WorldWideScience

Sample records for gene encoding regulatory

  1. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  2. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Science.gov (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  3. GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML.

    Science.gov (United States)

    Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas

    2013-09-01

    GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.

  4. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Science.gov (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  5. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    Science.gov (United States)

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  6. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

    2014-01-01

    . In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...

  7. CK2(beta)tes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster

    DEFF Research Database (Denmark)

    Kalmykova, Alla I; Shevelyov, Yuri Y; Polesskaya, Oksana O

    2002-01-01

    An earlier described CK2(beta)tes gene of Drosophila melanogaster is shown to encode a male germline specific isoform of regulatory beta subunit of casein kinase 2. Western-analysis using anti-CK2(beta)tes Ig revealed CK2(beta)tes protein in Drosophila testes extract. Expression of a CK2(beta...... and coimmunoprecipitation analysis of protein extract from Drosophila testes, we demonstrated an association between CK2(beta)tes and CK2alpha. Northern-analysis has shown that another regulatory (beta') subunit found recently in D. melanogaster genome is also testis-specific. Thus, we describe the first example of two...

  8. Exposure of a 23F Serotype Strain of Streptococcus pneumoniae to Cigarette Smoke Condensate Is Associated with Selective Upregulation of Genes Encoding the Two-Component Regulatory System 11 (TCS11

    Directory of Open Access Journals (Sweden)

    Riana Cockeran

    2014-01-01

    Full Text Available Alterations in whole genome expression profiles following exposure of the pneumococcus (strain 172, serotype 23F to cigarette smoke condensate (160 μg/mL for 15 and 60 min have been determined using the TIGR4 DNA microarray chip. Exposure to CSC resulted in the significant (P<0.014–0.0006 upregulation of the genes encoding the two-component regulatory system 11 (TCS11, consisting of the sensor kinase, hk11, and its cognate response regulator, rr11, in the setting of increased biofilm formation. These effects of cigarette smoke on the pneumococcus may contribute to colonization of the airways by this microbial pathogen.

  9. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  10. Contrasting exome constancy and regulatory region variation in the gene encoding CYP3A4: an examination of the extent and potential implications.

    Science.gov (United States)

    Creemer, Olivia J; Ansari-Pour, Naser; Ekong, Rosemary; Tarekegn, Ayele; Plaster, Christopher; Bains, Ripudaman K; Itan, Yuval; Bekele, Endashaw; Bradman, Neil

    2016-06-01

    CYP3A4 expression varies up to 100-fold among individuals, and, to date, genetic causes remain elusive. As a major drug-metabolizing enzyme, elucidation of such genetic causes would increase the potential for introducing personalized dose adjustment of therapies involving CYP3A4 drug substrates. The foetal CYP3A isoform, CYP3A7, is reported to be expressed in ∼10% of European adults and may thus contribute towards the metabolism of endogenous substances and CYP3A drug substrates. However, little is known about the distribution of the variant expressed in the adult. We resequenced the exons, flanking introns, regulatory elements and 3'UTR of CYP3A4 in five Ethiopian populations and incorporated data from the 1000 Genomes Project. Using bioinformatic analysis, we assessed likely consequences of observed CYP3A4 genomic variation. We also conducted the first extensive geographic survey of alleles associated with adult expression of CYP3A7 - that is, CYP3A7*1B and CYP3A7*1C. Ethiopia contained 60 CYP3A4 variants (26 novel) and more variants (>1%) than all non-African populations combined. No nonsynonymous mutation was found in the homozygous form or at more than 2.8% in any population. Seventy-nine per cent of haplotypes contained 3'UTR and/or regulatory region variation with striking pairwise population differentiation, highlighting the potential for interethnic variation in CYP3A4 expression. Conversely, coding region variation showed that significant interethnic variation is unlikely at the protein level. CYP3A7*1C was found at up to 17.5% in North African populations and in significant linkage disequilibrium with CYP3A5*3, indicating that adult expression of the foetal isoform is likely to be accompanied by reduced or null expression of CYP3A5.

  11. Identification of functional elements and regulatory circuits by Drosophila modENCODE.

    Science.gov (United States)

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L; Landolin, Jane M; Bristow, Christopher A; Ma, Lijia; Lin, Michael F; Washietl, Stefan; Arshinoff, Bradley I; Ay, Ferhat; Meyer, Patrick E; Robine, Nicolas; Washington, Nicole L; Di Stefano, Luisa; Berezikov, Eugene; Brown, Christopher D; Candeias, Rogerio; Carlson, Joseph W; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y; Will, Sebastian; Alekseyenko, Artyom A; Artieri, Carlo; Booth, Benjamin W; Brooks, Angela N; Dai, Qi; Davis, Carrie A; Duff, Michael O; Feng, Xin; Gorchakov, Andrey A; Gu, Tingting; Henikoff, Jorja G; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K; Riddle, Nicole C; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E; Schwartz, Yuri B; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E; Brent, Michael R; Cherbas, Lucy; Elgin, Sarah C R; Gingeras, Thomas R; Grossman, Robert; Hoskins, Roger A; Kaufman, Thomas C; Kent, William; Kuroda, Mitzi I; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J; Celniker, Susan E; Henikoff, Steven; Karpen, Gary H; Lai, Eric C; MacAlpine, David M; Stein, Lincoln D; White, Kevin P; Kellis, Manolis

    2010-12-24

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation.

