptors. In addition to their importance in maintaining tissue homeostasis, some of these responses may involve various underlying diseases. Given the wealth of literature describing the multiple roles of TRP in physiology in a very wide range of different mammalian tissues, this review limits itself to the literature describing the multiple roles of TRP channels in different ocular tissues. Accordingly, their importance to the corneal, trabecular meshwork, lens, ciliary muscle, retinal, microglial and retinal pigment epithelial physiology and pathology is reviewed.

  17. Transcription factor trapping by RNA in gene regulatory elements.

    Science.gov (United States)

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  18. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...

  19. Conservation and diversification of an ancestral chordate gene regulatory network for dorsoventral patterning.

    Directory of Open Access Journals (Sweden)

    Iryna Kozmikova

    Full Text Available Formation of a dorsoventral axis is a key event in the early development of most animal embryos. It is well established that bone morphogenetic proteins (Bmps and Wnts are key mediators of dorsoventral patterning in vertebrates. In the cephalochordate amphioxus, genes encoding Bmps and transcription factors downstream of Bmp signaling such as Vent are expressed in patterns reminiscent of those of their vertebrate orthologues. However, the key question is whether the conservation of expression patterns of network constituents implies conservation of functional network interactions, and if so, how an increased functional complexity can evolve. Using heterologous systems, namely by reporter gene assays in mammalian cell lines and by transgenesis in medaka fish, we have compared the gene regulatory network implicated in dorsoventral patterning of the basal chordate amphioxus and vertebrates. We found that Bmp but not canonical Wnt signaling regulates promoters of genes encoding homeodomain proteins AmphiVent1 and AmphiVent2. Furthermore, AmphiVent1 and AmphiVent2 promoters appear to be correctly regulated in the context of a vertebrate embryo. Finally, we show that AmphiVent1 is able to directly repress promoters of AmphiGoosecoid and AmphiChordin genes. Repression of genes encoding dorsal-specific signaling molecule Chordin and transcription factor Goosecoid by Xenopus and zebrafish Vent genes represents a key regulatory interaction during vertebrate axis formation. Our data indicate high evolutionary conservation of a core Bmp-triggered gene regulatory network for dorsoventral patterning in chordates and suggest that co-option of the canonical Wnt signaling pathway for dorsoventral patterning in vertebrates represents one of the innovations through which an increased morphological complexity of vertebrate embryo is achieved.

  20. A flood-based information flow analysis and network minimization method for gene regulatory networks.

    Science.gov (United States)

    Pavlogiannis, Andreas; Mozhayskiy, Vadim; Tagkopoulos, Ilias

    2013-04-24

    Biological networks tend to have high interconnectivity, complex topologies and multiple types of interactions. This renders difficult the identification of sub-networks that are involved in condition- specific responses. In addition, we generally lack scalable methods that can reveal the information flow in gene regulatory and biochemical pathways. Doing so will help us to identify key participants and paths under specific environmental and cellular context. This paper introduces the theory of network flooding, which aims to address the problem of network minimization and regulatory information flow in gene regulatory networks. Given a regulatory biological network, a set of source (input) nodes and optionally a set of sink (output) nodes, our task is to find (a) the minimal sub-network that encodes the regulatory program involving all input and output nodes and (b) the information flow from the source to the sink nodes of the network. Here, we describe a novel, scalable, network traversal algorithm and we assess its potential to achieve significant network size reduction in both synthetic and E. coli networks. Scalability and sensitivity analysis show that the proposed method scales well with the size of the network, and is robust to noise and missing data. The method of network flooding proves to be a useful, practical approach towards information flow analysis in gene regulatory networks. Further extension of the proposed theory has the potential to lead in a unifying framework for the simultaneous network minimization and information flow analysis across various "omics" levels.

  1. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  2. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  3. Robustness and Accuracy in Sea Urchin Developmental Gene Regulatory Networks.

    Science.gov (United States)

    Ben-Tabou de-Leon, Smadar

    2016-01-01

    Developmental gene regulatory networks robustly control the timely activation of regulatory and differentiation genes. The structure of these networks underlies their capacity to buffer intrinsic and extrinsic noise and maintain embryonic morphology. Here I illustrate how the use of specific architectures by the sea urchin developmental regulatory networks enables the robust control of cell fate decisions. The Wnt-βcatenin signaling pathway patterns the primary embryonic axis while the BMP signaling pathway patterns the secondary embryonic axis in the sea urchin embryo and across bilateria. Interestingly, in the sea urchin in both cases, the signaling pathway that defines the axis controls directly the expression of a set of downstream regulatory genes. I propose that this direct activation of a set of regulatory genes enables a uniform regulatory response and a clear cut cell fate decision in the endoderm and in the dorsal ectoderm. The specification of the mesodermal pigment cell lineage is activated by Delta signaling that initiates a triple positive feedback loop that locks down the pigment specification state. I propose that the use of compound positive feedback circuitry provides the endodermal cells enough time to turn off mesodermal genes and ensures correct mesoderm vs. endoderm fate decision. Thus, I argue that understanding the control properties of repeatedly used regulatory architectures illuminates their role in embryogenesis and provides possible explanations to their resistance to evolutionary change.

  4. Robustness and accuracy in sea urchin developmental gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Smadar eBen-Tabou De-Leon

    2016-02-01

    Full Text Available Developmental gene regulatory networks robustly control the timely activation of regulatory and differentiation genes. The structure of these networks underlies their capacity to buffer intrinsic and extrinsic noise and maintain embryonic morphology. Here I illustrate how the use of specific architectures by the sea urchin developmental regulatory networks enables the robust control of cell fate decisions. The Wnt-βcatenin signaling pathway patterns the primary embryonic axis while the BMP signaling pathway patterns the secondary embryonic axis in the sea urchin embryo and across bilateria. Interestingly, in the sea urchin in both cases, the signaling pathway that defines the axis controls directly the expression of a set of downstream regulatory genes. I propose that this direct activation of a set of regulatory genes enables a uniform regulatory response and a clear cut cell fate decision in the endoderm and in the dorsal ectoderm. The specification of the mesodermal pigment cell lineage is activated by Delta signaling that initiates a triple positive feedback loop that locks down the pigment specification state. I propose that the use of compound positive feedback circuitry provides the endodermal cells enough time to turn off mesodermal genes and ensures correct mesoderm vs. endoderm fate decision. Thus, I argue that understanding the control properties of repeatedly used regulatory architectures illuminates their role in embryogenesis and provides possible explanations to their resistance to evolutionary change.

  5. An algebra-based method for inferring gene regulatory networks.

    Science.gov (United States)

    Vera-Licona, Paola; Jarrah, Abdul; Garcia-Puente, Luis David; McGee, John; Laubenbacher, Reinhard

    2014-03-26

    The inference of gene regulatory networks (GRNs) from experimental observations is at the heart of systems biology. This includes the inference of both the network topology and its dynamics. While there are many algorithms available to infer the network topology from experimental data, less emphasis has been placed on methods that infer network dynamics. Furthermore, since the network inference problem is typically underdetermined, it is essential to have the option of incorporating into the inference process, prior knowledge about the network, along with an effective description of the search space of dynamic models. Finally, it is also important to have an understanding of how a given inference method is affected by experimental and other noise in the data used. This paper contains a novel inference algorithm using the algebraic framework of Boolean polynomial dynamical systems (BPDS), meeting all these requirements. The algorithm takes as input time series data, including those from network perturbations, such as knock-out mutant strains and RNAi experiments. It allows for the incorporation of prior biological knowledge while being robust to significant levels of noise in the data used for inference. It uses an evolutionary algorithm for local optimization with an encoding of the mathematical models as BPDS. The BPDS framework allows an effective representation of the search space for algebraic dynamic models that improves computational performance. The algorithm is validated with both simulated and experimental microarray expression profile data. Robustness to noise is tested using a published mathematical model of the segment polarity gene network in Drosophila melanogaster. Benchmarking of the algorithm is done by comparison with a spectrum of state-of-the-art network inference methods on data from the synthetic IRMA network to demonstrate that our method has good precision and recall for the network reconstruction task, while also predicting several of the

  6. Global transcriptional regulatory network for Escherichia coli robustly connects gene expression to transcription factor activities

    DEFF Research Database (Denmark)

    Fang, Xin; Sastry, Anand; Mih, Nathan

    2017-01-01

    gene expression using this TRN; and (iii) how robust is our understanding of the TRN? First, we reconstructed a high-confidence TRN (hiTRN) consisting of 147 transcription factors (TFs) regulating 1,538 transcription units (TUs) encoding 1,764 genes. The 3,797 high-confidence regulatory interactions...... algorithms to predict the expression of 1,364 TUs given TF activities using 441 samples. The algorithms accurately predicted condition-specific expression for 86% (1,174 of 1,364) of the TUs, while 193 TUs (14%) were predicted better than random TRNs. Third, we identified 10 regulatory modules whose...... definitions were robust against changes to the TRN or expression compendium. Using surrogate variable analysis, we also identified three unmodeled factors that systematically influenced gene expression. Our computational workflow comprehensively characterizes the predictive capabilities and systems...

  7. Prioritization of gene regulatory interactions from large-scale modules in yeast

    Directory of Open Access Journals (Sweden)

    Bringas Ricardo

    2008-01-01

    Full Text Available Abstract Background The identification of groups of co-regulated genes and their transcription factors, called transcriptional modules, has been a focus of many studies about biological systems. While methods have been developed to derive numerous modules from genome-wide data, individual links between regulatory proteins and target genes still need experimental verification. In this work, we aim to prioritize regulator-target links within transcriptional modules based on three types of large-scale data sources. Results Starting with putative transcriptional modules from ChIP-chip data, we first derive modules in which target genes show both expression and function coherence. The most reliable regulatory links between transcription factors and target genes are established by identifying intersection of target genes in coherent modules for each enriched functional category. Using a combination of genome-wide yeast data in normal growth conditions and two different reference datasets, we show that our method predicts regulatory interactions with significantly higher predictive power than ChIP-chip binding data alone. A comparison with results from other studies highlights that our approach provides a reliable and complementary set of regulatory interactions. Based on our results, we can also identify functionally interacting target genes, for instance, a group of co-regulated proteins related to cell wall synthesis. Furthermore, we report novel conserved binding sites of a glycoprotein-encoding gene, CIS3, regulated by Swi6-Swi4 and Ndd1-Fkh2-Mcm1 complexes. Conclusion We provide a simple method to prioritize individual TF-gene interactions from large-scale transcriptional modules. In comparison with other published works, we predict a complementary set of regulatory interactions which yields a similar or higher prediction accuracy at the expense of sensitivity. Therefore, our method can serve as an alternative approach to prioritization for

  8. Large-scale gene expression study in the ophiuroid Amphiura filiformis provides insights into evolution of gene regulatory networks

    Directory of Open Access Journals (Sweden)

    David Viktor Dylus

    2016-01-01

    Full Text Available Abstract Background The evolutionary mechanisms involved in shaping complex gene regulatory networks (GRN that encode for morphologically similar structures in distantly related animals remain elusive. In this context, echinoderm larval skeletons found in brittle stars and sea urchins provide an ideal system. Here, we characterize for the first time the development of the larval skeleton in the ophiuroid Amphiura filiformis and compare it systematically with its counterpart in sea urchin. Results We show that ophiuroids and euechinoids, that split at least 480 Million years ago (Mya, have remarkable similarities in tempo and mode of skeletal development. Despite morphological and ontological similarities, our high-resolution study of the dynamics of genetic regulatory states in A. filiformis highlights numerous differences in the architecture of their underlying GRNs. Importantly, the A.filiformis pplx, the closest gene to the sea urchin double negative gate (DNG repressor pmar1, fails to drive the skeletogenic program in sea urchin, showing important evolutionary differences in protein function. hesC, the second repressor of the DNG, is co-expressed with most of the genes that are repressed in sea urchin, indicating the absence of direct repression of tbr, ets1/2, and delta in A. filiformis. Furthermore, the absence of expression in later stages of brittle star skeleton development of key regulatory genes, such as foxb and dri, shows significantly different regulatory states. Conclusion Our data fill up an important gap in the picture of larval mesoderm in echinoderms and allows us to explore the evolutionary implications relative to the recently established phylogeny of echinoderm classes. In light of recent studies on other echinoderms, our data highlight a high evolutionary plasticity of the same nodes throughout evolution of echinoderm skeletogenesis. Finally, gene duplication, protein function diversification, and cis-regulatory element

  9. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  10. Sequence and functional conservation of the intergenic region between the head-to-head genes encoding the small heat shock proteins alphaB-crystallin and HspB2 in the mammalian lineage.

    NARCIS (Netherlands)

    Doerwald, L.; Rheede, T. van; Dirks, R.P.H.; Madsen, O.; Rexwinkel, R; Genesen, S.T. van; Martens, G.J.M.; Jong, W.W.W. de; Lubsen, N.H.

    2004-01-01

    An unexpected feature of the large mammalian genome is the frequent occurrence of closely linked head-to-head gene pairs. Close apposition of such gene pairs has been suggested to be due to sharing of regulatory elements. We show here that the head-to-head gene pair encoding two small heat shock

  11. A cis-regulatory signature for chordate anterior neuroectodermal genes.

    Directory of Open Access Journals (Sweden)

    Maximilian Haeussler

    2010-04-01

    Full Text Available One of the striking findings of comparative developmental genetics was that expression patterns of core transcription factors are extraordinarily conserved in bilaterians. However, it remains unclear whether cis-regulatory elements of their target genes also exhibit common signatures associated with conserved embryonic fields. To address this question, we focused on genes that are active in the anterior neuroectoderm and non-neural ectoderm of the ascidian Ciona intestinalis. Following the dissection of a prototypic anterior placodal enhancer, we searched all genomic conserved non-coding elements for duplicated motifs around genes showing anterior neuroectodermal expression. Strikingly, we identified an over-represented pentamer motif corresponding to the binding site of the homeodomain protein OTX, which plays a pivotal role in the anterior development of all bilaterian species. Using an in vivo reporter gene assay, we observed that 10 of 23 candidate cis-regulatory elements containing duplicated OTX motifs are active in the anterior neuroectoderm, thus showing that this cis-regulatory signature is predictive of neuroectodermal enhancers. These results show that a common cis-regulatory signature corresponding to K50-Paired homeodomain transcription factors is found in non-coding sequences flanking anterior neuroectodermal genes in chordate embryos. Thus, field-specific selector genes impose architectural constraints in the form of combinations of short tags on their target enhancers. This could account for the strong evolutionary conservation of the regulatory elements controlling field-specific selector genes responsible for body plan formation.

  12. Genes encoding Cher-TPR fusion proteins are predominantly found in gene clusters encoding chemosensory pathways with alternative cellular functions.

    Directory of Open Access Journals (Sweden)

    Francisco Muñoz-Martínez

    Full Text Available Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF. CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was

  13. Genes encoding Cher-TPR fusion proteins are predominantly found in gene clusters encoding chemosensory pathways with alternative cellular functions.

    Science.gov (United States)

    Muñoz-Martínez, Francisco; García-Fontana, Cristina; Rico-Jiménez, Miriam; Alfonso, Carlos; Krell, Tino

    2012-01-01

    Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF). CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR) domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was found to be

  14. Interactive visualization of gene regulatory networks with associated gene expression time series data

    NARCIS (Netherlands)

    Westenberg, Michel A.; Hijum, Sacha A.F.T. van; Lulko, Andrzej T.; Kuipers, Oscar P.; Roerdink, Jos B.T.M.; Linsen, L; Hagen, H; Hamann, B

    2008-01-01

    We present GENeVis, an application to visualize gene expression time series data in a gene regulatory network context. This is a network of regulator proteins that regulate the expression of their respective target genes. The networks are represented as graphs, in which the nodes represent genes,

  15. Semi-supervised prediction of gene regulatory networks using ...

    Indian Academy of Sciences (India)

    Use of computational methods to predict gene regulatory networks (GRNs) from gene expression data is a challenging task. Many studies have been conducted using unsupervised methods to fulfill the task; however, such methods usually yield low prediction accuracies due to the lack of training data. In this article, we ...

  16. Analysis of regulatory networks constructed based on gene ...

    Indian Academy of Sciences (India)

    For pituitary adenoma-specific coexpressed genes, we integrated transcription factor (TF) and microRNA (miRNA) regulation to construct a complex regulatory network from the transcriptional and posttranscriptional perspectives. Network module analysis identified the synergistic regulation of genes by miRNAs and TFs in ...

  17. Semi-supervised prediction of gene regulatory networks using ...

    Indian Academy of Sciences (India)

    2015-09-28

    Sep 28, 2015 ... Use of computational methods to predict gene regulatory networks (GRNs) from gene expression data is a challenging task. Many studies have been conducted using unsupervised methods to fulfill the task; however, such methods usually yield low prediction accuracies due to the lack of training data.

  18. Cloning and characterization of SmZF1, a gene encoding a Schistosoma mansoni zinc finger protein

    Directory of Open Access Journals (Sweden)

    Souza Paulo R Eleutério de

    2001-01-01

    Full Text Available The zinc finger motifs (Cys2His2 are found in several proteins playing a role in the regulation of transcripton. SmZF1, a Schistosoma mansoni gene encoding a zinc finger protein was initially isolated from an adult worm cDNA library, as a partial cDNA. The full sequence of the gene was obtained by subcloning and sequencing cDNA and genomic fragments. The collated gene sequence is 2181 nt and the complete cDNA sequence is 705 bp containing the full open reading frame of the gene. Analysis of the genome sequence revealed the presence of three introns interrupting the coding region. The open reading frame theoretically encodes a protein of 164 amino acids, with a calculated molecular mass of 18,667Da. The predicted protein contains three zinc finger motifs, usually present in transcription regulatory proteins. PCR amplification with specific primers for the gene allowed for the detection of the target in egg, cercariae, schistosomulum and adult worm cDNA libraries indicating the expression of the mRNA in these life cycle stages of S. mansoni. This pattern of expression suggests the gene plays a role in vital functions of different life cycle stages of the parasite. Future research will be directed to elucidate the functional role of SmZF1.

  19. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  20. Manipulation of regulatory genes reveals complexity and fidelity in hormaomycin biosynthesis.

    Science.gov (United States)

    Cai, Xiaofeng; Teta, Roberta; Kohlhaas, Christoph; Crüsemann, Max; Ueoka, Reiko; Mangoni, Alfonso; Freeman, Michael F; Piel, Jörn

    2013-06-20

    Hormaomycin (HRM) is a structurally remarkable peptide produced by Streptomyces griseoflavus W-384 that acts as a Streptomyces signaling metabolite and exhibits potent antibiotic activity against coryneform actinomycetes. HRM biosynthetic studies have been hampered by inconsistent and low production. To enhance fermentation titers, the role of its cluster-encoded regulatory genes was investigated. Extra copies of the putative regulators hrmA and hrmB were introduced into the wild-type strain, resulting in an increase of HRM production and its analogs up to 135-fold. For the HrmB overproducer, six bioactive analogs were isolated and characterized. This study demonstrates that HrmA and HrmB are positive regulators in HRM biosynthesis. A third gene, hrmH, was identified as encoding a protein capable of shifting the metabolic profile of HRM and its derivatives. Its manipulation resulted in the generation of an additional HRM analog. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Learning gene regulatory networks from only positive and unlabeled data

    Directory of Open Access Journals (Sweden)

    Elkan Charles

    2010-05-01

    Full Text Available Abstract Background Recently, supervised learning methods have been exploited to reconstruct gene regulatory networks from gene expression data. The reconstruction of a network is modeled as a binary classification problem for each pair of genes. A statistical classifier is trained to recognize the relationships between the activation profiles of gene pairs. This approach has been proven to outperform previous unsupervised methods. However, the supervised approach raises open questions. In particular, although known regulatory connections can safely be assumed to be positive training examples, obtaining negative examples is not straightforward, because definite knowledge is typically not available that a given pair of genes do not interact. Results A recent advance in research on data mining is a method capable of learning a classifier from only positive and unlabeled examples, that does not need labeled negative examples. Applied to the reconstruction of gene regulatory networks, we show that this method significantly outperforms the current state of the art of machine learning methods. We assess the new method using both simulated and experimental data, and obtain major performance improvement. Conclusions Compared to unsupervised methods for gene network inference, supervised methods are potentially more accurate, but for training they need a complete set of known regulatory connections. A supervised method that can be trained using only positive and unlabeled data, as presented in this paper, is especially beneficial for the task of inferring gene regulatory networks, because only an incomplete set of known regulatory connections is available in public databases such as RegulonDB, TRRD, KEGG, Transfac, and IPA.

  2. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    Energy Technology Data Exchange (ETDEWEB)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  3. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...

  4. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  5. Echinoderm systems for gene regulatory studies in evolution and development.

    Science.gov (United States)

    Arnone, Maria Ina; Andrikou, Carmen; Annunziata, Rossella

    2016-08-01

    One of the main challenges in Evolutionary Developmental Biology is to understand to which extent developmental changes are driven by regulatory alterations in the genomic sequence. In the recent years, the focus of comparative developmental studies has moved towards a systems biology approach providing a better understanding of the evolution of gene interactions that form the so called Gene Regulatory Networks (GRN). Echinoderms provide a powerful system to reveal regulatory mechanisms and within the past decade, due to the latest technological innovations, a great number of studies have provided valuable information for comparative GRN analyses. In this review we describe recent advances in evolution of GRNs arising from echinoderm systems, focusing on the properties of conserved regulatory kernels, circuit co-option events and GRN topological rearrangements. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  7. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... synthase (crtB), phytoene desaturase (crtL) and lycopene cyclase. (crtY). It also retains a chloramphenicol resistance gene. Cells of E. coli containing this plasmid produce and accumulate β-carotene, resulting in yellow colonies. The plasmid, pTrc-ATIPI, retains an ampicillin resistance gene and an IPI gene ...

  8. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Peanut Ubiquitin gene (Luo et al. 2005) was used as the internal control. Expression data of the target gene was normalized with internal control using the 2. –ΔΔCT method (Livak and Schmittgen 2001). Lysophosphatidyl acyltransferase gene from Arachis hypogaea. 1031. J. Biosci. 37(6), December 2012 ...

  9. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  10. Similarity in gene-regulatory networks suggests that cancer cells share characteristics of embryonic neural cells.

    Science.gov (United States)

    Zhang, Zan; Lei, Anhua; Xu, Liyang; Chen, Lu; Chen, Yonglong; Zhang, Xuena; Gao, Yan; Yang, Xiaoli; Zhang, Min; Cao, Ying

    2017-08-04

    Cancer cells are immature cells resulting from cellular reprogramming by gene misregulation, and redifferentiation is expected to reduce malignancy. It is unclear, however, whether cancer cells can undergo terminal differentiation. Here, we show that inhibition of the epigenetic modification enzyme enhancer of zeste homolog 2 (EZH2), histone deacetylases 1 and 3 (HDAC1 and -3), lysine demethylase 1A (LSD1), or DNA methyltransferase 1 (DNMT1), which all promote cancer development and progression, leads to postmitotic neuron-like differentiation with loss of malignant features in distinct solid cancer cell lines. The regulatory effect of these enzymes in neuronal differentiation resided in their intrinsic activity in embryonic neural precursor/progenitor cells. We further found that a major part of pan-cancer-promoting genes and the signal transducers of the pan-cancer-promoting signaling pathways, including the epithelial-to-mesenchymal transition (EMT) mesenchymal marker genes, display neural specific expression during embryonic neurulation. In contrast, many tumor suppressor genes, including the EMT epithelial marker gene that encodes cadherin 1 ( CDH1 ), exhibited non-neural or no expression. This correlation indicated that cancer cells and embryonic neural cells share a regulatory network, mediating both tumorigenesis and neural development. This observed similarity in regulatory mechanisms suggests that cancer cells might share characteristics of embryonic neural cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.

    Science.gov (United States)

    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B

    2013-02-01

    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (pgoat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

  12. In silicio search for genes encoding peroxisomal proteins in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kal, A J; Hettema, E H; van den Berg, M; Koerkamp, M G; van Ijlst, L; Distel, B; Tabak, H F

    2000-01-01

    The biogenesis of peroxisomes involves the synthesis of new proteins that after, completion of translation, are targeted to the organelle by virtue of peroxisomal targeting signals (PTS). Two types of PTSs have been well characterized for import of matrix proteins (PTS1 and PTS2). Induction of the genes encoding these matrix proteins takes place in oleate-containing medium and is mediated via an oleate response element (ORE) present in the region preceding these genes. The authors have searched the yeast genome for OREs preceding open reading frames (ORFs), and for ORFs that contain either a PTS1 or PTS2. Of the ORFs containing an ORE, as well as either a PTS1 or a PTS2, many were known to encode bona fide peroxisomal matrix proteins. In addition, candidate genes were identified as encoding putative new peroxisomal proteins. For one case, subcellular location studies validated the in silicio prediction. This gene encodes a new peroxisomal thioesterase.

  13. Effect of salt stress on genes encoding translation-associated proteins in Arabidopsis thaliana.

    Science.gov (United States)

    Omidbakhshfard, Mohammad Amin; Omranian, Nooshin; Ahmadi, Farajollah Shahriari; Nikoloski, Zoran; Mueller-Roeber, Bernd

    2012-09-01

    Salinity negatively affects plant growth and disturbs chloroplast integrity. Here, we aimed at identifying salt-responsive translation-related genes in Arabidopsis thaliana with an emphasis on those encoding plastid-located proteins. We used quantitative real-time PCR to test the expression of 170 genes after short-term salt stress (up to 24 h) and identified several genes affected by the stress including: PRPL11, encoding plastid ribosomal protein L11, ATAB2, encoding a chloroplast-located RNA-binding protein presumably functioning as an activator of translation, and PDF1B, encoding a peptide deformylase involved in N-formyl group removal from nascent proteins synthesized in chloroplasts. These genes were previously shown to have important functions in chloroplast biology and may therefore represent new targets for biotechnological optimization of salinity tolerance.

  14. Regulatory links between imprinted genes: evolutionary predictions and consequences.

    Science.gov (United States)

    Patten, Manus M; Cowley, Michael; Oakey, Rebecca J; Feil, Robert

    2016-02-10

    Genomic imprinting is essential for development and growth and plays diverse roles in physiology and behaviour. Imprinted genes have traditionally been studied in isolation or in clusters with respect to cis-acting modes of gene regulation, both from a mechanistic and evolutionary point of view. Recent studies in mammals, however, reveal that imprinted genes are often co-regulated and are part of a gene network involved in the control of cellular proliferation and differentiation. Moreover, a subset of imprinted genes acts in trans on the expression of other imprinted genes. Numerous studies have modulated levels of imprinted gene expression to explore phenotypic and gene regulatory consequences. Increasingly, the applied genome-wide approaches highlight how perturbation of one imprinted gene may affect other maternally or paternally expressed genes. Here, we discuss these novel findings and consider evolutionary theories that offer a rationale for such intricate interactions among imprinted genes. An evolutionary view of these trans-regulatory effects provides a novel interpretation of the logic of gene networks within species and has implications for the origin of reproductive isolation between species. © 2016 The Authors.

  15. The inferred cardiogenic gene regulatory network in the mammalian heart.

    Science.gov (United States)

    Bazil, Jason N; Stamm, Karl D; Li, Xing; Thiagarajan, Raghuram; Nelson, Timothy J; Tomita-Mitchell, Aoy; Beard, Daniel A

    2014-01-01

    Cardiac development is a complex, multiscale process encompassing cell fate adoption, differentiation and morphogenesis. To elucidate pathways underlying this process, a recently developed algorithm to reverse engineer gene regulatory networks was applied to time-course microarray data obtained from the developing mouse heart. Approximately 200 genes of interest were input into the algorithm to generate putative network topologies that are capable of explaining the experimental data via model simulation. To cull specious network interactions, thousands of putative networks are merged and filtered to generate scale-free, hierarchical networks that are statistically significant and biologically relevant. The networks are validated with known gene interactions and used to predict regulatory pathways important for the developing mammalian heart. Area under the precision-recall curve and receiver operator characteristic curve are 9% and 58%, respectively. Of the top 10 ranked predicted interactions, 4 have already been validated. The algorithm is further tested using a network enriched with known interactions and another depleted of them. The inferred networks contained more interactions for the enriched network versus the depleted network. In all test cases, maximum performance of the algorithm was achieved when the purely data-driven method of network inference was combined with a data-independent, functional-based association method. Lastly, the network generated from the list of approximately 200 genes of interest was expanded using gene-profile uniqueness metrics to include approximately 900 additional known mouse genes and to form the most likely cardiogenic gene regulatory network. The resultant network supports known regulatory interactions and contains several novel cardiogenic regulatory interactions. The method outlined herein provides an informative approach to network inference and leads to clear testable hypotheses related to gene regulation.

  16. Gene Regulatory Evolution During Speciation in a Songbird

    Directory of Open Access Journals (Sweden)

    John H. Davidson

    2016-05-01

    Full Text Available Over the last decade, tremendous progress has been made toward a comparative understanding of gene regulatory evolution. However, we know little about how gene regulation evolves in birds, and how divergent genomes interact in their hybrids. Because of the unique features of birds – female heterogamety, a highly conserved karyotype, and the slow evolution of reproductive incompatibilities – an understanding of regulatory evolution in birds is critical to a comprehensive understanding of regulatory evolution and its implications for speciation. Using a novel complement of analyses of replicated RNA-seq libraries, we demonstrate abundant divergence in brain gene expression between zebra finch (Taeniopygia guttata subspecies. By comparing parental populations and their F1 hybrids, we also show that gene misexpression is relatively rare among brain-expressed transcripts in male birds. If this pattern is consistent across tissues and sexes, it may partially explain the slow buildup of postzygotic reproductive isolation observed in birds relative to other taxa. Although we expected that the action of genetic drift on the island-dwelling zebra finch subspecies would be manifested in a higher rate of trans regulatory divergence, we found that most divergence was in cis regulation, following a pattern commonly observed in other taxa. Thus, our study highlights both unique and shared features of avian regulatory evolution.

  17. Human and mouse switch-like genes share common transcriptional regulatory mechanisms for bimodality

    Directory of Open Access Journals (Sweden)

    Tozeren Aydin

    2008-12-01

    Full Text Available Abstract Background Gene expression is controlled over a wide range at the transcript level through complex interplay between DNA and regulatory proteins, resulting in profiles of gene expression that can be represented as normal, graded, and bimodal (switch-like distributions. We have previously performed genome-scale identification and annotation of genes with switch-like expression at the transcript level in mouse, using large microarray datasets for healthy tissue, in order to study the cellular pathways and regulatory mechanisms involving this class of genes. We showed that a large population of bimodal mouse genes encoding for cell membrane and extracellular matrix proteins is involved in communication pathways. This study expands on previous results by annotating human bimodal genes, investigating their correspondence to bimodality in mouse orthologs and exploring possible regulatory mechanisms that contribute to bimodality in gene expression in human and mouse. Results Fourteen percent of the human genes on the HGU133A array (1847 out of 13076 were identified as bimodal or switch-like. More than 40% were found to have bimodal mouse orthologs. KEGG pathways enriched for bimodal genes included ECM-receptor interaction, focal adhesion, and tight junction, showing strong similarity to the results obtained in mouse. Tissue-specific modes of expression of bimodal genes among brain, heart, and skeletal muscle were common between human and mouse. Promoter analysis revealed a higher than average number of transcription start sites per gene within the set of bimodal genes. Moreover, the bimodal gene set had differentially methylated histones compared to the set of the remaining genes in the genome. Conclusion The fact that bimodal genes were enriched within the cell membrane and extracellular environment make these genes as candidates for biomarkers for tissue specificity. The commonality of the important roles bimodal genes play in tissue

  18. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  19. Direct control of type IIA topoisomerase activity by a chromosomally encoded regulatory protein.

    Science.gov (United States)

    Vos, Seychelle M; Lyubimov, Artem Y; Hershey, David M; Schoeffler, Allyn J; Sengupta, Sugopa; Nagaraja, Valakunja; Berger, James M

    2014-07-01

    Precise control of supercoiling homeostasis is critical to DNA-dependent processes such as gene expression, replication, and damage response. Topoisomerases are central regulators of DNA supercoiling commonly thought to act independently in the recognition and modulation of chromosome superstructure; however, recent evidence has indicated that cells tightly regulate topoisomerase activity to support chromosome dynamics, transcriptional response, and replicative events. How topoisomerase control is executed and linked to the internal status of a cell is poorly understood. To investigate these connections, we determined the structure of Escherichia coli gyrase, a type IIA topoisomerase bound to YacG, a recently identified chromosomally encoded inhibitor protein. Phylogenetic analyses indicate that YacG is frequently associated with coenzyme A (CoA) production enzymes, linking the protein to metabolism and stress. The structure, along with supporting solution studies, shows that YacG represses gyrase by sterically occluding the principal DNA-binding site of the enzyme. Unexpectedly, YacG acts by both engaging two spatially segregated regions associated with small-molecule inhibitor interactions (fluoroquinolone antibiotics and the newly reported antagonist GSK299423) and remodeling the gyrase holoenzyme into an inactive, ATP-trapped configuration. This study establishes a new mechanism for the protein-based control of topoisomerases, an approach that may be used to alter supercoiling levels for responding to changes in cellular state. © 2014 Vos et al.; Published by Cold Spring Harbor Laboratory Press.

  20. Distinct Patterns of Gene Gain and Loss: Diverse Evolutionary Modes of NBS-Encoding Genes in Three Solanaceae Crop Species.

    Science.gov (United States)

    Qian, Lan-Hua; Zhou, Guang-Can; Sun, Xiao-Qin; Lei, Zhao; Zhang, Yan-Mei; Xue, Jia-Yu; Hang, Yue-Yu

    2017-05-05

    Plant resistance conferred by nucleotide binding site (NBS)-encoding resistance genes plays a key role in the defense against various pathogens throughout the entire plant life cycle. However, comparative analyses for the systematic evaluation and determination of the evolutionary modes of NBS-encoding genes among Solanaceae species are rare. In this study, 447, 255, and 306 NBS-encoding genes were identified from the genomes of potato, tomato, and pepper, respectively. These genes usually clustered as tandem arrays on chromosomes; few existed as singletons. Phylogenetic analysis indicated that three subclasses [TNLs (TIR-NBS-LRR), CNLs (CC-NBS-LRR), and RNLs (RPW8-NBS-LRR)] each formed a monophyletic clade and were distinguished by unique exon/intron structures and amino acid motif sequences. By comparing phylogenetic and systematic relationships, we inferred that the NBS-encoding genes in the present genomes of potato, tomato, and pepper were derived from 150 CNL, 22 TNL, and 4 RNL ancestral genes, and underwent independent gene loss and duplication events after speciation. The NBS-encoding genes therefore exhibit diverse and dynamic evolutionary patterns in the three Solanaceae species, giving rise to the discrepant gene numbers observed today. Potato shows a "consistent expansion" pattern, tomato exhibits a pattern of "first expansion and then contraction," and pepper presents a "shrinking" pattern. The earlier expansion of CNLs in the common ancestor led to the dominance of this subclass in gene numbers. However, RNLs remained at low copy numbers due to their specific functions. Along the evolutionary process of NBS-encoding genes in Solanaceae, species-specific tandem duplications contributed the most to gene expansions. Copyright © 2017 Qian et al.

  1. Identification of toxin genes encoding Cyt proteins from standard ...

    African Journals Online (AJOL)

    Polymerase chain reaction-restriction fragment length polymorphism methods for identification of cyt subclasses from Bacillus thuringiensis were established. Eight of 68 standard and ten of 107 Argentine B. thuringiensis strains harbor at least one cyt gene. The combination of cyt1Aa/cyt2Ba genes was identified in four ...

  2. Expression of the Pseudomonas aeruginosa toxA positive regulatory gene (regA) in Escherichia coli.

    OpenAIRE

    Hamood, A N; Iglewski, B H

    1990-01-01

    The regA gene is a positive regulatory gene that regulates toxin A production in Pseudomonas aeruginosa at the transcriptional level. The product of the regA gene was examined in Escherichia coli with the expression vector pT7-7. A 1.3-kilobase AvaI-HindIII fragment containing the regA gene was cloned into the pT7-7 vector. A recombinant plasmid (pAH1) encoded a 29-kilodalton protein. The molecular weight of this protein correlated closely with the predicted molecular weight of the RegA prote...

  3. Occurrence of enterotoxin-encoding genes in Staphylococcus aureus causing mastitis in lactating goats

    Directory of Open Access Journals (Sweden)

    Daneelly H. Ferreira

    2014-07-01

    Full Text Available Staphylococcal enterotoxins are the leading cause of human food poisoning worldwide. Staphylococcus spp. are the main mastitis-causing agents in goats and frequently found in high counts in goat milk. This study aimed to investigate the occurrence of enterotoxin-encoding genes in Staphylococcus aureus associated with mastitis in lactating goats in Paraiba State, Brazil. Milk samples (n=2024 were collected from 393 farms. Staphylococcus aureus was isolated in 55 milk samples. Classical (sea, seb, sec, sed, see and novel (seg, seh, sei enterotoxin-encoding genes were investigated by means of polymerase chain reaction (PCR. From thirty-six tested isolates, enterotoxin-encoding genes were detected in 7 (19.5% S. aureus. The gene encoding enterotoxin C (seC was identified in six isolates, while seiwas observed in only one isolate. The genes sea, seb, sed, see, seg and seh were not observed amongst the S. aureus investigated in this study. In summary, S. aureus causing mastitis in goats can harbor enterotoxin-encoding genes and seC was the most frequent gene observed amongst the investigated isolates. This finding is important for surveillance purposes, since enterotoxin C should be investigated in human staphylococcal food poisoning outbreaks caused by consumption of goat milk and dairy products.

  4. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    Science.gov (United States)

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  5. Asthma and genes encoding components of the vitamin D pathway

    Directory of Open Access Journals (Sweden)

    Raby Benjamin A

    2009-10-01

    Full Text Available Abstract Background Genetic variants at the vitamin D receptor (VDR locus are associated with asthma and atopy. We hypothesized that polymorphisms in other genes of the vitamin D pathway are associated with asthma or atopy. Methods Eleven candidate genes were chosen for this study, five of which code for proteins in the vitamin D metabolism pathway (CYP27A1, CYP27B1, CYP2R1, CYP24A1, GC and six that are known to be transcriptionally regulated by vitamin D (IL10, IL1RL1, CD28, CD86, IL8, SKIIP. For each gene, we selected a maximally informative set of common SNPs (tagSNPs using the European-derived (CEU HapMap dataset. A total of 87 SNPs were genotyped in a French-Canadian family sample ascertained through asthmatic probands (388 nuclear families, 1064 individuals and evaluated using the Family Based Association Test (FBAT program. We then sought to replicate the positive findings in four independent samples: two from Western Canada, one from Australia and one from the USA (CAMP. Results A number of SNPs in the IL10, CYP24A1, CYP2R1, IL1RL1 and CD86 genes were modestly associated with asthma and atopy (p IL10 and VDR genes as well as in the IL10 and IL1RL1 genes were associated with asthma (p IL10 and CYP24A1 genes were again modestly associated with asthma and atopy (p IL10 and VDR was replicated in CAMP, but not in the other populations. Conclusion A number of genes involved in the vitamin D pathway demonstrate modest levels of association with asthma and atopy. Multilocus models testing genes in the same pathway are potentially more effective to evaluate the risk of asthma, but the effects are not uniform across populations.

  6. Unraveling condition specific gene transcriptional regulatory networks in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Kluger Yuval

    2006-03-01

    Full Text Available Abstract Background Gene expression and transcription factor (TF binding data have been used to reveal gene transcriptional regulatory networks. Existing knowledge of gene regulation can be presented using gene connectivity networks. However, these composite connectivity networks do not specify the range of biological conditions of the activity of each link in the network. Results We present a novel method that utilizes the expression and binding patterns of the neighboring nodes of each link in existing experimentally-based, literature-derived gene transcriptional regulatory networks and extend them in silico using TF-gene binding motifs and a compendium of large expression data from Saccharomyces cerevisiae. Using this method, we predict several hundreds of new transcriptional regulatory TF-gene links, along with experimental conditions in which known and predicted links become active. This approach unravels new links in the yeast gene transcriptional regulatory network by utilizing the known transcriptional regulatory interactions, and is particularly useful for breaking down the composite transcriptional regulatory network to condition specific networks. Conclusion Our methods can facilitate future binding experiments, as they can considerably help focus on the TFs that must be surveyed to understand gene regulation. (Supplemental material and the latest version of the MATLAB implementation of the United Signature Algorithm is available online at 1 or [see Additional files 1, 2, 3, 4, 5, 6, 7, 8, 9, 10] Additional File 1 overview of supplemental data Click here for file Additional File 2 experimental conditions for each link in figure 5. These are the experimental conditions in which the links are likely to be active. Click here for file Additional File 3 experimental conditions for each link in figure 7. These are the experimental conditions in which the links are likely to be active. Click here for file Additional File 4 Alon

  7. Molecular evolution of genes encoding ribonucleases in ruminant species.

    Science.gov (United States)

    Confalone, E; Beintema, J J; Sasso, M P; Carsana, A; Palmieri, M; Vento, M T; Furia, A

    1995-12-01

    Phylogenetic analysis, based on the primary structures of mammalian pancreatic-type ribonucleases, indicated that gene duplication events, which occurred during the evolution of ancestral ruminants, gave rise to the three paralogous enzymes present in the bovine species. Herein we report data that demonstrate the existence of the orthologues of the bovine pancreatic, seminal, and cerebral ribonucleases coding sequences in the genomes of giraffe and sheep. The "seminal" sequence is a pseudogene in both species. We also report an analysis of the transcriptional expression of ribonuclease genes in sheep tissues. The data presented support a model for positive selection acting on the molecular evolution of ruminant ribonuclease genes.