  12. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  13. Identification of functional elements and regulatory circuits by Drosophila modENCODE

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

    2010-12-22

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

  14. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  15. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  16. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

    Science.gov (United States)

    Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

    2009-12-30

    Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements

  17. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

    Science.gov (United States)

    2009-01-01

    Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T

  18. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  19. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  20. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  1. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  2. Deconstructing the pluripotency gene regulatory network

    KAUST Repository

    Li, Mo

    2018-04-04

    Pluripotent stem cells can be isolated from embryos or derived by reprogramming. Pluripotency is stabilized by an interconnected network of pluripotency genes that cooperatively regulate gene expression. Here we describe the molecular principles of pluripotency gene function and highlight post-transcriptional controls, particularly those induced by RNA-binding proteins and alternative splicing, as an important regulatory layer of pluripotency. We also discuss heterogeneity in pluripotency regulation, alternative pluripotency states and future directions of pluripotent stem cell research.

  3. Deconstructing the pluripotency gene regulatory network

    KAUST Repository

    Li, Mo; Belmonte, Juan Carlos Izpisua

    2018-01-01

    Pluripotent stem cells can be isolated from embryos or derived by reprogramming. Pluripotency is stabilized by an interconnected network of pluripotency genes that cooperatively regulate gene expression. Here we describe the molecular principles of pluripotency gene function and highlight post-transcriptional controls, particularly those induced by RNA-binding proteins and alternative splicing, as an important regulatory layer of pluripotency. We also discuss heterogeneity in pluripotency regulation, alternative pluripotency states and future directions of pluripotent stem cell research.

  4. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  5. Syndromes associated with Homo sapiens pol II regulatory genes.

    Science.gov (United States)

    Bina, M; Demmon, S; Pares-Matos, E I

    2000-01-01

    The molecular basis of human characteristics is an intriguing but an unresolved problem. Human characteristics cover a broad spectrum, from the obvious to the abstract. Obvious characteristics may include morphological features such as height, shape, and facial form. Abstract characteristics may be hidden in processes that are controlled by hormones and the human brain. In this review we examine exaggerated characteristics presented as syndromes. Specifically, we focus on human genes that encode transcription factors to examine morphological, immunological, and hormonal anomalies that result from deletion, insertion, or mutation of genes that regulate transcription by RNA polymerase II (the Pol II genes). A close analysis of abnormal phenotypes can give clues into how sequence variations in regulatory genes and changes in transcriptional control may give rise to characteristics defined as complex traits.

  6. Current approaches to gene regulatory network modelling

    Directory of Open Access Journals (Sweden)

    Brazma Alvis

    2007-09-01

    Full Text Available Abstract Many different approaches have been developed to model and simulate gene regulatory networks. We proposed the following categories for gene regulatory network models: network parts lists, network topology models, network control logic models, and dynamic models. Here we will describe some examples for each of these categories. We will study the topology of gene regulatory networks in yeast in more detail, comparing a direct network derived from transcription factor binding data and an indirect network derived from genome-wide expression data in mutants. Regarding the network dynamics we briefly describe discrete and continuous approaches to network modelling, then describe a hybrid model called Finite State Linear Model and demonstrate that some simple network dynamics can be simulated in this model.

  7. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  8. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  9. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  10. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  11. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  12. Computational challenges in modeling gene regulatory events.

    Science.gov (United States)

    Pataskar, Abhijeet; Tiwari, Vijay K

    2016-10-19

    Cellular transcriptional programs driven by genetic and epigenetic mechanisms could be better understood by integrating "omics" data and subsequently modeling the gene-regulatory events. Toward this end, computational biology should keep pace with evolving experimental procedures and data availability. This article gives an exemplified account of the current computational challenges in molecular biology.

  13. Overexpression of maize anthocyanin regulatory gene Lc affects rice fertility.

    Science.gov (United States)

    Li, Yuan; Zhang, Tao; Shen, Zhong-Wei; Xu, Yu; Li, Jian-Yue

    2013-01-01

    Seventeen independent transgenic rice plants with the maize anthocyanin regulatory gene Lc under control of the CaMV 35S promoter were obtained and verified by molecular identification. Ten plants showed red spikelets during early development of florets, and the degenerate florets were still red after heading. Additionally, these plants exhibited intense pigmentation on the surface of the anther and the bottom of the ovary. They were unable to properly bloom and were completely sterile. Following pollination with normal pollen, these plants yielded red caryopses but did not mature normally. QRT-PCR analysis indicated that mRNA accumulation of the CHS-like gene encoding a chalcone synthase-related protein was increased significantly in the sterile plant. This is the first report to suggest that upregulation of the CHS gene expression may result in rice sterility and affect the normal development of rice seeds.