  8. Characterization of a gene encoding cellulase from uncultured soil bacteria.

    Science.gov (United States)

    Kim, Soo-Jin; Lee, Chang-Muk; Han, Bo-Ram; Kim, Min-Young; Yeo, Yun-Soo; Yoon, Sang-Hong; Koo, Bon-Sung; Jun, Hong-Ki

    2008-05-01

    To detect cellulases encoded by uncultured microorganisms, we constructed metagenomic libraries from Korean soil DNAs. Screenings of the libraries revealed a clone pCM2 that uses carboxymethyl cellulose (CMC) as a sole carbon source. Further analysis of the insert showed two consecutive ORFs (celM2 and xynM2) encoding proteins of 226 and 662 amino acids, respectively. A multiple sequence analysis with the deduced amino acid sequences of celM2 showed 36% sequence identity with cellulase from the Synechococcus sp., while xynM2 had 59% identity to endo-1,4-beta-xylanase A from Cellulomonas pachnodae. The highest enzymatic CMC hydrolysis was observable at pH 4.0 and 45 degrees C with recombinant CelM2 protein. Although the enzyme CelM2 additionally hydrolyzed avicel and xylan, no substrate hydrolysis was observed on oligosaccharides such as cellobiose, pNP-beta-cellobioside, pNP-beta-glucoside, and pNP-beta-xyloside. These results showed that CelM2 is a novel endo-type cellulase.

  9. iRegulon: from a gene list to a gene regulatory network using large motif and track collections.

    Directory of Open Access Journals (Sweden)

    Rekin's Janky

    2014-07-01

    Full Text Available Identifying master regulators of biological processes and mapping their downstream gene networks are key challenges in systems biology. We developed a computational method, called iRegulon, to reverse-engineer the transcriptional regulatory network underlying a co-expressed gene set using cis-regulatory sequence analysis. iRegulon implements a genome-wide ranking-and-recovery approach to detect enriched transcription factor motifs and their optimal sets of direct targets. We increase the accuracy of network inference by using very large motif collections of up to ten thousand position weight matrices collected from various species, and linking these to candidate human TFs via a motif2TF procedure. We validate iRegulon on gene sets derived from ENCODE ChIP-seq data with increasing levels of noise, and we compare iRegulon with existing motif discovery methods. Next, we use iRegulon on more challenging types of gene lists, including microRNA target sets, protein-protein interaction networks, and genetic perturbation data. In particular, we over-activate p53 in breast cancer cells, followed by RNA-seq and ChIP-seq, and could identify an extensive up-regulated network controlled directly by p53. Similarly we map a repressive network with no indication of direct p53 regulation but rather an indirect effect via E2F and NFY. Finally, we generalize our computational framework to include regulatory tracks such as ChIP-seq data and show how motif and track discovery can be combined to map functional regulatory interactions among co-expressed genes. iRegulon is available as a Cytoscape plugin from http://iregulon.aertslab.org.

  10. Shaping skeletal growth by modular regulatory elements in the Bmp5 gene.

    Directory of Open Access Journals (Sweden)

    Catherine Guenther

    2008-12-01

    Full Text Available Cartilage and bone are formed into a remarkable range of shapes and sizes that underlie many anatomical adaptations to different lifestyles in vertebrates. Although the morphological blueprints for individual cartilage and bony structures must somehow be encoded in the genome, we currently know little about the detailed genomic mechanisms that direct precise growth patterns for particular bones. We have carried out large-scale enhancer surveys to identify the regulatory architecture controlling developmental expression of the mouse Bmp5 gene, which encodes a secreted signaling molecule required for normal morphology of specific skeletal features. Although Bmp5 is expressed in many skeletal precursors, different enhancers control expression in individual bones. Remarkably, we show here that different enhancers also exist for highly restricted spatial subdomains along the surface of individual skeletal structures, including ribs and nasal cartilages. Transgenic, null, and regulatory mutations confirm that these anatomy-specific sequences are sufficient to trigger local changes in skeletal morphology and are required for establishing normal growth rates on separate bone surfaces. Our findings suggest that individual bones are composite structures whose detailed growth patterns are built from many smaller lineage and gene expression domains. Individual enhancers in BMP genes provide a genomic mechanism for controlling precise growth domains in particular cartilages and bones, making it possible to separately regulate skeletal anatomy at highly specific locations in the body.

  11. Patterns of positive selection of the myogenic regulatory factor gene family in vertebrates.

    Science.gov (United States)

    Zhao, Xiao; Yu, Qi; Huang, Ling; Liu, Qing-Xin

    2014-01-01

    The functional divergence of transcriptional factors is critical in the evolution of transcriptional regulation. However, the mechanism of functional divergence among these factors remains unclear. Here, we performed an evolutionary analysis for positive selection in members of the myogenic regulatory factor (MRF) gene family of vertebrates. We selected 153 complete vertebrate MRF nucleotide sequences from our analyses, which revealed substantial evidence of positive selection. Here, we show that sites under positive selection were more frequently detected and identified from the genes encoding the myogenic differentiation factors (MyoG and Myf6) than the genes encoding myogenic determination factors (Myf5 and MyoD). Additionally, the functional divergence within the myogenic determination factors or differentiation factors was also under positive selection pressure. The positive selection sites were more frequently detected from MyoG and MyoD than Myf6 and Myf5, respectively. Amino acid residues under positive selection were identified mainly in their transcription activation domains and on the surface of protein three-dimensional structures. These data suggest that the functional gain and divergence of myogenic regulatory factors were driven by distinct positive selection of their transcription activation domains, whereas the function of the DNA binding domains was conserved in evolution. Our study evaluated the mechanism of functional divergence of the transcriptional regulation factors within a family, whereby the functions of their transcription activation domains diverged under positive selection during evolution.

  12. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    families. The recombinant BtabCSP was successfully expressed in Escherichia coli cells. This is the first report on the existence of chemosensory protein-coding gene in whiteflies. It will help us to elucidate the molecular.

  13. Conserved-peptide upstream open reading frames (CPuORFs are associated with regulatory genes in angiosperms

    Directory of Open Access Journals (Sweden)

    Richard A Jorgensen

    2012-08-01

    Full Text Available Upstream open reading frames (uORFs are common in eukaryotic transcripts, but those that encode conserved peptides (CPuORFs occur in less than 1% of transcripts. The peptides encoded by three plant CPuORF families are known to control translation of the downstream ORF in response to a small signal molecule (sucrose, polyamines and phosphocholine. In flowering plants, transcription factors are statistically over-represented among genes that possess CPuORFs, and in general it appeared that many CPuORF genes also had other regulatory functions, though the significance of this suggestion was uncertain (Hayden and Jorgensen, 2007. Five years later the literature provides much more information on the functions of many CPuORF genes. Here we reassess the functions of 27 known CPuORF gene families and find that 22 of these families play a variety of different regulatory roles, from transcriptional control to protein turnover, and from small signal molecules to signal transduction kinases. Clearly then, there is indeed a strong association of CPuORFs with regulatory genes. In addition, 16 of these families play key roles in a variety of different biological processes. Most strikingly, the core sucrose response network includes three different CPuORFs, creating the potential for sophisticated balancing of the network in response to three different molecular inputs. We propose that the function of most CPuORFs is to modulate translation of a downstream major ORF (mORF in response to a signal molecule recognized by the conserved peptide and that because the mORFs of CPuORF genes generally encode regulatory proteins, many of them centrally important in the biology of plants, CPuORFs play key roles in balancing such regulatory networks.

  14. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)

    Unknown

    digested with SmaI and SspI and self-ligated to generate. pSAC86 which eliminated the SacI site present in the. Multiple Cloning Site (MCS). Plasmid pBH86 contains a modified version of the erg-3 gene in which the intronic. HindIII site was destroyed (Prakash et al 1999). pMOD86 contains the erg-3 gene of Neurospora in ...

  15. A gene regulatory network armature for T-lymphocyte specification

    Energy Technology Data Exchange (ETDEWEB)

    Fung, Elizabeth-sharon [Los Alamos National Laboratory

    2008-01-01

    Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through which T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.

  16. Lineage-specific transcription factors and the evolution of gene regulatory networks.

    Science.gov (United States)

    Nowick, Katja; Stubbs, Lisa

    2010-01-01

    Nature is replete with examples of diverse cell types, tissues and body plans, forming very different creatures from genomes with similar gene complements. However, while the genes and the structures of proteins they encode can be highly conserved, the production of those proteins in specific cell types and at specific developmental time points might differ considerably between species. A full understanding of the factors that orchestrate gene expression will be essential to fully understand evolutionary variety. Transcription factor (TF) proteins, which form gene regulatory networks (GRNs) to act in cooperative or competitive partnerships to regulate gene expression, are key components of these unique regulatory programs. Although many TFs are conserved in structure and function, certain classes of TFs display extensive levels of species diversity. In this review, we highlight families of TFs that have expanded through gene duplication events to create species-unique repertoires in different evolutionary lineages. We discuss how the hierarchical structures of GRNs allow for flexible small to large-scale phenotypic changes. We survey evidence that explains how newly evolved TFs may be integrated into an existing GRN and how molecular changes in TFs might impact the GRNs. Finally, we review examples of traits that evolved due to lineage-specific TFs and species differences in GRNs.

  17. SELANSI: a toolbox for simulation of stochastic gene regulatory networks.

    Science.gov (United States)

    Pájaro, Manuel; Otero-Muras, Irene; Vázquez, Carlos; Alonso, Antonio A

    2018-03-01

    Gene regulation is inherently stochastic. In many applications concerning Systems and Synthetic Biology such as the reverse engineering and the de novo design of genetic circuits, stochastic effects (yet potentially crucial) are often neglected due to the high computational cost of stochastic simulations. With advances in these fields there is an increasing need of tools providing accurate approximations of the stochastic dynamics of gene regulatory networks (GRNs) with reduced computational effort. This work presents SELANSI (SEmi-LAgrangian SImulation of GRNs), a software toolbox for the simulation of stochastic multidimensional gene regulatory networks. SELANSI exploits intrinsic structural properties of gene regulatory networks to accurately approximate the corresponding Chemical Master Equation with a partial integral differential equation that is solved by a semi-lagrangian method with high efficiency. Networks under consideration might involve multiple genes with self and cross regulations, in which genes can be regulated by different transcription factors. Moreover, the validity of the method is not restricted to a particular type of kinetics. The tool offers total flexibility regarding network topology, kinetics and parameterization, as well as simulation options. SELANSI runs under the MATLAB environment, and is available under GPLv3 license at https://sites.google.com/view/selansi. antonio@iim.csic.es. © The Author(s) 2017. Published by Oxford University Press.

  18. Genetic polymorphism in FOXP3 gene: imbalance in regulatory T ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 92; Issue 1. Genetic polymorphism in FOXP3 gene: imbalance in regulatory T-cell role and development of human diseases. Julie Massayo Maeda Oda Bruna Karina Banin Hirata Roberta Losi Guembarovski Maria Angelica Ehara Watanabe. Review Article Volume 92 Issue 1 ...

  19. Global Regulatory Differences for Gene- and Cell-Based Therapies

    DEFF Research Database (Denmark)

    Coppens, Delphi G M; De Bruin, Marie L; Leufkens, Hubert G M

    2017-01-01

    Gene- and cell-based therapies (GCTs) offer potential new treatment options for unmet medical needs. However, the use of conventional regulatory requirements for medicinal products to approve GCTs may impede patient access and therapeutic innovation. Furthermore, requirements differ between juris...

  20. The naked endosperm genes encode duplicate INDETERMINATE domain transcription factors required for maize endosperm cell patterning and differentiation.

    Science.gov (United States)

    Yi, Gibum; Neelakandan, Anjanasree K; Gontarek, Bryan C; Vollbrecht, Erik; Becraft, Philip W

    2015-02-01

    The aleurone is the outermost layer of cereal endosperm and functions to digest storage products accumulated in starchy endosperm cells as well as to confer important dietary health benefits. Whereas normal maize (Zea mays [Zm]) has a single aleurone layer, naked endosperm (nkd) mutants produce multiple outer cell layers of partially differentiated cells that show sporadic expression of aleurone identity markers such as a viviparous1 promoter-β-glucuronidase transgene. The 15:1 F2 segregation ratio suggested that two recessive genes were involved, and map-based cloning identified two homologous genes in duplicated regions of the genome. The nkd1 and nkd2 genes encode the INDETERMINATE1 domain (IDD) containing transcription factors ZmIDDveg9 and ZmIDD9 on chromosomes 2 and 10, respectively. Independent mutant alleles of nkd1 and nkd2, as well as nkd2-RNA interference lines in which both nkd genes were knocked down, also showed the nkd mutant phenotype, confirming the gene identities. In wild-type kernels, the nkd transcripts were most abundant around 11 to 16 d after pollination. The NKD proteins have putative nuclear localization signals, and green fluorescent protein fusion proteins showed nuclear localization. The mutant phenotype and gene identities suggest that NKD controls a gene regulatory network involved in aleurone cell fate specification and cell differentiation. © 2015 American Society of Plant Biologists. All Rights Reserved.

  1. The Type Three Secretion System 2-Encoded Regulator EtrB Modulates Enterohemorrhagic Escherichia coli Virulence Gene Expression.

    Science.gov (United States)

    Luzader, Deborah H; Willsey, Graham G; Wargo, Matthew J; Kendall, Melissa M

    2016-09-01

    Enterohemorrhagic Escherichia coli O157:H7 (EHEC) is a foodborne pathogen that causes bloody diarrhea and hemolytic uremic syndrome throughout the world. A defining feature of EHEC pathogenesis is the formation of attaching and effacing (AE) lesions on colonic epithelial cells. Most of the genes that code for AE lesion formation, including a type three secretion system (T3SS) and effectors, are carried within a chromosomal pathogenicity island called the locus of enterocyte effacement (LEE). In this study, we report that a putative regulator, which is encoded in the cryptic E. coli type three secretion system 2 (ETT2) locus and herein renamed EtrB, plays an important role in EHEC pathogenesis. The etrB gene is expressed as a monocistronic transcript, and EtrB autoregulates expression. We provide evidence that EtrB directly interacts with the ler regulatory region to activate LEE expression and promote AE lesion formation. Additionally, we mapped the EtrB regulatory circuit in EHEC to determine a global role for EtrB. EtrB is regulated by the transcription factor QseA, suggesting that these proteins comprise a regulatory circuit important for EHEC colonization of the gastrointestinal tract. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  2. ISOLATION AND CHARACTERIZATION OF THE RAT GENE ENCODING GLUTAMATE-DEHYDROGENASE

    NARCIS (Netherlands)

    DAS, AT; ARNBERG, AC; MALINGRE, H; MOERER, P; CHARLES, R; MOORMAN, AFM; LAMERS, WH

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  3. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  4. Isolation and characterization of the rat glutamine synthetase-encoding gene

    NARCIS (Netherlands)

    van de Zande, L.; Labruyère, W. T.; Arnberg, A. C.; Wilson, R. H.; van den Bogaert, A. J.; Das, A. T.; van Oorschot, D. A.; Frijters, C.; Charles, R.; Moorman, A. F.

    1990-01-01

    From a rat genomic library in phage lambda Charon4A, a complete glutamine synthetase-encoding gene was isolated. The gene is 9.5-10 kb long, consists of seven exons, and codes for two mRNA species of 1375 nucleotides (nt) and 2787 nt, respectively. For both mRNAs, full-length cDNAs containing a

  5. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...... analysis established the subunit Mr as 43,500. Primer extension analysis indicated the presence of an adequate Pribnow box and suggested that the transcript contained a 110-base leader sequence. Strains harboring the gsk gene on multicopy plasmids overexpressed both guanosine and inosine kinase activities...

  6. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... is provided by a competitively coamplified DNA standard constructed by point mutation PCR. A single base difference was introduced to achieve a suitable migration difference in TGGE between the original target DNA and the modified standard without altering the PCR amplification efficiency. This competitive...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  7. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  8. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  9. Molecular evolution of genes encoding ribonucleases in ruminant species

    NARCIS (Netherlands)

    Confalone, E; Beintema, JJ; Sasso, MP; Carsana, A; Palmieri, M; Vento, MT; Furia, A

    1995-01-01

    Phylogenetic analysis, based on the primary structures of mammalian pancreatic-type ribonucleases, indicated that gene duplication events, which occurred during the evolution of ancestral ruminants, gave rise to the three paralogous enzymes present in the bovine species. Herein we report data that

  10. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous impact on crop productivity. To survive under unfavourable conditions, plants have developed a variety of sophisticated strategies (Bray 1997; Thomashow. 1999). One of the fundamental properties of adaptive mechanisms is that a gene must be ...

  11. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  12. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    Jane

    2011-04-06

    Apr 6, 2011 ... This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from. Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for.

  13. Association between GH encoding gene polymorphism and semen ...

    African Journals Online (AJOL)

    The objective of this present study was to investigate relationships between the growth hormone gene restriction fragment length polymorphism (RFLP) and bull sperm characteristics. A total of 89 bulls from two semen evaluation stations were genotyped for the bovine growth hormone (bGH)-AluI polymorphism by ...

  14. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    detoxification enzymes (glutathione S-transferase, soluble epoxide hydrolase, catalase and superoxide dismutase). The second group contains protein factors involved in the regulation of signal transduction and gene expression, which probably function in stress responses such as protein kinases, transcription factors and ...

  15. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    Escherichia coli was isolated and identified by standard cultural and biochemical methods. Pathogenicity of environmental and human isolates was determined by amplification of genes associated with virulence of E. coli, using specific primers. Of a total of 228 water and river sediment samples screened, E. coli was ...

  16. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  17. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  18. Interrogating the topological robustness of gene regulatory circuits by randomization.

    Directory of Open Access Journals (Sweden)

    Bin Huang

    2017-03-01

    Full Text Available One of the most important roles of cells is performing their cellular tasks properly for survival. Cells usually achieve robust functionality, for example, cell-fate decision-making and signal transduction, through multiple layers of regulation involving many genes. Despite the combinatorial complexity of gene regulation, its quantitative behavior has been typically studied on the basis of experimentally verified core gene regulatory circuitry, composed of a small set of important elements. It is still unclear how such a core circuit operates in the presence of many other regulatory molecules and in a crowded and noisy cellular environment. Here we report a new computational method, named random circuit perturbation (RACIPE, for interrogating the robust dynamical behavior of a gene regulatory circuit even without accurate measurements of circuit kinetic parameters. RACIPE generates an ensemble of random kinetic models corresponding to a fixed circuit topology, and utilizes statistical tools to identify generic properties of the circuit. By applying RACIPE to simple toggle-switch-like motifs, we observed that the stable states of all models converge to experimentally observed gene state clusters even when the parameters are strongly perturbed. RACIPE was further applied to a proposed 22-gene network of the Epithelial-to-Mesenchymal Transition (EMT, from which we identified four experimentally observed gene states, including the states that are associated with two different types of hybrid Epithelial/Mesenchymal phenotypes. Our results suggest that dynamics of a gene circuit is mainly determined by its topology, not by detailed circuit parameters. Our work provides a theoretical foundation for circuit-based systems biology modeling. We anticipate RACIPE to be a powerful tool to predict and decode circuit design principles in an unbiased manner, and to quantitatively evaluate the robustness and heterogeneity of gene expression.

  19. Gene Regulatory Network Reconstruction Using Conditional Mutual Information

    Directory of Open Access Journals (Sweden)

    Xiaodong Wang

    2008-06-01

    Full Text Available The inference of gene regulatory network from expression data is an important area of research that provides insight to the inner workings of a biological system. The relevance-network-based approaches provide a simple and easily-scalable solution to the understanding of interaction between genes. Up until now, most works based on relevance network focus on the discovery of direct regulation using correlation coefficient or mutual information. However, some of the more complicated interactions such as interactive regulation and coregulation are not easily detected. In this work, we propose a relevance network model for gene regulatory network inference which employs both mutual information and conditional mutual information to determine the interactions between genes. For this purpose, we propose a conditional mutual information estimator based on adaptive partitioning which allows us to condition on both discrete and continuous random variables. We provide experimental results that demonstrate that the proposed regulatory network inference algorithm can provide better performance when the target network contains coregulated and interactively regulated genes.

  20. Heart morphogenesis gene regulatory networks revealed by temporal expression analysis.

    Science.gov (United States)

    Hill, Jonathon T; Demarest, Bradley; Gorsi, Bushra; Smith, Megan; Yost, H Joseph

    2017-10-01

    During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks (GRNs) driving this phase of heart development, during which many congenital heart disease malformations likely arise, we conducted an RNA-seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern, identified transcription factor binding motifs enriched in each cluster, and generated a model GRN for the major gene batteries in heart morphogenesis. This approach predicted hundreds of regulatory interactions and found batteries enriched in specific cell and tissue types, indicating that the approach can be used to narrow the search for novel genetic markers and regulatory interactions. Subsequent analyses confirmed the GRN using two mutants, Tbx5 and nkx2-5 , and identified sets of duplicated zebrafish genes that do not show temporal subfunctionalization. This dataset provides an essential resource for future studies on the genetic/epigenetic pathways implicated in congenital heart defects and the mechanisms of cardiac transcriptional regulation. © 2017. Published by The Company of Biologists Ltd.

  1. A Consensus Network of Gene Regulatory Factors in the Human Frontal Lobe

    Science.gov (United States)

    Berto, Stefano; Perdomo-Sabogal, Alvaro; Gerighausen, Daniel; Qin, Jing; Nowick, Katja

    2016-01-01

    Cognitive abilities, such as memory, learning, language, problem solving, and planning, involve the frontal lobe and other brain areas. Not much is known yet about the molecular basis of cognitive abilities, but it seems clear that cognitive abilities are determined by the interplay of many genes. One approach for analyzing the genetic networks involved in cognitive functions is to study the coexpression networks of genes with known importance for proper cognitive functions, such as genes that have been associated with cognitive disorders like intellectual disability (ID) or autism spectrum disorders (ASD). Because many of these genes are gene regulatory factors (GRFs) we aimed to provide insights into the gene regulatory networks active in the human frontal lobe. Using genome wide human frontal lobe expression data from 10 independent data sets, we first derived 10 individual coexpression networks for all GRFs including their potential target genes. We observed a high level of variability among these 10 independently derived networks, pointing out that relying on results from a single study can only provide limited biological insights. To instead focus on the most confident information from these 10 networks we developed a method for integrating such independently derived networks into a consensus network. This consensus network revealed robust GRF interactions that are conserved across the frontal lobes of different healthy human individuals. Within this network, we detected a strong central module that is enriched for 166 GRFs known to be involved in brain development and/or cognitive disorders. Interestingly, several hubs of the consensus network encode for GRFs that have not yet been associated with brain functions. Their central role in the network suggests them as excellent new candidates for playing an essential role in the regulatory network of the human frontal lobe, which should be investigated in future studies. PMID:27014338

  2. A scalable algorithm for structure identification of complex gene regulatory network from temporal expression data.

    Science.gov (United States)

    Gui, Shupeng; Rice, Andrew P; Chen, Rui; Wu, Liang; Liu, Ji; Miao, Hongyu

    2017-01-31

    Gene regulatory interactions are of fundamental importance to various biological functions and processes. However, only a few previous computational studies have claimed success in revealing genome-wide regulatory landscapes from temporal gene expression data, especially for complex eukaryotes like human. Moreover, recent work suggests that these methods still suffer from the curse of dimensionality if a network size increases to 100 or higher. Here we present a novel scalable algorithm for identifying genome-wide gene regulatory network (GRN) structures, and we have verified the algorithm performances by extensive simulation studies based on the DREAM challenge benchmark data. The highlight of our method is that its superior performance does not degenerate even for a network size on the order of 10 4 , and is thus readily applicable to large-scale complex networks. Such a breakthrough is achieved by considering both prior biological knowledge and multiple topological properties (i.e., sparsity and hub gene structure) of complex networks in the regularized formulation. We also validate and illustrate the application of our algorithm in practice using the time-course gene expression data from a study on human respiratory epithelial cells in response to influenza A virus (IAV) infection, as well as the CHIP-seq data from ENCODE on transcription factor (TF) and target gene interactions. An interesting finding, owing to the proposed algorithm, is that the biggest hub structures (e.g., top ten) in the GRN all center at some transcription factors in the context of epithelial cell infection by IAV. The proposed algorithm is the first scalable method for large complex network structure identification. The GRN structure identified by our algorithm could reveal possible biological links and help researchers to choose which gene functions to investigate in a biological event. The algorithm described in this article is implemented in MATLAB Ⓡ , and the source code is freely

  3. The first gene in the Escherichia coli secA operon, gene X, encodes a nonessential secretory protein.

    OpenAIRE

    Rajapandi, T; Dolan, K M; Oliver, D B

    1991-01-01

    TnphoA insertions in the first gene of the Escherichia coli secA operon, gene X, were isolated and analyzed. Studies of the Gene X-PhoA fusion proteins showed that gene X encodes a secretory protein, since the fusion proteins possessed normal alkaline phosphatase activity and a substantial portion of this activity was found in the periplasm. In addition, the Gene X-PhoA fusion proteins were initially synthesized with a cleavable signal peptide. A gene X::TnphoA insertion was used to construct...

  4. Portrait of Candida Species Biofilm Regulatory Network Genes.

    Science.gov (United States)

    Araújo, Daniela; Henriques, Mariana; Silva, Sónia

    2017-01-01

    Most cases of candidiasis have been attributed to Candida albicans, but Candida glabrata, Candida parapsilosis and Candida tropicalis, designated as non-C. albicans Candida (NCAC), have been identified as frequent human pathogens. Moreover, Candida biofilms are an escalating clinical problem associated with significant rates of mortality. Biofilms have distinct developmental phases, including adhesion/colonisation, maturation and dispersal, controlled by complex regulatory networks. This review discusses recent advances regarding Candida species biofilm regulatory network genes, which are key components for candidiasis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Identification, characterization and analysis of expression of gene encoding carboxypeptidase A in Anopheles culicifacies A (Diptera: culicidae).

    Science.gov (United States)

    Kumar, Ashwani; Sharma, Arvind; Sharma, Richa; Gakhar, S K

    2014-11-01

    Carboxypeptidases are the digestive enzymes which cleave single amino acid residue from c-terminus of the protein. Digestive carboxypeptidase A gene regulatory elements in insects have shown their efficiency to drive midgut specific expression in transgenic mosquitoes. However no endogenous promoter has been reported for Indian malaria vector Anopheles culicifacies which is major vector in Indian subcontinent. Here we report cloning of carboxypeptidase A gene in the An. culicifacies A including its 5' upstream regions and named AcCP. In the upstream region of the gene an arthropod initiator sequence and two repeat sequences of the particular importance TTATC and GTTTT were also identified. The 1290 base pairs open reading frame encodes a protein of 48.5kDa. The coding region of the gene shares 82% and 72% similarity at nucleotide level with Anopheles gambiae and Ae. aegypti carboxypeptidase A gene, respectively. The peak expression of the gene was found to be at 3h after blood feeding and this is limited to midgut only. Based on the protein sequence, 3D structure of the AcCP was predicted and the active centre of the enzyme was predicted to consist of GLN 183, GLU 186, HIS 308 and Ser 309 amino acid residues. Comparison of the protein sequence among different genera revealed the conservation of zinc binding residues. Phylogenetically, AcCP was found most closely related to An. gambiae. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  7. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    Science.gov (United States)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

    2016-06-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  8. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Science.gov (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  9. A new cotton SDR family gene encodes a polypeptide possessing aldehyde reductase and 3-ketoacyl-CoA reductase activities.

    Science.gov (United States)

    Pang, Yu; Song, Wen-Qiang; Chen, Fang-Yuan; Qin, Yong-Mei

    2010-03-01

    To understand regulatory mechanisms of cotton fiber development, microarray analysis has been performed for upland cotton (Gossypium hirsutum). Based on this, a cDNA (GhKCR3) encoding a polypeptide belonging to short-chain alcohol dehydrogenase/reductase family was isolated and cloned. It contains an open reading frame of 987 bp encoding a polypeptide of 328 amino acid residues. Following its overexpression in bacterial cells, the purified recombinant protein specifically uses NADPH to reduce a variety of short-chain aldehydes. A fragment between Gly180 and Gly191 was found to be essential for its catalytic activity. Though the GhKCR3 gene shares low sequence similarities to the ortholog of Saccharomyces cerevisiae YBR159w that encodes 3-ketoacyl-CoA reductase (KCR) catalyzing the second step of fatty acid elongation, it was surprisingly able to complement the yeast ybr159wDelta mutant. Gas chromatography-mass spectrometry analysis showed that very long-chain fatty acids, especially C26:0, were produced in the ybr159wDelta mutant cells expressing GhKCR3. Applying palmitoyl-CoA and malonyl-CoA as substrates, GhKCR3 showed KCR activity in vitro. Quantitative real time-PCR analysis indicated GhKCR3 transcripts accumulated in rapidly elongating fibers, roots, and stems. Our results suggest that GhKCR3 is probably a novel KCR contributing to very long-chain fatty acid biosynthesis in plants.

  10. Singular Perturbation Analysis and Gene Regulatory Networks with Delay

    Science.gov (United States)

    Shlykova, Irina; Ponosov, Arcady

    2009-09-01

    There are different ways of how to model gene regulatory networks. Differential equations allow for a detailed description of the network's dynamics and provide an explicit model of the gene concentration changes over time. Production and relative degradation rate functions used in such models depend on the vector of steeply sloped threshold functions which characterize the activity of genes. The most popular example of the threshold functions comes from the Boolean network approach, where the threshold functions are given by step functions. The system of differential equations becomes then piecewise linear. The dynamics of this system can be described very easily between the thresholds, but not in the switching domains. For instance this approach fails to analyze stationary points of the system and to define continuous solutions in the switching domains. These problems were studied in [2], [3], but the proposed model did not take into account a time delay in cellular systems. However, analysis of real gene expression data shows a considerable number of time-delayed interactions suggesting that time delay is essential in gene regulation. Therefore, delays may have a great effect on the dynamics of the system presenting one of the critical factors that should be considered in reconstruction of gene regulatory networks. The goal of this work is to apply the singular perturbation analysis to certain systems with delay and to obtain an analog of Tikhonov's theorem, which provides sufficient conditions for constracting the limit system in the delay case.

  11. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  12. Design of experiment for nonlinear dynamic gene regulatory network identification.

    Science.gov (United States)

    Lu, Tao

    2017-04-04

    The gene regulatory network (GRN) is critical for understanding the regulatory interaction between genes. Time-course microarray experiments provide ample information for constructing GRN. The designs for microarray experiments serve different purposes. However, the experiment design specifically for GRN identification is still sparse. In this article, we use a simulation-based approach to deal with design problems in the framework of nonparametric differential equations. We investigate a number of feasible designs. In particular, we evaluate whether earlier samplings can result in more useful information for GRN identification. We also evaluate the effectiveness of two strategies: more frequent samplings per replicate with fewer replicates versus fewer samplings per replicate with more replicates while keeping the total number of samplings constant. The results of our investigation provide quantitative guidance for designing and selecting microarray experiments for the purpose of GRN identification.

  13. Establishing neural crest identity: a gene regulatory recipe

    Science.gov (United States)

    Simões-Costa, Marcos; Bronner, Marianne E.

    2015-01-01

    The neural crest is a stem/progenitor cell population that contributes to a wide variety of derivatives, including sensory and autonomic ganglia, cartilage and bone of the face and pigment cells of the skin. Unique to vertebrate embryos, it has served as an excellent model system for the study of cell behavior and identity owing to its multipotency, motility and ability to form a broad array of cell types. Neural crest development is thought to be controlled by a suite of transcriptional and epigenetic inputs arranged hierarchically in a gene regulatory network. Here, we examine neural crest development from a gene regulatory perspective and discuss how the underlying genetic circuitry results in the features that define this unique cell population. PMID:25564621

  14. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  15. Evolution of regulatory genes governing biodegradation in acinetobacter calcoaceticus. Final report, 15 July 1991-31 December 1994

    Energy Technology Data Exchange (ETDEWEB)

    Ornston, L.N.

    1995-02-22

    The Acinetobacter calcoaceticus pca-qui-pob supraoperonic gene cluster encodes bacterial enzymes that metabolize aromatic and hydroaromatic compounds in the environment. Our investigation is directed to understanding how mutation, gene rearrangement and selection contributed to evolution of the transcriptional controls exercised over genes in the cluster. The complete nucleotide sequence of the 18 kbp gene cluster has been determined, and genetic manipulations have been used to explore mechanisms contributing to expression of the genes. The results reveal that structural gene expression is governed by complex interactions between the products of different regulatory genes some of which share common ancestry. Additional controls appear to be exercised by compartmentation of some catabolic enzymes outside the inner cell membrane. Recombination appears to have made a major contribution to the evolution of existing control mechanisms, and their maintenance may be influence by continuing recombination. Contributions of recombination to mutation and repair are under investigation as are specific molecular mechanisms underlying transcriptional controls.

  16. Genetics and Molecular Biology of Epstein-Barr Virus-Encoded BART MicroRNA: A Paradigm for Viral Modulation of Host Immune Response Genes and Genome Stability

    Directory of Open Access Journals (Sweden)

    David H. Dreyfus

    2017-01-01

    Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.

  17. An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response.

    Science.gov (United States)

    Buckley, Katherine M; Rast, Jonathan P

    2017-01-01

    The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN) approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17), are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism.

  18. An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response

    Directory of Open Access Journals (Sweden)

    Katherine M. Buckley

    2017-10-01

    Full Text Available The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17, are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism.

  19. PREVALENCE OF TOXIN ENCODING GENES IN ESCHERICHIACOLI ISOLATES FROM URINARY TRACT INFECTIONS INSLOVENIA

    Directory of Open Access Journals (Sweden)

    Marjanca Starčič-Erjavec

    2008-06-01

    Full Text Available Methods 110 uropathogenic Escherichia coli strains (UPEC obtained from the Institute of Microbiology and Immunology of the Medical Faculty in Ljubljana were screened by PCR withprimers specific for the following toxin encoding genes: hlyA (haemolysin, cnf1 (cytotoxicnecrotising factor 1, usp (uropathogenic specific protein USP and ibeA (invasin. Dotblot hybridisation experiments were performed to validate the PCR assays.Results In 44% of the strains usp gene sequences were detected. The prevalence of hlyA and cnf1was 25% and 23%, respectively. Only 9% of the strains harbored ibeA. The majority of thetested toxin encoding genes was found in strains belonging to the B2 phylogenetic group.Conclusions The toxin encoding genes hlyA, cnf1 and usp were strongly co-associated. Further, we founda statistically significant co-association of ibeA and usp. The prevalence of the testedtoxin encoding genes in E. coli strains from urinary tract infections isolated in Slovenia iscomparable to those from studies in other geographic regions.

  20. Identification of a conserved cluster of skin-specific genes encoding secreted proteins.

    Science.gov (United States)

    Moffatt, Pierre; Salois, Patrick; St-Amant, Natalie; Gaumond, Marie-Hélène; Lanctôt, Christian

    2004-06-09

    Terminal differentiation of keratinocytes results in the formation of a cornified layer composed of cross-linked intracellular and extracellular material. Using a signal trap expression screening strategy, we have identified four cDNAs encoding secreted proteins potentially involved in this process. One of the cDNAs is identical to the short isoform of suprabasin, a recently described epidermis-specific protein, which is shown here to contain a functional secretory signal. The second cDNA, sk89, encodes a protein of 493 amino acids, rich in glycine and serine residues. The third cDNA encodes a C-terminal fragment of SK89 (amino acids 410-493). It comprises exons 13 to 18 of the sk89 locus but transcription starts at an isoform-specific exon encoding a distinct secretory signal. The fourth cDNA encodes keratinocyte differentiation-associated protein (KDAP), a precursor protein of 102 amino acids. Subcellular localization by immunofluorescence and detection of the tagged proteins by Western blotting confirmed that the four proteins are secreted. Northern analysis and in situ hybridization revealed that expression of the corresponding genes was restricted to the suprabasal keratinocytes of the epidermis. These genes encoding epidermis-specific secreted products are found in a conserved cluster on human chromosome 19q13.12 and on mouse chromosome 7A3.

  1. LEA (Late Embryogenesis Abundant proteins and their encoding genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Hincha Dirk K

    2008-03-01

    Full Text Available Abstract Background LEA (late embryogenesis abundant proteins have first been described about 25 years ago as accumulating late in plant seed development. They were later found in vegetative plant tissues following environmental stress and also in desiccation tolerant bacteria and invertebrates. Although they are widely assumed to play crucial roles in cellular dehydration tolerance, their physiological and biochemical functions are largely unknown. Results We present a genome-wide analysis of LEA proteins and their encoding genes in Arabidopsis thaliana. We identified 51 LEA protein encoding genes in the Arabidopsis genome that could be classified into nine distinct groups. Expression studies were performed on all genes at different developmental stages, in different plant organs and under different stress and hormone treatments using quantitative RT-PCR. We found evidence of expression for all 51 genes. There was only little overlap between genes expressed in vegetative tissues and in seeds and expression levels were generally higher in seeds. Most genes encoding LEA proteins had abscisic acid response (ABRE and/or low temperature response (LTRE elements in their promoters and many genes containing the respective promoter elements were induced by abscisic acid, cold or drought. We also found that 33% of all Arabidopsis LEA protein encoding genes are arranged in tandem repeats and that 43% are part of homeologous pairs. The majority of LEA proteins were predicted to be highly hydrophilic and natively unstructured, but some were predicted to be folded. Conclusion The analyses indicate a wide range of sequence diversity, intracellular localizations, and expression patterns. The high fraction of retained duplicate genes and the inferred functional diversification indicate that they confer an evolutionary advantage for an organism under varying stressful environmental conditions. This comprehensive analysis will be an important starting point for

  2. Comparison of evolutionary algorithms in gene regulatory network model inference.

    LENUS (Irish Health Repository)

    2010-01-01

    ABSTRACT: BACKGROUND: The evolution of high throughput technologies that measure gene expression levels has created a data base for inferring GRNs (a process also known as reverse engineering of GRNs). However, the nature of these data has made this process very difficult. At the moment, several methods of discovering qualitative causal relationships between genes with high accuracy from microarray data exist, but large scale quantitative analysis on real biological datasets cannot be performed, to date, as existing approaches are not suitable for real microarray data which are noisy and insufficient. RESULTS: This paper performs an analysis of several existing evolutionary algorithms for quantitative gene regulatory network modelling. The aim is to present the techniques used and offer a comprehensive comparison of approaches, under a common framework. Algorithms are applied to both synthetic and real gene expression data from DNA microarrays, and ability to reproduce biological behaviour, scalability and robustness to noise are assessed and compared. CONCLUSIONS: Presented is a comparison framework for assessment of evolutionary algorithms, used to infer gene regulatory networks. Promising methods are identified and a platform for development of appropriate model formalisms is established.

  3. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  4. A Gene Selection Method for Microarray Data Based on Binary PSO Encoding Gene-to-Class Sensitivity Information.

    Science.gov (United States)

    Han, Fei; Yang, Chun; Wu, Ya-Qi; Zhu, Jian-Sheng; Ling, Qing-Hua; Song, Yu-Qing; Huang, De-Shuang

    2017-01-01

    Traditional gene selection methods for microarray data mainly considered the features' relevance by evaluating their utility for achieving accurate predication or exploiting data variance and distribution, and the selected genes were usually poorly explicable. To improve the interpretability of the selected genes as well as prediction accuracy, an improved gene selection method based on binary particle swarm optimization (BPSO) and prior information is proposed in this paper. In the proposed method, BPSO encoding gene-to-class sensitivity (GCS) information is used to perform gene selection. The gene-to-class sensitivity information, extracted from the samples by extreme learning machine (ELM), is encoded into the selection process in four aspects: initializing particles, updating the particles, modifying maximum velocity, and adopting mutation operation adaptively. Constrained by the gene-to-class sensitivity information, the new method can select functional gene subsets which are significantly sensitive to the samples' classes. With the few discriminative genes selected by the proposed method, ELM, K-nearest neighbor and support vector machine classifiers achieve much high prediction accuracy on five public microarray data, which in turn verifies the efficiency and effectiveness of the proposed gene selection method.