  14. Sparsity in Model Gene Regulatory Networks

    International Nuclear Information System (INIS)

    Zagorski, M.

    2011-01-01

    We propose a gene regulatory network model which incorporates the microscopic interactions between genes and transcription factors. In particular the gene's expression level is determined by deterministic synchronous dynamics with contribution from excitatory interactions. We study the structure of networks that have a particular '' function '' and are subject to the natural selection pressure. The question of network robustness against point mutations is addressed, and we conclude that only a small part of connections defined as '' essential '' for cell's existence is fragile. Additionally, the obtained networks are sparse with narrow in-degree and broad out-degree, properties well known from experimental study of biological regulatory networks. Furthermore, during sampling procedure we observe that significantly different genotypes can emerge under mutation-selection balance. All the preceding features hold for the model parameters which lay in the experimentally relevant range. (author)

  15. Cloning and bioinformatic analysis of lovastatin biosynthesis regulatory gene lovE.

    Science.gov (United States)

    Huang, Xin; Li, Hao-ming

    2009-08-05

    Lovastatin is an effective drug for treatment of hyperlipidemia. This study aimed to clone lovastatin biosynthesis regulatory gene lovE and analyze the structure and function of its encoding protein. According to the lovastatin synthase gene sequence from genebank, primers were designed to amplify and clone the lovastatin biosynthesis regulatory gene lovE from Aspergillus terrus genomic DNA. Bioinformatic analysis of lovE and its encoding animo acid sequence was performed through internet resources and software like DNAMAN. Target fragment lovE, almost 1500 bp in length, was amplified from Aspergillus terrus genomic DNA and the secondary and three-dimensional structures of LovE protein were predicted. In the lovastatin biosynthesis process lovE is a regulatory gene and LovE protein is a GAL4-like transcriptional factor.

  16. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  17. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  18. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  19. Mutational robustness of gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Aalt D J van Dijk

    Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

  20. Automated Identification of Core Regulatory Genes in Human Gene Regulatory Networks.

    Directory of Open Access Journals (Sweden)

    Vipin Narang

    Full Text Available Human gene regulatory networks (GRN can be difficult to interpret due to a tangle of edges interconnecting thousands of genes. We constructed a general human GRN from extensive transcription factor and microRNA target data obtained from public databases. In a subnetwork of this GRN that is active during estrogen stimulation of MCF-7 breast cancer cells, we benchmarked automated algorithms for identifying core regulatory genes (transcription factors and microRNAs. Among these algorithms, we identified K-core decomposition, pagerank and betweenness centrality algorithms as the most effective for discovering core regulatory genes in the network evaluated based on previously known roles of these genes in MCF-7 biology as well as in their ability to explain the up or down expression status of up to 70% of the remaining genes. Finally, we validated the use of K-core algorithm for organizing the GRN in an easier to interpret layered hierarchy where more influential regulatory genes percolate towards the inner layers. The integrated human gene and miRNA network and software used in this study are provided as supplementary materials (S1 Data accompanying this manuscript.

  1. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  2. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  3. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  4. Asymmetrical distribution of non-conserved regulatory sequences at PHOX2B is reflected at the ENCODE loci and illuminates a possible genome-wide trend

    Directory of Open Access Journals (Sweden)

    McCallion Andrew S

    2009-01-01

    Full Text Available Abstract Background Transcriptional regulatory elements are central to development and interspecific phenotypic variation. Current regulatory element prediction tools rely heavily upon conservation for prediction of putative elements. Recent in vitro observations from the ENCODE project combined with in vivo analyses at the zebrafish phox2b locus suggests that a significant fraction of regulatory elements may fall below commonly applied metrics of conservation. We propose to explore these observations in vivo at the human PHOX2B locus, and also evaluate the potential evidence for genome-wide applicability of these observations through a novel analysis of extant data. Results Transposon-based transgenic analysis utilizing a tiling path proximal to human PHOX2B in zebrafish recapitulates the observations at the zebrafish phox2b locus of both conserved and non-conserved regulatory elements. Analysis of human sequences conserved with previously identified zebrafish phox2b regulatory elements demonstrates that the orthologous sequences exhibit overlapping regulatory control. Additionally, analysis of non-conserved sequences scattered over 135 kb 5' to PHOX2B, provides evidence of non-conserved regulatory elements positively biased with close proximity to the gene. Furthermore, we provide a novel analysis of data from the ENCODE project, finding a non-uniform distribution of regulatory elements consistent with our in vivo observations at PHOX2B. These observations remain largely unchanged when one accounts for the sequence repeat content of the assayed intervals, when the intervals are sub-classified by biological role (developmental versus non-developmental, or by gene density (gene desert versus non-gene desert. Conclusion While regulatory elements frequently display evidence of evolutionary conservation, a fraction appears to be undetected by current metrics of conservation. In vivo observations at the PHOX2B locus, supported by our analyses of in

  5. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  6. Simple mathematical models of gene regulatory dynamics

    CERN Document Server

    Mackey, Michael C; Tyran-Kamińska, Marta; Zeron, Eduardo S

    2016-01-01

    This is a short and self-contained introduction to the field of mathematical modeling of gene-networks in bacteria. As an entry point to the field, we focus on the analysis of simple gene-network dynamics. The notes commence with an introduction to the deterministic modeling of gene-networks, with extensive reference to applicable results coming from dynamical systems theory. The second part of the notes treats extensively several approaches to the study of gene-network dynamics in the presence of noise—either arising from low numbers of molecules involved, or due to noise external to the regulatory process. The third and final part of the notes gives a detailed treatment of three well studied and concrete examples of gene-network dynamics by considering the lactose operon, the tryptophan operon, and the lysis-lysogeny switch. The notes contain an index for easy location of particular topics as well as an extensive bibliography of the current literature. The target audience of these notes are mainly graduat...

  7. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  8. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  9. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  10. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  11. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  12. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  13. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  14. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  15. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  16. Generic Properties of Random Gene Regulatory Networks.

    Science.gov (United States)

    Li, Zhiyuan; Bianco, Simone; Zhang, Zhaoyang; Tang, Chao

    2013-12-01

    Modeling gene regulatory networks (GRNs) is an important topic in systems biology. Although there has been much work focusing on various specific systems, the generic behavior of GRNs with continuous variables is still elusive. In particular, it is not clear typically how attractors partition among the three types of orbits: steady state, periodic and chaotic, and how the dynamical properties change with network's topological characteristics. In this work, we first investigated these questions in random GRNs with different network sizes, connectivity, fraction of inhibitory links and transcription regulation rules. Then we searched for the core motifs that govern the dynamic behavior of large GRNs. We show that the stability of a random GRN is typically governed by a few embedding motifs of small sizes, and therefore can in general be understood in the context of these short motifs. Our results provide insights for the study and design of genetic networks.

  17. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  18. A Regulatory Network Analysis of Orphan Genes in Arabidopsis Thaliana

    Science.gov (United States)

    Singh, Pramesh; Chen, Tianlong; Arendsee, Zebulun; Wurtele, Eve S.; Bassler, Kevin E.

    Orphan genes, which are genes unique to each particular species, have recently drawn significant attention for their potential usefulness for organismal robustness. Their origin and regulatory interaction patterns remain largely undiscovered. Recently, methods that use the context likelihood of relatedness to infer a network followed by modularity maximizing community detection algorithms on the inferred network to find the functional structure of regulatory networks were shown to be effective. We apply improved versions of these methods to gene expression data from Arabidopsis thaliana, identify groups (clusters) of interacting genes with related patterns of expression and analyze the structure within those groups. Focusing on clusters that contain orphan genes, we compare the identified clusters to gene ontology (GO) terms, regulons, and pathway designations and analyze their hierarchical structure. We predict new regulatory interactions and unravel the structure of the regulatory interaction patterns of orphan genes. Work supported by the NSF through Grants DMR-1507371 and IOS-1546858.

  19. Dose response relationship in anti-stress gene regulatory networks.

    Science.gov (United States)

    Zhang, Qiang; Andersen, Melvin E

    2007-03-02

    To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products) in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear) depends on changes in the specific values of local response coefficients (gains) distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear, and depending on

  20. Dose response relationship in anti-stress gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    2007-03-01

    Full Text Available To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear depends on changes in the specific values of local response coefficients (gains distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear

  1. Predictive minimum description length principle approach to inferring gene regulatory networks.

    Science.gov (United States)

    Chaitankar, Vijender; Zhang, Chaoyang; Ghosh, Preetam; Gong, Ping; Perkins, Edward J; Deng, Youping

    2011-01-01

    Reverse engineering of gene regulatory networks using information theory models has received much attention due to its simplicity, low computational cost, and capability of inferring large networks. One of the major problems with information theory models is to determine the threshold that defines the regulatory relationships between genes. The minimum description length (MDL) principle has been implemented to overcome this problem. The description length of the MDL principle is the sum of model length and data encoding length. A user-specified fine tuning parameter is used as control mechanism between model and data encoding, but it is difficult to find the optimal parameter. In this work, we propose a new inference algorithm that incorporates mutual information (MI), conditional mutual information (CMI), and predictive minimum description length (PMDL) principle to infer gene regulatory networks from DNA microarray data. In this algorithm, the information theoretic quantities MI and CMI determine the regulatory relationships between genes and the PMDL principle method attempts to determine the best MI threshold without the need of a user-specified fine tuning parameter. The performance of the proposed algorithm is evaluated using both synthetic time series data sets and a biological time series data set (Saccharomyces cerevisiae). The results show that the proposed algorithm produced fewer false edges and significantly improved the precision when compared to existing MDL algorithm.

  2. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  3. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  4. Transcription factor trapping by RNA in gene regulatory elements.