  5. Comparative structural and functional analysis of genes encoding pectin methylesterases in Phytophthora spp.

    Science.gov (United States)

    Mingora, Christina; Ewer, Jason; Ospina-Giraldo, Manuel

    2014-03-15

    We have scanned the Phytophthora infestans, P. ramorum, and P. sojae genomes for the presence of putative pectin methylesterase genes and conducted a sequence analysis of all gene models found. We also searched for potential regulatory motifs in the promoter region of the proposed P. infestans models, and investigated the gene expression levels throughout the course of P. infestans infection on potato plants, using in planta and detached leaf assays. We found that genes located on contiguous chromosomal regions contain similar motifs in the promoter region, indicating the possibility of a shared regulatory mechanism. Results of our investigations also suggest that, during the pathogenicity process, the expression levels of some of the analyzed genes vary considerably when compared to basal expression observed in in vitro cultures of non-sporulating mycelium. These results were observed both in planta and in detached leaf assays. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. DNA methylation status of nuclear-encoded mitochondrial genes underlies the tissue-dependent mitochondrial functions

    Directory of Open Access Journals (Sweden)

    Takasugi Masaki

    2010-08-01

    Full Text Available Abstract Background Mitochondria are semi-autonomous, semi-self-replicating organelles harboring their own DNA (mitochondrial DNA, mtDNA, and their dysregulation is involved in the development of various diseases. While mtDNA does not generally undergo epigenetic modifications, almost all mitochondrial proteins are encoded by nuclear DNA. However, the epigenetic regulation of nuclear-encoded mitochondrial genes (nuclear mt genes has not been comprehensively analyzed. Results We analyzed the DNA methylation status of 899 nuclear mt genes in the liver, brain, and heart tissues of mouse, and identified 636 nuclear mt genes carrying tissue-dependent and differentially methylated regions (T-DMRs. These nuclar mt genes are involved in various mitochondrial functions and they also include genes related to human diseases. T-DMRs regulate the expression of nuclear mt genes. Nuclear mt genes with tissue-specific hypomethylated T-DMRs were characterized by enrichment of the target genes of specific transcription factors such as FOXA2 in the liver, and CEBPA and STAT1 in the brain. Conclusions A substantial proportion of nuclear mt genes contained T-DMRs, and the DNA methylation status of numerous T-DMRs should underlie tissue-dependent mitochondrial functions.

  7. The gene encoding topoisomerase I from the human malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Tosh, K; Kilbey, B

    1995-09-22

    Part of the topoisomerase I (TopoI)-encoding gene from Plasmodium falciparum (Pf) was isolated by PCR from cDNA using oligodeoxyribonucleotides modelled on the highly conserved regions of sequence from other species. The entire TopoI gene was obtained by screening a Pf K1 HindIII-EcoRI genomic library in lambda NM1149 with a random-labeled heterologous probe from the Saccharomyces cerevisiae TopoI gene. DNA sequence analysis revealed an open reading frame of 2520 nt encoding a deduced protein of 839 amino acids (aa) with no detectable introns. The Pf TopoI aa sequence has about 40% identity with most eukaryotic TopoI homologues. The gene is located as a single copy on chromosome 5 and Northern analysis identified a transcript of 3.8 kb.

  8. Using GeneReg to construct time delay gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Qian Ziliang

    2010-05-01

    Full Text Available Abstract Background Understanding gene expression and regulation is essential for understanding biological mechanisms. Because gene expression profiling has been widely used in basic biological research, especially in transcription regulation studies, we have developed GeneReg, an easy-to-use R package, to construct gene regulatory networks from time course gene expression profiling data; More importantly, this package can provide information about time delays between expression change in a regulator and that of its target genes. Findings The R package GeneReg is based on time delay linear regression, which can generate a model of the expression levels of regulators at a given time point against the expression levels of their target genes at a later time point. There are two parameters in the model, time delay and regulation coefficient. Time delay is the time lag during which expression change of the regulator is transmitted to change in target gene expression. Regulation coefficient expresses the regulation effect: a positive regulation coefficient indicates activation and negative indicates repression. GeneReg was implemented on a real Saccharomyces cerevisiae cell cycle dataset; more than thirty percent of the modeled regulations, based entirely on gene expression files, were found to be consistent with previous discoveries from known databases. Conclusions GeneReg is an easy-to-use, simple, fast R package for gene regulatory network construction from short time course gene expression data. It may be applied to study time-related biological processes such as cell cycle, cell differentiation, or causal inference.

  9. Regulatory region with putA gene of proline dehydrogenase that links to the lum and the lux operons in Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Yu, K Y; Chen, H Y; Weng, S F

    1996-02-27

    Nucleotide sequence of regulatory region (R & R) with putA gene (EMBL Accession No. U39227) from Photobacterium leiognathi PL741 has been determined, and the putA gene encoded amino acid sequence of proline dehydrogenase is deduced. Alignment and comparison of proline dehydrogenase of P. leiognathi with the proline dehydrogenase domain in the PutA protein of Escherichia coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that regulatory region with the putA gene is linked to the lum and lux operons in genome; the gene order is putA--R & R(I) (R & R: regulatory region; ter:transcriptional terminator), whereas the R & R is the regulatory region for the lum and the lux operons, ter is the transcriptional terminator for the lum operon, and R & R(I) apparently is the regulatory region for the putA and related genes. Nucleotide sequence analysis illustrates the specific inverted repeat (SIR), cAMP-CRP consensus sequence, canonical -10/-35 promoter, putative operator and Shine-Dalgarno (SD) sequence on the regulatory region R & R(I) for the putA and related genes; it suggests that the putA and related genes are simply linked to the lum and the lux operons in genome, the regulatory region R & R(I) is independent for the putA and related genes.

  10. TMC and EVER genes belong to a larger novel family, the TMC gene family encoding transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Mutai Hideki

    2003-06-01

    Full Text Available Abstract Background Mutations in the transmembrane cochlear expressed gene 1 (TMC1 cause deafness in human and mouse. Mutations in two homologous genes, EVER1 and EVER2 increase the susceptibility to infection with certain human papillomaviruses resulting in high risk of skin carcinoma. Here we report that TMC1, EVER1 and EVER2 (now TMC6 and TMC8 belong to a larger novel gene family, which is named TMC for trans membrane channel-like gene family. Results Using a combination of iterative database searches and reverse transcriptase-polymerase chain reaction (RT-PCR experiments we assembled contigs for cDNA encoding human, murine, puffer fish, and invertebrate TMC proteins. TMC proteins of individual species can be grouped into three subfamilies A, B, and C. Vertebrates have eight TMC genes. The majority of murine TMC transcripts are expressed in most organs; some transcripts, however, in particular the three subfamily A members are rare and more restrictively expressed. Conclusion The eight vertebrate TMC genes are evolutionary conserved and encode proteins that form three subfamilies. Invertebrate TMC proteins can also be categorized into these three subfamilies. All TMC genes encode transmembrane proteins with intracellular amino- and carboxyl-termini and at least eight membrane-spanning domains. We speculate that the TMC proteins constitute a novel group of ion channels, transporters, or modifiers of such.

  11. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    Science.gov (United States)

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn AL; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W

    2007-01-01

    Background Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing

  12. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    Directory of Open Access Journals (Sweden)

    St Clair Dina A

    2007-10-01

    Full Text Available Abstract Background Nucleotide binding site-leucine rich repeat (NBS-LRR-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST representation, massively parallel signature sequencing (MPSS, microarray analysis, rapid amplification of cDNA ends (RACE PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH, a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for

  13. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis.

    Science.gov (United States)

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn A L; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W

    2007-10-23

    Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. We analyzed the expression patterns of approximately 170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing was

  14. Ty3 GAG3 and POL3 genes encode the components of intracellular particles.

    OpenAIRE

    Hansen, L J; Chalker, D L; Orlinsky, K J; Sandmeyer, S B

    1992-01-01

    Ty3 is a Saccharomyces cerevisiae retrotransposon that integrates near the transcription initiation sites of polymerase III-transcribed genes. It is distinct from the copialike Ty1 and Ty2 retrotransposons of S. cerevisiae in both the sequences of encoded proteins and gene order. It is a member of the gypsylike family of retrotransposons which resemble animal retroviruses. This study was undertaken to investigate the nucleocapsid particle of a transpositionally active gypsylike retrotransposo...

  15. New Integron-Associated Gene Cassette Encoding a 3-N-Aminoglycoside Acetyltransferase

    OpenAIRE

    Levings, Renee S.; Partridge, Sally R.; Lightfoot, Diane; Hall, Ruth M.; Djordjevic, Steven P.

    2005-01-01

    A fifth gene cassette containing an aacC gene, aacCA5, was found in an aacCA5-aadA7 cassette array in a class 1 integron isolated from a multiply drug resistant Salmonella enterica serovar Kentucky strain. The AacC-A5 or AAC(3)-Ie acetyltransferase encoded by aacCA5 is related to other AAC(3)-I enzymes and confers resistance to gentamicin.

  16. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol

    OpenAIRE

    Kehrenberg, Corinna; Schwarz, Stefan

    2004-01-01

    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.

  17. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  18. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    NARCIS (Netherlands)

    Choorapoikayil, S.; Kuiper, R.V.; de Bruin, A.; den Hertog, J.

    2012-01-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile.

  19. Pentocin KCA1: a novel circular bacteriocin gene encoded in the ...

    African Journals Online (AJOL)

    We isolated and carried out comprehensive genome sequence analysis of the first Lactobacillus pentosus KCA1 of human origin encoding genes for the biosynthesis of antimicrobial bacteriocin peptide. Due to the growing number of antimicrobial resistance, the need for developing alternatives to traditional antibiotics is ...

  20. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available for the efficient hydrolytic kinetic resolution of epoxides, which serve as high-value intermediates in the fine chemicals and pharmaceutical industries. Degenerate primers, based on data from available EH-encoding gene sequences, in conjunction with inverse PCR...

  1. The capacity for multistability in small gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Grotewold Erich

    2009-09-01

    Full Text Available Abstract Background Recent years have seen a dramatic increase in the use of mathematical modeling to gain insight into gene regulatory network behavior across many different organisms. In particular, there has been considerable interest in using mathematical tools to understand how multistable regulatory networks may contribute to developmental processes such as cell fate determination. Indeed, such a network may subserve the formation of unicellular leaf hairs (trichomes in the model plant Arabidopsis thaliana. Results In order to investigate the capacity of small gene regulatory networks to generate multiple equilibria, we present a chemical reaction network (CRN-based modeling formalism and describe a number of methods for CRN analysis in a parameter-free context. These methods are compared and applied to a full set of one-component subnetworks, as well as a large random sample from 40,680 similarly constructed two-component subnetworks. We find that positive feedback and cooperativity mediated by transcription factor (TF dimerization is a requirement for one-component subnetwork bistability. For subnetworks with two components, the presence of these processes increases the probability that a randomly sampled subnetwork will exhibit multiple equilibria, although we find several examples of bistable two-component subnetworks that do not involve cooperative TF-promoter binding. In the specific case of epidermal differentiation in Arabidopsis, dimerization of the GL3-GL1 complex and cooperative sequential binding of GL3-GL1 to the CPC promoter are each independently sufficient for bistability. Conclusion Computational methods utilizing CRN-specific theorems to rule out bistability in small gene regulatory networks are far superior to techniques generally applicable to deterministic ODE systems. Using these methods to conduct an unbiased survey of parameter-free deterministic models of small networks, and the Arabidopsis epidermal cell

  2. BAGE: a new gene encoding an antigen recognized on human melanomas by cytolytic T lymphocytes.

    Science.gov (United States)

    Boël, P; Wildmann, C; Sensi, M L; Brasseur, R; Renauld, J C; Coulie, P; Boon, T; van der Bruggen, P

    1995-02-01

    Several tumor antigens are recognized by autologous cytolytic T lymphocytes (CTL) on human melanoma MZ2-MEL. Some of them are encoded by genes MAGE-1 and MAGE-3, which are not expressed in normal tissues except in testis. Here, we report the identification of a new gene that codes for another of these antigens. This gene, named BAGE, codes for a putative protein of 43 aa and seems to belong to a family of several genes. The antigen recognized by the autologous CTL consists of BAGE-encoded peptide AARAVFLAL bound to an HLA-Cw 1601 molecule. Gene BAGE is expressed in 22% of melanomas, 30% of infiltrating bladder carcinomas, 10% of mammary carcinomas, 8% of head and neck squamous cell carcinomas, and 6% of non-small cell lung carcinomas. Like the MAGE genes, it is silent in normal tissues with the exception of testis. Because of its tumor-specific expression, the BAGE-encoded antigen may prove useful for cancer immunotherapy.

  3. Understanding Epistatic Interactions between Genes Targeted by Non-coding Regulatory Elements in Complex Diseases

    Directory of Open Access Journals (Sweden)

    Min Kyung Sung

    2014-12-01

    Full Text Available Genome-wide association studies have proven the highly polygenic architecture of complex diseases or traits; therefore, single-locus-based methods are usually unable to detect all involved loci, especially when individual loci exert small effects. Moreover, the majority of associated single-nucleotide polymorphisms resides in non-coding regions, making it difficult to understand their phenotypic contribution. In this work, we studied epistatic interactions associated with three common diseases using Korea Association Resource (KARE data: type 2 diabetes mellitus (DM, hypertension (HT, and coronary artery disease (CAD. We showed that epistatic single-nucleotide polymorphisms (SNPs were enriched in enhancers, as well as in DNase I footprints (the Encyclopedia of DNA Elements [ENCODE] Project Consortium 2012, which suggested that the disruption of the regulatory regions where transcription factors bind may be involved in the disease mechanism. Accordingly, to identify the genes affected by the SNPs, we employed whole-genome multiple-cell-type enhancer data which discovered using DNase I profiles and Cap Analysis Gene Expression (CAGE. Assigned genes were significantly enriched in known disease associated gene sets, which were explored based on the literature, suggesting that this approach is useful for detecting relevant affected genes. In our knowledge-based epistatic network, the three diseases share many associated genes and are also closely related with each other through many epistatic interactions. These findings elucidate the genetic basis of the close relationship between DM, HT, and CAD.

  4. Fused Regression for Multi-source Gene Regulatory Network Inference.

    Directory of Open Access Journals (Sweden)

    Kari Y Lam

    2016-12-01

    Full Text Available Understanding gene regulatory networks is critical to understanding cellular differentiation and response to external stimuli. Methods for global network inference have been developed and applied to a variety of species. Most approaches consider the problem of network inference independently in each species, despite evidence that gene regulation can be conserved even in distantly related species. Further, network inference is often confined to single data-types (single platforms and single cell types. We introduce a method for multi-source network inference that allows simultaneous estimation of gene regulatory networks in multiple species or biological processes through the introduction of priors based on known gene relationships such as orthology incorporated using fused regression. This approach improves network inference performance even when orthology mapping and conservation are incomplete. We refine this method by presenting an algorithm that extracts the true conserved subnetwork from a larger set of potentially conserved interactions and demonstrate the utility of our method in cross species network inference. Last, we demonstrate our method's utility in learning from data collected on different experimental platforms.

  5. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  6. Evaluation of combinatorial cis-regulatory elements for stable gene expression in chicken cells

    Directory of Open Access Journals (Sweden)

    Seo Hee W

    2010-09-01

    Full Text Available Abstract Background Recent successes in biotechnological application of birds are based on their unique physiological traits such as unlimited manipulability onto developing embryos and simple protein constituents of the eggs. However it is not likely that target protein is produced as kinetically expected because various factors affect target gene expression. Although there have been various attempts to minimize the silencing of transgenes, a generalized study that uses multiple cis-acting elements in chicken has not been made. The aim of the present study was to analyze whether various cis-acting elements can help to sustain transgene expression in chicken fibroblasts. Results We investigated the optimal transcriptional regulatory elements for enhancing stable transgene expression in chicken cells. We generated eight constructs that encode enhanced green fluorescent protein (eGFP driven by either CMV or CAG promoters (including the control, containing three types of key regulatory elements: a chicken lysozyme matrix attachment region (cMAR, 5'-DNase I-hypersensitive sites 4 (cHS4, and the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE. Then we transformed immortalized chicken embryonic fibroblasts with these constructs by electroporation, and after cells were expanded under G418 selection, analyzed mRNA levels and mean fluorescence intensity (MFI by quantitative real-time PCR and flow cytometry, respectively. We found that the copy number of each construct significantly decreased as the size of the construct increased (R2 = 0.701. A significant model effect was found in the expression level among various constructs in both mRNA and protein (P cis-acting elements decreased the level of gene silencing as well as the coefficient of variance of eGFP-expressing cells (P Conclusions Our current data show that an optimal combination of cis-acting elements and promoters/enhancers for sustaining gene expression in chicken cells

  7. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  8. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  9. The gene regulatory network for breast cancer: Integrated regulatory landscape of cancer hallmarks

    Directory of Open Access Journals (Sweden)

    Frank eEmmert-Streib

    2014-02-01

    Full Text Available In this study, we infer the breast cancer gene regulatory network from gene expression data. This network is obtained from the application of the BC3Net inference algorithm to a large-scale gene expression data set consisting of $351$ patient samples. In order to elucidate the functional relevance of the inferred network, we are performing a Gene Ontology (GO analysis for its structural components. Our analysis reveals that most significant GO-terms we find for the breast cancer network represent functional modules of biological processes that are described by known cancer hallmarks, including translation, immune response, cell cycle, organelle fission, mitosis, cell adhesion, RNA processing, RNA splicing and response to wounding. Furthermore, by using a curated list of census cancer genes, we find an enrichment in these functional modules. Finally, we study cooperative effects of chromosomes based on information of interacting genes in the beast cancer network. We find that chromosome $21$ is most coactive with other chromosomes. To our knowledge this is the first study investigating the genome-scale breast cancer network.

  10. Cloning of Lab Gene Encoding Bacteriocin From Pediococcus acidilactici Fil Into Escherichia coli DH5a

    OpenAIRE

    Margono, Sebastian; Wijaya, Agus; Rahayu, Endang S.

    2017-01-01

    Pediococcus acidilactici F11 is able to inhibit the growth of related species of enterobacteriaceae by secreting bacteriocin. Effort to increase bacteriocin production by transforming lab gene encoding bacteriocin from P. acidilactici Fl 1 into E. colt DH5a was carried out. Plasmid pPAF11 (encoding bacteriocin from P. acidilactici F11) and p13C19 as vector which were double-digested with Madill and BamHI, ligated, and transformed into E. colt DH5a. White colonies, as indicator of transformant...

  11. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    Directory of Open Access Journals (Sweden)

    A.V. Karlyshev

    2014-01-01

    Full Text Available According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection.

  12. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  13. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...

  14. Transcriptional regulatory networks underlying gene expression changes in Huntington's disease.

    Science.gov (United States)

    Ament, Seth A; Pearl, Jocelynn R; Cantle, Jeffrey P; Bragg, Robert M; Skene, Peter J; Coffey, Sydney R; Bergey, Dani E; Wheeler, Vanessa C; MacDonald, Marcy E; Baliga, Nitin S; Rosinski, Jim; Hood, Leroy E; Carroll, Jeffrey B; Price, Nathan D

    2018-03-26

    Transcriptional changes occur presymptomatically and throughout Huntington's disease (HD), motivating the study of transcriptional regulatory networks (TRNs) in HD We reconstructed a genome-scale model for the target genes of 718 transcription factors (TFs) in the mouse striatum by integrating a model of genomic binding sites with transcriptome profiling of striatal tissue from HD mouse models. We identified 48 differentially expressed TF-target gene modules associated with age- and CAG repeat length-dependent gene expression changes in Htt CAG knock-in mouse striatum and replicated many of these associations in independent transcriptomic and proteomic datasets. Thirteen of 48 of these predicted TF-target gene modules were also differentially expressed in striatal tissue from human disease. We experimentally validated a specific model prediction that SMAD3 regulates HD-related gene expression changes using chromatin immunoprecipitation and deep sequencing (ChIP-seq) of mouse striatum. We found CAG repeat length-dependent changes in the genomic occupancy of SMAD3 and confirmed our model's prediction that many SMAD3 target genes are downregulated early in HD. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  15. Inferring Gene Regulatory Networks Using Conditional Regulation Pattern to Guide Candidate Genes.

    Directory of Open Access Journals (Sweden)

    Fei Xiao

    Full Text Available Combining path consistency (PC algorithms with conditional mutual information (CMI are widely used in reconstruction of gene regulatory networks. CMI has many advantages over Pearson correlation coefficient in measuring non-linear dependence to infer gene regulatory networks. It can also discriminate the direct regulations from indirect ones. However, it is still a challenge to select the conditional genes in an optimal way, which affects the performance and computation complexity of the PC algorithm. In this study, we develop a novel conditional mutual information-based algorithm, namely RPNI (Regulation Pattern based Network Inference, to infer gene regulatory networks. For conditional gene selection, we define the co-regulation pattern, indirect-regulation pattern and mixture-regulation pattern as three candidate patterns to guide the selection of candidate genes. To demonstrate the potential of our algorithm, we apply it to gene expression data from DREAM challenge. Experimental results show that RPNI outperforms existing conditional mutual information-based methods in both accuracy and time complexity for different sizes of gene samples. Furthermore, the robustness of our algorithm is demonstrated by noisy interference analysis using different types of noise.

  16. A genomic analysis of disease-resistance genes encoding nucleotide binding sites in Sorghum bicolor

    Directory of Open Access Journals (Sweden)

    Xiao Cheng

    2010-01-01

    Full Text Available A large set of candidate nucleotide-binding site (NBS-encoding genes related to disease resistance was identified in the sorghum (Sorghum bicolor genome. These resistance (R genes were characterized based on their structural diversity, physical chromosomal location and phylogenetic relationships. Based on their N-terminal motifs and leucine-rich repeats (LRR, 50 non-regular NBS genes and 224 regular NBS genes were identified in 274 candidate NBS genes. The regular NBS genes were classified into ten types: CNL, CN, CNLX, CNX, CNXL, CXN, NX, N, NL and NLX. The vast majority (97% of NBS genes occurred in gene clusters, indicating extensive gene duplication in the evolution of S. bicolor NBS genes. Analysis of the S. bicolor NBS phylogenetic tree revealed two major clades. Most NBS genes were located at the distal tip of the long arms of the ten sorghum chromosomes, a pattern significantly different from rice and Arabidopsis, the NBS genes of which have a random chromosomal distribution.

  17. Ground rules of the pluripotency gene regulatory network.

    KAUST Repository

    Li, Mo

    2017-01-03

    Pluripotency is a state that exists transiently in the early embryo and, remarkably, can be recapitulated in vitro by deriving embryonic stem cells or by reprogramming somatic cells to become induced pluripotent stem cells. The state of pluripotency, which is stabilized by an interconnected network of pluripotency-associated genes, integrates external signals and exerts control over the decision between self-renewal and differentiation at the transcriptional, post-transcriptional and epigenetic levels. Recent evidence of alternative pluripotency states indicates the regulatory flexibility of this network. Insights into the underlying principles of the pluripotency network may provide unprecedented opportunities for studying development and for regenerative medicine.

  18. Metagenomic Analysis of Apple Orchard Soil Reveals Antibiotic Resistance Genes Encoding Predicted Bifunctional Proteins▿

    Science.gov (United States)

    Donato, Justin J.; Moe, Luke A.; Converse, Brandon J.; Smart, Keith D.; Berklein, Flora C.; McManus, Patricia S.; Handelsman, Jo

    2010-01-01

    To gain insight into the diversity and origins of antibiotic resistance genes, we identified resistance genes in the soil in an apple orchard using functional metagenomics, which involves inserting large fragments of foreign DNA into Escherichia coli and assaying the resulting clones for expressed functions. Among 13 antibiotic-resistant clones, we found two genes that encode bifunctional proteins. One predicted bifunctional protein confers resistance to ceftazidime and contains a natural fusion between a predicted transcriptional regulator and a β-lactamase. Sequence analysis of the entire metagenomic clone encoding the predicted bifunctional β-lactamase revealed a gene potentially involved in chloramphenicol resistance as well as a predicted transposase. A second clone that encodes a predicted bifunctional protein confers resistance to kanamycin and contains an aminoglycoside acetyltransferase domain fused to a second acetyltransferase domain that, based on nucleotide sequence, was predicted not to be involved in antibiotic resistance. This is the first report of a transcriptional regulator fused to a β-lactamase and of an aminoglycoside acetyltransferase fused to an acetyltransferase not involved in antibiotic resistance. PMID:20453147

  19. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  20. The arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier

    Science.gov (United States)

    Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.

    1998-01-01

    Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.

  1. Characterisation of genes encoding key enzymes involved in sugar metabolism of apple fruit in controlled atmosphere storage.

    Science.gov (United States)

    Zhu, Zhu; Liu, Ruiling; Li, Boqiang; Tian, Shiping

    2013-12-15

    Sugars are essential contributors to fruit flavour. Controlled atmosphere (CA) storage has been proved to be beneficial for maintaining harvested fruit quality. To explore regulatory mechanism of sugar metabolism in fruit stored in CA condition, we cloned several genes, encoding key enzymes, involved in sugar metabolism in apple fruit, and analyzed sugar contents, along with gene expression and enzyme activities in fruits stored in air and CA. The results indicated that CA could maintain higher contents of sugars, including sucrose, fructose and glucose. Expression levels of key genes, such as sucrose synthase (SS), sucrose phosphate synthase (SPS), fructokinase (FK) and hexokinase (HK), were shown to be correlated with the corresponding enzyme activities. We found that activities of neutral invertase (NI), vacuolar invertase (VI), FK and HK were inhibited, but SPS activity was promoted in apple fruit stored in CA, suggesting that CA storage could enhance sucrose synthesis and delay hydrolysis of sucrose and hexose. These findings provided molecular evidence to explain why higher sugar levels in harvested fruit are maintained under CA storage. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Learning gene regulatory networks from gene expression data using weighted consensus

    KAUST Repository

    Fujii, Chisato

    2016-08-25

    An accurate determination of the network structure of gene regulatory systems from high-throughput gene expression data is an essential yet challenging step in studying how the expression of endogenous genes is controlled through a complex interaction of gene products and DNA. While numerous methods have been proposed to infer the structure of gene regulatory networks, none of them seem to work consistently over different data sets with high accuracy. A recent study to compare gene network inference methods showed that an average-ranking-based consensus method consistently performs well under various settings. Here, we propose a linear programming-based consensus method for the inference of gene regulatory networks. Unlike the average-ranking-based one, which treats the contribution of each individual method equally, our new consensus method assigns a weight to each method based on its credibility. As a case study, we applied the proposed consensus method on synthetic and real microarray data sets, and compared its performance to that of the average-ranking-based consensus and individual inference methods. Our results show that our weighted consensus method achieves superior performance over the unweighted one, suggesting that assigning weights to different individual methods rather than giving them equal weights improves the accuracy. © 2016 Elsevier B.V.

  3. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci.

    Science.gov (United States)

    Perumal, N; Murugesan, S; Krishnan, P

    2016-01-01

    The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs) and staphylococcal cassette chromosome mec (SCCmec) elements among clinical isolates of methicillin-resistant staphylococci (MRS). Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6')-Ie-aph (2''), aph (3')-IIIa and ant (4')-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6')-Ie-aph (2'') (55.4%) followed by aph (3')-IIIa (32.3%) and ant (4')-Ia gene (9%). SCCmec type I (34%) was predominant in this study. In conclusion, the aac (6')-Ie-aph (2'') was the most common AME gene and SCCmec type I was most predominant among the MRS isolates.

  4. Reverse Engineering of Gene Regulatory Networks: A Comparative Study

    Directory of Open Access Journals (Sweden)

    Hendrik Hache

    2009-01-01

    Full Text Available Reverse engineering of gene regulatory networks has been an intensively studied topic in bioinformatics since it constitutes an intermediate step from explorative to causative gene expression analysis. Many methods have been proposed through recent years leading to a wide range of mathematical approaches. In practice, different mathematical approaches will generate different resulting network structures, thus, it is very important for users to assess the performance of these algorithms. We have conducted a comparative study with six different reverse engineering methods, including relevance networks, neural networks, and Bayesian networks. Our approach consists of the generation of defined benchmark data, the analysis of these data with the different methods, and the assessment of algorithmic performances by statistical analyses. Performance was judged by network size and noise levels. The results of the comparative study highlight the neural network approach as best performing method among those under study.

  5. The insect metalloproteinase inhibitor gene of the lepidopteran Galleria mellonella encodes two distinct inhibitors.

    Science.gov (United States)

    Wedde, Marianne; Weise, Christoph; Nuck, Rolf; Altincicek, Boran; Vilcinskas, Andreas

    2007-01-01

    The insect metalloproteinase inhibitor (IMPI) from the greater wax moth, Galleria mellonella, represents the first and to date only specific inhibitor of microbial metalloproteinases reported from animals. Here, we report on the characterization including carbohydrate analysis of two recombinant constructs encoded by impi cDNA either upstream or downstream of the furin cleavage site identified. rIMPI-1, corresponding to native IMPI purified from hemolymph, is encoded by the N-terminal part of the impi sequence, whereas rIMPI-2 is encoded by its C-terminal part. rIMPI-1 is glycosylated at N48 with GlcNAc2Man3, showing fucosylation to different extents. Similarly, rIMPI-2 is glycosylated at N149 with GlcNAc2Man3, but is fully fucosylated. rIMPI-1 represents a promising template for the design of second-generation antibiotics owing to its specific activity against thermolysin-like metalloproteinases produced by human pathogenic bacteria such as Vibrio vulnificus. In contrast, rIMPI-2 does not inhibit bacterial metalloproteinases, but is moderately active against recombinant human matrix metalloproteinases (MMPs). Both microbial metalloproteinases and MMPs induce expression of the impi gene when injected into G. mellonella larvae. These findings provide evidence that the impi gene encodes two distinct inhibitors, one inhibiting microbial metalloproteinases and contributing to innate immunity, the other putatively mediating regulation of endogenous MMPs during metamorphosis.

  6. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  7. A multiplex PCR for detection of genes encoding exfoliative toxins from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter

    2004-01-01

    Aims: To develop a multiplex PCR for detection of genes encoding the exfoliative toxins ExhA, ExhB, ExhC and ExhD from Staphylococcus hyicus and to estimate the prevalence of exfoliative toxins among Staph. hyicus isolates from Danish pig herds with exudative epidermitis (EE). Methods and Results......: A multiplex PCR employing specific primers for each of the genes encoding four different exfoliative toxins was developed and evaluated using a collection of Staph. hyicus with known toxin type and a number of other staphylococcal species. A total of 314 Staph. hyicus isolates from pigs with EE were screened...... by multiplex PCR and the combined results of the present and previous investigations showed that ExhA, ExhB, ExhC and ExhD was found in 20, 33, 18 and 22%, respectively, of 60 cases of EE investigated. Conclusions: This study has provided a new tool for detection of toxigenic Staph. hyicus and a more...

  8. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  9. Neurogenic gene regulatory pathways in the sea urchin embryo.

    Science.gov (United States)

    Wei, Zheng; Angerer, Lynne M; Angerer, Robert C

    2016-01-15

    During embryogenesis the sea urchin early pluteus larva differentiates 40-50 neurons marked by expression of the pan-neural marker synaptotagmin B (SynB) that are distributed along the ciliary band, in the apical plate and pharyngeal endoderm, and 4-6 serotonergic neurons that are confined to the apical plate. Development of all neurons has been shown to depend on the function of Six3. Using a combination of molecular screens and tests of gene function by morpholino-mediated knockdown, we identified SoxC and Brn1/2/4, which function sequentially in the neurogenic regulatory pathway and are also required for the differentiation of all neurons. Misexpression of Brn1/2/4 at low dose caused an increase in the number of serotonin-expressing cells and at higher dose converted most of the embryo to a neurogenic epithelial sphere expressing the Hnf6 ciliary band marker. A third factor, Z167, was shown to work downstream of the Six3 and SoxC core factors and to define a branch specific for the differentiation of serotonergic neurons. These results provide a framework for building a gene regulatory network for neurogenesis in the sea urchin embryo. © 2016. Published by The Company of Biologists Ltd.

  10. DNA vaccine encoding peptide P10 against experimental paracoccidioidomycosis induces long-term protection in presence of regulatory T cells.

    Science.gov (United States)

    de Amorim, Juliana; Magalhães, Adriana; Muñoz, Julián Esteban; Rittner, Glauce M G; Nosanchuk, Joshua D; Travassos, Luiz R; Taborda, Carlos P

    2013-03-01

    Paracoccidioidomycosis is a granulomatous systemic mycosis endemic in Brazil and other Latin America countries. A DNA vaccine encoding the immunoprotective peptide 10 (P10) significantly reduced the fungal burden in mice when given prior to or after intratracheal challenge with Paracoccidioides brasiliensis. Presently, the generation/expansion of CD4+ CD44hi memory T cells as well as Foxp3+ Treg cells in mice immunized with the DNA vaccine (pcDNA3-P10) before and after infection with P. brasiliensis was investigated. Memory CD4+ CD44hi T cells simultaneously with Foxp3+ Treg cells increased in the spleens and lungs of pcDNA3-P10 immunized mice on day 0, 30, 60 and 120 postinfection. Histopathology of the lung tissue showed minimal inflammation in immunized mice compared with the unimmunized group, suggesting a role for regulatory T cells in controlling the immunopathology. The DNA vaccine shows that the repeated immunization generates memory cells and regulatory T cells that replace the initially protective pro-inflammatory T cells conferring a long term protection while preserving the integrity of the infected tissue. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  11. Structures and Boolean Dynamics in Gene Regulatory Networks

    Science.gov (United States)

    Szedlak, Anthony

    This dissertation discusses the topological and dynamical properties of GRNs in cancer, and is divided into four main chapters. First, the basic tools of modern complex network theory are introduced. These traditional tools as well as those developed by myself (set efficiency, interset efficiency, and nested communities) are crucial for understanding the intricate topological properties of GRNs, and later chapters recall these concepts. Second, the biology of gene regulation is discussed, and a method for disease-specific GRN reconstruction developed by our collaboration is presented. This complements the traditional exhaustive experimental approach of building GRNs edge-by-edge by quickly inferring the existence of as of yet undiscovered edges using correlations across sets of gene expression data. This method also provides insight into the distribution of common mutations across GRNs. Third, I demonstrate that the structures present in these reconstructed networks are strongly related to the evolutionary histories of their constituent genes. Investigation of how the forces of evolution shaped the topology of GRNs in multicellular organisms by growing outward from a core of ancient, conserved genes can shed light upon the ''reverse evolution'' of normal cells into unicellular-like cancer states. Next, I simulate the dynamics of the GRNs of cancer cells using the Hopfield model, an infinite range spin-glass model designed with the ability to encode Boolean data as attractor states. This attractor-driven approach facilitates the integration of gene expression data into predictive mathematical models. Perturbations representing therapeutic interventions are applied to sets of genes, and the resulting deviations from their attractor states are recorded, suggesting new potential drug targets for experimentation. Finally, I extend the Hopfield model to modular networks, cyclic attractors, and complex attractors, and apply these concepts to simulations of the cell cycle

  12. Sca1, a previously undescribed paralog from autotransporter protein-encoding genes in Rickettsia species

    Directory of Open Access Journals (Sweden)

    Raoult Didier

    2006-02-01

    Full Text Available Abstract Background Among the 17 genes encoding autotransporter proteins of the "surface cell antigen" (sca family in the currently sequenced Rickettsia genomes, ompA, sca5 (ompB and sca4 (gene D, have been extensively used for identification and phylogenetic purposes for Rickettsia species. However, none of these genes is present in all 20 currently validated Rickettsia species. Of the remaining 14 sca genes, sca1 is the only gene to be present in all nine sequenced Rickettsia genomes. To estimate whether the sca1 gene is present in all Rickettsia species and its usefulness as an identification and phylogenetic tool, we searched for sca1genes in the four published Rickettsia genomes and amplified and sequenced this gene in the remaining 16 validated Rickettsia species. Results Sca1 is the only one of the 17 rickettsial sca genes present in all 20 Rickettsia species. R. prowazekii and R. canadensis exhibit a split sca1 gene whereas the remaining species have a complete gene. Within the sca1 gene, we identified a 488-bp variable sequence fragment that can be amplified using a pair of conserved primers. Sequences of this fragment are specific for each Rickettsia species. The phylogenetic organization of Rickettsia species inferred from the comparison of sca1 sequences strengthens the classification based on the housekeeping gene gltA and is similar to those obtained from the analyses of ompA, sca5 and sca4, thus suggesting similar evolutionary constraints. We also observed that Sca1 protein sequences have evolved under a dual selection pressure: with the exception of typhus group rickettsiae, the amino-terminal part of the protein that encompasses the predicted passenger domain, has evolved under positive selection in rickettsiae. This suggests that the Sca1 protein interacts with the host. In contrast, the C-terminal portion containing the autotransporter domain has evolved under purifying selection. In addition, sca1 is transcribed in R. conorii

  13. Learning Gene Regulatory Networks Computationally from Gene Expression Data Using Weighted Consensus

    KAUST Repository

    Fujii, Chisato

    2015-04-16

    Gene regulatory networks analyze the relationships between genes allowing us to un- derstand the gene regulatory interactions in systems biology. Gene expression data from the microarray experiments is used to obtain the gene regulatory networks. How- ever, the microarray data is discrete, noisy and non-linear which makes learning the networks a challenging problem and existing gene network inference methods do not give consistent results. Current state-of-the-art study uses the average-ranking-based consensus method to combine and average the ranked predictions from individual methods. However each individual method has an equal contribution to the consen- sus prediction. We have developed a linear programming-based consensus approach which uses learned weights from linear programming among individual methods such that the methods have di↵erent weights depending on their performance. Our result reveals that assigning di↵erent weights to individual methods rather than giving them equal weights improves the performance of the consensus. The linear programming- based consensus method is evaluated and it had the best performance on in silico and Saccharomyces cerevisiae networks, and the second best on the Escherichia coli network outperformed by Inferelator Pipeline method which gives inconsistent results across a wide range of microarray data sets.

  14. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol

    Science.gov (United States)

    Kehrenberg, Corinna; Schwarz, Stefan

    2004-01-01

    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.   PMID:14742219

  15. Sequencing the Gene Encoding Manganese-Dependent Superoxide Dismutase for Rapid Species Identification of Enterococci

    OpenAIRE

    Poyart, Claire; Quesnes, Gilles; Trieu-Cuot, Patrick

    2000-01-01

    Simple PCR and sequencing assays that utilize a single pair of degenerate primers were used to characterize a 438-bp-long DNA fragment internal (sodAint) to the sodA gene encoding the manganese-dependent superoxide dismutase in 19 enterococcal type strains (Enterococcus avium, Enterococcus casseliflavus, Enterococcus cecorum, Enterococcus columbae, Enterococcus dispar, Enterococcus durans, Enterococcus faecalis, Enterococcus faecium, Enterococcus flavescens, Enterococcus gallinarum, Enterococ...

  16. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  17. Inferring Drosophila gap gene regulatory network: Pattern analysis of simulated gene expression profiles and stability analysis

    NARCIS (Netherlands)

    Fomekong-Nanfack, Y.; Postma, M.; Kaandorp, J.A.

    2009-01-01

    Background: Inference of gene regulatory networks (GRNs) requires accurate data, a method to simulate the expression patterns and an efficient optimization algorithm to estimate the unknown parameters. Using this approach it is possible to obtain alternative circuits without making any a priori

  18. Enterotoxin-Encoding Genes in Staphylococcus spp. from Food Handlers in a University Restaurant.

    Science.gov (United States)

    da Silva, Sabina Dos Santos Paulino; Cidral, Thiago André; Soares, Maria José dos Santos; de Melo, Maria Celeste Nunes

    2015-11-01

    Food handlers carrying enterotoxin-producing Staphylococcus are a potential source of food poisoning. The aim of this study was to analyze genes encoding enterotoxins in coagulase-positive Staphylococcus (CoPS) and coagulase-negative Staphylococcus (CoNS) isolated from the anterior nostrils and hands of food handlers at a university restaurant in the city of Natal, Northeast Brazil. Thirty food handlers were screened for the study. The isolates were subjected to Gram staining, a bacitracin sensitivity test, mannitol fermentation, and catalase and coagulase tests. CoNS and CoPS strains were subsequently identified by a Vitek 2 System (BioMerieux, France) and various biochemical tests. Polymerase chain reaction was used to detect genes for enterotoxins A, B, C, D, E, G, H, and I (sea, seb, sec, sed, see, seg, seh, and sei) and a disc-diffusion method was used to determine susceptibility to several classes of antimicrobials. All food handlers presented staphylococci on their hands and/or noses. The study found 58 Staphylococcus spp., of which 20.7% were CoPS and 79.3% were CoNS. S. epidermidis was the most prevalent species. Twenty-nine staphylococci (50%) were positive for one or more enterotoxin genes, and the most prevalent genes were seg and sei, each with a frequency of 29.3%. Indeed, CoNS encoded a high percentage of enterotoxin genes (43.5%). However, S. aureus encoded even more enterotoxin genes (75%). Most isolates showed sensitivity to the antibiotics used for testing, except for penicillin (only 35% sensitive). The results from this study reinforce that coagulase-negative as well as coagulase-positive staphylococci isolated from food handlers are capable of genotypic enterotoxigenicity.

  19. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  20. Mutations in the gene encoding epsilon-sarcoglycan cause myoclonus-dystonia syndrome.

    Science.gov (United States)

    Zimprich, A; Grabowski, M; Asmus, F; Naumann, M; Berg, D; Bertram, M; Scheidtmann, K; Kern, P; Winkelmann, J; Müller-Myhsok, B; Riedel, L; Bauer, M; Müller, T; Castro, M; Meitinger, T; Strom, T M; Gasser, T

    2001-09-01

    The dystonias are a common clinically and genetically heterogeneous group of movement disorders. More than ten loci for inherited forms of dystonia have been mapped, but only three mutated genes have been identified so far. These are DYT1, encoding torsin A and mutant in the early-onset generalized form, GCH1 (formerly known as DYT5), encoding GTP-cyclohydrolase I and mutant in dominant dopa-responsive dystonia, and TH, encoding tyrosine hydroxylase and mutant in the recessive form of the disease. Myoclonus-dystonia syndrome (MDS; DYT11) is an autosomal dominant disorder characterized by bilateral, alcohol-sensitive myoclonic jerks involving mainly the arms and axial muscles. Dystonia, usually torticollis and/or writer's cramp, occurs in most but not all affected patients and may occasionally be the only symptom of the disease. In addition, patients often show prominent psychiatric abnormalities, including panic attacks and obsessive-compulsive behavior. In most MDS families, the disease is linked to a locus on chromosome 7q21 (refs. 11-13). Using a positional cloning approach, we have identified five different heterozygous loss-of-function mutations in the gene for epsilon-sarcoglycan (SGCE), which we mapped to a refined critical region of about 3.2 Mb. SGCE is expressed in all brain regions examined. Pedigree analysis shows a marked difference in penetrance depending on the parental origin of the disease allele. This is indicative of a maternal imprinting mechanism, which has been demonstrated in the mouse epsilon-sarcoglycan gene.

  1. The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli.

    OpenAIRE

    Okada, K; Minehira, M; Zhu, X; Suzuki, K; Nakagawa, T; Matsuda, H; Kawamukai, M

    1997-01-01

    The Escherichia coli ispB gene encoding octaprenyl diphosphate synthase is responsible for the synthesis of the side chain of isoprenoid quinones. We tried to construct an E. coli ispB-disrupted mutant but could not isolate the chromosomal ispB disrupted mutant unless the ispB gene or its homolog was supplied on a plasmid. The chromosomal ispB disruptants that harbored plasmids carrying the ispB homologs from Haemophilus influenzae and Synechocystis sp. strain PCC6803 produced mainly ubiquino...

  2. PRS1 is a key member of the gene family encoding phosphoribosylpyrophosphate synthetase in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Carter, Andrew T.; Beiche, Flora; Hove-Jensen, Bjarne

    1997-01-01

    In Saccharomyces cerevisiae the metabolite phosphoribosyl-pyrophosphate (PRPP) is required for purine, pyrimidine, tryptophan and histidine biosynthesis. Enzymes that can synthesize PRPP can be encoded by at least four genes. We have studied 5-phospho-ribosyl-1(α)-pyrophosphate synthetases (PRS......) genetically and biochemically. Each of the four genes, all of which are transcribed, has been disrupted in haploid yeast strains of each mating type and although all disruptants are able to grow on complete medium, differences in growth rate and enzyme activity suggest that disruption of PRS1 or PRS3 has...

  3. Indeterminacy of reverse engineering of Gene Regulatory Networks: the curse of gene elasticity.

    Directory of Open Access Journals (Sweden)

    Arun Krishnan

    2007-06-01

    Full Text Available Gene Regulatory Networks (GRNs have become a major focus of interest in recent years. A number of reverse engineering approaches have been developed to help uncover the regulatory networks giving rise to the observed gene expression profiles. However, this is an overspecified problem due to the fact that more than one genotype (network wiring can give rise to the same phenotype. We refer to this phenomenon as "gene elasticity." In this work, we study the effect of this particular problem on the pure, data-driven inference of gene regulatory networks.We simulated a four-gene network in order to produce "data" (protein levels that we use in lieu of real experimental data. We then optimized the network connections between the four genes with a view to obtain the original network that gave rise to the data. We did this for two different cases: one in which only the network connections were optimized and the other in which both the network connections as well as the kinetic parameters (given as reaction probabilities in our case were estimated. We observed that multiple genotypes gave rise to very similar protein levels. Statistical experimentation indicates that it is impossible to differentiate between the different networks on the basis of both equilibrium as well as dynamic data.We show explicitly that reverse engineering of GRNs from pure expression data is an indeterminate problem. Our results suggest the unsuitability of an inferential, purely data-driven approach for the reverse engineering transcriptional networks in the case of gene regulatory networks displaying a certain level of complexity.

  4. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  5. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae. Progress report, March 1993

    Energy Technology Data Exchange (ETDEWEB)

    Parke, D.; Ornston, L.N.

    1993-03-01

    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the {beta}-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novel regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate {beta}-carboxy-cis,cis-muconate. {beta}-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for {beta}-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to {beta}-carboxy-cis,cis-muconate.

  6. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  7. Selection and characterization of forest soil metagenome genes encoding lipolytic enzymes.

    Science.gov (United States)

    Hong, Kyung Sik; Lim, He Kyoung; Chung, Eu Jin; Park, Eun Jin; Lee, Myung Hwan; Kim, Jin-Cheol; Choi, Gyung Ja; Cho, Kwang Yun; Lee, Seon-Woo

    2007-10-01

    A metagenome is a unique resource to search for novel microbial enzymes from the unculturable microorganisms in soil. A forest soil metagenomic library using a fosmid and soil microbial DNA from Gwangneung forest, Korea, was constructed in Escherichia coli and screened to select lipolytic genes. A total of seven unique lipolytic clones were selected by screening of the 31,000-member forest soil metagenome library based on tributyrin hydrolysis. The ORFs for lipolytic activity were subcloned in a high copy number plasmid by screening the secondary shortgun libraries from the seven clones. Since the lipolytic enzymes were well secreted in E. coli into the culture broth, the lipolytic activity of the subclones was confirmed by the hydrolysis of p-nitrophenyl butyrate using culture broth. Deduced amino acid sequence analysis of the identified ORFs for lipolytic activity revealed that 4 genes encode hormone-sensitive lipase (HSL) in lipase family IV. Phylogenetic analysis indicated that 4 proteins were clustered with HSL in the database and other metagenomic HSLs. The other 2 genes and 1 gene encode non-heme peroxidase-like enzymes of lipase family V and a GDSL family esterase/lipase in family II, respectively. The gene for the GDSL enzyme is the first description of the enzyme from metagenomic screening.

  8. Production of cyanophycin in Rhizopus oryzae through the expression of a cyanophycin synthetase encoding gene.

    Science.gov (United States)

    Meussen, Bas J; Weusthuis, Ruud A; Sanders, Johan P M; Graaff, Leo H de

    2012-02-01

    Cyanophycin or cyanophycin granule peptide is a protein that results from non-ribosomal protein synthesis in microorganisms such as cyanobacteria. The amino acids in cyanophycin can be used as a feedstock in the production of a wide range of chemicals such as acrylonitrile, polyacrylic acid, 1,4-butanediamine, and urea. In this study, an auxotrophic mutant (Rhizopus oryzae M16) of the filamentous fungus R. oryzae 99-880 was selected to express cyanophycin synthetase encoding genes. These genes originated from Synechocystis sp. strain PCC6803, Anabaena sp. strain PCC7120, and a codon optimized version of latter gene. The genes were under control of the pyruvate decarboxylase promoter and terminator elements of R. oryzae. Transformants were generated by the biolistic transformation method. In only two transformants both expressing the cyanophycin synthetase encoding gene from Synechocystis sp. strain PCC6803 was a specific enzyme activity detected of 1.5 mU/mg protein. In one of these transformants was both water-soluble and insoluble cyanophycin detected. The water-soluble fraction formed the major fraction and accounted for 0.5% of the dry weight. The water-insoluble CGP was produced in trace amounts. The amino acid composition of the water-soluble form was determined and constitutes of equimolar amounts of arginine and aspartic acid.

  9. What makes the lac-pathway switch: identifying the fluctuations that trigger phenotype switching in gene regulatory systems.

    Science.gov (United States)

    Bhogale, Prasanna M; Sorg, Robin A; Veening, Jan-Willem; Berg, Johannes

    2014-10-01

    Multistable gene regulatory systems sustain different levels of gene expression under identical external conditions. Such multistability is used to encode phenotypic states in processes including nutrient uptake and persistence in bacteria, fate selection in viral infection, cell-cycle control and development. Stochastic switching between different phenotypes can occur as the result of random fluctuations in molecular copy numbers of mRNA and proteins arising in transcription, translation, transport and binding. However, which component of a pathway triggers such a transition is generally not known. By linking single-cell experiments on the lactose-uptake pathway in E. coli to molecular simulations, we devise a general method to pinpoint the particular fluctuation driving phenotype switching and apply this method to the transition between the uninduced and induced states of the lac-genes. We find that the transition to the induced state is not caused only by the single event of lac-repressor unbinding, but depends crucially on the time period over which the repressor remains unbound from the lac-operon. We confirm this notion in strains with a high expression level of the lac-repressor (leading to shorter periods over which the lac-operon remains unbound), which show a reduced switching rate. Our techniques apply to multistable gene regulatory systems in general and allow to identify the molecular mechanisms behind stochastic transitions in gene regulatory circuits. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...... and to the Saccharomyces cerevisiae STE6 gene product, which mediates export of a-factor mating pheromone. We show that STE6 can also mediate secretion of M-factor in S. pombe....

  11. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  12. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  13. Cloning and characterization of nif structural and regulatory genes in the purple sulfur bacterium, Halorhodospira halophila.

    Science.gov (United States)

    Tsuihiji, Hisayoshi; Yamazaki, Yoichi; Kamikubo, Hironari; Imamoto, Yasushi; Kataoka, Mikio

    2006-03-01

    Halorhodospira halophila is a halophilic photosynthetic bacterium classified as a purple sulfur bacterium. We found that H. halophila generates hydrogen gas during photoautotrophic growth as a byproduct of a nitrogenase reaction. In order to consider the applied possibilities of this photobiological hydrogen generation, we cloned and characterized the structural and regulatory genes encoding the nitrogenase, nifH, nifD and nifA, from H. halophila. This is the first description of the nif genes for a purple sulfur bacterium. The amino-acid sequences of NifH and NifD indicated that these proteins are an Fe protein and a part of a MoFe protein, respectively. The important residues are conserved completely. The sequence upstream from the nifH region and sequence similarities of nifH and nifD with those of the other organisms suggest that the regulatory system might be a NifL-NifA system; however, H. halophila lacks nifL. The amino-acid sequence of H. halophila NifA is closer to that of the NifA of the NifL-NifA system than to that of NifA without NifL. H. halophila NifA does not conserve either the residue that interacts with NifL or the important residues involved in NifL-independent regulation. These results suggest the existence of yet another regulatory system, and that the development of functional systems and their molecular counterparts are not necessarily correlated throughout evolution. All of these Nif proteins of H. halophila possess an excess of acidic residues, which acts as a salt-resistant mechanism.

  14. A highly conserved NB-LRR encoding gene cluster effective against Setosphaeria turcica in sorghum

    Directory of Open Access Journals (Sweden)

    Martin Tom

    2011-11-01

    Full Text Available Abstract Background The fungal pathogen Setosphaeria turcica causes turcicum or northern leaf blight disease on maize, sorghum and related grasses. A prevalent foliar disease found worldwide where the two host crops, maize and sorghum are grown. The aim of the present study was to find genes controlling the host defense response to this devastating plant pathogen. A cDNA-AFLP approach was taken to identify candidate sequences, which functions were further validated via virus induced gene silencing (VIGS, and real-time PCR analysis. Phylogenetic analysis was performed to address evolutionary events. Results cDNA-AFLP analysis was run on susceptible and resistant sorghum and maize genotypes to identify resistance-related sequences. One CC-NB-LRR encoding gene GRMZM2G005347 was found among the up-regulated maize transcripts after fungal challenge. The new plant resistance gene was designated as St referring to S. turcica. Genome sequence comparison revealed that the CC-NB-LRR encoding St genes are located on chromosome 2 in maize, and on chromosome 5 in sorghum. The six St sorghum genes reside in three pairs in one locus. When the sorghum St genes were silenced via VIGS, the resistance was clearly compromised, an observation that was supported by real-time PCR. Database searches and phylogenetic analysis suggest that the St genes have a common ancestor present before the grass subfamily split 50-70 million years ago. Today, 6 genes are present in sorghum, 9 in rice and foxtail millet, respectively, 3 in maize and 4 in Brachypodium distachyon. The St gene homologs have all highly conserved sequences, and commonly reside as gene pairs in the grass genomes. Conclusions Resistance genes to S. turcica, with a CC-NB-LRR protein domain architecture, have been found in maize and sorghum. VIGS analysis revealed their importance in the surveillance to S. turcica in sorghum. The St genes are highly conserved in sorghum, rice, foxtail millet, maize and

  15. Gene Therapy With Regulatory T Cells: A Beneficial Alliance

    Directory of Open Access Journals (Sweden)

    Moanaro Biswas

    2018-03-01

    Full Text Available Gene therapy aims to replace a defective or a deficient protein at therapeutic or curative levels. Improved vector designs have enhanced safety, efficacy, and delivery, with potential for lasting treatment. However, innate and adaptive immune responses to the viral vector and transgene product remain obstacles to the establishment of therapeutic efficacy. It is widely accepted that endogenous regulatory T cells (Tregs are critical for tolerance induction to the transgene product and in some cases the viral vector. There are two basic strategies to harness the suppressive ability of Tregs: in vivo induction of adaptive Tregs specific to the introduced gene product and concurrent administration of autologous, ex vivo expanded Tregs. The latter may be polyclonal or engineered to direct specificity to the therapeutic antigen. Recent clinical trials have advanced adoptive immunotherapy with Tregs for the treatment of autoimmune disease and in patients receiving cell transplants. Here, we highlight the potential benefit of combining gene therapy with Treg adoptive transfer to achieve a sustained transgene expression. Furthermore, techniques to engineer antigen-specific Treg cell populations, either through reprogramming conventional CD4+ T cells or transferring T cell receptors with known specificity into polyclonal Tregs, are promising in preclinical studies. Thus, based upon these observations and the successful use of chimeric (IgG-based antigen receptors (CARs in antigen-specific effector T cells, different types of CAR-Tregs could be added to the repertoire of inhibitory modalities to suppress immune responses to therapeutic cargos of gene therapy vectors. The diverse approaches to harness the ability of Tregs to suppress unwanted immune responses to gene therapy and their perspectives are reviewed in this article.

  16. Data Integration for Microarrays: Enhanced Inference for Gene Regulatory Networks

    Directory of Open Access Journals (Sweden)

    Alina Sîrbu

    2015-05-01

    Full Text Available Microarray technologies have been the basis of numerous important findings regarding gene expression in the few last decades. Studies have generated large amounts of data describing various processes, which, due to the existence of public databases, are widely available for further analysis. Given their lower cost and higher maturity compared to newer sequencing technologies, these data continue to be produced, even though data quality has been the subject of some debate. However, given the large volume of data generated, integration can help overcome some issues related, e.g., to noise or reduced time resolution, while providing additional insight on features not directly addressed by sequencing methods. Here, we present an integration test case based on public Drosophila melanogaster datasets (gene expression, binding site affinities, known interactions. Using an evolutionary computation framework, we show how integration can enhance the ability to recover transcriptional gene regulatory networks from these data, as well as indicating which data types are more important for quantitative and qualitative network inference. Our results show a clear improvement in performance when multiple datasets are integrated, indicating that microarray data will remain a valuable and viable resource for some time to come.

  17. Complex Dynamic Behavior in Simple Gene Regulatory Networks

    Science.gov (United States)

    Santillán Zerón, Moisés

    2007-02-01

    Knowing the complete genome of a given species is just a piece of the puzzle. To fully unveil the systems behavior of an organism, an organ, or even a single cell, we need to understand the underlying gene regulatory dynamics. Given the complexity of the whole system, the ultimate goal is unattainable for the moment. But perhaps, by analyzing the most simple genetic systems, we may be able to develop the mathematical techniques and procedures required to tackle more complex genetic networks in the near future. In the present work, the techniques for developing mathematical models of simple bacterial gene networks, like the tryptophan and lactose operons are introduced. Despite all of the underlying assumptions, such models can provide valuable information regarding gene regulation dynamics. Here, we pay special attention to robustness as an emergent property. These notes are organized as follows. In the first section, the long historical relation between mathematics, physics, and biology is briefly reviewed. Recently, the multidisciplinary work in biology has received great attention in the form of systems biology. The main concepts of this novel science are discussed in the second section. A very slim introduction to the essential concepts of molecular biology is given in the third section. In the fourth section, a brief introduction to chemical kinetics is presented. Finally, in the fifth section, a mathematical model for the lactose operon is developed and analyzed..

  18. Identification and characterization of a gene encoding for a nucleotidase from Phaseolus vulgaris.

    Science.gov (United States)

    Cabello-Díaz, Juan Miguel; Gálvez-Valdivieso, Gregorio; Caballo, Cristina; Lambert, Rocío; Quiles, Francisco Antonio; Pineda, Manuel; Piedras, Pedro

    2015-08-01

    Nucleotidases are phosphatases that catalyze the removal of phosphate from nucleotides, compounds with an important role in plant metabolism. A phosphatase enzyme, with high affinity for nucleotides monophosphate previously identified and purified in embryonic axes from French bean, has been analyzed by MALDI TOF/TOF and two internal peptides have been obtained. The information of these peptide sequences has been used to search in the genome database and only a candidate gene that encodes for the phosphatase was identified (PvNTD1). The putative protein contains the conserved domains (motif I-IV) for haloacid dehalogenase-like hydrolases superfamily. The residues involved in the catalytic activity are also conserved. A recombinant protein overexpressed in Escherichia coli has shown molybdate resistant phosphatase activity with nucleosides monophosphate as substrate, confirming that the identified gene encodes for the phosphatase with high affinity for nucleotides purified in French bean embryonic axes. The activity of the purified protein was inhibited by adenosine. The expression of PvNTD1 gene was induced at the specific moment of radicle protrusion in embryonic axes. The gene was also highly expressed in young leaves whereas the level of expression in mature tissues was minimal. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

  19. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  20. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae

    Directory of Open Access Journals (Sweden)

    Dhia Bouktila

    2014-09-01

    Full Text Available Proteins containing nucleotide binding sites (NBS encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution.

  1. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  2. A corm-specific gene encodes tarin, a major globulin of taro (Colocasia esculenta L. Schott).

    Science.gov (United States)

    Bezerra, I C; Castro, L A; Neshich, G; de Almeida, E R; de Sá, M F; Mello, L V; Monte-Neshich, D C

    1995-04-01

    A gene encoding a globulin from a major taro (Colocasia esculenta L. Schott) corm protein family, tarin (G1, ca. 28 kDa) was isolated from a lambda Charon 35 library, using a cDNA derived from a highly abundant corm-specific mRNA, as probe. The gene, named tar1, and the corresponding cDNA were characterized and compared. No introns were found. The major transcription start site was determined by primer extension analysis. The gene has an open reading frame (ORF) of 765 bp, and the deduced amino acid sequence indicated a precursor polypeptide of 255 residues that is post-translationally processed into two subunits of about 12.5 kDa each. The deduced protein is 45% homologous to curculin, a sweet-tasting protein found in the fruit pulp of Curculigo latifolia and 40% homologous to a mannose-binding lectin from Galanthus nivalis. Significant similarity was also found at the nucleic acid sequence level with genes encoding lectins from plant species of the Amaryllidaceae and Lilliaceae families.

  3. [Cloning and structure of gene encoded alpha-latrocrustoxin from the Black widow spider venom].

    Science.gov (United States)

    Danilevich, V N; Luk'ianov, S A; Grishin, E V

    1999-07-01

    The primary structure of the crusta gene encoding alpha-latrocrustoxin (alpha-LCT), a high molecular mass neurotoxin specific to crustaceans, was determined in the black widow spider Latrodectus mactans tredicimguttatus genome. The total length of the sequenced DNA was 4693 bp. The structural part of the black widow spider chromosome gene encoding alpha-LCT does not contain introns. The sequenced DNA contains a single extended open reading frame (4185 bp) and encodes a protein precursor of alpha-LCT, comprising 1395 aa. We assume the Met residue at position -10 relative to the N-terminal residue of Glu1 of the mature toxin to be the first one in the protein precursor. The calculated molecular mass of the precursor (156147 Da) exceeds that of the mature toxin by approximately 30 kDa. These data are in agreement with the notion that over the course of maturation the protein precursor undergoes double processing--cleavage of a decapeptide from the N-terminal part and of a approximately 200-aa fragment from the C-terminal part. alpha-LCT displayed a number of imperfect ankyrin-like repeats and areas of structural homology with earlier studied latrotoxins; the highest homology degree (62%) was revealed with alpha-latroinsectotoxin (alpha-LIT).

  4. Analysis of deterministic cyclic gene regulatory network models with delays

    CERN Document Server

    Ahsen, Mehmet Eren; Niculescu, Silviu-Iulian

    2015-01-01

    This brief examines a deterministic, ODE-based model for gene regulatory networks (GRN) that incorporates nonlinearities and time-delayed feedback. An introductory chapter provides some insights into molecular biology and GRNs. The mathematical tools necessary for studying the GRN model are then reviewed, in particular Hill functions and Schwarzian derivatives. One chapter is devoted to the analysis of GRNs under negative feedback with time delays and a special case of a homogenous GRN is considered. Asymptotic stability analysis of GRNs under positive feedback is then considered in a separate chapter, in which conditions leading to bi-stability are derived. Graduate and advanced undergraduate students and researchers in control engineering, applied mathematics, systems biology and synthetic biology will find this brief to be a clear and concise introduction to the modeling and analysis of GRNs.

  5. Regulatory RNAs in Planarians.

    Science.gov (United States)

    Pawlicka, Kamila; Perrigue, Patrick M; Barciszewski, Jan

    2016-01-01

    The full scope of regulatory RNA evolution and function in epigenetic processes is still not well understood. The development of planarian flatworms to be used as a simple model organism for research has shown a great potential to address gaps in the knowledge in this field of study. The genomes of planarians encode a wide array of regulatory RNAs that function in gene regulation. Here, we review planarians as a suitable model organism for the identification and function of regulatory RNAs.

  6. The immune gene repertoire encoded in the purple sea urchin genome.

    Science.gov (United States)

    Hibino, Taku; Loza-Coll, Mariano; Messier, Cynthia; Majeske, Audrey J; Cohen, Avis H; Terwilliger, David P; Buckley, Katherine M; Brockton, Virginia; Nair, Sham V; Berney, Kevin; Fugmann, Sebastian D; Anderson, Michele K; Pancer, Zeev; Cameron, R Andrew; Smith, L Courtney; Rast, Jonathan P

    2006-12-01

    Echinoderms occupy a critical and largely unexplored phylogenetic vantage point from which to infer both the early evolution of bilaterian immunity and the underpinnings of the vertebrate adaptive immune system. Here we present an initial survey of the purple sea urchin genome for genes associated with immunity. An elaborate repertoire of potential immune receptors, regulators and effectors is present, including unprecedented expansions of innate pathogen recognition genes. These include a diverse array of 222 Toll-like receptor (TLR) genes and a coordinate expansion of directly associated signaling adaptors. Notably, a subset of sea urchin TLR genes encodes receptors with structural characteristics previously identified only in protostomes. A similarly expanded set of 203 NOD/NALP-like cytoplasmic recognition proteins is present. These genes have previously been identified only in vertebrates where they are represented in much lower numbers. Genes that mediate the alternative and lectin complement pathways are described, while gene homologues of the terminal pathway are not present. We have also identified several homologues of genes that function in jawed vertebrate adaptive immunity. The most striking of these is a gene cluster with similarity to the jawed vertebrate Recombination Activating Genes 1 and 2 (RAG1/2). Sea urchins are long-lived, complex organisms and these findings reveal an innate immune system of unprecedented complexity. Whether the presumably intense selective processes that molded these gene families also gave rise to novel immune mechanisms akin to adaptive systems remains to be seen. The genome sequence provides immediate opportunities to apply the advantages of the sea urchin model toward problems in developmental and evolutionary immunobiology.

  7. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  8. Phylogenetic and evolutionary analysis of NBS-encoding genes in Rosaceae fruit crops.

    Science.gov (United States)

    Xu, Qiang; Wen, Xiaopeng; Deng, Xiuxin

    2007-07-01

    Phylogenetic relationships of the nucleotide binding site (NBS)-encoding resistance gene homologues (RGHs) among 12 species in five genera of Rosaceae fruit crops were evaluated. A total of 228 Rosaceous RGHs were deeply separated into two distinct clades, designated as TIR (sequences within this clade containing a Toll Interleukin-1 Receptor domain) and NonTIR (sequences lacking a TIR domain). Most Rosaceous RGH genes were phylogenetically distinct from Arabidopsis, Rice or Pine genes, except for a few Rosaceous members which grouped closely with Arabidopsis genes. Within Rosaceae, sequences from multiple species were often phylogenetically clustered together, forming heterogenous groups, however, apple- and chestnut rose-specific groups really exist. Gene duplication followed by sequence divergence were proposed as the mode for the evolution of a large number of distantly or closely related RGH genes in Rosaceae, and this mode may play a role in the generation of new resistance specificity. Positively selected sites within NBS-coding region were detected and thus nucleotide variation within NBS domain may function in determining disease resistance specificity. This study also discusses the synteny of a genomic region that encompass powdery mildew resistance locus among Malus, Prunus and Rosa, which may have potential use for fruit tree disease breeding and important gene cloning.

  9. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  10. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  11. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes.

    NARCIS (Netherlands)

    Jensen, A.; Magistrado, P.; Sharp, S.; Joergensen, L.; Lavstsen, T.; Chiucchiuini, A.; Salanti, A.; Vestergaard, L.S.; Lusingu, J.P.; Hermsen, R.; Sauerwein, R.W.; Christensen, J.; Nielsen, M.A.; Hviid, L.; Sutherland, C.J.; Staalsoe, T.; Theander, T.G.

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in

  12. Identification and characterization of the Vibrio anguillarum prtV gene encoding a new metalloprotease

    Science.gov (United States)

    Mo, Zhaolan; Guo, Dongsheng; Mao, Yunxiang; Ye, Xuhong; Zou, Yuxia; Xiao, Peng; Hao, Bin

    2010-01-01

    We cloned and sequenced a prtV-like gene from Vibrio anguillarum M3 strain. This prtV gene encodes a putative protein of 918 amino acids, and is highly homologous to the V. cholerae prtV gene. We found that a prtV insertion mutant strain displayed lower gelatinase activity on gelatin agar, lower protease activity against azocasein, and lower activity for four glycosidases. This prtV mutant strain also had increased activity for two esterases in its extracellular products, as analyzed by the API ZYM system. In addition, the prtV mutant strain exhibited decreased growth in turbot intestinal mucus and reduced hemolytic activity on turbot erythrocytes. Infection experiments showed that the LD50 of the prtV mutant strain increased by at least 1 log compared to the wild-type in turbot fish. We propose that prtV plays an important role in the pathogenesis of V. anguillarum.

  13. Genetic variability in the sable (Martes zibellina L.) with respect to genes encoding blood proteins

    Energy Technology Data Exchange (ETDEWEB)

    Kashtanov, S.N. [Vavilov Institute of General Genetics, Moscow (Russian Federation); Kazakova, T.I. [Afanas`ev Scientific Research Institute for Breeding of Fur-Bearing Animals, Moscow (Russian Federation)

    1995-02-01

    Electrophoresis of blood proteins was used to determine, for the first time, the level of genetic variability of certain loci in the sable (Martes zibellina L., Mustelidae). Variation of 23 blood proteins encoded by 25 genes was analyzed. Polymorphism was revealed in six genes. The level of heterozygosity was estimated at 0.069; the proportion of polymorphic loci was 24%. Data on the history of the sable population maintained at the farm, on geographical distribution of natural sable populations, and on the number of animals selected for reproduction in captivity is presented. The great number of animals studies and the extensive range of natural sable populations, on the basis of which the population maintained in captivity was obtained, suggest that the results of this work can be used for estimating the variability of the gene pool of sable as a species. 9 refs., 2 figs., 1 tab.

  14. [The expression of genes encoding the voltage-dependent L-type Ca2+ channels in proliferating and differentiating C2C12 myoblasts of mice].

    Science.gov (United States)

    Krasnyi, A M; Ozerniuk, N D

    2011-01-01

    Votage-dependent L-type Ca+ channels of the C2C12 line myoblasts of mice have been studied at the stage of proliferation and 24 h after the beginning of differentiation. The expression of genes Cacna1s, Cacna1S, Cacna1d, and Cacna1f, which encode channel forming subunits alpha1S, alpha1C, alph1D, and alpha1F, respectively, has been assessed. The expression of genes Cacna2d and Cacn1g, which encode the alpha2, delta, and gamma regulatory subunits, has been studied as well. For the first time, the expression of Cacnald, which is typical for nerve cells, units, has been revealed in proliferating myoblasts, whereas in differentiating mononuclear myoblasts the expression of this gene was significantly decreased. On the contrary, the low level of expression of Cacnal IS, which encodes the specific alpha1S channel forming subunit of skeletal muscles, has been observed in proliferating myoblasts, whereas in differentiating mononuclear myoblasts it has been shown to increase multifold. No considerable changes in expression of Cacna2d and Cacn 1g have been revealed in proliferating and differentiating myoblasts. No traces of expression of Cacna1c and Cacna1f have been revealed in myoblasts.

  15. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    NARCIS (Netherlands)

    Dijkman, Ronald; Jebbink, Maarten F.; Wilbrink, Berry; Pyrc, Krzysztof; Zaaijer, Hans L.; Minor, Philip D.; Franklin, Sally; Berkhout, Ben; Thiel, Volker; van der Hoek, Lia

    2006-01-01

    BACKGROUND: The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV) 229E. The prototype virus has a

  16. Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene

    Directory of Open Access Journals (Sweden)

    Michael Hadjiargyrou

    2018-01-01

    Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.

  17. The impact of gene expression variation on the robustness and evolvability of a developmental gene regulatory network.

    Directory of Open Access Journals (Sweden)

    David A Garfield

    2013-10-01

    Full Text Available Regulatory interactions buffer development against genetic and environmental perturbations, but adaptation requires phenotypes to change. We investigated the relationship between robustness and evolvability within the gene regulatory network underlying development of the larval skeleton in the sea urchin Strongylocentrotus purpuratus. We find extensive variation in gene expression in this network throughout development in a natural population, some of which has a heritable genetic basis. Switch-like regulatory interactions predominate during early development, buffer expression variation, and may promote the accumulation of cryptic genetic variation affecting early stages. Regulatory interactions during later development are typically more sensitive (linear, allowing variation in expression to affect downstream target genes. Variation in skeletal morphology is associated primarily with expression variation of a few, primarily structural, genes at terminal positions within the network. These results indicate that the position and properties of gene interactions within a network can have important evolutionary consequences independent of their immediate regulatory role.

  18. A gene encoding phosphatidylethanolamine N-methyltransferase from Acetobacter aceti and some properties of its disruptant.

    Science.gov (United States)

    Hanada, T; Kashima, Y; Kosugi, A; Koizumi, Y; Yanagida, F; Udaka, S

    2001-12-01

    Phosphatidylcholine (PC) is a major component of membranes not only in eukaryotes, but also in several bacteria, including Acetobacter. To identify the PC biosynthetic pathway and its role in Acetobacter sp., we have studied Acetobacter aceti IFO3283, which is characterized by high ethanol oxidizing ability and high resistance to acetic acid. The pmt gene of A. aceti, encoding phosphatidylethanolamine N-methyltransferase (Pmt), which catalyzes methylation of phosphatidylethanolamine (PE) to PC, has been cloned and sequenced. One recombinant plasmid that complemented the PC biosynthesis was isolated from a gene library of the genomic DNA of A. aceti. The pmt gene encodes a polypeptide with molecular mass of either 25125, 26216, or 29052 for an about 27-kDa protein. The sequence of this gene showed significant similarity (44.3% identity in the similar sequence region) with the Rhodobacter sphaeroides pmtA gene which is involved in PE N-methylation. When the pmt gene was expressed in E. coli, which lacks PC, the Pmt activity and PC formation were clearly demonstrated. A. aceti strain harboring an interrupted pmt allele, pmt::Km, was constructed. The pmt disruption was confirmed by loss of Pmt and PC, and by Southern blot analyses. The null pmt mutant contained no PC, but tenfold more PE and twofold more phosphatidylglycerol (PG). The pmt disruptant did not show any dramatic effects on growth in basal medium supplemented with ethanol, but the disruption caused slow growth in basal medium supplemented with acetate. These results suggest that the lack of PC in the A. aceti membrane may be compensated by the increases of PE and PG by an unknown mechanism, and PC in A. aceti membrane is related to its acetic acid tolerance.

  19. Cis and trans interactions between genes encoding PAF1 complex and ESCRT machinery components in yeast.

    Science.gov (United States)

    Rodrigues, Joana; Lydall, David

    2018-03-22

    Saccharomyces cerevisiae is a commonly used model organism for understanding eukaryotic gene function. However, the close proximity between yeast genes can complicate the interpretation of yeast genetic data, particularly high-throughput data. In this study, we examined the interplay between genes encoding components of the PAF1 complex and VPS36, the gene located next to CDC73 on chromosome XII. The PAF1 complex (Cdc73, Paf1, Ctr9, Leo1, and Rtf1, in yeast) affects RNA levels by affecting transcription, histone modifications, and post-transcriptional RNA processing. The human PAF1 complex is linked to cancer, and in yeast, it has been reported to play a role in telomere biology. Vps36, part of the ESCRT-II complex, is involved in sorting proteins for vacuolar/lysosomal degradation. We document a complex set of genetic interactions, which include an adjacent gene effect between CDC73 and VPS36 and synthetic sickness between vps36Δ and cdc73Δ, paf1Δ, or ctr9Δ. Importantly, paf1Δ and ctr9Δ are synthetically lethal with deletions of other components of the ESCRT-II (SNF8 and VPS25), ESCRT-I (STP22), or ESCRT-III (SNF7) complexes. We found that RNA levels of VPS36, but not other ESCRT components, are positively regulated by all components of the PAF1 complex. Finally, we show that deletion of ESCRT components decreases the telomere length in the S288C yeast genetic background, but not in the W303 background. Together, our results outline complex interactions, in cis and in trans, between genes encoding PAF1 and ESCRT-II complex components that affect telomere function and cell viability in yeast.

  20. Inferring Drosophila gap gene regulatory network: A parameter sensitivity and perturbation analysis

    NARCIS (Netherlands)

    Fomekong-Nanfack, Y.; Postma, M.; Kaandorp, J.A.

    2009-01-01

    Background: Inverse modelling of gene regulatory networks (GRNs) capable of simulating continuous spatio-temporal biological processes requires accurate data and a good description of the system. If quantitative relations between genes cannot be extracted from direct measurements, an efficient

  1. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  2. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    Science.gov (United States)

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Gene therapy for bladder pain with gene gun particle encoding pro-opiomelanocortin cDNA.

    Science.gov (United States)

    Chuang, Yao-Chi; Chou, A-K; Wu, P-C; Chiang, Po-Hui; Yu, T-J; Yang, L-C; Yoshimura, Naoki; Chancellor, Michael B

    2003-11-01

    Interstitial cystitis is a bladder hypersensitivity disease associated with bladder pain that has been a major challenge to understand and treat. We hypothesized that targeted and localized expression of endogenous opioid peptide in the bladder could be useful for the treatment of bladder pain. Pro-opiomelanocortin (POMC) is one of such precursor molecules. In this study we developed a gene gun method for the transfer of POMC cDNA in vivo and investigated its therapeutic effect on acetic acid induced bladder hyperactivity in rats. Human POMC cDNA was cloned into a modified pCMV plasmid and delivered into the bladder wall of adult female rats by direct injection or the gene gun. Three days after gene therapy continuous cystometrograms were performed using urethane anesthesia by filling the bladder (0.08 ml per minute) with saline, followed by 0.3% acetic acid. Bladder immunohistochemical testing was used to detect endorphin after POMC cDNA transfer. The intercontraction interval was decreased after intravesical instillation of acetic acid (73.1% or 68.1% decrease) in 2 control groups treated with saline or the gene gun without POMC cDNA, respectively. However, rats that received POMC cDNA via the gene gun showed a significantly decreased response (intercontraction interval 35% decreased) to acetic acid instillation, whereas this antinociceptive effect was not detected in the plasmid POMC cDNA direct injection group. This effect induced by POMC gene gun treatment was reversed by intramuscular naloxone (1 mg/kg), an opioid antagonist. Increased endorphin immunoreactivity with anti-endorphin antibodies was observed in the bladder of gene gun treated animals. The POMC gene can be transferred in the bladder using the gene gun and increased bladder expression of endorphin can suppress nociceptive responses induced by bladder irritation. Thus, POMC gene gun delivery may be useful for the treatment of interstitial cystitis and other types of visceral pain.

  4. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    Science.gov (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  5. The Lethal Toxin from Australian Funnel-Web Spiders Is Encoded by an Intronless Gene

    Science.gov (United States)

    Pineda, Sandy Steffany; Wilson, David; Mattick, John S.; King, Glenn F.

    2012-01-01

    Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome. PMID:22928020

  6. Cloning and characterization of a gene encoding trehalose phosphorylase (TP) from Pleurotus sajor-caju.

    Science.gov (United States)

    Han, Sang-Eun; Kwon, Hawk-Bin; Lee, Seung-Bum; Yi, Bu-Young; Murayama, Ikuo; Kitamoto, Yutaka; Byun, Myung-Ok

    2003-08-01

    Complementary DNA for a gene encoding trehalose phosphorylase (TP) that reversibly catalyzes trehalose synthesis and degradation from alpha-glucose-1-phosphate (alpha-Glc-1-P) and glucose was cloned from Pleurotus sajor-caju. The cDNA of P. sajor-caju TP (designated PsTP, GenBank Accession No. AF149777) encodes a polypeptide of 751 amino acids with a deduced molecular mass of 83.7 kDa. The PsTP gene is expressed in mycelia, pilei, and stipes of fruiting bodies. Trehalose phosphorylase PsTP was purified from PsTP-transformed Escherichia coli. The enzyme catalyzes both the phosphorolysis of trehalose to produce alpha-Glc-1-P and glucose, and the synthesis of trehalose. The apparent K(m) values for trehalose and Pi in phosphorolytic reaction at pH 7.0 were 74.8 and 5.4 mM, respectively. The PsTP gene complemented Saccharomyces cerevisiae Deltatps1, Deltatps2 double-mutant cells, allowing their growth on glucose medium. Furthermore, yeast transformed with PsTP produced 2-2.5-fold more trehalose than non-transformants or cells transformed with empty vector only.

  7. The lethal toxin from Australian funnel-web spiders is encoded by an intronless gene.

    Directory of Open Access Journals (Sweden)

    Sandy Steffany Pineda

    Full Text Available Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome.

  8. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae.

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko; Yaoi, Katsuro

    2016-03-04

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-D-xylopyranose-(1 → 6)-D-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Expression of Mitochondrial-Encoded Genes in Blood Differentiate Acute Renal Allograft Rejection

    Directory of Open Access Journals (Sweden)

    Silke Roedder

    2017-11-01

    Full Text Available Despite potent immunosuppression, clinical and biopsy confirmed acute renal allograft rejection (AR still occurs in 10–15% of recipients, ~30% of patients demonstrate subclinical rejection on biopsy, and ~50% of them can show molecular inflammation, all which increase the risk of chronic dysfunction and worsened allograft outcomes. Mitochondria represent intracellular endogenous triggers of inflammation, which can regulate immune cell differentiation, and expansion and cause antigen-independent graft injury, potentially enhancing the development of acute rejection. In the present study, we investigated the role of mitochondrial DNA encoded gene expression in biopsy matched peripheral blood (PB samples from kidney transplant recipients. Quantitative PCR was performed in 155 PB samples from 115 unique pediatric (<21 years and adult (>21 years renal allograft recipients at the point of AR (n = 61 and absence of rejection (n = 94 for the expression of 11 mitochondrial DNA encoded genes. We observed increased expression of all genes in adult recipients compared to pediatric recipients; separate analyses in both cohorts demonstrated increased expression during rejection, which also differentiated borderline rejection and showed an increasing pattern in serially collected samples (0–3 months prior to and post rejection. Our results provide new insights on the role of mitochondria during rejection and potentially indicate mitochondria as targets for novel immunosuppression.