    Science.gov (United States)

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  5. Evolving chromosomes and gene regulatory networks

    Indian Academy of Sciences (India)

    Aswin

    Genes under H NS control can be. (a) regulated by H NS. (b) regulated by H NS and StpA. Because backup by StpA is partial. Page 19. Gene expression level. H NS regulated xenogenes. Other genes. Page 20 ... recollect: H&NS silences highl transcribable genes. Gene expression level unilateral. Other genes epistatic ...

  6. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  7. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  8. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  9. A flood-based information flow analysis and network minimization method for gene regulatory networks.

    Science.gov (United States)

    Pavlogiannis, Andreas; Mozhayskiy, Vadim; Tagkopoulos, Ilias

    2013-04-24

    Biological networks tend to have high interconnectivity, complex topologies and multiple types of interactions. This renders difficult the identification of sub-networks that are involved in condition- specific responses. In addition, we generally lack scalable methods that can reveal the information flow in gene regulatory and biochemical pathways. Doing so will help us to identify key participants and paths under specific environmental and cellular context. This paper introduces the theory of network flooding, which aims to address the problem of network minimization and regulatory information flow in gene regulatory networks. Given a regulatory biological network, a set of source (input) nodes and optionally a set of sink (output) nodes, our task is to find (a) the minimal sub-network that encodes the regulatory program involving all input and output nodes and (b) the information flow from the source to the sink nodes of the network. Here, we describe a novel, scalable, network traversal algorithm and we assess its potential to achieve significant network size reduction in both synthetic and E. coli networks. Scalability and sensitivity analysis show that the proposed method scales well with the size of the network, and is robust to noise and missing data. The method of network flooding proves to be a useful, practical approach towards information flow analysis in gene regulatory networks. Further extension of the proposed theory has the potential to lead in a unifying framework for the simultaneous network minimization and information flow analysis across various "omics" levels.

  10. Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

    Science.gov (United States)

    Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

    2016-11-15

    Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

  11. Global Regulatory Differences for Gene- and Cell-Based Therapies

    DEFF Research Database (Denmark)

    Coppens, Delphi G M; De Bruin, Marie L; Leufkens, Hubert G M

    2017-01-01

    Gene- and cell-based therapies (GCTs) offer potential new treatment options for unmet medical needs. However, the use of conventional regulatory requirements for medicinal products to approve GCTs may impede patient access and therapeutic innovation. Furthermore, requirements differ between...... jurisdictions, complicating the global regulatory landscape. We provide a comparative overview of regulatory requirements for GCT approval in five jurisdictions and hypothesize on the consequences of the observed global differences on patient access and therapeutic innovation....

  12. An algebra-based method for inferring gene regulatory networks.

    Science.gov (United States)

    Vera-Licona, Paola; Jarrah, Abdul; Garcia-Puente, Luis David; McGee, John; Laubenbacher, Reinhard

    2014-03-26

    The inference of gene regulatory networks (GRNs) from experimental observations is at the heart of systems biology. This includes the inference of both the network topology and its dynamics. While there are many algorithms available to infer the network topology from experimental data, less emphasis has been placed on methods that infer network dynamics. Furthermore, since the network inference problem is typically underdetermined, it is essential to have the option of incorporating into the inference process, prior knowledge about the network, along with an effective description of the search space of dynamic models. Finally, it is also important to have an understanding of how a given inference method is affected by experimental and other noise in the data used. This paper contains a novel inference algorithm using the algebraic framework of Boolean polynomial dynamical systems (BPDS), meeting all these requirements. The algorithm takes as input time series data, including those from network perturbations, such as knock-out mutant strains and RNAi experiments. It allows for the incorporation of prior biological knowledge while being robust to significant levels of noise in the data used for inference. It uses an evolutionary algorithm for local optimization with an encoding of the mathematical models as BPDS. The BPDS framework allows an effective representation of the search space for algebraic dynamic models that improves computational performance. The algorithm is validated with both simulated and experimental microarray expression profile data. Robustness to noise is tested using a published mathematical model of the segment polarity gene network in Drosophila melanogaster. Benchmarking of the algorithm is done by comparison with a spectrum of state-of-the-art network inference methods on data from the synthetic IRMA network to demonstrate that our method has good precision and recall for the network reconstruction task, while also predicting several of the

  13. Robustness and accuracy in sea urchin developmental gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Smadar eBen-Tabou De-Leon

    2016-02-01

    Full Text Available Developmental gene regulatory networks robustly control the timely activation of regulatory and differentiation genes. The structure of these networks underlies their capacity to buffer intrinsic and extrinsic noise and maintain embryonic morphology. Here I illustrate how the use of specific architectures by the sea urchin developmental regulatory networks enables the robust control of cell fate decisions. The Wnt-βcatenin signaling pathway patterns the primary embryonic axis while the BMP signaling pathway patterns the secondary embryonic axis in the sea urchin embryo and across bilateria. Interestingly, in the sea urchin in both cases, the signaling pathway that defines the axis controls directly the expression of a set of downstream regulatory genes. I propose that this direct activation of a set of regulatory genes enables a uniform regulatory response and a clear cut cell fate decision in the endoderm and in the dorsal ectoderm. The specification of the mesodermal pigment cell lineage is activated by Delta signaling that initiates a triple positive feedback loop that locks down the pigment specification state. I propose that the use of compound positive feedback circuitry provides the endodermal cells enough time to turn off mesodermal genes and ensures correct mesoderm vs. endoderm fate decision. Thus, I argue that understanding the control properties of repeatedly used regulatory architectures illuminates their role in embryogenesis and provides possible explanations to their resistance to evolutionary change.