  10. The Neurospora crassa colonial temperature-sensitive 3 (cot-3) gene encodes protein elongation factor 2.

    Science.gov (United States)

    Propheta, O; Vierula, J; Toporowski, P; Gorovits, R; Yarden, O

    2001-02-01

    At elevated temperatures, the Neurospora crassa mutant colonial, temperature-sensitive 3 (cot-3) forms compact, highly branched colonies. Growth of the cot-3 strain under these conditions also results in the loss of the lower molecular weight (LMW) isoform of the Ser/Thr protein kinase encoded by the unlinked cot-1 gene, whose function is also involved in hyphal elongation. The unique cot-3 gene has been cloned by complementation and shown to encode translation elongation factor 2 (EF-2). As expected for a gene with a general role in protein synthesis, cot-3 mRNA is abundantly expressed throughout all asexual phases of the N. crassa life cycle. The molecular basis of the cot-3 mutation was determined to be an ATT to AAT transversion, which causes an Ile to Asn substitution at residue 278. Treatment with fusidic acid (a specific inhibitor of EF-2) inhibits hyphal elongation and induces hyperbranching in a manner which mimics the cot-3 phenotype, and also leads to a decrease in the abundance of the LMW isoform of COT1. This supports our conclusion that the mutation in cot-3 which results in abnormal hyphal elongation/branching impairs EF-2 function and confirms that the abundance of a LMW isoform of COT1 kinase is dependent on the function of this general translation factor.

  11. Potential transfer of extended spectrum β-lactamase encoding gene, blashv18 gene, between Klebsiella pneumoniae in raw foods.

    Science.gov (United States)

    Jung, Yangjin; Matthews, Karl R

    2016-12-01

    This study investigated the transfer frequency of the extended-spectrum β-lactamase-encoding gene (blaSHV18) among Klebsiella pneumoniae in tryptic soy broth (TSB), pasteurized milk, unpasteurized milk, alfalfa sprouts and chopped lettuce at defined temperatures. All transconjugants were characterized phenotypically and genotypically. KP04(ΔKM) and KP08(ΔKM) isolated from seed sprouts and KP342 were used as recipients in mating experiments with K. pneumoniae ATCC 700603 serving as the donor. In mating experiments, no transconjugants were detected at 4 °C in liquid media or chopped lettuce, but detected in all media tested at 15 °C, 24 °C, and 37 °C. At 24 °C, the transfer of blaSHV18 gene occurred more frequently in alfalfa sprouts (5.15E-04 transconjugants per recipient) and chopped lettuce (3.85E-05) than liquid media (1.08E-05). On chopped lettuce, transconjugants were not detected at day 1 post-mating at 15 °C, but observed on day 2 (1.43E-05). Transconjugants carried the blaSHV18 gene transferred from the donor and the virulence gene harbored by recipient. More importantly, a class 1 integrase gene and resistance to tetracycline, trimethoprim/sulfamethoxazole were co-transferred during mating. These quantitative results suggest that fresh produce exposed to temperature abuse may serve as a competent vehicle for the spread of gene encoding for antibiotic resistance, having a potential negative impact on human health. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)

    2013-10-15

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.

  13. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  14. Finding gene regulatory network candidates using the gene expression knowledge base.

    Science.gov (United States)

    Venkatesan, Aravind; Tripathi, Sushil; Sanz de Galdeano, Alejandro; Blondé, Ward; Lægreid, Astrid; Mironov, Vladimir; Kuiper, Martin

    2014-12-10

    Network-based approaches for the analysis of large-scale genomics data have become well established. Biological networks provide a knowledge scaffold against which the patterns and dynamics of 'omics' data can be interpreted. The background information required for the construction of such networks is often dispersed across a multitude of knowledge bases in a variety of formats. The seamless integration of this information is one of the main challenges in bioinformatics. The Semantic Web offers powerful technologies for the assembly of integrated knowledge bases that are computationally comprehensible, thereby providing a potentially powerful resource for constructing biological networks and network-based analysis. We have developed the Gene eXpression Knowledge Base (GeXKB), a semantic web technology based resource that contains integrated knowledge about gene expression regulation. To affirm the utility of GeXKB we demonstrate how this resource can be exploited for the identification of candidate regulatory network proteins. We present four use cases that were designed from a biological perspective in order to find candidate members relevant for the gastrin hormone signaling network model. We show how a combination of specific query definitions and additional selection criteria derived from gene expression data and prior knowledge concerning candidate proteins can be used to retrieve a set of proteins that constitute valid candidates for regulatory network extensions. Semantic web technologies provide the means for processing and integrating various heterogeneous information sources. The GeXKB offers biologists such an integrated knowledge resource, allowing them to address complex biological questions pertaining to gene expression. This work illustrates how GeXKB can be used in combination with gene expression results and literature information to identify new potential candidates that may be considered for extending a gene regulatory network.

  15. In vivo SPECT reporter gene imaging of regulatory T cells.

    Directory of Open Access Journals (Sweden)

    Ehsan Sharif-Paghaleh

    Full Text Available Regulatory T cells (Tregs were identified several years ago and are key in controlling autoimmune diseases and limiting immune responses to foreign antigens, including alloantigens. In vivo imaging techniques including intravital microscopy as well as whole body imaging using bioluminescence probes have contributed to the understanding of in vivo Treg function, their mechanisms of action and target cells. Imaging of the human sodium/iodide symporter via Single Photon Emission Computed Tomography (SPECT has been used to image various cell types in vivo. It has several advantages over the aforementioned imaging techniques including high sensitivity, it allows non-invasive whole body studies of viable cell migration and localisation of cells over time and lastly it may offer the possibility to be translated to the clinic. This study addresses whether SPECT/CT imaging can be used to visualise the migratory pattern of Tregs in vivo. Treg lines derived from CD4(+CD25(+FoxP3(+ cells were retrovirally transduced with a construct encoding for the human Sodium Iodide Symporter (NIS and the fluorescent protein mCherry and stimulated with autologous DCs. NIS expressing self-specific Tregs were specifically radiolabelled in vitro with Technetium-99m pertechnetate ((99mTcO(4(- and exposure of these cells to radioactivity did not affect cell viability, phenotype or function. In addition adoptively transferred Treg-NIS cells were imaged in vivo in C57BL/6 (BL/6 mice by SPECT/CT using (99mTcO(4(-. After 24 hours NIS expressing Tregs were observed in the spleen and their localisation was further confirmed by organ biodistribution studies and flow cytometry analysis. The data presented here suggests that SPECT/CT imaging can be utilised in preclinical imaging studies of adoptively transferred Tregs without affecting Treg function and viability thereby allowing longitudinal studies within disease models.

  16. Phytochrome-regulated expression of the genes encoding the small GTP-binding proteins in peas.

    OpenAIRE

    Yoshida, K; Nagano, Y; Murai, N; Sasaki, Y

    1993-01-01

    We examined the effect of light on the mRNA levels of 11 genes (pra1-pra9A, pra9B, and pra9C) encoding the small GTP-binding proteins that belong to the ras superfamily in Pisum sativum. When the dark-grown seedlings were exposed to continuous white light for 24 hr, the levels of several pra mRNAs in the pea buds decreased: pra2 and pra3 mRNAs decreased markedly; pra4, pra6, and pra9A mRNAs decreased slightly; the other 6 pra mRNAs did not decrease. We studied the kinetics of mRNA accumulatio...

  17. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  18. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    Directory of Open Access Journals (Sweden)

    Sleumer Monica C

    2012-08-01

    Full Text Available Abstract Background Ribosomal protein genes (RPGs are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from

  19. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  20. Molecular cloning and characterization of a glutathione S-transferase encoding gene from Opisthorchis viverrini.

    Science.gov (United States)

    Eursitthichai, Veerachai; Viyanant, Vithoon; Vichasri-Grams, Suksiri; Sobhon, Prasert; Tesana, Smarn; Upatham, Suchart Edward; Hofmann, Annemarie; Korge, Günter; Grams, Rudi

    2004-12-01

    An adult stage Opisthorchis viverrini cDNA library was constructed and screened for abundant transcripts. One of the isolated cDNAs was found by sequence comparison to encode a glutathione S-transferase (GST) and was further analyzed for RNA expression, encoded protein function, tissue distribution and cross-reactivity of the encoded protein with other trematode protein counterparts. The cDNA has a size of 893 bp and encodes a GST of 213 amino acids length (OV28GST). The most closely-related GST of OV28GST among those published for trematodes is a 28 kDa GST of Clonorchis sinensis as shown by multiple sequence alignment and phylogenetic analysis. Northern analysis of total RNA with a gene-specific probe revealed a 900 nucleotide OV28GST transcriptional product in the adult parasite. Through RNA in situ hybridization OV28GST RNA was detected in the parenchymal cells of adult parasites. This result was confirmed by immunolocalization of OV28GST with an antiserum generated in a mouse against bacterially-produced recombinant OV28GST. Both, purified recombinant and purified native OV28GST were resolved as 28 kDa proteins by SDS-PAGE. Using the anti-recOV28GST antiserum, no or only weak cross-reactivity was observed in an immunoblot of crude worm extracts against the GSTs of Schistosoma mansoni, S. japonicum, S. mekongi, Eurytrema spp. and Fasciola gigantica. The enzyme activity of the purified recombinant OV28GST was verified by a standard 1-chloro-2, 4-dinitrobenzene (CDNB) based activity assay. The present results of our molecular analysis of OV28GST should be helpful in the ongoing development of diagnostic applications for opisthorchiasis viverrini.

  1. Cloning and characterization of a delta-6 desaturase encoding gene from Nannochloropsis oculata

    Science.gov (United States)

    Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Pan, Kehou; Pan, Jin; Yang, Guanpin

    2011-03-01

    A gene ( NANOC-D6D) encoding a desaturase that removes two hydrogen atoms from fatty acids at delta 6 position was isolated from a cDNA library of Nannochloropsis oculata (Droop) D. J. Hibberd (Eustigmatophyceae). The unicellular marine microalga N. oculata synthesizes rich long chain polyunsaturated fatty acids (LCPUFAs), including eicosapentaenoic acid (20:5n-3, EPA). The deduced protein contains 474 amino acids that fold into 4 trans-membrane domains. The neighbor-joining phylogenetic tree indicates that NANOC-D6D is phylogenetically close to the delta-6 fatty acid desaturase of marine microalgae such as Glossomastix chrysoplasta, Thalassiosira pseudonana, and Phaeodactylum tricornutum. The gene was expressed in Saccharomyces cerevisiae INVScl to verify the substrate specificity of NANOC-D6D. Our results suggest that the recombinant NANOC-D6D simultaneously desaturates linoleic acid (LA) and α-linolenic acid (ALA).

  2. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  3. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  4. Multidrug resistance in fungi: regulation of transporter-encoding gene expression.

    Science.gov (United States)

    Paul, Sanjoy; Moye-Rowley, W Scott

    2014-01-01

    A critical risk to the continued success of antifungal chemotherapy is the acquisition of resistance; a risk exacerbated by the few classes of effective antifungal drugs. Predictably, as the use of these drugs increases in the clinic, more resistant organisms can be isolated from patients. A particularly problematic form of drug resistance that routinely emerges in the major fungal pathogens is known as multidrug resistance. Multidrug resistance refers to the simultaneous acquisition of tolerance to a range of drugs via a limited or even single genetic change. This review will focus on recent progress in understanding pathways of multidrug resistance in fungi including those of most medical relevance. Analyses of multidrug resistance in Saccharomyces cerevisiae have provided the most detailed outline of multidrug resistance in a eukaryotic microorganism. Multidrug resistant isolates of S. cerevisiae typically result from changes in the activity of a pair of related transcription factors that in turn elicit overproduction of several target genes. Chief among these is the ATP-binding cassette (ABC)-encoding gene PDR5. Interestingly, in the medically important Candida species, very similar pathways are involved in acquisition of multidrug resistance. In both C. albicans and C. glabrata, changes in the activity of transcriptional activator proteins elicits overproduction of a protein closely related to S. cerevisiae Pdr5 called Cdr1. The major filamentous fungal pathogen, Aspergillus fumigatus, was previously thought to acquire resistance to azole compounds (the principal antifungal drug class) via alterations in the azole drug target-encoding gene cyp51A. More recent data indicate that pathways in addition to changes in the cyp51A gene are important determinants in A. fumigatus azole resistance. We will discuss findings that suggest azole resistance in A. fumigatus and Candida species may share more mechanistic similarities than previously thought.

  5. Cell type-specific transcriptional regulation of the gene encoding importin-α1

    International Nuclear Information System (INIS)

    Kamikawa, Yasunao; Yasuhara, Noriko; Yoneda, Yoshihiro

    2011-01-01

    Importin-α1 belongs to a receptor family that recognizes classical nuclear localization signals. Encoded by Kpna2, this receptor subtype is highly expressed in mouse embryonic stem (ES) cells. In this study, we identified a critical promoter region in Kpna2 and showed that the expression of this gene is differentially regulated in ES cells and NIH3T3 cells. Conserved CCAAT boxes are required for Kpna2 promoter activity in both ES and NIH3T3 cells. Interestingly, deletion of the region from nucleotide position - 251 to - 179 bp resulted in a drastic reduction in Kpna2 transcriptional activity only in ES cells. This region contains Krueppel-like factor (Klf) binding sequences and is responsible for transactivation of the gene by Klf2 and Klf4. Accordingly, endogenous Kpna2 mRNA levels decreased in response to depletion of Klf2 and Klf4 in ES cells. Our results suggest that Klf2 and Klf4 function redundantly to drive high level of Kpna2 expression in ES cells. -- Research Highlights: → We showed the cell type-specific transcriptional regulation of Kpna2 encoding importin-al. → NF-Y binds the CCAAT boxes to activate Kpna2 transcription in NIH3T3 cells. → Klf2 and Klf4 redundantly activate the expression of Kpna2 in ES cells.

  6. Cloning, sequencing and expression of the gene encoding the extracellular metalloprotease of Aeromonas caviae.

    Science.gov (United States)

    Kawakami, K; Toma, C; Honma, Y

    2000-01-01

    A gene (apk) encoding the extracellular protease of Aeromonas caviae Ae6 has been cloned and sequenced. For cloning the gene, the DNA genomic library was screened using skim milk LB agar. One clone harboring plasmid pKK3 was selected for sequencing. Nucleotide sequencing of the 3.5 kb region of pKK3 revealed a single open reading frame (ORF) of 1,785 bp encoding 595 amino acids. The deduced polypeptide contained a putative 16-amino acid signal peptide followed by a large propeptide. The N-terminal amino acid sequence of purified recombinant protein (APK) was consistent with the DNA sequence. This result suggested a mature protein of 412 amino acids with a molecular mass of 44 kDa. However, the molecular mass of purified recombinant APK revealed 34 kDa by SDS-PAGE, suggesting that further processing at the C-terminal region took place. The 2 motifs of zinc binding sites deduced are highly conserved in the APK as well as in other zinc metalloproteases including Vibrio proteolyticus neutral protease, Emp V from Vibrio vulnificus, HA/P from Vibrio cholerae, and Pseudomonas aeruginosa elastase. Proteolytic activity was inhibited by EDTA, Zincov, 1,10-phenanthroline and tetraethylenepentamine while unaffected by the other inhibitors tested. The protease showed maximum activity at pH 7.0 and was inactivated by heating at 80 C for 15 min. These results together suggest that APK belongs to the thermolysin family of metalloendopeptidases.

  7. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  8. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    Directory of Open Access Journals (Sweden)

    Suma Choorapoikayil

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena+/−ptenb−/− or ptena−/−ptenb+/− are viable and fertile. ptena+/−ptenb−/− fish develop tumors at a relatively high incidence (10.2% and most tumors developed close to the eye (26/30. Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena−/−ptenb+/− fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena+/−ptenb−/− and ptena−/−ptenb+/− fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena+/−ptenb−/− zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  9. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.

    Science.gov (United States)

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José

    2010-11-01

    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  10. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma.

    Science.gov (United States)

    Choorapoikayil, Suma; Kuiper, Raoul V; de Bruin, Alain; den Hertog, Jeroen

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile. ptena(+/-)ptenb(-/-) fish develop tumors at a relatively high incidence (10.2%) and most tumors developed close to the eye (26/30). Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena(-/-)ptenb(+/-) fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena(+/-)ptenb(-/-) and ptena(-/-)ptenb(+/-) fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena(+/-)ptenb(-/-) zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  11. The upstream regulatory sequence of the light harvesting complex Lhcf2 gene of the marine diatom Phaeodactylum tricornutum enhances transcription in an orientation- and distance-independent fashion.

    Science.gov (United States)

    Russo, Monia Teresa; Annunziata, Rossella; Sanges, Remo; Ferrante, Maria Immacolata; Falciatore, Angela

    2015-12-01

    Diatoms are a key phytoplankton group in the contemporary ocean, showing extraordinary adaptation capacities to rapidly changing environments. The recent availability of whole genome sequences from representative species has revealed distinct features in their genomes, like novel combinations of genes encoding distinct metabolisms and a significant number of diatom-specific genes. However, the regulatory mechanisms driving diatom gene expression are still largely uncharacterized. Considering the wide variety of fields of study orbiting diatoms, ranging from ecology, evolutionary biology to biotechnology, it is thus essential to increase our understanding of fundamental gene regulatory processes such as transcriptional regulation. To this aim, we explored the functional properties of the 5'-flanking region of the Phaeodatylum tricornutum Lhcf2 gene, encoding a member of the Light Harvesting Complex superfamily and we showed that this region enhances transcription of a GUS reporter gene in an orientation- and distance-independent fashion. This represents the first example of a cis-regulatory sequence with enhancer-like features discovered in diatoms and it is instrumental for the generation of novel genetic tools and diatom exploitation in different areas of study. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Co-ordinate regulation of Salmonella typhimurium invasion genes by environmental and regulatory factors is mediated by control of hilA expression.

    Science.gov (United States)

    Bajaj, V; Lucas, R L; Hwang, C; Lee, C A

    1996-11-01

    During infection of their hosts, salmonellae enter intestinal epithelial cells. It has been proposed that when Salmonella typhimurium is present in the intestinal lumen, several environmental and regulatory conditions modulate the expression of invasion factors required for bacterial entry into host cells. We report here that the expression of six different S. typhimurium invasion genes encoded on SPI1 (Salmonella pathogenicity island 1) is co-ordinately regulated by oxygen, osmolarity, pH, PhoPQ, and HilA. HilA is a transcriptional activator of the OmpR/ToxR family that is also encoded on SPI1. We have found that HilA plays a central role in the co-ordinated regulation of invasion genes by environmental and regulatory conditions. HilA can activate the expression of two invasion gene-lacZY fusions on reporter plasmids in Escherichia coll, suggesting that HilA acts directly at invasion-gene promoters in S. typhimurium. We have found that the regulation of invasion genes by oxygen, osmolarity, pH, and PhoPQ is indirect and is mediated by regulation of hilA expression by these environmental and regulatory factors. We hypothesize that the complex and co-ordinate regulation of Invasion genes by HilA is an important feature of salmonella pathogenesis and allows salmonellae to enter intestinal epithelial cells.

  13. Virulence control in group A Streptococcus by a two-component gene regulatory system: global expression profiling and in vivo infection modeling.

    Science.gov (United States)

    Graham, Morag R; Smoot, Laura M; Migliaccio, Cristi A Lux; Virtaneva, Kimmo; Sturdevant, Daniel E; Porcella, Stephen F; Federle, Michael J; Adams, Gerald J; Scott, June R; Musser, James M

    2002-10-15

    Two-component gene regulatory systems composed of a membrane-bound sensor and cytoplasmic response regulator are important mechanisms used by bacteria to sense and respond to environmental stimuli. Group A Streptococcus, the causative agent of mild infections and life-threatening invasive diseases, produces many virulence factors that promote survival in humans. A two-component regulatory system, designated covRS (cov, control of virulence; csrRS), negatively controls expression of five proven or putative virulence factors (capsule, cysteine protease, streptokinase, streptolysin S, and streptodornase). Inactivation of covRS results in enhanced virulence in mouse models of invasive disease. Using DNA microarrays and quantitative RT-PCR, we found that CovR influences transcription of 15% (n = 271) of all chromosomal genes, including many that encode surface and secreted proteins mediating host-pathogen interactions. CovR also plays a central role in gene regulatory networks by influencing expression of genes encoding transcriptional regulators, including other two-component systems. Differential transcription of genes influenced by covR also was identified in mouse soft-tissue infection. This analysis provides a genome-scale overview of a virulence gene network in an important human pathogen and adds insight into the molecular mechanisms used by group A Streptococcus to interact with the host, promote survival, and cause disease.

  14. Identifying key genes in glaucoma based on a benchmarked dataset and the gene regulatory network.

    Science.gov (United States)

    Chen, Xi; Wang, Qiao-Ling; Zhang, Meng-Hui

    2017-10-01

    The current study aimed to identify key genes in glaucoma based on a benchmarked dataset and gene regulatory network (GRN). Local and global noise was added to the gene expression dataset to produce a benchmarked dataset. Differentially-expressed genes (DEGs) between patients with glaucoma and normal controls were identified utilizing the Linear Models for Microarray Data (Limma) package based on benchmarked dataset. A total of 5 GRN inference methods, including Zscore, GeneNet, context likelihood of relatedness (CLR) algorithm, Partial Correlation coefficient with Information Theory (PCIT) and GEne Network Inference with Ensemble of Trees (Genie3) were evaluated using receiver operating characteristic (ROC) and precision and recall (PR) curves. The interference method with the best performance was selected to construct the GRN. Subsequently, topological centrality (degree, closeness and betweenness) was conducted to identify key genes in the GRN of glaucoma. Finally, the key genes were validated by performing reverse transcription-quantitative polymerase chain reaction (RT-qPCR). A total of 176 DEGs were detected from the benchmarked dataset. The ROC and PR curves of the 5 methods were analyzed and it was determined that Genie3 had a clear advantage over the other methods; thus, Genie3 was used to construct the GRN. Following topological centrality analysis, 14 key genes for glaucoma were identified, including IL6 , EPHA2 and GSTT1 and 5 of these 14 key genes were validated by RT-qPCR. Therefore, the current study identified 14 key genes in glaucoma, which may be potential biomarkers to use in the diagnosis of glaucoma and aid in identifying the molecular mechanism of this disease.

  15. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae

    Science.gov (United States)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  16. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  17. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  18. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  19. Creating and validating cis-regulatory maps of tissue-specific gene expression regulation

    Science.gov (United States)

    O'Connor, Timothy R.; Bailey, Timothy L.

    2014-01-01

    Predicting which genomic regions control the transcription of a given gene is a challenge. We present a novel computational approach for creating and validating maps that associate genomic regions (cis-regulatory modules–CRMs) with genes. The method infers regulatory relationships that explain gene expression observed in a test tissue using widely available genomic data for ‘other’ tissues. To predict the regulatory targets of a CRM, we use cross-tissue correlation between histone modifications present at the CRM and expression at genes within 1 Mbp of it. To validate cis-regulatory maps, we show that they yield more accurate models of gene expression than carefully constructed control maps. These gene expression models predict observed gene expression from transcription factor binding in the CRMs linked to that gene. We show that our maps are able to identify long-range regulatory interactions and improve substantially over maps linking genes and CRMs based on either the control maps or a ‘nearest neighbor’ heuristic. Our results also show that it is essential to include CRMs predicted in multiple tissues during map-building, that H3K27ac is the most informative histone modification, and that CAGE is the most informative measure of gene expression for creating cis-regulatory maps. PMID:25200088

  20. Biochemical and molecular analysis of pink tomatoes: deregulated expression of the gene encoding transcription factor SlMYB12 leads to pink tomato fruit color.

    Science.gov (United States)

    Ballester, Ana-Rosa; Molthoff, Jos; de Vos, Ric; Hekkert, Bas te Lintel; Orzaez, Diego; Fernández-Moreno, Josefina-Patricia; Tripodi, Pasquale; Grandillo, Silvana; Martin, Cathie; Heldens, Jos; Ykema, Marieke; Granell, Antonio; Bovy, Arnaud

    2010-01-01

    The color of tomato fruit is mainly determined by carotenoids and flavonoids. Phenotypic analysis of an introgression line (IL) population derived from a cross between Solanum lycopersicum 'Moneyberg' and the wild species Solanum chmielewskii revealed three ILs with a pink fruit color. These lines had a homozygous S. chmielewskii introgression on the short arm of chromosome 1, consistent with the position of the y (yellow) mutation known to result in colorless epidermis, and hence pink-colored fruit, when combined with a red flesh. Metabolic analysis showed that pink fruit lack the ripening-dependent accumulation of the yellow-colored flavonoid naringenin chalcone in the fruit peel, while carotenoid levels are not affected. The expression of all genes encoding biosynthetic enzymes involved in the production of the flavonol rutin from naringenin chalcone was down-regulated in pink fruit, suggesting that the candidate gene underlying the pink phenotype encodes a regulatory protein such as a transcription factor rather than a biosynthetic enzyme. Of 26 MYB and basic helix-loop-helix transcription factors putatively involved in regulating transcription of genes in the phenylpropanoid and/or flavonoid pathway, only the expression level of the MYB12 gene correlated well with the decrease in the expression of structural flavonoid genes in peel samples of pink- and red-fruited genotypes during ripening. Genetic mapping and segregation analysis showed that MYB12 is located on chromosome 1 and segregates perfectly with the characteristic pink fruit color. Virus-induced gene silencing of SlMYB12 resulted in a decrease in the accumulation of naringenin chalcone, a phenotype consistent with the pink-colored tomato fruit of IL1b. In conclusion, biochemical and molecular data, gene mapping, segregation analysis, and virus-induced gene silencing experiments demonstrate that the MYB12 transcription factor plays an important role in regulating the flavonoid pathway in tomato fruit

  1. Adenovirus carrying gene encoding Haliotis discus discus sialic acid binding lectin induces cancer cell apoptosis.

    Science.gov (United States)

    Yang, Xinyan; Wu, Liqin; Duan, Xuemei; Cui, Lianzhen; Luo, Jingjing; Li, Gongchu

    2014-06-30

    Lectins exist widely in marine bioresources such as bacteria, algae, invertebrate animals and fishes. Some purified marine lectins have been found to elicit cytotoxicity to cancer cells. However, there are few reports describing the cytotoxic effect of marine lectins on cancer cells through virus-mediated gene delivery. We show here that a replication-deficient adenovirus-carrying gene encoding Haliotis discus discus sialic acid binding lectin (Ad.FLAG-HddSBL) suppressed cancer cell proliferation by inducing apoptosis, as compared to the control virus Ad.FLAG. A down-regulated level of anti-apoptosis factor Bcl-2 was suggested to be responsible for the apoptosis induced by Ad.FLAG-HddSBL infection. Further subcellular localization studies revealed that HddSBL distributed in cell membrane, ER, and the nucleus, but not in mitochondria and Golgi apparatus. In contrast, a previously reported mannose-binding lectin Pinellia pedatisecta agglutinin entered the nucleus as well, but did not distribute in inner membrane systems, suggesting differed intracellular sialylation and mannosylation, which may provide different targets for lectin binding. Further cancer-specific controlling of HddSBL expression and animal studies may help to provide insights into a novel way of anti-cancer marine lectin gene therapy. Lectins may provide a reservoir of anti-cancer genes.

  2. The Bradyrhizobium japonicum frcB Gene Encodes a Diheme Ferric Reductase ▿†

    Science.gov (United States)

    Small, Sandra K.; O'Brian, Mark R.

    2011-01-01

    Iron utilization by bacteria in aerobic environments involves uptake as a ferric chelate from the environment, followed by reduction to the ferrous form. Ferric iron reduction is poorly understood in most bacterial species. Here, we identified Bradyrhizobium japonicum frcB (bll3557) as a gene adjacent to, and coregulated with, the pyoR gene (blr3555) encoding the outer membrane receptor for transport of a ferric pyoverdine. FrcB is a membrane-bound, diheme protein, characteristic of eukaryotic ferric reductases. Heme was essential for FrcB stability, as were conserved histidine residues in the protein that likely coordinate the heme moieties. Expression of the frcB gene in Escherichia coli conferred ferric reductase activity on those cells. Furthermore, reduced heme in purified FrcB was oxidized by ferric iron in vitro. B. japonicum cells showed inducible ferric reductase activity in iron-limited cells that was diminished in an frcB mutant. Steady-state levels of frcB mRNA were strongly induced under iron-limiting conditions, but transcript levels were low and unresponsive to iron in an irr mutant lacking the global iron response transcriptional regulator Irr. Thus, Irr positively controls the frcB gene. FrcB belongs to a family of previously uncharacterized proteins found in many proteobacteria and some cyanobacteria. This suggests that membrane-bound, heme-containing ferric reductase proteins are not confined to eukaryotes but may be common in bacteria. PMID:21705608

  3. The Bradyrhizobium japonicum frcB gene encodes a diheme ferric reductase.

    Science.gov (United States)

    Small, Sandra K; O'Brian, Mark R

    2011-08-01

    Iron utilization by bacteria in aerobic environments involves uptake as a ferric chelate from the environment, followed by reduction to the ferrous form. Ferric iron reduction is poorly understood in most bacterial species. Here, we identified Bradyrhizobium japonicum frcB (bll3557) as a gene adjacent to, and coregulated with, the pyoR gene (blr3555) encoding the outer membrane receptor for transport of a ferric pyoverdine. FrcB is a membrane-bound, diheme protein, characteristic of eukaryotic ferric reductases. Heme was essential for FrcB stability, as were conserved histidine residues in the protein that likely coordinate the heme moieties. Expression of the frcB gene in Escherichia coli conferred ferric reductase activity on those cells. Furthermore, reduced heme in purified FrcB was oxidized by ferric iron in vitro. B. japonicum cells showed inducible ferric reductase activity in iron-limited cells that was diminished in an frcB mutant. Steady-state levels of frcB mRNA were strongly induced under iron-limiting conditions, but transcript levels were low and unresponsive to iron in an irr mutant lacking the global iron response transcriptional regulator Irr. Thus, Irr positively controls the frcB gene. FrcB belongs to a family of previously uncharacterized proteins found in many proteobacteria and some cyanobacteria. This suggests that membrane-bound, heme-containing ferric reductase proteins are not confined to eukaryotes but may be common in bacteria.

  4. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa

    2015-04-01

    Full Text Available The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produce a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous genes. We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters.

  5. Hypoxia-inducible genes encoding small EF-hand proteins in rice and tomato.

    Science.gov (United States)

    Otsuka, Chie; Minami, Ikuko; Oda, Kenji

    2010-01-01

    Rice has evolved metabolic and morphological adaptations to low-oxygen stress to grow in submerged paddy fields. To characterize the molecular components that mediate the response to hypoxia in rice, we identified low-oxygen stress early response genes by microarray analysis. Among the highly responsive genes, five genes, OsHREF1 to OsHREF5, shared strong homology. They encoded small proteins harboring two EF-hands, typical Ca(2+)-binding motifs. Homologous genes were found in many land plants, including SlHREF in tomato, which is also strongly induced by hypoxia. SlHREF induction was detected in both roots and shoots of tomato plants under hypoxia. With the exception of OsHREF5, OsHREF expression was unaffected by drought, salinity, cold, or osmotic stress. Fluorescent signals of green fluorescent protein-fused OsHREFs were detected in the cytosol and nucleus. Ruthenium red, an inhibitor of intracellular Ca(2+) release, repressed induction of OsHREF1-4 under hypoxia. The HREFs may be related to the Ca(2+) response to hypoxia.

  6. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  7. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans

    Science.gov (United States)

    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja

    2003-01-01

    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress. PMID:15115284

  8. Mitochondrial Genes of Dinoflagellates Are Transcribed by a Nuclear-Encoded Single-Subunit RNA Polymerase.

    Directory of Open Access Journals (Sweden)

    Chang Ying Teng

    Full Text Available Dinoflagellates are a large group of algae that contribute significantly to marine productivity and are essential photosynthetic symbionts of corals. Although these algae have fully-functioning mitochondria and chloroplasts, both their organelle genomes have been highly reduced and the genes fragmented and rearranged, with many aberrant transcripts. However, nothing is known about their RNA polymerases. We cloned and sequenced the gene for the nuclear-encoded mitochondrial polymerase (RpoTm of the dinoflagellate Heterocapsa triquetra and showed that the protein presequence targeted a GFP construct into yeast mitochondria. The gene belongs to a small gene family, which includes a variety of 3'-truncated copies that may have originated by retroposition. The catalytic C-terminal domain of the protein shares nine conserved sequence blocks with other single-subunit polymerases and is predicted to have the same fold as the human enzyme. However, the N-terminal (promoter binding/transcription initiation domain is not well-conserved. In conjunction with the degenerate nature of the mitochondrial genome, this suggests a requirement for novel accessory factors to ensure the accurate production of functional mRNAs.

  9. Polymorphisms in genes encoding the serotonin and dopamine pathways in two sisters with metachromatic leukodystrophy.

    Science.gov (United States)

    Kumperscak, H G; Dolzan, V; Videtic, A; Plesnicar, B K

    2008-01-01

    Metachromatic leukodystrophy (MLD) is a metabolic disease that has recently been investigated as a model for the study of psychosis. We report on two sisters with adult-type MLD who developed psychiatric symptomatology, but differed in their expression of psychotic and depressive symptoms. Association studies have indicated that polymorphisms in genes encoding the serotonin and dopamine transporters and receptors are related to the symptomatology of schizophrenia and/or depression; hence both sisters were genotyped for some of these candidate genes. The sisters shared dopamine receptor D(2) (DRD(2)) c.1047GG (p.311Ser/Ser) and c.-141Cins/ins polymorphisms, which are significantly associated with schizophrenia, but differed in the serotonin transporter gene-linked polymorphic region and serotonin receptor 1A (5-HT(1A)) c.-1019C to G polymorphisms, which may have increased the elder sister's susceptibility to depressive symptoms. Much bigger samples would be needed to gain enough statistical power to develop any hypotheses. This is the first report on genotyping MLD patients for candidate genes for psychiatric disorders, although MLD has been proposed as a model for schizophrenia.

  10. EXPRESSION OF B-XYLOSIDASE ENCODING GENE IN PHIS/ BACILLUS MEGATERIUM MS SYSTEM

    Directory of Open Access Journals (Sweden)

    sri sumarsih

    2011-01-01

    Full Text Available b-Xylosidase encoding gene from G. thermoleovorans IT-08 had been expressed in the pHIS1525/ B. megaterium MS941 system. The b-xylosidase gene (xyl was inserted into plasmid pHIS1525 and propagated in E. coli DH10b. The recombinant plasmid was transformed into B. megaterium MS941 by protoplast transformation. Transformants were selected by growing the recombinant cells on solid LB medium containing tetracycline (10 µg/ ml. The expression of the b-xylosidase gene was assayed by overlaid the recombinant B. megaterium MS941 cell with agar medium containing 0.2% ethylumbelliferyl-b-D-xyloside (MUX. This research showed that the b-xylosidase gene was succesfully sub-cloned in pHIS1525 system and expressed by the recombinant B. megaterium MS941. Theaddition of 0.5% xylose into the culture medium could increase the activity of recombinantactivity of recombinant of recombinantb-xylosidase by 2.74 fold. The recombinant B. megaterium MS941 secreted 75.56% of the expressed b-xylosidase into culture medium. The crude extract b-xylosidase showed the optimum activity at 50° C and pH 6. The recombinant b-xylosidase was purified from culture supernatant by affinity chromatographic method using agarose containing Ni-NTA (Nickel-Nitrilotriacetic acid. The pure b-xylosidase showed a specific activity of 10.06 Unit/mg protein and relative molecular weight ± 58 kDa.

  11. Evidence of gene conversion in genes encoding the Gal/GalNac lectin complex of Entamoeba.

    Directory of Open Access Journals (Sweden)

    Gareth D Weedall

    2011-06-01

    Full Text Available The human gut parasite Entamoeba histolytica, uses a lectin complex on its cell surface to bind to mucin and to ligands on the intestinal epithelia. Binding to mucin is necessary for colonisation and binding to intestinal epithelia for invasion, therefore blocking this binding may protect against amoebiasis. Acquired protective immunity raised against the lectin complex should create a selection pressure to change the amino acid sequence of lectin genes in order to avoid future detection. We present evidence that gene conversion has occurred in lineages leading to E. histolytica strain HM1:IMSS and E. dispar strain SAW760. This evolutionary mechanism generates diversity and could contribute to immune evasion by the parasites.

  12. Enhanced expression in tobacco of the gene encoding green fluorescent protein by modification of its codon usage

    NARCIS (Netherlands)

    Rouwendal, G.J.A.; Mendes, O.; Wolbert, E.J.H.; Boer, de A.D.

    1997-01-01

    The gene encoding green fluorescent protein (GFP) from Aequorea victoria was resynthesized to adapt its codon usage for expression in plants by increasing the frequency of codons with a C or a G in the third position from 32 to 60%. The strategy for constructing the synthetic gfp gene was based on

  13. Prevalence of genes encoding for members of the staphylococcal leukotoxin family among clinical isolates of Staphylococcus aureus

    NARCIS (Netherlands)

    von Eiff, Christof; Friedrich, Alexander W.; Peters, Georg; Becker, Karsten

    Well-characterized Staphylococcus aureus nasal and blood isolates (N = 429) were tested by polymerase chain reaction for the prevalence of genes that encode leukocidal toxins. The leukotoxin genes lukE+lukD were found at high prevalence, significantly more so in blood (82%) than in nasal isolates

  14. Cloning and Characterization of a Gene (mspA) Encoding the Major Sheath Protein of Treponema maltophilum ATCC 51939T

    Science.gov (United States)

    Heuner, Klaus; Choi, Bong-Kyu; Schade, Rüdiger; Moter, Annette; Otto, Albrecht; Göbel, Ulf B.

    1999-01-01

    The major sheath protein-encoding gene (mspA) of the oral spirochete Treponema maltophilum ATCC 51939T was cloned by screening a genomic library with an anti-outer membrane fraction antibody. The mspA gene encodes a precursor protein of 575 amino acids with a predicted molecular mass of 62.3 kDa, including a signal peptide of 19 amino acids. The native MspA formed a heat-modifiable, detergent- and trypsin-stable complex which is associated with the outer membrane. Hybridization with an mspA-specific probe showed no cross-reactivity with the msp gene from Treponema denticola. PMID:9922270

  15. Direct activation of EXPANSIN14 by LBD18 in the gene regulatory network of lateral root formation in Arabidopsis.

    Science.gov (United States)

    Kim, Jungmook; Lee, Han Woo

    2013-02-01

    Root system architecture is important for plants to adapt to a changing environment. The major determinant of the root system is lateral roots originating from the primary root. The developmental process of lateral root formation can be divided into priming, initiation, primordium development and the emergence of lateral roots, and is well characterized in Arabidopsis. The hormone auxin plays a critical role in lateral root development, and several auxin response modules involving AUXIN RESPONSE FACTORS (ARFs), transcriptional regulators of auxin-regulated genes and Aux/IAA, negative regulators of ARFs, regulate lateral root formation. The LATERAL ORGAN BOUNDARIES DOMAIN/ASYMMETRIC LEAVES2-LIKE (LBD/ASL) gene family encodes a unique class of transcription factors harbouring a conserved plant-specific lateral organ boundary domain and plays a role in lateral organ development of plants including lateral root formation. In our previous study, we showed that LBD18 stimulates lateral root formation in combination with LBD16 downstream of ARF7 and ARF19 during the auxin response. We have recently demonstrated that LBD18 activates expression of EXP14, a gene encoding the cell-wall loosening factor, by directly binding to the EXP14 promoter to promote lateral root emergence. Here we present the molecular function of LBD18 and its gene regulatory network during lateral root formation.

  16. The nomenclature of MHC class I gene regulatory regions - the case of two different downstream regulatory elements

    Czech Academy of Sciences Publication Activity Database

    Hatina, J.; Jansa, Petr; Forejt, Jiří

    2001-01-01

    Roč. 37, 12-13 (2001), s. 799-800 ISSN 0161-5890 Institutional research plan: CEZ:AV0Z5052915 Keywords : MHC I gene regulatory elements Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.973, year: 2001

  17. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters.

    Science.gov (United States)

    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H

    2016-01-01

    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. DMPD: Type I interferon [corrected] gene induction by the interferon regulatory factorfamily of transcription factors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16979567 Type I interferon [corrected] gene induction by the interferon regulatory factorfamily...ng) (.svg) (.html) (.csml) Show Type I interferon [corrected] gene induction by the interferon regulatory factorfamily...orrected] gene induction by the interferon regulatory factorfamily of transcription factors. Authors Honda K

  19. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  20. The gene cutA of Fusarium fujikuroi, encoding a protein of the haloacid dehalogenase family, is involved in osmotic stress and glycerol metabolism.