  14. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  15. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    International Nuclear Information System (INIS)

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

    1987-01-01

    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  16. Prioritization of gene regulatory interactions from large-scale modules in yeast

    Directory of Open Access Journals (Sweden)

    Bringas Ricardo

    2008-01-01

    Full Text Available Abstract Background The identification of groups of co-regulated genes and their transcription factors, called transcriptional modules, has been a focus of many studies about biological systems. While methods have been developed to derive numerous modules from genome-wide data, individual links between regulatory proteins and target genes still need experimental verification. In this work, we aim to prioritize regulator-target links within transcriptional modules based on three types of large-scale data sources. Results Starting with putative transcriptional modules from ChIP-chip data, we first derive modules in which target genes show both expression and function coherence. The most reliable regulatory links between transcription factors and target genes are established by identifying intersection of target genes in coherent modules for each enriched functional category. Using a combination of genome-wide yeast data in normal growth conditions and two different reference datasets, we show that our method predicts regulatory interactions with significantly higher predictive power than ChIP-chip binding data alone. A comparison with results from other studies highlights that our approach provides a reliable and complementary set of regulatory interactions. Based on our results, we can also identify functionally interacting target genes, for instance, a group of co-regulated proteins related to cell wall synthesis. Furthermore, we report novel conserved binding sites of a glycoprotein-encoding gene, CIS3, regulated by Swi6-Swi4 and Ndd1-Fkh2-Mcm1 complexes. Conclusion We provide a simple method to prioritize individual TF-gene interactions from large-scale transcriptional modules. In comparison with other published works, we predict a complementary set of regulatory interactions which yields a similar or higher prediction accuracy at the expense of sensitivity. Therefore, our method can serve as an alternative approach to prioritization for

  17. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  18. Interactive visualization of gene regulatory networks with associated gene expression time series data

    NARCIS (Netherlands)

    Westenberg, M.A.; Hijum, van S.A.F.T.; Lulko, A.T.; Kuipers, O.P.; Roerdink, J.B.T.M.; Linsen, L.; Hagen, H.; Hamann, B.

    2008-01-01

    We present GENeVis, an application to visualize gene expression time series data in a gene regulatory network context. This is a network of regulator proteins that regulate the expression of their respective target genes. The networks are represented as graphs, in which the nodes represent genes,

  19. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  20. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Semi-supervised prediction of gene regulatory networks using ...

    Indian Academy of Sciences (India)

    2015-09-28

    Sep 28, 2015 ... Use of computational methods to predict gene regulatory networks (GRNs) from gene expression data is a challenging ... two types of methods differ primarily based on whether ..... negligible, allowing us to draw the qualitative conclusions .... research will be conducted to develop additional biologically.

  2. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  3. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  4. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  5. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  6. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  7. Learning gene regulatory networks from only positive and unlabeled data

    Directory of Open Access Journals (Sweden)

    Elkan Charles

    2010-05-01

    Full Text Available Abstract Background Recently, supervised learning methods have been exploited to reconstruct gene regulatory networks from gene expression data. The reconstruction of a network is modeled as a binary classification problem for each pair of genes. A statistical classifier is trained to recognize the relationships between the activation profiles of gene pairs. This approach has been proven to outperform previous unsupervised methods. However, the supervised approach raises open questions. In particular, although known regulatory connections can safely be assumed to be positive training examples, obtaining negative examples is not straightforward, because definite knowledge is typically not available that a given pair of genes do not interact. Results A recent advance in research on data mining is a method capable of learning a classifier from only positive and unlabeled examples, that does not need labeled negative examples. Applied to the reconstruction of gene regulatory networks, we show that this method significantly outperforms the current state of the art of machine learning methods. We assess the new method using both simulated and experimental data, and obtain major performance improvement. Conclusions Compared to unsupervised methods for gene network inference, supervised methods are potentially more accurate, but for training they need a complete set of known regulatory connections. A supervised method that can be trained using only positive and unlabeled data, as presented in this paper, is especially beneficial for the task of inferring gene regulatory networks, because only an incomplete set of known regulatory connections is available in public databases such as RegulonDB, TRRD, KEGG, Transfac, and IPA.

  8. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    Energy Technology Data Exchange (ETDEWEB)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  9. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  10. Prediction of regulatory gene pairs using dynamic time warping and gene ontology.