    Science.gov (United States)

    García-Martínez, Jorge; Castrillo, Marta; Avalos, Javier

    2014-01-01

    Survival of micro-organisms in natural habitats depends on their ability to adapt to variations in osmotic conditions. We previously described the gene cut-1 of Neurospora crassa, encoding a protein of the haloacid dehalogenase family with an unknown function in the osmotic stress response. Here we report on the functional analysis of cutA, the orthologous gene in the phytopathogenic fungus Fusarium fujikuroi. cutA mRNA levels increased transiently after exposure to 0.68 M NaCl and were reduced upon return to normal osmotic conditions; deletion of the gene resulted in a partial reduction in tolerance to osmotic stress. ΔcutA mutants contained much lower intracellular levels of glycerol than the wild-type, and did not exhibit the increase following hyper-osmotic shock expected from the high osmolarity glycerol (HOG) response. cutA is linked and divergently transcribed with the putative glycerol dehydrogenase gene gldB, which showed the same regulation by osmotic shock. The intergenic cutA/gldB regulatory region contains putative stress-response elements conserved in other fungi, and both genes shared other regulatory features, such as induction by heat shock and by illumination. Photoinduction was also observed in the HOG response gene hogA, and was lost in mutants of the white collar gene wcoA. Previous data on glycerol production in Aspergillus spp. and features of the predicted CutA protein lead us to propose that F. fujikuroi produces glycerol from dihydroxyacetone, and that CutA is the enzyme involved in the synthesis of this precursor by dephosphorylation of dihydroxyacetone-3P.

  1. Demonstration of expression of a neuropeptide-encoding gene in crustacean hemocytes.

    Science.gov (United States)

    Wu, Su-Hua; Chen, Yan-Jhou; Huang, Shao-Yen; Tsai, Wei-Shiun; Wu, Hsin-Ju; Hsu, Tsan-Ting; Lee, Chi-Ying

    2012-04-01

    Crustacean hyperglycemic hormone (CHH) was originally identified in a neuroendocrine system-the X-organ/sinus gland complex. In this study, a cDNA (Prc-CHH) encoding CHH precursor was cloned from the hemocyte of the crayfish Procambarus clarkii. Analysis of tissues by a CHH-specific enzyme-linked immunosorbent assay (ELISA) confirmed the presence of CHH in hemocytes, the levels of which were much lower than those in the sinus gland, but 2 to 10 times higher than those in the thoracic and cerebral ganglia. Total hemocytes were separated by density gradient centrifugation into layers of hyaline cell (HC), semi-granular cell (SGC), and granular cell (GC). Analysis of extracts of each layer using ELISA revealed that CHH is present in GCs (202.8±86.7 fmol/mg protein) and SGCs (497.8±49.4 fmol/mg protein), but not in HCs. Finally, CHH stimulated the membrane-bound guanylyl cyclase (GC) activity of hemocytes in a dose-dependent manner. These data for the first time confirm that a crustacean neuropeptide-encoding gene is expressed in cells essential for immunity and its expression in hemocytes is cell type-specific. Effect of CHH on the membrane-bound GC activity of hemocyte suggests that hemocyte is a target site of CHH. Possible functions of the hemocyte-derived CHH are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Lateral gene transfer of streptococcal ICE element RD2 (region of difference 2 encoding secreted proteins

    Directory of Open Access Journals (Sweden)

    Mereghetti Laurent

    2011-04-01

    Full Text Available Abstract Background The genome of serotype M28 group A Streptococcus (GAS strain MGAS6180 contains a novel genetic element named Region of Difference 2 (RD2 that encodes seven putative secreted extracellular proteins. RD2 is present in all serotype M28 strains and strains of several other GAS serotypes associated with female urogenital infections. We show here that the GAS RD2 element is present in strain MGAS6180 both as an integrative chromosomal form and a circular extrachromosomal element. RD2-like regions were identified in publicly available genome sequences of strains representing three of the five major group B streptococcal serotypes causing human disease. Ten RD2-encoded proteins have significant similarity to proteins involved in conjugative transfer of Streptococcus thermophilus integrative chromosomal elements (ICEs. Results We transferred RD2 from GAS strain MGAS6180 (serotype M28 to serotype M1 and M4 GAS strains by filter mating. The copy number of the RD2 element was rapidly and significantly increased following treatment of strain MGAS6180 with mitomycin C, a DNA damaging agent. Using a PCR-based method, we also identified RD2-like regions in multiple group C and G strains of Streptococcus dysgalactiae subsp.equisimilis cultured from invasive human infections. Conclusions Taken together, the data indicate that the RD2 element has disseminated by lateral gene transfer to genetically diverse strains of human-pathogenic streptococci.

  3. The zebrafish moonshine gene encodes transcriptional intermediary factor 1gamma, an essential regulator of hematopoiesis.

    Directory of Open Access Journals (Sweden)

    David G Ransom

    2004-08-01

    Full Text Available Hematopoiesis is precisely orchestrated by lineage-specific DNA-binding proteins that regulate transcription in concert with coactivators and corepressors. Mutations in the zebrafish moonshine (mon gene specifically disrupt both embryonic and adult hematopoiesis, resulting in severe red blood cell aplasia. We report that mon encodes the zebrafish ortholog of mammalian transcriptional intermediary factor 1gamma (TIF1gamma (or TRIM33, a member of the TIF1 family of coactivators and corepressors. During development, hematopoietic progenitor cells in mon mutants fail to express normal levels of hematopoietic transcription factors, including gata1, and undergo apoptosis. Three different mon mutant alleles each encode premature stop codons, and enforced expression of wild-type tif1gamma mRNA rescues embryonic hematopoiesis in homozygous mon mutants. Surprisingly, a high level of zygotic tif1gamma mRNA expression delineates ventral mesoderm during hematopoietic stem cell and progenitor formation prior to gata1 expression. Transplantation studies reveal that tif1gamma functions in a cell-autonomous manner during the differentiation of erythroid precursors. Studies in murine erythroid cell lines demonstrate that Tif1gamma protein is localized within novel nuclear foci, and expression decreases during erythroid cell maturation. Our results establish a major role for this transcriptional intermediary factor in the differentiation of hematopoietic cells in vertebrates.

  4. Constructing gene regulatory networks for long term photosynthetic light acclimation in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Chen Bor-Sen

    2011-08-01

    Full Text Available Abstract Background Photosynthetic light acclimation is an important process that allows plants to optimize the efficiency of photosynthesis, which is the core technology for green energy. However, currently little is known about the molecular mechanisms behind the regulation of the photosynthetic light acclimation response. In this study, a systematic method is proposed to investigate this mechanism by constructing gene regulatory networks from microarray data of Arabidopsis thaliana. Methods The potential TF-gene regulatory pairs of photosynthetic light acclimation have been obtained by data mining of literature and databases. Following the identification of these potential TF-gene pairs, they have been refined using Pearson's correlation, allowing the construction of a rough gene regulatory network. This rough gene regulatory network is then pruned using time series microarray data of Arabidopsis thaliana via the maximum likelihood system identification method and Akaike's system order detection method to approach the real gene regulatory network of photosynthetic light acclimation. Results By comparing the gene regulatory networks under the PSI-to-PSII light shift and the PSII-to-PSI light shift, it is possible to identify important transcription factors for the different light shift conditions. Furthermore, the robustness of the gene network, in particular the hubs and weak linkage points, are also discussed under the different light conditions to gain further insight into the mechanisms of photosynthesis. Conclusions This study investigates the molecular mechanisms of photosynthetic light acclimation for Arabidopsis thaliana from the physiological level. This has been achieved through the construction of gene regulatory networks from the limited data sources and literature via an efficient computation method. If more experimental data for whole-genome ChIP-chip data and microarray data with multiple sampling points becomes available in the

  5. Kallmann syndrome: mutations in the genes encoding prokineticin-2 and prokineticin receptor-2.

    Directory of Open Access Journals (Sweden)

    Catherine Dodé

    2006-10-01

    Full Text Available Kallmann syndrome combines anosmia, related to defective olfactory bulb morphogenesis, and hypogonadism due to gonadotropin-releasing hormone deficiency. Loss-of-function mutations in KAL1 and FGFR1 underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. Mutations in these genes, however, only account for approximately 20% of all Kallmann syndrome cases. In a cohort of 192 patients we took a candidate gene strategy and identified ten and four different point mutations in the genes encoding the G protein-coupled prokineticin receptor-2 (PROKR2 and one of its ligands, prokineticin-2 (PROK2, respectively. The mutations in PROK2 were detected in the heterozygous state, whereas PROKR2 mutations were found in the heterozygous, homozygous, or compound heterozygous state. In addition, one of the patients heterozygous for a PROKR2 mutation was also carrying a missense mutation in KAL1, thus indicating a possible digenic inheritance of the disease in this individual. These findings reveal that insufficient prokineticin-signaling through PROKR2 leads to abnormal development of the olfactory system and reproductive axis in man. They also shed new light on the complex genetic transmission of Kallmann syndrome.

  6. Growth Characteristics of Methanomassiliicoccus luminyensis and Expression of Methyltransferase Encoding Genes

    Directory of Open Access Journals (Sweden)

    Lena Kröninger

    2017-01-01

    Full Text Available DNA sequence analysis of the human gut revealed the presence a seventh order of methanogens referred to as Methanomassiliicoccales. Methanomassiliicoccus luminyensis is the only member of this order that grows in pure culture. Here, we show that the organism has a doubling time of 1.8 d with methanol + H2 and a growth yield of 2.4 g dry weight/mol CH4. M. luminyensis also uses methylamines + H2 (monomethylamine, dimethylamine, and trimethylamine with doubling times of 2.1–2.3 d. Similar cell yields were obtained with equimolar concentrations of methanol and methylamines with respect to their methyl group contents. The transcript levels of genes encoding proteins involved in substrate utilization indicated increased amounts of mRNA from the mtaBC2 gene cluster in methanol-grown cells. When methylamines were used as substrates, mRNA of the mtb/mtt operon and of the mtmBC1 cluster were found in high abundance. The transcript level of mtaC2 was almost identical in methanol- and methylamine-grown cells, indicating that genes for methanol utilization were constitutively expressed in high amounts. The same observation was made with resting cells where methanol always yielded the highest CH4 production rate independently from the growth substrate. Hence, M. luminyensis is adapted to habitats that provide methanol + H2 as substrates.

  7. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  8. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  9. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster.

    Science.gov (United States)

    Gilbert, Lawrence I

    2004-02-27

    Mutation of members of the Halloween gene family results in embryonic lethality. We have shown that two of these genes code for enzymes responsible for specific steps in the synthesis of ecdysone, a polyhydroxylated sterol that is the precursor of the major molting hormone of all arthropods, 20-hydroxyecdysone. These two mitochondrial P450 enzymes, coded for by disembodied (dib) (CYP302A1) and shadow (sad) (CYP315A1), are the C22 and C2 hydroxylases, respectively, as shown by transfection of the gene into S2 cells and subsequent biochemical analysis. These are the last two enzymes in the ecdysone biosynthetic pathway. A third enzyme, necessary for the critical conversion of ecdysone to 20-hydroxyecdysone, the 20-monooxygenase, is encoded by shade (shd) (CYP314A1). All three enzymes are mitochondrial although shade has motifs suggesting both mitochondrial and microsomal locations. By tagging these enzymes, their subcellular location has been confirmed by confocal microscopy. Shade is present in several tissues as expected while disembodied and shadow are restricted to the ring gland. The paradigm used should allow us to define the enzymes mediating the entire ecdysteroid biosynthetic pathway.

  10. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  11. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Science.gov (United States)

    Mousa, Walaa K.; Raizada, Manish N.

    2015-01-01

    The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produces a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins, and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous coding sequences (CDS). We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters. PMID:25914708

  12. A Mutation in the Tubulin-Encoding Gene Causes Complex Cortical Malformations and Unilateral Hypohidrosis

    Directory of Open Access Journals (Sweden)

    Shinobu Fukumura MD

    2016-08-01

    Full Text Available Recent studies have emphasized the association between tubulin gene mutations and developmental abnormalities of the cortex. In this study, the authors identified a mutation in the tubulin-encoding class III β-tubulin ( TUBB3 gene in a 4-year-old boy presenting with brain abnormalities and unilateral hypohidrosis. The patient showed a left internal strabismus, moderate developmental delay, and congenital hypohidrosis of the right side of the body. Magnetic resonance imaging disclosed gyral disorganization mainly in the left perisylvian region, dysmorphic and hypertrophic basal ganglia with fusion between the putamen and caudate nucleus without affecting the anterior limb of the internal capsule, and moderate hypoplasia of the right brain stem and cerebellum. Diffusion tensor imaging studies revealed disorganization of the pyramidal fibers. The amplitude of the sympathetic skin response was low in the right arm, which led to a diagnosis of focal autonomic neuropathy. Sequencing the TUBB3 gene revealed a de novo missense mutation, c.862G>A (p.E288K.

  13. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Science.gov (United States)

    Miao, Hongxia; Sun, Peiguang; Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  14. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  15. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    -of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited......The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  16. A flax-retting endopolygalacturonase-encoding gene from Rhizopus oryzae.

    Science.gov (United States)

    Xiao, Zhizhuang; Wang, Shaozhao; Bergeron, Hélène; Zhang, Jianchun; Lau, Peter C K

    2008-11-01

    A polygalacturonase from the filamentous fungus Rhizopus oryzae strain sb (NRRL 29086), previously shown to be effective in the retting of flax fibers, was shown by the analysis of its reaction products on polygalacturonic acid to be an endo-type. By zymogram analysis, the enzyme in the crude culture filtrate appeared as two active species of 37 and 40 kD. The endopolygalacturonase-encoding gene was cloned in Escherichia coli and its translated 383-amino acid sequence found to be identical to that of a presumed exopolygalacturonase found in R. oryzae strain YM9901 and 96% identical to a hypothetical protein (RO3G_04731.1) in the sequenced genome of R. oryzae strain 99-880. Phylogenetic analysis revealed the presence of an unique cluster of Rhizopus polygalacturonase sequences that are separate from other fungal polygalacturonases. Conservation of 12 cysteines appears to be a special feature of this family of Rhizopus polygalacturonase sequences.

  17. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters.

    Science.gov (United States)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven; Jørgensen, Morten Egevang; Olsen, Carl Erik; Andersen, Jonathan Sonne; Seynnaeve, David; Verhoye, Thalia; Fulawka, Rudy; Denolf, Peter; Halkier, Barbara Ann

    2017-04-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed glucosinolate content in other oilseed crops, such as Camelina sativa or Crambe abyssinica.

  18. A Clostridioides difficile bacteriophage genome encodes functional binary toxin-associated genes.

    Science.gov (United States)

    Riedel, Thomas; Wittmann, Johannes; Bunk, Boyke; Schober, Isabel; Spröer, Cathrin; Gronow, Sabine; Overmann, Jörg

    2017-05-20

    Pathogenic clostridia typically produce toxins as virulence factors which cause severe diseases in both humans and animals. Whereas many clostridia like e.g., Clostridium perfringens, Clostridium botulinum or Clostridium tetani were shown to contain toxin-encoding plasmids, only toxin genes located on the chromosome were detected in Clostridioides difficile so far. In this study, we determined, annotated, and analyzed the complete genome of the bacteriophage phiSemix9P1 using single-molecule real-time sequencing technology (SMRT). To our knowledge, this represents the first C. difficile-associated bacteriophage genome that carries a complete functional binary toxin locus in its genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Inherited variants in regulatory T cell genes and outcome of ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Ellen L Goode

    Full Text Available Although ovarian cancer is the most lethal of gynecologic malignancies, wide variation in outcome following conventional therapy continues to exist. The presence of tumor-infiltrating regulatory T cells (Tregs has a role in outcome of this disease, and a growing body of data supports the existence of inherited prognostic factors. However, the role of inherited variants in genes encoding Treg-related immune molecules has not been fully explored. We analyzed expression quantitative trait loci (eQTL and sequence-based tagging single nucleotide polymorphisms (tagSNPs for 54 genes associated with Tregs in 3,662 invasive ovarian cancer cases. With adjustment for known prognostic factors, suggestive results were observed among rarer histological subtypes; poorer survival was associated with minor alleles at SNPs in RGS1 (clear cell, rs10921202, p=2.7×10(-5, LRRC32 and TNFRSF18/TNFRSF4 (mucinous, rs3781699, p=4.5×10(-4, and rs3753348, p=9.0×10(-4, respectively, and CD80 (endometrioid, rs13071247, p=8.0×10(-4. Fo0r the latter, correlative data support a CD80 rs13071247 genotype association with CD80 tumor RNA expression (p=0.006. An additional eQTL SNP in CD80 was associated with shorter survival (rs7804190, p=8.1×10(-4 among all cases combined. As the products of these genes are known to affect induction, trafficking, or immunosuppressive function of Tregs, these results suggest the need for follow-up phenotypic studies.

  20. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  1. Ty3 GAG3 and POL3 genes encode the components of intracellular particles.

    Science.gov (United States)

    Hansen, L J; Chalker, D L; Orlinsky, K J; Sandmeyer, S B

    1992-03-01

    Ty3 is a Saccharomyces cerevisiae retrotransposon that integrates near the transcription initiation sites of polymerase III-transcribed genes. It is distinct from the copialike Ty1 and Ty2 retrotransposons of S. cerevisiae in both the sequences of encoded proteins and gene order. It is a member of the gypsylike family of retrotransposons which resemble animal retroviruses. This study was undertaken to investigate the nucleocapsid particle of a transpositionally active gypsylike retrotransposon. Characterization of extracts from cells in which Ty3 expression was induced showed the presence of Ty3 nucleoprotein complexes, or viruslike particles, that migrated on linear sucrose gradients with a size of 156S. These particles are composed of Ty3 RNA, full-length, linear DNA, and proteins. In this study, antibodies raised against peptides predicted from the Ty3 sequence were used to identify Ty3-encoded proteins. These include the capsid (26 kDa), nucleocapsid (9 kDa), and reverse transcriptase (55 kDa) proteins. Ty3 integrase proteins of 61 and 58 kDa were identified previously (L. J. Hansen and S. B. Sandmeyer, J. Virol. 64:2599-2607, 1990). Reverse transcriptase activity associated with the particles was measured by using exogenous and endogenous primer-templates. Immunofluorescence studies of cells overexpressing Ty3 revealed cytoplasmic clusters of immunoreactive proteins. Transmission electron microscopy showed that Ty3 viruslike particles are about 50 nm in diameter. Thus, despite the unusual position specificity of Ty3 upstream of tRNA-coding regions, aspects of the Ty3 life cycle are fundamentally similar to those of retroviruses.

  2. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Directory of Open Access Journals (Sweden)

    Hamada F Rady

    Full Text Available Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC. DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  3. Gene-based neonatal immune priming potentiates a mucosal adenoviral vaccine encoding mycobacterial Ag85B.

    Science.gov (United States)

    Dai, Guixiang; Rady, Hamada F; Huang, Weitao; Shellito, Judd E; Mason, Carol; Ramsay, Alistair J

    2016-12-07

    Tuberculosis remains a major public health hazard worldwide, with neonates and young infants potentially more susceptible to infection than adults. BCG, the only vaccine currently available, provides some protection against tuberculous meningitis in children but variable efficacy in adults, and is not safe to use in immune compromised individuals. A safe and effective vaccine that could be given early in life, and that could also potentiate subsequent booster immunization, would represent a significant advance. To test this proposition, we have generated gene-based vaccine vectors expressing Ag85B from Mycobacterium tuberculosis (Mtb) and designed experiments to test their immunogenicity and protective efficacy particularly when given in heterologous prime-boost combination, with the initial DNA vaccine component given soon after birth. Intradermal delivery of DNA vaccines elicited Th1-based immune responses against Ag85B in neonatal mice but did not protect them from subsequent aerosol challenge with virulent Mtb H37Rv. Recombinant adenovirus vectors encoding Ag85B, given via the intranasal route at six weeks of age, generated moderate immune responses and were poorly protective. However, neonatal DNA priming following by mucosal boosting with recombinant adenovirus generated strong immune responses, as evidenced by strong Ag85B-specific CD4+ and CD8+ T cell responses, both in the lung-associated lymph nodes and the spleen, by the quality of these responding cells (assessed by their capacity to secrete multiple antimicrobial factors), and by improved protection, as indicated by reduced bacterial burden in the lungs following pulmonary TB challenge. These results suggest that neonatal immunization with gene-based vaccines may create a favorable immunological environment that potentiates the pulmonary mucosal boosting effects of a subsequent heterologous vector vaccine encoding the same antigen. Our data indicate that immunization early in life with mycobacterial

  4. The Physiological and Biochemical Mechanisms Providing the Increased Constitutive Cold Resistance in the Potato Plants, Expressing the Yeast SUC2 Gene Encoding Apoplastic Invertase

    Directory of Open Access Journals (Sweden)

    A.N. Deryabin

    2016-05-01

    Full Text Available The expression of heterologous genes in plants is an effective method to improve our understanding of plant resistance mechanisms. The purpose of this work was to investigate the involvement of cell-wall invertase and apoplastic sugars into constitutive cold resistance of potato (Solanum tuberosum L., cv. Dйsirйe plants, which expressed the yeast SUC2 gene encoding apoplastic invertase. WT-plants of a potato served as the control. The increase in the essential cell-wall invertase activity in the leaves of transformed plants indicates significant changes in the cellular carbohydrate metabolism and regulatory function of this enzyme. The activity of yeast invertase changed the composition of intracellular sugars in the leaves of the transformed potato plant. The total content of sugars (sucrose, glucose, fructose in the leaves and apoplast was higher in the transformants, in comparison by WT-plants. Our data indicate higher constitutive resistance of transformants to severe hypothermia conditions compared to WT-plants. This fact allows us to consider cell-wall invertase as a enzyme of carbohydrate metabolism playing an important regulatory role in the metabolic signaling upon forming increased plant resistance to low temperature. Thus, the potato line with the integrated SUC2 gene is a convenient tool to study the role of the apoplastic invertase and the products of its activity during growth, development and formation constitutive resistance to hypothermia.

  5. Frequent mutations of genes encoding ubiquitin-mediated proteolysis pathway components in clear cell renal cell carcinoma

    DEFF Research Database (Denmark)

    Guo, Guangwu; Gui, Yaoting; Gao, Shengjie

    2012-01-01

    We sequenced whole exomes of ten clear cell renal cell carcinomas (ccRCCs) and performed a screen of similar to 1,100 genes in 88 additional ccRCCs, from which we discovered 12 previously unidentified genes mutated at elevated frequencies in ccRCC. Notably, we detected frequent mutations in the u...... of the hypoxia regulatory network....

  6. Isolation and characterization of strong gene regulatory sequences from apple, Malus x domestica

    NARCIS (Netherlands)

    Schaart, J.G.; Tinnenbroek, I.E.M.; Krens, F.A.

    2011-01-01

    For the strong expression of genes in plant tissue, the availability of specific gene regulatory sequences is desired. We cloned promoter and terminator sequences of an apple (Malus x domestica) ribulose biphosphate carboxylase small subunit gene (MdRbcS), which is known for its high expression and

  7. A Regulatory RNA Inducing Transgenerationally Inherited Phenotypes

    DEFF Research Database (Denmark)

    Jensen, Lea Møller

    . The variation in Arabidopsis enables different regulatory networks and mechanisms to shape the phenotypic characteristics. The thesis describes the identification of regulatory RNA encoded by an enzyme encoding gene. The RNA regulates by inducing transgenerationally inherited phenotypes. The function of the RNA...... is dependent on the genetic background illustrating that polymorphisms are found in either interactors or target genes of the RNA. Furthermore, the RNA provides a mechanistic link between accumulation of glucosinolate and onset of flowering....

  8. Maternal depressive symptoms during pregnancy, placental expression of genes regulating glucocorticoid and serotonin function and infant regulatory behaviors.

    Science.gov (United States)

    Räikkönen, K; Pesonen, A-K; O'Reilly, J R; Tuovinen, S; Lahti, M; Kajantie, E; Villa, P; Laivuori, H; Hämäläinen, E; Seckl, J R; Reynolds, R M

    2015-11-01

    Glucocorticoids and serotonin may mediate the link between maternal environment, fetal brain development and 'programming' of offspring behaviors. The placenta regulates fetal exposure to maternal hormonal signals in animal studies, but few data address this in humans. We measured prospectively maternal depressive symptoms during pregnancy and mRNAs encoding key gene products determining glucocorticoid and serotonin function in term human placenta and explored associations with infant regulatory behaviors. Bi-weekly self-ratings of the Center for Epidemiologic Studies Depression Scale from 12th to 13th gestational week onwards and term placental mRNAs of 11beta-hydroxysteroid dehydrogenase type 2 (HSD2B11), type 1 (HSD1B11), glucocorticoid (NR3C1), mineralocorticoid receptors (NR3C2) and serotonin transporter (SLC6A4) were obtained from 54 healthy mothers aged 32.2 ± 5.3 years with singleton pregnancies and without pregnancy complications. Infant regulatory behaviors (crying, feeding, spitting, elimination, sleeping and predictability) were mother-rated at 15.6 ± 4.2 days. Higher placental mRNA levels of HSD2B11 [0.41 standard deviation (s.d.) unit increase per s.d. unit increase; 95% confidence interval (CI) 0.13-0.69, p = 0.005], HSD1B11 (0.30, 0.03-0.57, p = 0.03), NR3C1 (0.44, 0.19-0.68, p = 0.001) and SLC6A4 (0.26, 0.00-0.53, p = 0.05) were associated with more regulatory behavioral challenges of the infant. Higher placental NR3C1 mRNA partly mediated the association between maternal depressive symptoms during pregnancy and infant regulatory behaviors (p serotonin exposure is characteristic of infants with more regulatory behavioral challenges. Maternal depression acts, at least partly, via altering glucocorticoid action in the placenta to impact on offspring regulatory behaviors.

  9. Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    RUBÉN POLANCO

    2006-01-01

    Full Text Available In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes

  10. Inferring nonlinear gene regulatory networks from gene expression data based on distance correlation.

    Directory of Open Access Journals (Sweden)

    Xiaobo Guo

    Full Text Available Nonlinear dependence is general in regulation mechanism of gene regulatory networks (GRNs. It is vital to properly measure or test nonlinear dependence from real data for reconstructing GRNs and understanding the complex regulatory mechanisms within the cellular system. A recently developed measurement called the distance correlation (DC has been shown powerful and computationally effective in nonlinear dependence for many situations. In this work, we incorporate the DC into inferring GRNs from the gene expression data without any underling distribution assumptions. We propose three DC-based GRNs inference algorithms: CLR-DC, MRNET-DC and REL-DC, and then compare them with the mutual information (MI-based algorithms by analyzing two simulated data: benchmark GRNs from the DREAM challenge and GRNs generated by SynTReN network generator, and an experimentally determined SOS DNA repair network in Escherichia coli. According to both the receiver operator characteristic (ROC curve and the precision-recall (PR curve, our proposed algorithms significantly outperform the MI-based algorithms in GRNs inference.

  11. [Cloning of y3 gene encoding a tobacco mosaic virus inhibitor from Coprinus comatus and transformation to Nicotiana tabacum].

    Science.gov (United States)

    Wang, Xueren; He, Tao; Zhang, Gaina; Hao, Jianguo; Jia, Jingfen

    2010-02-01

    The protein Y3 was a TMV inhibitor which was encoded by y3 gene. The aim of this work was to clone the full length of y3 gene from Coprinus comatus and to reveal its inhibitory function to TMV in in vivo conditions. We amplified the unknown 5'- terminal cDNA sequence of y3 gene with 5'- Full RACE Core Set (TaKaRa), obtained the full length of this gene by RT-PCR, constructed the expression plasmid pCAMBIA1301-y3 via inserting gene y3 sequence, CaMV 35 S promoter, and NOS terminator at MCS and transformed it into Nicotiana tabacum via agrobacterium-mediation. The full length of y3 gene was 534 bps including one ORF encoding 130 amino acid residues (GenBank Accession No. GQ859168; EMBL FN546262). The cDNA sequence and its deduced amino acid sequence showed high similarity (94%) to the published fragment of y3 gene sequence. Northern blot analysis proved the transcription of y3 gene in transgenic tobacco plants. The transgenic plants inoculated with TMV expressed the inhibitory activity to TMV. We cloned the full length of y3 gene and obtained transgenic tobacco plants. The expression of y3 gene in transgenic plants improved the inhibitory activity to TMV. The cloning and expression analysis of y3 gene might provide background information for future studying of y3 gene.

  12. Expression of genes encoding IGFBPs, SNARK, CD36, and PECAM1 in the liver of mice treated with chromium disilicide and titanium nitride nanoparticles.

    Science.gov (United States)

    Minchenko, Dmytro O; Tsymbal, D O; Yavorovsky, O P; Solokha, N V; Minchenko, O H

    2017-04-25

    The aim of the present study was to examine the effect of chromium disilicide and titanium nitride nanoparticles on the expression level of genes encoding important regulatory factors (IGFBP1, IGFBP2, IGFBP3, IGFBP4, IGFBP5, SNARK/NUAK2, CD36, and PECAM1/CD31) in mouse liver for evaluation of possible toxic effects of these nanoparticles. Male mice received 20 mg chromium disilicide nanoparticles (45 nm) and titanium nitride nanoparticles (20 nm) with food every working day for 2 months. The expression of IGFBP1, IGFBP2, IGFBP3, IGFBP4, IGFBP5, SNARK, CD36, and PECAM1 genes in mouse liver was studied by quantitative polymerase chain reaction. Treatment of mice with chromium disilicide nanoparticles led to down-regulation of the expression of IGFBP2, IGFBP5, PECAM1, and SNARK genes in the liver in comparison with control mice, with more prominent changes for SNARK gene. At the same time, the expression of IGFBP3 and CD36 genes was increased in mouse liver upon treatment with chromium disilicide nanoparticles. We have also shown that treatment with titanium nitride nanoparticles resulted in down-regulation of the expression of IGFBP2 and SNARK genes in the liver with more prominent changes for SNARK gene. At the same time, the expression of IGFBP3, IGFBP4, and CD36 genes was increased in the liver of mice treated with titanium nitride nanoparticles. Furthermore, the effect of chromium disilicide nanoparticles on IGFBP2 and CD36 genes expression was significantly stronger as compared to titanium nitride nanoparticles. The results of this study demonstrate that chromium disilicide and titanium nitride nanoparticles have variable effects on the expression of IGFBP2, IGFBP3, IGFBP4, IGFBP5, SNARK, CD36, and PECAM1 genes in mouse liver, which may reflect the genotoxic activities of the studied nanoparticles.

  13. [Identification of the gene encoding transglutaminase zymogen from Streptomyces hygroscopicus and its expression in Escherichia coli].

    Science.gov (United States)

    Ren, Zengliang; Zhang, Dongxu; Yu, Meiying; Zhao, Qingxin; Du, Guocheng; Chen, Jian; Wu, Jing

    2008-04-01

    We identified a microbial transglutaminase (MTGase) gene from Streptomyces hygroscopicus; cloned and expressed it in Escherichia coli. We also analyzed the active sites sequence of S. hygroscopicus MTGase through homologous sequence comparison. Wild-type microbial transglutaminase zymogen (pro-MTGase) was purified from liquid culture of S. hygroscopicus (CCTCC M203062). N-terminal amino acid sequence of this pro-MTGase was determined. According to the N-terminal sequence and the corresponding nucleotide sequence of MTGase from other three Streptomyces species, PCR primers of S. hygroscopicus pro-MTGase were designed and the completed gene of pro-MTGase was amplified and sequenced. The gene was sub-cloned into pET-20b(+) vector downstream pelB signal peptide to construct the expression vector pET/pro-MTG. The nucleotide sequence showed 92% homologue with that of S. platensis and S. caniferus. Rosetta (DE3) pLysS carrying the expression vector was induced with IPTG at 24 and expressed pro-MTGase as extracellular soluble protein. SDS-PAGE showed the expressed recombinant pro-MTGase was about 44 kDa, similar to the wild-type pro-MTGase purified from S. hgroscopicus. Recombinant pro-MTGase was activated with trypsin and the enzyme activity reached to 0.24U/mL. This is the first report of the gene encoding microbial pro-transglutaminase from S. hygroscopicus, and also this is the first report of expression extracellular soluble pro-MTGase in E. coli in our country.

  14. MicroRNAs and gene regulatory networks: managing the impact of noise in biological systems.

    Science.gov (United States)

    Herranz, Héctor; Cohen, Stephen M

    2010-07-01

    Biological systems are continuously challenged by an environment that is variable. Yet, a key feature of developmental and physiological processes is their remarkable stability. This review considers how microRNAs contribute to gene regulatory networks that confer robustness.

  15. A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul

    2005-01-05

    A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

  16. Codon usage of HIV regulatory genes is not determined by nucleotide composition.

    Science.gov (United States)

    Phakaratsakul, Supinya; Sirihongthong, Thanyaporn; Boonarkart, Chompunuch; Suptawiwat, Ornpreya; Auewarakul, Prasert

    2018-02-01

    Codon usage bias can be a result of either mutational bias or selection for translational efficiency and/or accuracy. Previous data has suggested that nucleotide composition constraint was the main determinant of HIV codon usage, and that nucleotide composition and codon usage were different between the regulatory genes, tat and rev, and other viral genes. It is not clear whether translational selection contributed to the codon usage difference and how nucleotide composition and translational selection interact to determine HIV codon usage. In this study, a model of codon bias due to GC composition with modification for the A-rich third codon position was used to calculate predicted HIV codon frequencies based on its nucleotide composition. The predicted codon usage of each gene was compared with the actual codon frequency. The predicted codon usage based on GC composition matched well with the actual codon frequencies for the structural genes (gag, pol and env). However, the codon usage of the regulatory genes (tat and rev) could not be predicted. Codon usage of the regulatory genes was also relatively unbiased showing the highest effective number of codons (ENC). Moreover, the codon adaptation index (CAI) of the regulatory genes showed better adaptation to human codons when compared to other HIV genes. Therefore, the early expressed genes responsible for regulation of the replication cycle, tat and rev, were more similar to humans in terms of codon usage and GC content than other HIV genes. This may help these genes to be expressed efficiently during the early stages of infection.

  17. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ...

  18. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  19. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  20. Cloning of the mouse cDNA encoding DNA topoisomerase I and chromosomal location of the gene.

    Science.gov (United States)

    Koiwai, O; Yasui, Y; Sakai, Y; Watanabe, T; Ishii, K; Yanagihara, S; Andoh, T

    1993-03-30

    The mouse cDNA encoding DNA topoisomerase I (TopoI) was cloned and the nucleotide sequence of 3512 bp was determined. The cDNA clone contained an open reading frame encoding a protein of 767 amino acids (aa), which is 2 aa longer than its human counterpart. Overall aa sequence homology between the mouse and human, and between the mouse and yeast (Saccharomyces cerevisiae) sequences was 96% and 42%, respectively. The mouse TopI gene was mapped at position 54.5 on chromosome 2 from linkage analyses of a three-point cross test with Geg, Ada, and a as marker genes.

  1. The Drosophila homologue of vertebrate myogenic-determination genes encodes a transiently expressed nuclear protein marking primary myogenic cells.

    OpenAIRE

    Paterson, B M; Walldorf, U; Eldridge, J; Dübendorfer, A; Frasch, M; Gehring, W J

    1991-01-01

    We have isolated a cDNA clone, called Dmyd for Drosophila myogenic-determination gene, that encodes a protein with structural and functional characteristics similar to the members of the vertebrate MyoD family. Dmyd clone encodes a polypeptide of 332 amino acids with 82% identity to MyoD in the 41 amino acids of the putative helix-loop-helix region and 100% identity in the 13 amino acids of the basic domain proposed to contain the essential recognition code for muscle-specific gene activation...

  2. Genetic polymorphism in FOXP3 gene: imbalance in regulatory T ...

    Indian Academy of Sciences (India)

    2013-04-02

    Jonuleit and Schmitt 2003). Regulatory T ... immunological unresponsiveness to self-Ags and in sup- pressing excessive immune responses ... FOXP3 for prognosis or drug monitoring. The expression of. FOXP3 in tumour cells ...

  3. The gene expression data of Mycobacterium tuberculosis based on Affymetrix gene chips provide insight into regulatory and hypothetical genes

    Directory of Open Access Journals (Sweden)

    Fu-Liu Casey S

    2007-05-01

    Full Text Available Abstract Background Tuberculosis remains a leading infectious disease with global public health threat. Its control and management have been complicated by multi-drug resistance and latent infection, which prompts scientists to find new and more effective drugs. With the completion of the genome sequence of the etiologic bacterium, Mycobacterium tuberculosis, it is now feasible to search for new drug targets by sieving through a large number of gene products and conduct genome-scale experiments based on microarray technology. However, the full potential of genome-wide microarray analysis in configuring interrelationships among all genes in M. tuberculosis has yet to be realized. To date, it is only possible to assign a function to 52% of proteins predicted in the genome. Results We conducted a functional-genomics study using the high-resolution Affymetrix oligonucleotide GeneChip. Approximately one-half of the genes were found to be always expressed, including more than 100 predicted conserved hypotheticals, in the genome of M. tuberculosis during the log phase of in vitro growth. The gene expression profiles were analyzed and visualized through cluster analysis to epitomize the full details of genomic behavior. Broad patterns derived from genome-wide expression experiments in this study have provided insight into the interrelationships among genes in the basic cellular processes of M. tuberculosis. Conclusion Our results have confirmed several known gene clusters in energy production, information pathways, and lipid metabolism, and also hinted at potential roles of hypothetical and regulatory proteins.

  4. Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

    Science.gov (United States)

    Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

    2012-11-01

    Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

  5. Saccharomyces cerevisiae gene ISW2 encodes a microtubule-interacting protein required for premeiotic DNA replication.

    Science.gov (United States)

    Trachtulcová, P; Janatová, I; Kohlwein, S D; Hasek, J

    2000-01-15

    A molecular genetic characterization of the ORF YOR304W (ISW2), identified in a screen of a yeast lambdagt11 library using a monoclonal antibody that reacts with a 210 kDa mammalian microtubule-interacting protein, is presented in this paper. The protein encoded by the ORF YOR304W is 50% identical to the Drosophila nucleosome remodelling factor ISWI and is therefore a new member of the SNF2 protein family and has been recently entered into SDG as ISW2. Although not essential for vegetative growth, we found that the ISW2 gene is required for early stages in sporulation. The isw2 homozygous deletant diploid strain was blocked in the G(1) phase of the cell cycle, unable to execute the premeiotic DNA replication and progress through the nuclear meiotic division cycle. ISW2 expression from a multicopy plasmid had the same effect as deletion, but ISW2 expression from a centromeric plasmid rescued the deletion phenotype. In vegetatively growing diploid cells, the Isw2 protein was preferentially found in the cytoplasm, co-localizing with microtubules. An accumulation of the Isw2 protein within the nucleus was observed in cells entering sporulation. Together with data published very recently by Tsukiyama et al. (1999), we propose a role for the Isw2 protein in facilitating chromatin accessibility for transcriptional factor(s) that positively regulate meiosis/sporulation-specific genes. Copyright 2000 John Wiley & Sons, Ltd.

  6. Novel Genes Encoding Hexadecanoic Acid Δ6-Desaturase Activity in a Rhodococcus sp.

    Science.gov (United States)

    Araki, Hiroyuki; Hagihara, Hiroshi; Takigawa, Hirofumi; Tsujino, Yukiharu; Ozaki, Katsuya

    2016-11-01

    cis-6-Hexadecenoic acid, a major component of human sebaceous lipids, is involved in the defense mechanism against Staphylococcus aureus infection in healthy skin and closely related to atopic dermatitis. Previously, Koike et al. (Biosci Biotechnol Biochem 64:1064-1066, 2000) reported that a mutant strain of Rhodococcus sp. produced cis-6-hexadecenoate derivatives from palmitate alkyl esters. From the mutant Rhodococcus strain, we identified and sequenced two open reading frames present in an amplified 5.7-kb region; these open reading frames encoded tandemly repeated Δ6-desaturase-like genes, Rdes1 and Rdes2. A phylogenetic tree indicated that Rdes1 and Rdes2 were different from previously known Δ6-desaturase genes, and that they formed a new cluster. Rdes1 and Rdes2 were each introduced into vectors and then expressed separately in Escherichia coli, and the fatty acid composition of the transformed cells was analyzed by gas chromatography and mass spectrometry. The amount of cis-6-hexadecenoic acid was significantly higher in Rdes1- or Rdes2-transformed E. coli cells (twofold and threefold, respectively) than in vector-only control cells. These results showed that cis-6-hexadecenoic acid was produced in E. coli cells by the rhodococcal Δ6-desaturase-like proteins.

  7. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  8. Little things make big things happen: A summary of micropeptide encoding genes

    Directory of Open Access Journals (Sweden)

    Jeroen Crappé

    2014-06-01

    Full Text Available Classical bioactive peptides are cleaved from larger precursor proteins and are targeted toward the secretory pathway by means of an N-terminal signaling sequence. In contrast, micropeptides encoded from small open reading frames, lack such signaling sequence and are immediately released in the cytoplasm after translation. Over the past few years many such non-canonical genes (including open reading frames, ORFs smaller than 100 AAs have been discovered and functionally characterized in different eukaryotic organisms. Furthermore, in silico approaches enabled the prediction of the existence of many more putatively coding small ORFs in the genomes of Sacharomyces cerevisiae, Arabidopsis thaliana, Drosophila melanogaster and Mus musculus. However, questions remain as to what the functional role of this new class of eukaryotic genes might be, and how widespread they are. In the future, approaches integrating in silico, conservation-based prediction and a combination of genomic, proteomic and functional validation methods will prove to be indispensable to answer these open questions.

  9. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  10. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  11. Comparative Bioinformatics Analysis of Transcription Factor Genes Indicates Conservation of Key Regulatory Domains among Babesia bovis, Babesia microti, and Theileria equi.

    Directory of Open Access Journals (Sweden)

    Heba F Alzan

    2016-11-01

    Full Text Available Apicomplexa tick-borne hemoparasites, including Babesia bovis, Babesia microti, and Theileria equi are responsible for bovine and human babesiosis and equine theileriosis, respectively. These parasites of vast medical, epidemiological, and economic impact have complex life cycles in their vertebrate and tick hosts. Large gaps in knowledge concerning the mechanisms used by these parasites for gene regulation remain. Regulatory genes coding for DNA binding proteins such as members of the Api-AP2, HMG, and Myb families are known to play crucial roles as transcription factors. Although the repertoire of Api-AP2 has been defined and a HMG gene was previously identified in the B. bovis genome, these regulatory genes have not been described in detail in B. microti and T. equi. In this study, comparative bioinformatics was used to: (i identify and map genes encoding for these transcription factors among three parasites' genomes; (ii identify a previously unreported HMG gene in B. microti; (iii define a repertoire of eight conserved Myb genes; and (iv identify AP2 correlates among B. bovis and the better-studied Plasmodium parasites. Searching the available transcriptome of B. bovis defined patterns of transcription of these three gene families in B. bovis erythrocyte stage parasites. Sequence comparisons show conservation of functional domains and general architecture in the AP2, Myb, and HMG proteins, which may be significant for the regulation of common critical parasite life cycle transitions in B. bovis, B. microti, and T. equi. A detailed understanding of the role of gene families encoding DNA binding proteins will provide new tools for unraveling regulatory mechanisms involved in B. bovis, B. microti, and T. equi life cycles and environmental adaptive responses and potentially contributes to the development of novel convergent strategies for improved control of babesiosis and equine piroplasmosis.

  12. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  13. Identification of genes encoding critical factors regulating B-cell terminal differentiation in torafugu (Takifugu rubripes).

    Science.gov (United States)

    Ohtani, Maki; Miyadai, Toshiaki; Hiroishi, Shingo

    2006-03-01

    Many transcription factors, and associated co-factors, are involved in the regulation of B-cell terminal differentiation in mammals. In the teleost and cartilaginous fish, although evidence has strongly suggested the existence of B-cell like lymphocytes, the mechanism of terminal differentiation of B-cells remains to be elucidated. In the present study, we searched for the nucleotide and amino acid sequences similar to the critical regulatory factors facilitating the terminal differentiation of B-cells using the fugu BLAST server. We cloned the following cDNAs from Takifugu rubripes: (1) B-lymphocyte-induced maturation protein-1 (Blimp-1), which plays a major role in promoting plasma cell differentiation by repressing the transcription of many genes that participate in maintaining the differentiation of mature B-cells; (2) Bcl-6, which facilitates germinal center formation and represses Blimp-1 expression; (3) X-box binding protein-1 (XBP-1), which operates Ig secretion by activating transcription of the ER-stress responsible genes; (4) Pax-5, which suppresses XBP-1 and enhances the expression of activation-induced cytidine deaminase (AID), an inducer of somatic hypermutation and class-switch recombination of the immunoglobulin gene; and (5) TLE-3, one of the Groucho family proteins, a co-factor for Blimp-1. We also identified other co-factors and many target genes of Blimp-1 by in silico and/or cDNA cloning. These finding indicates that the basal process of B-cell terminal differentiation in fish is controlled by factors identical to those in mammals.

  14. A novel parametric approach to mine gene regulatory relationship from microarray datasets

    Directory of Open Access Journals (Sweden)

    Zhu Yunping

    2010-12-01

    Full Text Available Abstract Background Microarray has been widely used to measure the gene expression level on the genome scale in the current decade. Many algorithms have been developed to reconstruct gene regulatory networks based on microarray data. Unfortunately, most of these models and algorithms focus on global properties of the expression of genes in regulatory networks. And few of them are able to offer intuitive parameters. We wonder whether some simple but basic characteristics of microarray datasets can be found to identify the potential gene regulatory relationship. Results Based on expression correlation, expression level variation and vectors derived from microarray expression levels, we first introduced several novel parameters to measure the characters of regulating gene pairs. Subsequently, we used the naïve Bayesian network to integrate these features as well as the functional co-annotation between transcription factors and their target genes. Then, based on the character of time-delay from the expression profile, we were able to predict the existence and direction of the regulatory relationship respectively. Conclusions Several novel parameters have been proposed and integrated to identify the regulatory relationship. This new model is proved to be of higher efficacy than that of individual features. It is believed that our parametric approach can serve as a fast approach for regulatory relationship mining.

  15. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  16. Integration of steady-state and temporal gene expression data for the inference of gene regulatory networks.

    Science.gov (United States)

    Wang, Yi Kan; Hurley, Daniel G; Schnell, Santiago; Print, Cristin G; Crampin, Edmund J

    2013-01-01

    We develop a new regression algorithm, cMIKANA, for inference of gene regulatory networks from combinations of steady-state and time-series gene expression data. Using simulated gene expression datasets to assess the accuracy of reconstructing gene regulatory networks, we show that steady-state and time-series data sets can successfully be combined to identify gene regulatory interactions using the new algorithm. Inferring gene networks from combined data sets was found to be advantageous when using noisy measurements collected with either lower sampling rates or a limited number of experimental replicates. We illustrate our method by applying it to a microarray gene expression dataset from human umbilical vein endothelial cells (HUVECs) which combines time series data from treatment with growth factor TNF and steady state data from siRNA knockdown treatments. Our results suggest that the combination of steady-state and time-series datasets may provide better prediction of RNA-to-RNA interactions, and may also reveal biological features that cannot be identified from dynamic or steady state information alone. Finally, we consider the experimental design of genomics experiments for gene regulatory network inference and show that network inference can be improved by incorporating steady-state measurements with time-series data.

  17. Disabled-2 is a FOXP3 target gene required for regulatory T cell function

    OpenAIRE

    Jain, N; Nguyen, H; Friedline, RH; Malhotra, N; Brehm, M; Koyonagi, M; Bix, M; Cooper, JA; Chambers, CA; Kang, J

    2009-01-01

    FOXP3 expressing regulatory T cells are vital for maintaining peripheral T cell tolerance and homeostasis. The mechanisms by which FOXP3 target genes orchestrate context-dependent Treg cell function are largely unknown. Here we show that in mouse peripheral lymphocytes, the Drosophila Disabled-2 (Dab2) homolog, a gene that is involved in enhancing TGFβ responses, is exclusively expressed in FOXP3+ regulatory T cells. Dab2 is a direct target of FOXP3 and regulatory T cells lacking DAB2 are fun...

  18. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  19. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  20. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    Science.gov (United States)

    Lu, C.; Fedoroff, N.

    2000-01-01

    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  1. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    Science.gov (United States)

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  2. Reconstructing gene-regulatory networks from time series, knock-out data, and prior knowledge

    Directory of Open Access Journals (Sweden)

    Timmer Jens

    2007-02-01

    Full Text Available Abstract Background Cellular processes are controlled by gene-regulatory networks. Several computational methods are currently used to learn the structure of gene-regulatory networks from data. This study focusses on time series gene expression and gene knock-out data in order to identify the underlying network structure. We compare the performance of different network reconstruction methods using synthetic data generated from an ensemble of reference networks. Data requirements as well as optimal experiments for the reconstruction of gene-regulatory networks are investigated. Additionally, the impact of prior knowledge on network reconstruction as well as the effect of unobserved cellular processes is studied. Results We identify linear Gaussian dynamic Bayesian networks and variable selection based on F-statistics as suitable methods for the reconstruction of gene-regulatory networks from time series data. Commonly used discrete dynamic Bayesian networks perform inferior and this result can be attributed to the inevitable information loss by discretization of expression data. It is shown that short time series generated under transcription factor knock-out are optimal experiments in order to reveal the structure of gene regulatory networks. Relative to the level of observational noise, we give estimates for the required amount of gene expression data in order to accurately reconstruct gene-regulatory networks. The benefit of using of prior knowledge within a Bayesian learning framework is found to be limited to conditions of small gene expression data size. Unobserved processes, like protein-protein interactions, induce dependencies between gene expression levels similar to direct transcriptional regulation. We show that these dependencies cannot be distinguished from transcription factor mediated gene regulation on the basis of gene expression data alone. Conclusion Currently available data size and data quality make the reconstruction of

  3. Transcription patterns of genes encoding four metallothionein homologs in Daphnia pulex exposed to copper and cadmium are time- and homolog-dependent

    Energy Technology Data Exchange (ETDEWEB)

    Asselman, Jana, E-mail: jana.asselman@ugent.be [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium); Shaw, Joseph R.; Glaholt, Stephen P. [The School of Public and Environmental Affairs, Indiana University, Bloomington, IN (United States); Colbourne, John K. [School of Biosciences, The University of Birmingham, Birmingham (United Kingdom); De Schamphelaere, Karel A.C. [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium)

    2013-10-15

    Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species.

  4. The Neurospora crassa gene responsible for the cut and ovc phenotypes encodes a protein of the haloacid dehalogenase family.

    Science.gov (United States)

    Youssar, Loubna; Schmidhauser, Thomas J; Avalos, Javier

    2005-02-01

    Light stimulation of carotenogenesis in Neurospora crassa, mediated by the White Collar proteins, is enhanced in some regulatory mutants, such as vivid and ovc. The gene responsible for the vivid mutation has been identified, but not the one responsible for the ovc phenotype. The ovc mutant is sensitive to high osmotic conditions and allelic with another mutant, cut, also osmosensitive but not affected in carotenogenesis. A phenotypic characterization of both strains is presented. Light induction of mRNA levels of the carotenoid genes al-1 and al-2, the regulatory gene wc-1 or the conidiation-specific gene con-10 is not significantly changed in the ovc mutant when compared with the wild type. We have identified the gene affected in the ovc mutant by complementation of osmosensitivity with a cosmid library. This gene, which we call cut-1, codes for an enzyme of the haloacid dehalogenase family, which includes different classes of phosphatases. cut-1 is able to restore the wild-type phenotype of the ovc and cut strains, confirming that they are affected in the same gene. DNA sequence analysis identified a point mutation in the cut mutant, leading to a truncated protein. The ovc mutant represents a deletion encompassing the entire gene and surrounding sequences. The cut-1 promoter contains putative regulatory elements involved in osmotic or thermal stress. We show that cut-1 transcription is low in illuminated or dark-grown cultures, and is induced by high osmotic conditions or by heat shock.

  5. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    Science.gov (United States)

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-09-05

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation.

  6. Distinct and competitive regulatory patterns of tumor suppressor genes and oncogenes in ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Min Zhao

    Full Text Available So far, investigators have found numerous tumor suppressor genes (TSGs and oncogenes (OCGs that control cell proliferation and apoptosis during cancer development. Furthermore, TSGs and OCGs may act as modulators of transcription factors (TFs to influence gene regulation. A comprehensive investigation of TSGs, OCGs, TFs, and their joint target genes at the network level may provide a deeper understanding of the post-translational modulation of TSGs and OCGs to TF gene regulation.In this study, we developed a novel computational framework for identifying target genes of TSGs and OCGs using TFs as bridges through the integration of protein-protein interactions and gene expression data. We applied this pipeline to ovarian cancer and constructed a three-layer regulatory network. In the network, the top layer was comprised of modulators (TSGs and OCGs, the middle layer included TFs, and the bottom layer contained target genes. Based on regulatory relationships in the network, we compiled TSG and OCG profiles and performed clustering analyses. Interestingly, we found TSGs and OCGs formed two distinct branches. The genes in the TSG branch were significantly enriched in DNA damage and repair, regulating macromolecule metabolism, cell cycle and apoptosis, while the genes in the OCG branch were significantly enriched in the ErbB signaling pathway. Remarkably, their specific targets showed a reversed functional enrichment in terms of apoptosis and the ErbB signaling pathway: the target genes regulated by OCGs only were enriched in anti-apoptosis and the target genes regulated by TSGs only were enriched in the ErbB signaling pathway.This study provides the first comprehensive investigation of the interplay of TSGs and OCGs in a regulatory network modulated by TFs. Our application in ovarian cancer revealed distinct regulatory patterns of TSGs and OCGs, suggesting a competitive regulatory mechanism acting upon apoptosis and the ErbB signaling pathway through

  7. Diversity of β-lactamase-encoding genes among Gram-negative isolates from water samples in Northern Portugal

    OpenAIRE

    Manageiro, Vera; Ferreira, Eugénia; Figueira, Vânia; Manaia, Célia M.; Caniça, Manuela

    2012-01-01

    Water has been recognized as a reservoir for antibiotic resistance genes (ARG), where the presence of mobile genetic elements, including plasmids, favors their dissemination. It is noteworthy that non- pathogenic environmental organisms, where plasmids encoding multiple ARG are prevalent, can provide resistance to most classes of antimicrobials including :-lactams, aminoglycosides, chloramphenicol, trimethoprim, streptomycin, fosfomycin, q...

  8. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

    Science.gov (United States)

    Tomas Johansson; Per Olof Nyman; Daniel Cullen

    2002-01-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

  9. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  10. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    Science.gov (United States)

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  11. Annotation and analysis of malic enzyme genes encoding for multiple isoforms in the fungus Mucor circinelloides CBS 277.49.

    Science.gov (United States)

    Vongsangnak, Wanwipa; Zhang, Yingtong; Chen, Wei; Ratledge, Colin; Song, Yuanda

    2012-05-01

    Based on the newly-released genomic data of Mucor circinelloides CBS 277.49, we have annotated five genes encoding for malic enzyme: all code for proteins that contain conserved domains/motifs for malic acid binding, NAD(+) binding and NAD(P)(+) binding. Phylogenetic analysis for malic enzyme genes showed that genes ID 78524 and 11639 share ~80% amino acid identity and are grouped in cluster 1; genes ID 182779, 186772 and 116127 share ~66% amino acid identity are grouped in cluster 2. Genes ID 78524, 11639 and 166127 produce proteins that are localized in the mitochondrion, while the products from genes 182779 and 186772 are localized in the cytosol. Based on the comparative analysis published previously by Song et al. (Microbiology 147:1507-1515, 2001), we propose that malic enzyme genes ID 78524, 166127, 182779, 186772, 11639, respectively, represent protein isoforms I, II, III/IV, V, and VI.

  12. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  13. Lineage-specific transcription factors and the evolution of gene regulatory networks

    OpenAIRE

    Nowick, Katja; Stubbs, Lisa

    2010-01-01

    Nature is replete with examples of diverse cell types, tissues and body plans, forming very different creatures from genomes with similar gene complements. However, while the genes and the structures of proteins they encode can be highly conserved, the production of those proteins in specific cell types and at specific developmental time points might differ considerably between species. A full understanding of the factors that orchestrate gene expression will be essential to fully understand ...

  14. Rapid male-specific regulatory divergence and down regulation of spermatogenesis genes in Drosophila species hybrids.

    Directory of Open Access Journals (Sweden)

    Jennifer Ferguson

    Full Text Available In most crosses between closely related species of Drosophila, the male hybrids are sterile and show postmeiotic abnormalities. A series of gene expression studies using genomic approaches have found significant down regulation of postmeiotic spermatogenesis genes in sterile male hybrids. These results have led some to suggest a direct relationship between down regulation in gene expression and hybrid sterility. An alternative explanation to a cause-and-effect relationship between misregulation of gene expression and male sterility is rapid divergence of male sex regulatory elements leading to incompatible interactions in an interspecies hybrid genome. To test the effect of regulatory divergence in spermatogenesis gene expression, we isolated 35 fertile D. simulans strains with D. mauritiana introgressions in either the X, second or third chromosome. We analyzed gene expression in these fertile hybrid strains for a subset of spermatogenesis genes previously reported as significantly under expressed in sterile hybrids relative to D. simulans. We found that fertile autosomal introgressions can cause levels of gene down regulation similar to that of sterile hybrids. We also found that X chromosome heterospecific introgressions cause significantly less gene down regulation than autosomal introgressions. Our results provide evidence that rapid male sex gene regulatory divergence can explain misexpression of spermatogenesis genes in hybrids.

  15. CoryneRegNet 4.0 – A reference database for corynebacterial gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Baumbach Jan

    2007-11-01

    Full Text Available Abstract Background Detailed information on DNA-binding transcription factors (the key players in the regulation of gene expression and on transcriptional regulatory interactions of microorganisms deduced from literature-derived knowledge, computer predictions and global DNA microarray hybridization experiments, has opened the way for the genome-wide analysis of transcriptional regulatory networks. The large-scale reconstruction of these networks allows the in silico analysis of cell behavior in response to changing environmental conditions. We previously published CoryneRegNet, an ontology-based data warehouse of corynebacterial transcription factors and regulatory networks. Initially, it was designed to provide methods for the analysis and visualization of the gene regulatory network of Corynebacterium glutamicum. Results Now we introduce CoryneRegNet release 4.0, which integrates data on the gene regulatory networks of 4 corynebacteria, 2 mycobacteria and the model organism Escherichia coli K12. As the previous versions, CoryneRegNet provides a web-based user interface to access the database content, to allow various queries, and to support the reconstruction, analysis and visualization of regulatory networks at different hierarchical levels. In this article, we present the further improved database content of CoryneRegNet along with novel analysis features. The network visualization feature GraphVis now allows the inter-species comparisons of reconstructed gene regulatory networks and the projection of gene expression levels onto that networks. Therefore, we added stimulon data directly into the database, but also provide Web Service access to the DNA microarray analysis platform EMMA. Additionally, CoryneRegNet now provides a SOAP based Web Service server, which can easily be consumed by other bioinformatics software systems. Stimulons (imported from the database, or uploaded by the user can be analyzed in the context of known

  16. A Gene Regulatory Program for Meiotic Prophase in the Fetal Ovary

    NARCIS (Netherlands)

    Soh, Y Q Shirleen; Junker, Jan Philipp; Gill, Mark E; Mueller, Jacob L; van Oudenaarden, Alexander; Page, David C

    The chromosomal program of meiotic prophase, comprising events such as laying down of meiotic cohesins, synapsis between homologs, and homologous recombination, must be preceded and enabled by the regulated induction of meiotic prophase genes. This gene regulatory program is poorly understood,

  17. The life-extending gene Indy encodes an exchanger for Krebs-cycle intermediates.

    Science.gov (United States)

    Knauf, Felix; Mohebbi, Nilufar; Teichert, Carsten; Herold, Diana; Rogina, Blanka; Helfand, Stephen; Gollasch, Maik; Luft, Friedrich C; Aronson, Peter S

    2006-07-01

    A longevity gene called Indy (for 'I'm not dead yet'), with similarity to mammalian genes encoding sodium-dicarboxylate cotransporters, was identified in Drosophila melanogaster. Functional studies in Xenopus oocytes showed that INDY mediates the flux of dicarboxylates and citrate across the plasma membrane, but the specific transport mechanism mediated by INDY was not identified. To test whether INDY functions as an anion exchanger, we examined whether substrate efflux is stimulated by transportable substrates added to the external medium. Efflux of [14C]citrate from INDY-expressing oocytes was greatly accelerated by the addition of succinate to the external medium, indicating citrate-succinate exchange. The succinate-stimulated [14C]citrate efflux was sensitive to inhibition by DIDS (4,4'-di-isothiocyano-2,2'-disulphonic stilbene), as demonstrated previously for INDY-mediated succinate uptake. INDY-mediated efflux of [14C]citrate was also stimulated by external citrate and oxaloacetate, indicating citrate-citrate and citrate-oxaloacetate exchange. Similarly, efflux of [14C]succinate from INDY-expressing oocytes was stimulated by external citrate, alpha-oxoglutarate and fumarate, indicating succinate-citrate, succinate-alpha-oxoglutarate and succinate-fumarate exchange respectively. Conversely, when INDY-expressing Xenopus oocytes were loaded with succinate and citrate, [14C]succinate uptake was markedly stimulated, confirming succinate-succinate and succinate-citrate exchange. Exchange of internal anion for external citrate was markedly pH(o)-dependent, consistent with the concept that citrate is co-transported with a proton. Anion exchange was sodium-independent. We conclude that INDY functions as an exchanger of dicarboxylate and tricarboxylate Krebs-cycle intermediates. The effect of decreasing INDY activity, as in the long-lived Indy mutants, may be to alter energy metabolism in a manner that favours lifespan extension.

  18. A novel protein encoded by the circular form of the SHPRH gene suppresses glioma tumorigenesis.

    Science.gov (United States)

    Zhang, Maolei; Huang, Nunu; Yang, Xuesong; Luo, Jingyan; Yan, Sheng; Xiao, Feizhe; Chen, Wenping; Gao, Xinya; Zhao, Kun; Zhou, Huangkai; Li, Ziqiang; Ming, Liu; Xie, Bo; Zhang, Nu

    2018-01-18

    Circular RNAs (circRNAs) are recognized as functional non-coding transcripts in eukaryotic cells. Recent evidence has indicated that even though circRNAs are generally expressed at low levels, they may be involved in many physiological or pathological processes, such as gene regulation, tissue development and carcinogenesis. Although the 'microRNA sponge' function is well characterized, most circRNAs do not contain perfect trapping sites for microRNAs, which suggests the possibility that circRNAs have functions that have not yet been defined. In this study, we show that a circRNA containing an open reading frame (ORF) driven by the internal ribosome entry site (IRES) can translate a functional protein. The circular form of the SNF2 histone linker PHD RING helicase (SHPRH) gene encodes a novel protein that we termed SHPRH-146aa. Circular SHPRH (circ-SHPRH) uses overlapping genetic codes to generate a 'UGA' stop codon, which results in the translation of the 17 kDa SHPRH-146aa. Both circ-SHPRH and SHPRH-146aa are abundantly expressed in normal human brains and are down-regulated in glioblastoma. The overexpression of SHPRH-146aa in U251 and U373 glioblastoma cells reduces their malignant behavior and tumorigenicity in vitro and in vivo. Mechanistically, SHPRH-146aa protects full-length SHPRH from degradation by the ubiquitin proteasome. Stabilized SHPRH sequentially ubiquitinates proliferating cell nuclear antigen (PCNA) as an E3 ligase, leading to inhibited cell proliferation and tumorigenicity. Our findings provide a novel perspective regarding circRNA function in physiological and pathological processes. Specifically, SHPRH-146aa generated from overlapping genetic codes of circ-SHPRH is a tumor suppressor in human glioblastoma.

  19. Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium.

    Science.gov (United States)

    Todd, Sarah J; Moir, Arthur J G; Johnson, Matt J; Moir, Anne

    2003-06-01

    The exosporium is the outermost layer of spores of Bacillus cereus and its close relatives Bacillus anthracis and Bacillus thuringiensis. For these pathogens, it represents the surface layer that makes initial contact with the host. To date, only the BclA glycoprotein has been described as a component of the exosporium; this paper defines 10 more tightly associated proteins from the exosporium of B. cereus ATCC 10876, identified by N-terminal sequencing of proteins from purified, washed exosporium. Likely coding sequences were identified from the incomplete genome sequence of B. anthracis or B. cereus ATCC 14579, and the precise corresponding sequence from B. cereus ATCC 10876 was defined by PCR and sequencing. Eight genes encode likely structural components (exsB, exsC, exsD, exsE, exsF, exsG, exsJ, and cotE). Several proteins of the exosporium are related to morphogenetic and outer spore coat proteins of B. subtilis, but most do not have homologues in B. subtilis. ExsE is processed from a larger precursor, and the CotE homologue appears to have been C-terminally truncated. ExsJ contains a domain of GXX collagen-like repeats, like the BclA exosporium protein of B. anthracis. Although most of the exosporium genes are scattered on the genome, bclA and exsF are clustered in a region flanking the rhamnose biosynthesis operon; rhamnose is part of the sugar moiety of spore glycoproteins. Two enzymes, alanine racemase and nucleoside hydrolase, are tightly adsorbed to the exosporium layer; they could metabolize small molecule germinants and may reduce the sensitivity of spores to these, limiting premature germination.

  20. Gene encoding erythrocyte binding ligand linked to blood stage multiplication rate phenotype in Plasmodium yoelii yoelii.

    Science.gov (United States)

    Pattaradilokrat, Sittiporn; Culleton, Richard L; Cheesman, Sandra J; Carter, Richard

    2009-04-28

    Variation in the multiplication rate of blood stage malaria parasites is often positively correlated with the severity of the disease they cause. The rodent malaria parasite Plasmodium yoelii yoelii has strains with marked differences in multiplication rate and pathogenicity in the blood. We have used genetic analysis by linkage group selection (LGS) to identify genes that determine differences in multiplication rate. Genetic crosses were generated between genetically unrelated, fast- (17XYM) and slowly multiplying (33XC) clones of P. y. yoelii. The uncloned progenies of these crosses were placed under multiplication rate selection in blood infections in mice. The selected progenies were screened for reduction in intensity of quantitative genetic markers of the slowly multiplying parent. A small number of strongly selected markers formed a linkage group on P. y. yoelii chromosome 13. Of these, that most strongly selected marked the gene encoding the P. yoelii erythrocyte binding ligand (pyebl), which has been independently identified by Otsuki and colleagues [Otsuki H, et al. (2009) Proc Natl Acad Sci USA 106:10.1073/pnas.0811313106] as a major determinant of virulence in these parasites. In an analysis of a previous genetic cross in P. y. yoelii, pyebl alleles of fast- and slowly multiplying parents segregated with the fast and slow multiplication rate phenotype in the cloned recombinant progeny, implying the involvement of the pyebl locus in determining the multiplication rate. Our genome-wide LGS analysis also indicated effects of at least 1 other locus on multiplication rate, as did the findings of Otsuki and colleagues on virulence in P. y. yoelii.

  1. Temporal clustering of gene expression links the metabolic transcription factor HNF4α to the ER stress-dependent gene regulatory network

    Directory of Open Access Journals (Sweden)

    Angela M Arensdorf

    2013-09-01

    Full Text Available The unfolded protein response (UPR responds to disruption of endoplasmic reticulum (ER function by initiating signaling cascades that ultimately culminate in extensive transcriptional regulation. Classically, this regulation includes genes encoding ER chaperones, ER-associated degradation factors, and others involved in secretory protein folding and processing, and is carried out by the transcriptional activators that are produced as a consequence of UPR activation. However, up to half of the mRNAs regulated by ER stress are downregulated rather than upregulated, and the mechanisms linking ER stress and UPR activation to mRNA suppression are poorly understood. To begin to address this issue, we used a bottom-up approach to study the metabolic gene regulatory network controlled by the UPR in the liver, because ER in the liver stress leads to lipid accumulation, and fatty liver disease is the most common liver disease in the western world. qRT-PCR profiling of mouse liver mRNAs during ER stress revealed that suppression of the transcriptional regulators C/EBPα, PPARα, and PGC-1α preceded lipid accumulation, and was then followed by suppression of mRNAs encoding key enzymes involved in fatty acid oxidation and lipoprotein biogenesis and transport. Mice lacking the ER stress sensor ATF6α, which experience persistent ER stress and profound lipid accumulation during challenge, were then used as the basis for a functional genomics approach that allowed genes to be grouped into distinct expression profiles. This clustering predicted that ER stress would suppress the activity of the metabolic transcriptional regulator HNF4α--a finding subsequently confirmed by chromatin immunopreciptation at the Cebpa and Pgc1a promoters. Our results establish a framework for hepatic gene regulation during ER stress and suggest that HNF4α occupies the apex of that framework. They also provide a unique resource for the community to further explore the temporal

  2. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  3. A novel GDNF-inducible gene, BMZF3, encodes a transcriptional repressor associated with KAP-1

    International Nuclear Information System (INIS)

    Suzuki, Chikage; Murakumo, Yoshiki; Kawase, Yukari; Sato, Tomoko; Morinaga, Takatoshi; Fukuda, Naoyuki; Enomoto, Atsushi; Ichihara, Masatoshi; Takahashi, Masahide

    2008-01-01

    The Krueppel-associated box (KRAB)-containing zinc finger proteins (ZFPs) comprise the largest family of zinc finger transcription factors that function as transcriptional repressors. In the study of glial cell line-derived neurotrophic factor (GDNF)-RET signaling, we have identified bone marrow zinc finger 3 (BMZF3), encoding a KRAB-ZFP, as a GDNF-inducible gene by differential display analysis. The expression of BMZF3 transcripts in the human neuroblastoma cell line TGW increased 1 h after GDNF stimulation, as determined by Northern blotting and quantitative reverse-transcriptase polymerase chain reaction. The BMZF3 possesses transcriptional repressor activity in the KRAB domain. BMZF3 interacts with a co-repressor protein, KRAB-associated protein 1 (KAP-1), through the KRAB domain and siRNA-mediated knockdown of KAP-1 abolished the transcriptional repressor activity of BMZF3, indicating that KAP-1 is necessary for BMZF3 function. Furthermore, siRNA-mediated silencing of BMZF3 inhibited cell proliferation. These findings suggest that BMZF3 is a transcriptional repressor induced by GDNF that plays a role in cell proliferation

  4. Plasmodium falciparum var genes expressed in children with severe malaria encode CIDRα1 domains

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Wang, Christian W.; Mkumbaye, Sixbert I.

    2016-01-01

    Most severe Plasmodium falciparum infections are experienced by young children. Severe symptoms are precipitated by vascular sequestration of parasites expressing a particular subset of the polymorphic P. falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion molecules. Parasites binding hum...... the hypothesis that the CIDRα1-EPCR interaction is key to the pathogenesis of severe malaria and strengthen the rationale for pursuing a vaccine or adjunctive treatment aiming at inhibiting or reducing the damaging effects of this interaction....... endothelial protein C receptor (EPCR) through the CIDRα1 domain of certain PfEMP1 were recently associated with severe malaria in children. However, it has remained unclear to which extend the EPCR-binding CIDRα1 domains epitomize PfEMP1 expressed in severe malaria. Here, we characterized the near full......-length transcripts dominating the var transcriptome in children with severe malaria and found that the only common feature of the encoded PfEMP1 was CIDRα1 domains. Such genes were highly and dominantly expressed in both children with severe malarial anaemia and cerebral malaria. These observations support...

  5. Molecular cloning and characterization of two genes encoding dihydroflavonol-4-reductase from Populus trichocarpa.

    Directory of Open Access Journals (Sweden)

    Yan Huang

    Full Text Available Dihydroflavonol 4-reductase (DFR, EC 1.1.1.219 is a rate-limited enzyme in the biosynthesis of anthocyanins and condensed tannins (proanthocyanidins that catalyzes the reduction of dihydroflavonols to leucoanthocyanins. In this study, two full-length transcripts encoding for PtrDFR1 and PtrDFR2 were isolated from Populus trichocarpa. Sequence alignment of the two PtrDFRs with other known DFRs reveals the homology of these genes. The expression profile of PtrDFRs was investigated in various tissues of P. trichocarpa. To determine their functions, two PtrDFRs were overexpressed in tobacco (Nicotiana tabacum via Agrobacterium-mediated transformation. The associated color change in the flowers was observed in all 35S:PtrDFR1 lines, but not in 35S:PtrDFR2 lines. Compared to the wild-type control, a significantly higher accumulation of anthocyanins was detected in transgenic plants harboring the PtrDFR1. Furthermore, overexpressing PtrDFR1 in Chinese white poplar (P. tomentosa Carr. resulted in a higher accumulation of both anthocyanins and condensed tannins, whereas constitutively expressing PtrDFR2 only improved condensed tannin accumulation, indicating the potential regulation of condensed tannins by PtrDFR2 in the biosynthetic pathway in poplars.

  6. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  7. Effects of light fluence and wavelength on expression of the gene encoding cucumber hydroxypyruvate reductase.

    Science.gov (United States)

    Bertoni, G P; Becker, W M

    1993-01-01

    We have investigated the regulation of cucumber (Cucumis sativus) hydroxypyruvate reductase mRNA abundance in response to white-, red-, and far-red-light treatments. Following irradiation of dark-adapted cucumber seedlings with 15 min to 4 h of either white or red light and return to darkness, the mRNA level for the gene encoding hydroxypyruvate reductase (Hpr) in cotyledons peaks in the darkness 16 to 20 h later. The response of the Hpr mRNA level to total fluence of white light depends more directly on irradiation time than on fluence rate. In addition to this time-dependent component, a phytochrome-dependent component is involved in Hpr regulation in dark-adapted green cotyledons as shown by red-light induction and partial far-red-light reversibility. Parallel measurements of mRNA levels for the ribulose bisphosphate carboxylase/oxygenase small subunit and for the chlorophyll a/b-binding protein show that Hpr is the most responsive to short (about 60 min) white- and red-light treatments and that each mRNA has a characteristic pattern of accumulation in dark-adapted cotyledons in response to light. PMID:8022942

  8. On the Interplay between Entropy and Robustness of Gene Regulatory Networks

    Directory of Open Access Journals (Sweden)

    Bor-Sen Chen

    2010-05-01

    Full Text Available The interplay between entropy and robustness of gene network is a core mechanism of systems biology. The entropy is a measure of randomness or disorder of a physical system due to random parameter fluctuation and environmental noises in gene regulatory networks. The robustness of a gene regulatory network, which can be measured as the ability to tolerate the random parameter fluctuation and to attenuate the effect of environmental noise, will be discussed from the robust H∞ stabilization and filtering perspective. In this review, we will also discuss their balancing roles in evolution and potential applications in systems and synthetic biology.

  9. [Cloning and analysis of three genes encoding type II CHH family neuropeptides from Fennropenaeus chinensis].

    Science.gov (United States)

    Wang, Zai-Zhao; Xiang, Jian-Hai

    2003-10-01

    On the basis of sequence similarity, the crustean hyperglycemic hormone (CHH) family peptides have been classified into two types of hormones: type I and type II. Molt-inhibiting hormone (MIH) is a neuropeptide member of type II CHH family. Molting in shrimp is controlled by MIH and ecdysone. By inhibiting the synthesis of ecdysone in the Y-organ, MIH indirectly suppresses the molting activity of shrimp. In this study, we reported the cloning and characterization of 3 gene fragments encoding type II CHH family neuropeptides of the shrimp Fennropenaeus chinensis. According to the complementary DNA sequence of the mult-inhibiting hormone of Fennropenaeus chinensis, 3 primers were designed and synthesized. MP1 and MP2 are sense primers, and MP3 is anti-sense primer. Polymerase chain reaction was performed using genomic DNA of Fennropenaeus chinensis as template. Three PCR products were obtained using primers MP1 and MP3. Their sizes are about 600 bp, 850 bp, 1050 bp, respectively. A 580 bp PCR product was obtained using primers MP2 and MP3. All the 4 PCR products were cloned into pMD18-T vector. The recombinant clones were sequenced using ABI 310 Genetic Analyzer. After sequencing, all the DNA sequences were searched in the GenBank by Blast program to find similar gene sequences. The searching results revealed 3 DNA fragment sequences were of high similarity with CHH family neuropeptide genes from various crustean species. The 3 DNA fragments were named as NP1, NP2, and NP3. Their sizes were 540 bp, 601 bp, and 826 bp, respectively. Using the mRNA sequences with the most similarity to the 3 sequence fragments as reference, the gene structure of the 3 DNA fragment sequences was analyzed. The exons of 3 sequence fragments were aligned with their similar sequences by Clustal W program. Both NP1 and NP2 consisted of 1 intron and 2 exons. NP3 consisted of 2 introns and 3 exons. Sequence analysis suggested that these 3 products belonged to sequence fragments of neuropeptide

  10. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  11. The yeast ISN1 (YOR155c gene encodes a new type of IMP-specific 5'-nucleotidase

    Directory of Open Access Journals (Sweden)

    Schmitter Jean-Marie

    2003-05-01

    Full Text Available Abstract Background The purine salvage enzyme inosine 5'-monophosphate (IMP-specific 5'-nucleotidase catalyzes degradation of IMP to inosine. Although this enzymatic activity has been purified and characterized in Saccharomyces cerevisiae, the gene encoding IMP 5'-nucleotidase had not been identified. Results Mass spectrometry analysis of several peptides of this enzyme purified from yeast allowed identification of the corresponding gene as YOR155c, an open reading frame of unknown function, renamed ISN1. The deduced Isn1p sequence was clearly not homologous to 5'-nucleotidases from other species. However, significant similarities to Isn1p were found in proteins of unknown function from Neurospora crassa, Plasmodium falciparum and several yeast species. Knock-out of ISN1 resulted in the total loss of IMP-specific 5'-nucleotidase activity, thus confirming that the ISN1 gene indeed encodes the enzymatic activity purified from yeast. In vivo studies revealed that, when IMP is overproduced through constitutive activation of the IMP de novo synthesis pathway, ISN1 is required for excretion of inosine and hypoxanthine in the medium. Conclusion We have identified a new yeast gene, ISN1 (YOR155c, as encoding IMP-specific 5'-nucleotidase activity. The ISN1 gene defines a new type of 5'-nucleotidase which was demonstrated to be functional in vivo.

  12. Molecular characterization and expression analysis of three homoeologous Ta14S genes encoding 14-3-3 proteins in wheat (Triticum aestivum L.

    Directory of Open Access Journals (Sweden)

    Xinguo Wang

    2016-06-01

    Full Text Available The purpose of this study was to characterize Ta14S homoeologs and assess their functions in wheat seed development. The genomic and cDNA sequences of three Ta14S homoeologous genes encoding 14-3-3 proteins were isolated. Sequence analysis revealed that the three homoeologs consisted of five exons and four introns and were very highly conserved in the coding regions and in exon/intron structure, whereas the cDNA sequences were variable in the 5′ and 3′-UTR. The three genes, designated as Ta14S-2A, Ta14S-2B and Ta14S-2D, were located in homoeologous group 2 chromosomes. The polypeptide chains of the three Ta14S genes were highly similar. These genes were most homologous to Hv14A from barley. Real-time quantitative PCR indicated that the three Ta14S genes were differentially expressed in different organs at different developmental stages and all exhibited greater expression in primary roots of 1-day-old germlings than in other tissues. Comparison of the expression patterns of the three homoeologous genes at different times after pollination also revealed that their expression was developmentally regulated. The transcription of Ta14S-2B was clearly higher during seed germination, whereas expressions of Ta14S-2A and Ta14S-2D were up-regulated at the beginning of seed imbibition (0–12 h, but declined thereafter. The results suggested that the three Ta14S homoeologous genes have regulatory roles in seed development and germination.

  13. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Jandova, Jana; Janda, Jaroslav [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States); Sligh, James E, E-mail: jsligh@azcc.arizona.edu [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States)

    2012-10-15

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  14. A guide to approaching regulatory considerations for lentiviral-mediated gene therapies.

    Science.gov (United States)

    White, Michael; Whittaker, Roger; Stoll, Elizabeth Ann

    2017-06-12

    Lentiviral vectors are increasingly the gene transfer tool of choice for gene or cell therapies, with multiple clinical investigations showing promise for this viral vector in terms of both safety and efficacy. The third-generation vector system is well-characterized, effectively delivers genetic material and maintains long-term stable expression in target cells, delivers larger amounts of genetic material than other methods, is non-pathogenic and does not cause an inflammatory response in the recipient. This report aims to help academic scientists and regulatory managers negotiate the governance framework to achieve successful translation of a lentiviral vector-based gene therapy. The focus is on European regulations, and how they are administered in the United Kingdom, although many of the principles will be similar for other regions including the United States. The report justifies the rationale for using third-generation lentiviral vectors to achieve gene delivery for in vivo and ex vivo applications; briefly summarises the extant regulatory guidance for gene therapies, categorised as advanced therapeutic medicinal products (ATMPs); provides guidance on specific regulatory issues regarding gene therapies; presents an overview of the key stakeholders to be approached when pursuing clinical trials authorization for an ATMP; and includes a brief catalogue of the documentation required to submit an application for regulatory approval of a new gene therapy.

  15. Medusa structure of the gene regulatory network: dominance of transcription factors in cancer subtype classification.

    Science.gov (United States)

    Guo, Yuchun; Feng, Ying; Trivedi, Niraj S; Huang, Sui

    2011-05-01

    Gene expression profiles consisting of ten thousands of transcripts are used for clustering of tissue, such as tumors, into subtypes, often without considering the underlying reason that the distinct patterns of expression arise because of constraints in the realization of gene expression profiles imposed by the gene regulatory network. The topology of this network has been suggested to consist of a regulatory core of genes represented most prominently by transcription factors (TFs) and microRNAs, that influence the expression of other genes, and of a periphery of 'enslaved' effector genes that are regulated but not regulating. This 'medusa' architecture implies that the core genes are much stronger determinants of the realized gene expression profiles. To test this hypothesis, we examined the clustering of gene expression profiles into known tumor types to quantitatively demonstrate that TFs, and even more pronounced, microRNAs, are much stronger discriminators of tumor type specific gene expression patterns than a same number of randomly selected or metabolic genes. These findings lend support to the hypothesis of a medusa architecture and of the canalizing nature of regulation by microRNAs. They also reveal the degree of freedom for the expression of peripheral genes that are less stringently associated with a tissue type specific global gene expression profile.