    Science.gov (United States)

    Yang, Andy C; Hsu, Hui-Huang; Lu, Ming-Da; Tseng, Vincent S; Shih, Timothy K

    2014-01-01

    Selecting informative genes is the most important task for data analysis on microarray gene expression data. In this work, we aim at identifying regulatory gene pairs from microarray gene expression data. However, microarray data often contain multiple missing expression values. Missing value imputation is thus needed before further processing for regulatory gene pairs becomes possible. We develop a novel approach to first impute missing values in microarray time series data by combining k-Nearest Neighbour (KNN), Dynamic Time Warping (DTW) and Gene Ontology (GO). After missing values are imputed, we then perform gene regulation prediction based on our proposed DTW-GO distance measurement of gene pairs. Experimental results show that our approach is more accurate when compared with existing missing value imputation methods on real microarray data sets. Furthermore, our approach can also discover more regulatory gene pairs that are known in the literature than other methods.

  11. Sequence-based model of gap gene regulatory network.

    Science.gov (United States)

    Kozlov, Konstantin; Gursky, Vitaly; Kulakovskiy, Ivan; Samsonova, Maria

    2014-01-01

    The detailed analysis of transcriptional regulation is crucially important for understanding biological processes. The gap gene network in Drosophila attracts large interest among researches studying mechanisms of transcriptional regulation. It implements the most upstream regulatory layer of the segmentation gene network. The knowledge of molecular mechanisms involved in gap gene regulation is far less complete than that of genetics of the system. Mathematical modeling goes beyond insights gained by genetics and molecular approaches. It allows us to reconstruct wild-type gene expression patterns in silico, infer underlying regulatory mechanism and prove its sufficiency. We developed a new model that provides a dynamical description of gap gene regulatory systems, using detailed DNA-based information, as well as spatial transcription factor concentration data at varying time points. We showed that this model correctly reproduces gap gene expression patterns in wild type embryos and is able to predict gap expression patterns in Kr mutants and four reporter constructs. We used four-fold cross validation test and fitting to random dataset to validate the model and proof its sufficiency in data description. The identifiability analysis showed that most model parameters are well identifiable. We reconstructed the gap gene network topology and studied the impact of individual transcription factor binding sites on the model output. We measured this impact by calculating the site regulatory weight as a normalized difference between the residual sum of squares error for the set of all annotated sites and for the set with the site of interest excluded. The reconstructed topology of the gap gene network is in agreement with previous modeling results and data from literature. We showed that 1) the regulatory weights of transcription factor binding sites show very weak correlation with their PWM score; 2) sites with low regulatory weight are important for the model output; 3

  12. Gene regulatory mechanisms in infected fish

    DEFF Research Database (Denmark)

    Schyth, Brian Dall; Hajiabadi, Seyed Amir Hossein Jalali; Kristensen, Lasse Bøgelund Juel

    2011-01-01

    molecules produced by the eukaryotic cell is used to program the RNA Induced Silencing Complex (RISC) for cleavage of specific mRNA transcripts and/or translational repression in the cytoplasm or even chromatin methylation in the nucleus. All processes leading to silencing of the target gene. MicroRNAs (or...... differentiation. Thus the expression of these miRNAs might be steered by different mechanisms in different cell types and have different roles in terms of the genes they target in different cell types. Thus gene regulation and function is better looked upon as a web of interactions. Data from zebrafish studies...

  13. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  14. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  15. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

    Directory of Open Access Journals (Sweden)

    Ricardo Harakava

    2005-01-01

    Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

  16. Gene regulatory networks elucidating huanglongbing disease mechanisms.

    Directory of Open Access Journals (Sweden)

    Federico Martinelli

    Full Text Available Next-generation sequencing was exploited to gain deeper insight into the response to infection by Candidatus liberibacter asiaticus (CaLas, especially the immune disregulation and metabolic dysfunction caused by source-sink disruption. Previous fruit transcriptome data were compared with additional RNA-Seq data in three tissues: immature fruit, and young and mature leaves. Four categories of orchard trees were studied: symptomatic, asymptomatic, apparently healthy, and healthy. Principal component analysis found distinct expression patterns between immature and mature fruits and leaf samples for all four categories of trees. A predicted protein - protein interaction network identified HLB-regulated genes for sugar transporters playing key roles in the overall plant responses. Gene set and pathway enrichment analyses highlight the role of sucrose and starch metabolism in disease symptom development in all tissues. HLB-regulated genes (glucose-phosphate-transporter, invertase, starch-related genes would likely determine the source-sink relationship disruption. In infected leaves, transcriptomic changes were observed for light reactions genes (downregulation, sucrose metabolism (upregulation, and starch biosynthesis (upregulation. In parallel, symptomatic fruits over-expressed genes involved in photosynthesis, sucrose and raffinose metabolism, and downregulated starch biosynthesis. We visualized gene networks between tissues inducing a source-sink shift. CaLas alters the hormone crosstalk, resulting in weak and ineffective tissue-specific plant immune responses necessary for bacterial clearance. Accordingly, expression of WRKYs (including WRKY70 was higher in fruits than in leaves. Systemic acquired responses were inadequately activated in young leaves, generally considered the sites where most new infections occur.

  17. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  18. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous ... mechanisms is that a gene must be inducible in response to an external threat, to ..... of CPs known in plants. The others are legumain (C13), calcium-dependent.