  16. Expression of the nucleus-encoded chloroplast division genes and proteins regulated by the algal cell cycle.

    Science.gov (United States)

    Miyagishima, Shin-Ya; Suzuki, Kenji; Okazaki, Kumiko; Kabeya, Yukihiro

    2012-10-01

    Chloroplasts have evolved from a cyanobacterial endosymbiont and their continuity has been maintained by chloroplast division, which is performed by the constriction of a ring-like division complex at the division site. It is believed that the synchronization of the endosymbiotic and host cell division events was a critical step in establishing a permanent endosymbiotic relationship, such as is commonly seen in existing algae. In the majority of algal species, chloroplasts divide once per specific period of the host cell division cycle. In order to understand both the regulation of the timing of chloroplast division in algal cells and how the system evolved, we examined the expression of chloroplast division genes and proteins in the cell cycle of algae containing chloroplasts of cyanobacterial primary endosymbiotic origin (glaucophyte, red, green, and streptophyte algae). The results show that the nucleus-encoded chloroplast division genes and proteins of both cyanobacterial and eukaryotic host origin are expressed specifically during the S phase, except for FtsZ in one graucophyte alga. In this glaucophyte alga, FtsZ is persistently expressed throughout the cell cycle, whereas the expression of the nucleus-encoded MinD and MinE as well as FtsZ ring formation are regulated by the phases of the cell cycle. In contrast to the nucleus-encoded division genes, it has been shown that the expression of chloroplast-encoded division genes is not regulated by the host cell cycle. The endosymbiotic gene transfer of minE and minD from the chloroplast to the nuclear genome occurred independently on multiple occasions in distinct lineages, whereas the expression of nucleus-encoded MIND and MINE is regulated by the cell cycle in all lineages examined in this study. These results suggest that the timing of chloroplast division in algal cell cycle is restricted by the cell cycle-regulated expression of some but not all of the chloroplast division genes. In addition, it is

  17. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  18. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  19. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice.

    Science.gov (United States)

    Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M; Bansal, Kailash C

    2015-01-01

    MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by "top-down" and "guide-gene" approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via "top-down" approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by "guide-gene" approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought response in rice

  20. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    Directory of Open Access Journals (Sweden)

    Shuchi eSmita

    2015-12-01

    Full Text Available MYB transcription factor (TF is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by top down and guide gene approaches. More than 50% of OsMYBs were strongly correlated under fifty experimental conditions with 51 hub genes via top down approach. Further, clusters were identified using Markov Clustering (MCL. To maximize the clustering performance, parameter evaluation of the MCL inflation score (I was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by guide gene approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought

  1. Developmentally regulated expression of a human ''finger'' - containing gene encoded by the 5' half of the ret transforming gene

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, M.; Inaguma, Y.; Hiai, H.; Hirose, F.

    1988-04-01

    The authors isolated and sequenced a cDNA clone of the human gene encoded by the 5' half of the ret transforming gene. The nucleotide sequence indicates that it encodes a protein with ''finger'' structures which represent putative metal- and nucleic acid-binding domains. Transcriptions of this gene was detected at high levels in a variety of human and rodent tumor cell lines, mouse testis, and embryos. In addition, a unique transcript was observed in testis RNA. When the expression of the unique transcript was examined at different stages of spermatogenesis, a striking increase in mRNA levels accompanied progression from meiotic prophase pachytene spermatocytes to postmeiotic round spermatids. This finger-containing gene may thus function in male germ cell development.

  2. Two potential hookworm DAF-16 target genes, SNR-3 and LPP-1: gene structure, expression profile, and implications of a cis-regulatory element in the regulation of gene expression.

    Science.gov (United States)

    Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M

    2015-01-08

    elements. Aca-snr-3 encodes a core small nuclear ribonucleoprotein, and Aca-lpp-1 encodes a lipid phosphate phosphohydrolase. Expression of both genes peaked at the late L4 stage, suggesting a role in L4 development. The 3'-terminal genomic fragment of the snr-3 gene displayed Ac-DAF-16-dependent cis-regulatory activity.

  3. Regulatory Considerations for Gene Therapy Products in the US, EU, and Japan.

    Science.gov (United States)

    Halioua-Haubold, Celine-Lea; Peyer, James G; Smith, James A; Arshad, Zeeshaan; Scholz, Matthew; Brindley, David A; MacLaren, Robert E

    2017-12-01

    Developers of gene therapy products (GTPs) must adhere to additional regulation beyond that of traditional small-molecule therapeutics, due to the unique mechanism-of-action of GTPs and the subsequent novel risks arisen. We have provided herein a summary of the regulatory structure under which GTPs fall in the United States, the European Union, and Japan, and a comprehensive overview of the regulatory guidance applicable to the developer of GTP. Understanding the regulatory requirements for seeking GTP market approval in these major jurisdictions is crucial for an effective and expedient path to market. The novel challenges facing GTP developers is highlighted by a case study of alipogene tiparvovec (Glybera).

  4. Molecular and Biochemical Characterization of Two Xylanase-Encoding Genes from Cellulomonas pachnodae

    Science.gov (United States)

    Cazemier, Anne E.; Verdoes, Jan C.; van Ooyen, Albert J. J.; Op den Camp, Huub J. M.

    1999-01-01

    Two xylanase-encoding genes, named xyn11A and xyn10B, were isolated from a genomic library of Cellulomonas pachnodae by expression in Escherichia coli. The deduced polypeptide, Xyn11A, consists of 335 amino acids with a calculated molecular mass of 34,383 Da. Different domains could be identified in the Xyn11A protein on the basis of homology searches. Xyn11A contains a catalytic domain belonging to family 11 glycosyl hydrolases and a C-terminal xylan binding domain, which are separated from the catalytic domain by a typical linker sequence. Binding studies with native Xyn11A and a truncated derivative of Xyn11A, lacking the putative binding domain, confirmed the function of the two domains. The second xylanase, designated Xyn10B, consists of 1,183 amino acids with a calculated molecular mass of 124,136 Da. Xyn10B also appears to be a modular protein, but typical linker sequences that separate the different domains were not identified. It comprises a N-terminal signal peptide followed by a stretch of amino acids that shows homology to thermostabilizing domains. Downstream of the latter domain, a catalytic domain specific for family 10 glycosyl hydrolases was identified. A truncated derivative of Xyn10B bound tightly to Avicel, which was in accordance with the identified cellulose binding domain at the C terminus of Xyn10B on the basis of homology. C. pachnodae, a (hemi)cellulolytic bacterium that was isolated from the hindgut of herbivorous Pachnoda marginata larvae, secretes at least two xylanases in the culture fluid. Although both Xyn11A and Xyn10B had the highest homology to xylanases from Cellulomonas fimi, distinct differences in the molecular organizations of the xylanases from the two Cellulomonas species were identified. PMID:10473422

  5. Transcriptional regulation of the Rhodococcus rhodochrous J1 nitA gene encoding a nitrilase.

    Science.gov (United States)

    Komeda, H; Hori, Y; Kobayashi, M; Shimizu, S

    1996-01-01

    The 1.4-kb downstream region from a nitrilase gene (nitA) of an actinomycete Rhodococcus rhodochrous J1, which is industrially in use, was found to be required for the isovaleronitrile-dependent induction of nitrilase synthesis in experiments using a Rhodococcus-Escherichia coli shuttle vector pK4 in a Rhodococcus strain. Sequence analysis of the 1.4-kb region revealed the existence of an open reading frame (nitR) of 957 bp, which would encode a protein with a molecular mass of 35,100. Deletion of the central and 3'-terminal portion of nitR resulted in the complete loss of nitrilase activity, demonstrating that nitR codes for a transcriptional positive regulator in nitA expression. The deduced amino acid sequence of nitR showed similarity to a positive regulator family including XylS from Pseudomonas putida and AraC from E. coli. By Northern blot analysis, the 1.4-kb transcripts for nitA were detected in R. rhodochrous J1 cells cultured in the presence of isovaleronitrile, but not those cultured in the absence of isovaleronitrile. The transcriptional start site for nitA was mapped to a C residue located 26 bp upstream of its translational start site. Deletion analysis to define the nitA promoter region suggested the possible participation of an inverted repeat sequence, centered on base pair -52, in induction of nitA transcription. Images Fig. 2 Fig. 5 Fig. 6 PMID:8855219

  6. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  7. Cloning and expression of a novel, moderately thermostable xylanase-encoding gene (Cflxyn11A) from Cellulomonas flavigena.

    Science.gov (United States)

    Amaya-Delgado, Lorena; Mejía-Castillo, Teresa; Santiago-Hernández, Alejandro; Vega-Estrada, Jesús; Amelia, Farrés-G-S; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto; Montes-Horcasitas, María Del Carmen; Hidalgo-Lara, María Eugenia

    2010-07-01

    The Cfl xyn11A gene, encoding the endo-1,4-beta-xylanase Cfl Xyn11A from Cellulomonas flavigena, was isolated from a genomic DNA library. The open reading frame of the Cfl xyn11A gene was 999 base pairs long and encoded a polypeptide (Cfl Xyn11A) of 332 amino acids with a calculated molecular mass of 35,110Da. The Cfl xyn11A gene was expressed in Escherichia coli and the recombinant enzyme, with an estimated molecular weight of 31kDa was purified and xylanase activity was measured. Cfl Xyn11A showed optimal activity at pH 6.5 and 55 degrees C. The enzyme demonstrated moderate thermal stability as Cfl Xyn11A maintained 50% of its activity when incubated at 55 degrees C for 1h or at 45 degrees C for 6h. This is the first report describing the cloning, expression and functional characterization of an endo-1,4-beta-xylanase-encoding gene from C. flavigena. Cfl Xyn11A may be suitable for industrial applications in the food and feed industries, or in the pre-treatment of lignocellulosic biomass required to improve the yields of fermentable sugars for bioethanol production. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  8. Genome organisation and expression profiling of ABC protein-encoding genes in Heterobasidion annosum s.l. complex.

    Science.gov (United States)

    Baral, Bikash; Kovalchuk, Andriy; Asiegbu, Fred O

    2016-03-01

    Members of Heterobasidion annosum species complex are widely regarded as the most destructive fungal pathogens of conifer trees in the boreal and temperate zones of Northern hemisphere. To invade and colonise their host trees, Heterobasidion fungi must overcome components of host chemical defence, including terpenoid oleoresin and phenolic compounds. ABC transporters may play an important role in this process participating in the export of toxic host metabolites and maintaining their intracellular concentration below the critical level. We have identified and phylogenetically classified Heterobasidion genes encoding ABC transporters and closely related ABC proteins. The number of ABC proteins in the Heterobasidion genome is one of the lowest among analysed species of Agaricomycotina. Using quantitative RT-PCR, we have analysed transcriptional response of Heterobasidion ABC transporter-encoding genes to monoterpenes as well as their expression profile during growth on pine wood in comparison to the growth on defined media. Several ABC transporters were up-regulated during growth on pine wood. The ABC-transporter encoding gene ABCG1.1 was induced both during growth of H. annosum on pine wood and upon exposure to monoterpenes. Our experimental data demonstrate the differential responses of Heterobasidion ABC genes to growth conditions and chemical stressors. The presented results suggest a potential role of Heterobasidion ABC-G transporters in the resistance to the components of conifer chemical defence. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  9. Genomic organization and chromosomal localization of the human and mouse genes encoding the {alpha} receptor component for ciliary neurotrophic factor

    Energy Technology Data Exchange (ETDEWEB)

    Valenzuela, D.M.; Rojas, E.; McClain, J. [Regeneron Pharmaceuticals, Inc., Tarrytown, NY (United States)] [and others

    1995-01-01

    Ciliary neurotrophic factor (CNTF) has recently been found to share receptor components with, and to be structurally related to, a family of broadly acting cytokines, including interleukin-6, leukemia inhibitory factor, and oncostatin M. However, the CNTF receptor complex also includes a CNTF-specific component known as CNTF receptor {alpha} (CNTFR{alpha}). Here we describe the molecular cloning of the human and mouse genes encoding CNTFR. We report that the human and mouse genes have an identical intron-exon structure that correlates well with the domain structure of CNTFR{alpha}. That is, the signal peptide and the immunoglobulin-like domain are each encoded by single exons, the cytokine receptor-like domain is distributed among 4 exons, and the C-terminal glycosyl phosphatidylinositol recognition domain in encoded by the final coding exon. The position of the introns within the cytokine receptor-like domain corresponds to those found in other members of the cytokine receptor superfamily. Confirming a recent study using radiation hybrids, we have also mapped the human CNTFR gene to chromosome band 9p13 and the mouse gene to a syntenic region of chromosome 4. 24 refs., 4 figs.

  10. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria...... in nonimmune patients tend to express a restricted subset of VSA (VSA(SM)) that differs from VSA associated with uncomplicated malaria and asymptomatic infection (VSA(UM)). We compared var gene transcription in unselected P. falciparum clone 3D7 expressing VSA(UM) to in vitro-selected sublines expressing VSA......(SM) to identify PfEMP1 responsible for the VSA(SM) phenotype. Expression of VSA(SM) was accompanied by up-regulation of Group A var genes. The most prominently up-regulated Group A gene (PFD1235w/MAL7P1.1) was translated into a protein expressed on the infected RBC surface. The proteins encoded by Group A var...

  11. Genomic cloning and characterization of a PPA gene encoding a mannose-binding lectin from Pinellia pedatisecta.

    Science.gov (United States)

    Lin, Juan; Zhou, Xuanwei; Fei, Jiong; Liao, Zhihua; Jin, Wang; Sun, Xiaofen; Tang, Kexuan

    2006-04-01

    A gene encoding a mannose-binding lectin, Pinellia pedatisecta agglutinin (PPA), was isolated from leaves of Pinellia pedatisecta using genomic walker technology. The ppa contained an 1140-bp 5'-upstream region, a 771-bp open reading frame (ORF) and an 829-bp 3'-downstream region. The ORF encoded a precursor polypeptide of 256 amino acid residues with a 24-amino acid signal peptide. There were one putative TATA box and six possible CAAT boxes lying in the 5'-upstream region of ppa. The ppa showed significant similarity at the nucleic acid level with genes encoding mannose-binding lectins from other Araceae species such as Pinellia ternata, Arisaema hererophyllum, Colocasia esculenta and Arum maculatum. At the amino acid level, PPA also shared varying homology (ranging from 40% to 85%) with mannose-binding lectins from other plant species, such as those from Araceae, Alliaceae, Iridaceae, Lillaceae, Amaryllidaceae and Bromeliaceae. The cloning of the ppa gene not only provides a basis for further investigation of PPA's structure, expression and regulation mechanism, but also enables us to test its potential role in controlling pests and fungal diseases by transferring the gene into tobacco and rice in the future.

  12. Identifying noncoding risk variants using disease-relevant gene regulatory networks.

    Science.gov (United States)

    Gao, Long; Uzun, Yasin; Gao, Peng; He, Bing; Ma, Xiaoke; Wang, Jiahui; Han, Shizhong; Tan, Kai

    2018-02-16

    Identifying noncoding risk variants remains a challenging task. Because noncoding variants exert their effects in the context of a gene regulatory network (GRN), we hypothesize that explicit use of disease-relevant GRNs can significantly improve the inference accuracy of noncoding risk variants. We describe Annotation of Regulatory Variants using Integrated Networks (ARVIN), a general computational framework for predicting causal noncoding variants. It employs a set of novel regulatory network-based features, combined with sequence-based features to infer noncoding risk variants. Using known causal variants in gene promoters and enhancers in a number of diseases, we show ARVIN outperforms state-of-the-art methods that use sequence-based features alone. Additional experimental validation using reporter assay further demonstrates the accuracy of ARVIN. Application of ARVIN to seven autoimmune diseases provides a holistic view of the gene subnetwork perturbed by the combinatorial action of the entire set of risk noncoding mutations.

  13. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.

    1986-01-01

    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  14. Influence of the experimental design of gene expression studies on the inference of gene regulatory networks: environmental factors

    Directory of Open Access Journals (Sweden)

    Frank Emmert-Streib

    2013-02-01

    Full Text Available The inference of gene regulatory networks gained within recent years a considerable interest in the biology and biomedical community. The purpose of this paper is to investigate the influence that environmental conditions can exhibit on the inference performance of network inference algorithms. Specifically, we study five network inference methods, Aracne, BC3NET, CLR, C3NET and MRNET, and compare the results for three different conditions: (I observational gene expression data: normal environmental condition, (II interventional gene expression data: growth in rich media, (III interventional gene expression data: normal environmental condition interrupted by a positive spike-in stimulation. Overall, we find that different statistical inference methods lead to comparable, but condition-specific results. Further, our results suggest that non-steady-state data enhance the inferability of regulatory networks.

  15. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    Energy Technology Data Exchange (ETDEWEB)

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  16. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  17. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Lei [Los Alamos National Laboratory

    2009-01-01

    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  18. A regulatory gene (ECO-orf4) required for ECO-0501 biosynthesis in Amycolatopsis orientalis.

    Science.gov (United States)

    Shen, Yang; Huang, He; Zhu, Li; Luo, Minyu; Chen, Daijie

    2014-02-01

    ECO-0501 is a novel linear polyene antibiotic, which was discovered from Amycolatopsis orientalis. Recent study of ECO-0501 biosynthesis pathway revealed the presence of regulatory gene: ECO-orf4. The A. orientalis ECO-orf4 gene from the ECO-0501 biosynthesis cluster was analyzed, and its deduced protein (ECO-orf4) was found to have amino acid sequence homology with large ATP-binding regulators of the LuxR (LAL) family regulators. Database comparison revealed two hypothetical domains, a LuxR-type helix-turn-helix (HTH) DNA binding motif near the C-terminal and an N-terminal nucleotide triphosphate (NTP) binding motif included. Deletion of the corresponding gene (ECO-orf4) resulted in complete loss of ECO-0501 production. Complementation by one copy of intact ECO-orf4 restored the polyene biosynthesis demonstrating that ECO-orf4 is required for ECO-0501 biosynthesis. The results of overexpression ECO-orf4 on ECO-0501 production indicated that it is a positive regulatory gene. Gene expression analysis by reverse transcription PCR of the ECO-0501 gene cluster showed that the transcription of ECO-orf4 correlates with that of genes involved in polyketide biosynthesis. These results demonstrated that ECO-orf4 is a pathway-specific positive regulatory gene that is essential for ECO-0501 biosynthesis. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  20. Effect of hypoxia on the expression of nuclear genes encoding mitochondrial proteins in U87 glioma cells

    Directory of Open Access Journals (Sweden)

    O. H. Minchenko

    2016-06-01

    Full Text Available We have studied the effect of hypoxia on the expression of nuclear genes encoding mitochondrial proteins in U87 glioma cells under the inhibition of IRE1 (inositol requiring enzyme-1, which controls cell proliferation and tumor growth as a central mediator of endoplasmic reticulum stress. It was shown that hypoxia down-regulated gene expression of malate dehydrogenase 2 (MDH2, malic enzyme 2 (ME2, mitochondrial aspartate aminotransferase (GOT2, and subunit B of succinate dehydrogenase (SDHB in control (transfected by empty vector glioma cells in a gene specific manner. At the same time, the expression level of mitochondrial NADP+-dependent isocitrate dehydrogenase 2 (IDH2 and subunit D of succinate dehydrogenase (SDHD genes in these cells does not significantly change in hypoxic conditions. It was also shown that the inhibition of ІRE1 signaling enzyme function in U87 glioma cells decreases the effect of hypoxia on the expression of ME2, GOT2, and SDHB genes and introduces the sensitivity of IDH2 gene to hypoxia. Furthermore, the expression of all studied genes depends on IRE1-mediated endoplasmic reticulum stress signaling in gene specific manner, because ІRE1 knockdown significantly decreases their expression in normoxic conditions, except for IDH2 gene, which expression level is strongly up-regulated. Therefore, changes in the expression level of nuclear genes encoding ME2, MDH2, IDH2, SDHB, SDHD, and GOT2 proteins possibly reflect metabolic reprogramming of mitochondria by hypoxia and IRE1-mediated endoplasmic reticulum stress signaling and correlate with suppression of glioma cell proliferation under inhibition of the IRE1 enzyme function.

  1. Inferring a transcriptional regulatory network of the cytokinesis-related genes by network component analysis

    Directory of Open Access Journals (Sweden)

    Kao Cheng-Yan

    2009-11-01

    Full Text Available Abstract Background Network Component Analysis (NCA is a network structure-driven framework for deducing regulatory signal dynamics. In contrast to principal component analysis, which can be employed to select the high-variance genes, NCA makes use of the connectivity structure from transcriptional regulatory networks to infer dynamics of transcription factor activities. Using the budding yeast Saccharomyces cerevisiae as a model system, we aim to deduce regulatory actions of cytokinesis-related genes, using precise spatial proximity (midbody and/or temporal synchronicity (cytokinesis to avoid full-scale computation from genome-wide databases. Results NCA was applied to infer regulatory actions of transcription factor activity from microarray data and partial transcription factor-gene connectivity information for cytokinesis-related genes, which were a subset of genome-wide datasets. No literature has so far discussed the inferred results through NCA are independent of the scale of the gene expression dataset. To avoid full-scale computation from genome-wide databases, four cytokinesis-related gene cases were selected for NCA by running computational analysis over the transcription factor database to confirm the approach being scale-free. The inferred dynamics of transcription factor activity through NCA were independent of the scale of the data matrix selected from the four cytokinesis-related gene sets. Moreover, the inferred regulatory actions were nearly identical to published observations for the selected cytokinesis-related genes in the budding yeast; namely, Mcm1, Ndd1, and Fkh2, which form a transcription factor complex to control expression of the CLB2 cluster (i.e. BUD4, CHS2, IQG1, and CDC5. Conclusion In this study, using S. cerevisiae as a model system, NCA was successfully applied to infer similar regulatory actions of transcription factor activities from two various microarray databases and several partial transcription factor-gene

  2. Inferring a transcriptional regulatory network of the cytokinesis-related genes by network component analysis.

    Science.gov (United States)

    Chen, Shun-Fu; Juang, Yue-Li; Chou, Wei-Kang; Lai, Jin-Mei; Huang, Chi-Ying F; Kao, Cheng-Yan; Wang, Feng-Sheng

    2009-11-27

    Network Component Analysis (NCA) is a network structure-driven framework for deducing regulatory signal dynamics. In contrast to principal component analysis, which can be employed to select the high-variance genes, NCA makes use of the connectivity structure from transcriptional regulatory networks to infer dynamics of transcription factor activities. Using the budding yeast Saccharomyces cerevisiae as a model system, we aim to deduce regulatory actions of cytokinesis-related genes, using precise spatial proximity (midbody) and/or temporal synchronicity (cytokinesis) to avoid full-scale computation from genome-wide databases. NCA was applied to infer regulatory actions of transcription factor activity from microarray data and partial transcription factor-gene connectivity information for cytokinesis-related genes, which were a subset of genome-wide datasets. No literature has so far discussed the inferred results through NCA are independent of the scale of the gene expression dataset. To avoid full-scale computation from genome-wide databases, four cytokinesis-related gene cases were selected for NCA by running computational analysis over the transcription factor database to confirm the approach being scale-free. The inferred dynamics of transcription factor activity through NCA were independent of the scale of the data matrix selected from the four cytokinesis-related gene sets. Moreover, the inferred regulatory actions were nearly identical to published observations for the selected cytokinesis-related genes in the budding yeast; namely, Mcm1, Ndd1, and Fkh2, which form a transcription factor complex to control expression of the CLB2 cluster (i.e. BUD4, CHS2, IQG1, and CDC5). In this study, using S. cerevisiae as a model system, NCA was successfully applied to infer similar regulatory actions of transcription factor activities from two various microarray databases and several partial transcription factor-gene connectivity datasets for selected cytokinesis

  3. Fractal gene regulatory networks for robust locomotion control of modular robots

    DEFF Research Database (Denmark)

    Zahadat, Payam; Christensen, David Johan; Schultz, Ulrik Pagh

    2010-01-01

    Designing controllers for modular robots is difficult due to the distributed and dynamic nature of the robots. In this paper fractal gene regulatory networks are evolved to control modular robots in a distributed way. Experiments with different morphologies of modular robot are performed and the ......Designing controllers for modular robots is difficult due to the distributed and dynamic nature of the robots. In this paper fractal gene regulatory networks are evolved to control modular robots in a distributed way. Experiments with different morphologies of modular robot are performed...

  4. Sensor-coupled fractal gene regulatory networks for locomotion control of a modular snake robot

    DEFF Research Database (Denmark)

    Zahadat, Payam; Christensen, David Johan; Katebi, Serajeddin

    2013-01-01

    In this paper we study fractal gene regulatory network (FGRN) controllers based on sensory information. The FGRN controllers are evolved to control a snake robot consisting of seven simulated ATRON modules. Each module contains three tilt sensors which represent the direction of gravity in the co......In this paper we study fractal gene regulatory network (FGRN) controllers based on sensory information. The FGRN controllers are evolved to control a snake robot consisting of seven simulated ATRON modules. Each module contains three tilt sensors which represent the direction of gravity...

  5. Molecular characterization of a maize regulatory gene. Progress report, July 1989--March 1990

    Energy Technology Data Exchange (ETDEWEB)

    Wessler, S.

    1990-12-31

    This progress report contains information concerning the characterization of the Maize regulatory gene. The findings of this research program have immediate significance. Firstly, it provides support for the notion that R proteins, produced by the regulatory gene, are functionally equivalent. Secondly, the success of these experiments provides a simple transient assay for either natural or constructed R protein mutations. The relative ease of this assay coupled with overnight results are important prerequisites to the proposed experiments involving a structure-function analysis of the R protein.

  6. Genome-wide identification of regulatory elements and reconstruction of gene regulatory networks of the green alga Chlamydomonas reinhardtii under carbon deprivation.

    Science.gov (United States)

    Winck, Flavia Vischi; Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

    2013-01-01

    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  7. Harnessing diversity towards the reconstructing of large scale gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Takeshi Hase

    Full Text Available Elucidating gene regulatory network (GRN from large scale experimental data remains a central challenge in systems biology. Recently, numerous techniques, particularly consensus driven approaches combining different algorithms, have become a potentially promising strategy to infer accurate GRNs. Here, we develop a novel consensus inference algorithm, TopkNet that can integrate multiple algorithms to infer GRNs. Comprehensive performance benchmarking on a cloud computing framework demonstrated that (i a simple strategy to combine many algorithms does not always lead to performance improvement compared to the cost of consensus and (ii TopkNet integrating only high-performance algorithms provide significant performance improvement compared to the best individual algorithms and community prediction. These results suggest that a priori determination of high-performance algorithms is a key to reconstruct an unknown regulatory network. Similarity among gene-expression datasets can be useful to determine potential optimal algorithms for reconstruction of unknown regulatory networks, i.e., if expression-data associated with known regulatory network is similar to that with unknown regulatory network, optimal algorithms determined for the known regulatory network can be repurposed to infer the unknown regulatory network. Based on this observation, we developed a quantitative measure of similarity among gene-expression datasets and demonstrated that, if similarity between the two expression datasets is high, TopkNet integrating algorithms that are optimal for known dataset perform well on the unknown dataset. The consensus framework, TopkNet, together with the similarity measure proposed in this study provides a powerful strategy towards harnessing the wisdom of the crowds in reconstruction of unknown regulatory networks.

  8. Expression of the Acc1 Gene-Encoded Acetyl-Coenzyme A Carboxylase in Developing Maize (Zea mays L.) Kernels.

    Science.gov (United States)

    Somers, D. A.; Keith, R. A.; Egli, M. A.; Marshall, L. C.; Gengenbach, B. G.; Gronwald, J. W.; Wyse, D. L.

    1993-01-01

    A mutation (Acc1-S2) in the structural gene for maize (Zea mays L.) acetyl-coenzyme A carboxylase (ACCase) that significantly reduces sethoxydim inhibition of leaf ACCase activity was used to investigate the gene-enzyme relationship regulating ACCase activity during oil deposition in developing kernels. Mutant embryo and endosperm ACCase activities were more than 600-fold less sensitive to sethoxydim inhibition than ACCase in wild-type kernel tissues. Moreover, in vitro cultured mutant kernels developed normally in the presence of sethoxydim concentrations that inhibited wild-type kernel development. The results indicate that the Acc1-encoded ACCase accounts for the majority of ACCase activity in developing maize kernels, suggesting that Acc1-encoded ACCase functions not only during membrane biogenesis in leaves but is also the predominant form of ACCase involved in storage lipid biosynthesis in maize embryos. PMID:12231761

  9. Variation in the Gene Encoding the Serotonin Transporter is Associated with a Measure of Sociopathy in Alcoholics

    OpenAIRE

    Herman, Aryeh I.; Conner, Tamlin S.; Anton, Raymond F.; Gelernter, Joel; Kranzler, Henry R.; Covault, Jonathan

    2011-01-01

    The present study examined the association between a measure of sociopathy and 5-HTTLPR genotype in a sample of individuals from Project MATCH, a multi-center alcohol treatment trial. 5-HTTLPR, an insertion/deletion polymorphism in SLC6A4, the gene encoding the serotonin transporter protein, results in functionally distinct long (L) and short (S) alleles. The S allele has been associated with a variety of psychiatric disorders and symptoms including alcohol dependence, but it is unknown wheth...

  10. Excretion of putrescine by the putrescine-ornithine antiporter encoded by the potE gene of Escherichia coli.

    OpenAIRE

    Kashiwagi, K; Miyamoto, S; Suzuki, F; Kobayashi, H; Igarashi, K

    1992-01-01

    Excretion of putrescine from Escherichia coli was assessed by measuring its uptake into inside-out membrane vesicles. The vesicles were prepared from wild-type E. coli or E. coli transformed with plasmids containing one of the three polyamine transport systems. The results indicate that excretion of putrescine is catalyzed by the putrescine transport protein, encoded by the potE gene located at 16 min on the E. coli chromosome. Loading of ornithine (or lysine) inside the vesicles was essentia...

  11. BTNET : boosted tree based gene regulatory network inference algorithm using time-course measurement data.

    Science.gov (United States)

    Park, Sungjoon; Kim, Jung Min; Shin, Wonho; Han, Sung Won; Jeon, Minji; Jang, Hyun Jin; Jang, Ik-Soon; Kang, Jaewoo

    2018-03-19

    Identifying gene regulatory networks is an important task for understanding biological systems. Time-course measurement data became a valuable resource for inferring gene regulatory networks. Various methods have been presented for reconstructing the networks from time-course measurement data. However, existing methods have been validated on only a limited number of benchmark datasets, and rarely verified on real biological systems. We first integrated benchmark time-course gene expression datasets from previous studies and reassessed the baseline methods. We observed that GENIE3-time, a tree-based ensemble method, achieved the best performance among the baselines. In this study, we introduce BTNET, a boosted tree based gene regulatory network inference algorithm which improves the state-of-the-art. We quantitatively validated BTNET on the integrated benchmark dataset. The AUROC and AUPR scores of BTNET were higher than those of the baselines. We also qualitatively validated the results of BTNET through an experiment on neuroblastoma cells treated with an antidepressant. The inferred regulatory network from BTNET showed that brachyury, a transcription factor, was regulated by fluoxetine, an antidepressant, which was verified by the expression of its downstream genes. We present BTENT that infers a GRN from time-course measurement data using boosting algorithms. Our model achieved the highest AUROC and AUPR scores on the integrated benchmark dataset. We further validated BTNET qualitatively through a wet-lab experiment and showed that BTNET can produce biologically meaningful results.

  12. Developmental gene regulatory network architecture across 500 million years of echinoderm evolution

    Science.gov (United States)

    Hinman, Veronica F.; Nguyen, Albert T.; Cameron, R. Andrew; Davidson, Eric H.

    2003-01-01

    Evolutionary change in morphological features must depend on architectural reorganization of developmental gene regulatory networks (GRNs), just as true conservation of morphological features must imply retention of ancestral developmental GRN features. Key elements of the provisional GRN for embryonic endomesoderm development in the sea urchin are here compared with those operating in embryos of a distantly related echinoderm, a starfish. These animals diverged from their common ancestor 520-480 million years ago. Their endomesodermal fate maps are similar, except that sea urchins generate a skeletogenic cell lineage that produces a prominent skeleton lacking entirely in starfish larvae. A relevant set of regulatory genes was isolated from the starfish Asterina miniata, their expression patterns determined, and effects on the other genes of perturbing the expression of each were demonstrated. A three-gene feedback loop that is a fundamental feature of the sea urchin GRN for endoderm specification is found in almost identical form in the starfish: a detailed element of GRN architecture has been retained since the Cambrian Period in both echinoderm lineages. The significance of this retention is highlighted by the observation of numerous specific differences in the GRN connections as well. A regulatory gene used to drive skeletogenesis in the sea urchin is used entirely differently in the starfish, where it responds to endomesodermal inputs that do not affect it in the sea urchin embryo. Evolutionary changes in the GRNs since divergence are limited sharply to certain cis-regulatory elements, whereas others have persisted unaltered.

  13. Experimentally based sea urchin gene regulatory network and the causal explanation of developmental phenomenology.

    Science.gov (United States)

    Ben-Tabou de-Leon, Smadar; Davidson, Eric H

    2009-01-01

    Gene regulatory networks for development underlie cell fate specification and differentiation. Network topology, logic and dynamics can be obtained by thorough experimental analysis. Our understanding of the gene regulatory network controlling endomesoderm specification in the sea urchin embryo has attained an advanced level such that it explains developmental phenomenology. Here we review how the network explains the mechanisms utilized in development to control the formation of dynamic expression patterns of transcription factors and signaling molecules. The network represents the genomic program controlling timely activation of specification and differentiation genes in the correct embryonic lineages. It can also be used to study evolution of body plans. We demonstrate how comparing the sea urchin gene regulatory network to that of the sea star and to that of later developmental stages in the sea urchin, reveals mechanisms underlying the origin of evolutionary novelty. The experimentally based gene regulatory network for endomesoderm specification in the sea urchin embryo provides unique insights into the system level properties of cell fate specification and its evolution.

  14. ICGA-PSO-ELM approach for accurate multiclass cancer classification resulting in reduced gene sets in which genes encoding secreted proteins are highly represented.

    Science.gov (United States)

    Saraswathi, Saras; Sundaram, Suresh; Sundararajan, Narasimhan; Zimmermann, Michael; Nilsen-Hamilton, Marit

    2011-01-01

    A combination of Integer-Coded Genetic Algorithm (ICGA) and Particle Swarm Optimization (PSO), coupled with the neural-network-based Extreme Learning Machine (ELM), is used for gene selection and cancer classification. ICGA is used with PSO-ELM to select an optimal set of genes, which is then used to build a classifier to develop an algorithm (ICGA_PSO_ELM) that can handle sparse data and sample imbalance. We evaluate the performance of ICGA-PSO-ELM and compare our results with existing methods in the literature. An investigation into the functions of the selected genes, using a systems biology approach, revealed that many of the identified genes are involved in cell signaling and proliferation. An analysis of these gene sets shows a larger representation of genes that encode secreted proteins than found in randomly selected gene sets. Secreted proteins constitute a major means by which cells interact with their surroundings. Mounting biological evidence has identified the tumor microenvironment as a critical factor that determines tumor survival and growth. Thus, the genes identified by this study that encode secreted proteins might provide important insights to the nature of the critical biological features in the microenvironment of each tumor type that allow these cells to thrive and proliferate.

  15. Molecular evolution constraints in the floral organ specification gene regulatory network module across 18 angiosperm genomes.

    Science.gov (United States)

    Davila-Velderrain, Jose; Servin-Marquez, Andres; Alvarez-Buylla, Elena R

    2014-03-01

    The gene regulatory network of floral organ cell fate specification of Arabidopsis thaliana is a robust developmental regulatory module. Although such finding was proposed to explain the overall conservation of floral organ types and organization among angiosperms, it has not been confirmed that the network components are conserved at the molecular level among flowering plants. Using the genomic data that have accumulated, we address the conservation of the genes involved in this network and the forces that have shaped its evolution during the divergence of angiosperms. We recovered the network gene homologs for 18 species of flowering plants spanning nine families. We found that all the genes are highly conserved with no evidence of positive selection. We studied the sequence conservation features of the genes in the context of their known biological function and the strength of the purifying selection acting upon them in relation to their placement within the network. Our results suggest an association between protein length and sequence conservation, evolutionary rates, and functional category. On the other hand, we found no significant correlation between the strength of purifying selection and gene placement. Our results confirm that the studied robust developmental regulatory module has been subjected to strong functional constraints. However, unlike previous studies, our results do not support the notion that network topology plays a major role in constraining evolutionary rates. We speculate that the dynamical functional role of genes within the network and not just its connectivity could play an important role in constraining evolution.

  16. Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (pppGpp synthase

    Directory of Open Access Journals (Sweden)

    Kalinowski Jörn

    2006-09-01

    Full Text Available Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (pppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (pppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be

  17. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  18. Toxoplasma gondii gene expression is under the control of regulatory pathways acting through chromatin structure

    Directory of Open Access Journals (Sweden)

    Bougdour A.

    2008-09-01

    Full Text Available The activity state of a gene is determined by a complex regulatory network of co-acting factors affecting the structure of the chromatin into which the gene is embedded. While significant changes of the transcriptome occur during cell differentiation in apicomplexan parasites, basic mechanisms controlling gene expression are still unknown. Recent studies support and expand the concept of the chromatin environment being key factor for the control of transcriptional activity in these lower eukaryotes organisms. Here, we review recent advances in the field of epigenetic gene regulation in Toxoplasma gondii, the model apicomplexan.

  19. Mutations in the gene encoding the synaptic scaffolding protein SHANK3 are associated with autism spectrum disorders

    Science.gov (United States)

    Durand, Christelle M.; Betancur, Catalina; Boeckers, Tobias M.; Bockmann, Juergen; Chaste, Pauline; Fauchereau, Fabien; Nygren, Gudrun; Rastam, Maria; Gillberg, I Carina; Anckarsäter, Henrik; Sponheim, Eili; Goubran-Botros, Hany; Delorme, Richard; Chabane, Nadia; Mouren-Simeoni, Marie-Christine; de Mas, Philippe; Bieth, Eric; Rogé, Bernadette; Héron, Delphine; Burglen, Lydie; Gillberg, Christopher; Leboyer, Marion; Bourgeron, Thomas

    2007-01-01

    SHANK3 (also known as ProSAP2) regulates the structural organization of dendritic spines and is a binding partner of neuroligins; genes encoding neuroligins are mutated in autism and Asperger syndrome. Here, we report that a mutation of a single copy of SHANK3 on chromosome 22q13 can result in language and/or social communication disorders. These mutations concern only a small number of individuals, but they shed light on one gene dosage-sensitive synaptic pathway that is involved in autism spectrum disorders. PMID:17173049

  20. Cloning and Expression of Genes for Dengue Virus Type-2 Encoded Antigens for Rapid Diagnosis and Vaccine Development

    Science.gov (United States)

    1986-11-26

    SIE cop AD nCloning and Expression of Genes for Dengue Virus ,4. CJ Type 2 Encoded Antigens for Rapid Diagnosis and Vaccine Development 0ANNUAL...pVVI and pVVI7 cDNA clones, synthetic peptides homologous to NS5 and NSI regions were synthesized. These peptides are being used at Walter Reed Army...NO. Frederick, MD 21701-5012 63750A 63750 D808 A i 031 11. TITLE (Include Serurity Classification) Cloning and Expression of Genes for Dengue Virus

  1. Analysis of single nucleotide polymorphisms in uridine/cytidine kinase gene encoding metabolic enzyme of 3'-ethynylcytidine.

    Science.gov (United States)

    Hasegawa, Takako; Futagami, Michiko; Kim, Hey-Sook; Matsuda, Akira; Wataya, Yusuke

    2002-01-01

    We investigated single nucleotide polymorphisms (SNPs) in uck2 gene encoding metabolic enzyme of 3'-ethynylcytidine (ECyd) which were associated with drug response of ECyd, and the newly synthesized antitumor ribonucleoside analog. We analized that on exon-intron junction and exon region to affect the qualitative alteration of gene product directly in ECyd sensitive and resistant human cancer cell lines. As the results, cSNP and sSNP were detected in exon 4. In the promoter region, 3 SNPs were detected. Our data seem to be able to give an important knowledge, when ECyd is applied clinically.

  2. DNA inversion within the apolipoproteins AI/CIII/AIV-encoding gene cluster of certain patients with premature atherosclerosis

    International Nuclear Information System (INIS)

    Karathanasis, S.K.; Ferris, E.; Haddad, I.A.

    1987-01-01

    The genes coding for apolipoproteins (apo)