  19. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  20. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  1. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  2. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  3. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  4. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  5. Conserved-peptide upstream open reading frames (CPuORFs are associated with regulatory genes in angiosperms

    Directory of Open Access Journals (Sweden)

    Richard A Jorgensen

    2012-08-01

    Full Text Available Upstream open reading frames (uORFs are common in eukaryotic transcripts, but those that encode conserved peptides (CPuORFs occur in less than 1% of transcripts. The peptides encoded by three plant CPuORF families are known to control translation of the downstream ORF in response to a small signal molecule (sucrose, polyamines and phosphocholine. In flowering plants, transcription factors are statistically over-represented among genes that possess CPuORFs, and in general it appeared that many CPuORF genes also had other regulatory functions, though the significance of this suggestion was uncertain (Hayden and Jorgensen, 2007. Five years later the literature provides much more information on the functions of many CPuORF genes. Here we reassess the functions of 27 known CPuORF gene families and find that 22 of these families play a variety of different regulatory roles, from transcriptional control to protein turnover, and from small signal molecules to signal transduction kinases. Clearly then, there is indeed a strong association of CPuORFs with regulatory genes. In addition, 16 of these families play key roles in a variety of different biological processes. Most strikingly, the core sucrose response network includes three different CPuORFs, creating the potential for sophisticated balancing of the network in response to three different molecular inputs. We propose that the function of most CPuORFs is to modulate translation of a downstream major ORF (mORF in response to a signal molecule recognized by the conserved peptide and that because the mORFs of CPuORF genes generally encode regulatory proteins, many of them centrally important in the biology of plants, CPuORFs play key roles in balancing such regulatory networks.

  6. Efficient Reverse-Engineering of a Developmental Gene Regulatory Network

    Science.gov (United States)

    Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes

    2012-01-01

    Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to

  7. A gene regulatory network armature for T-lymphocyte specification

    Energy Technology Data Exchange (ETDEWEB)

    Fung, Elizabeth-sharon [Los Alamos National Laboratory

    2008-01-01

    Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through which T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.

  8. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  9. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  10. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  11. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    such as BRCA1 (a product of a breast cancer-associated gene) and Cb1 ... research has indicated that ubiquitination mediated by the ... environment and is unique to China. Since it is ..... benefit the normal biological function of the plant. We.

  12. SELANSI: a toolbox for simulation of stochastic gene regulatory networks.

    Science.gov (United States)

    Pájaro, Manuel; Otero-Muras, Irene; Vázquez, Carlos; Alonso, Antonio A

    2018-03-01

    Gene regulation is inherently stochastic. In many applications concerning Systems and Synthetic Biology such as the reverse engineering and the de novo design of genetic circuits, stochastic effects (yet potentially crucial) are often neglected due to the high computational cost of stochastic simulations. With advances in these fields there is an increasing need of tools providing accurate approximations of the stochastic dynamics of gene regulatory networks (GRNs) with reduced computational effort. This work presents SELANSI (SEmi-LAgrangian SImulation of GRNs), a software toolbox for the simulation of stochastic multidimensional gene regulatory networks. SELANSI exploits intrinsic structural properties of gene regulatory networks to accurately approximate the corresponding Chemical Master Equation with a partial integral differential equation that is solved by a semi-lagrangian method with high efficiency. Networks under consideration might involve multiple genes with self and cross regulations, in which genes can be regulated by different transcription factors. Moreover, the validity of the method is not restricted to a particular type of kinetics. The tool offers total flexibility regarding network topology, kinetics and parameterization, as well as simulation options. SELANSI runs under the MATLAB environment, and is available under GPLv3 license at https://sites.google.com/view/selansi. antonio@iim.csic.es. © The Author(s) 2017. Published by Oxford University Press.

  13. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  14. Interrogating the topological robustness of gene regulatory circuits by randomization.

    Directory of Open Access Journals (Sweden)

    Bin Huang

    2017-03-01

    Full Text Available One of the most important roles of cells is performing their cellular tasks properly for survival. Cells usually achieve robust functionality, for example, cell-fate decision-making and signal transduction, through multiple layers of regulation involving many genes. Despite the combinatorial complexity of gene regulation, its quantitative behavior has been typically studied on the basis of experimentally verified core gene regulatory circuitry, composed of a small set of important elements. It is still unclear how such a core circuit operates in the presence of many other regulatory molecules and in a crowded and noisy cellular environment. Here we report a new computational method, named random circuit perturbation (RACIPE, for interrogating the robust dynamical behavior of a gene regulatory circuit even without accurate measurements of circuit kinetic parameters. RACIPE generates an ensemble of random kinetic models corresponding to a fixed circuit topology, and utilizes statistical tools to identify generic properties of the circuit. By applying RACIPE to simple toggle-switch-like motifs, we observed that the stable states of all models converge to experimentally observed gene state clusters even when the parameters are strongly perturbed. RACIPE was further applied to a proposed 22-gene network of the Epithelial-to-Mesenchymal Transition (EMT, from which we identified four experimentally observed gene states, including the states that are associated with two different types of hybrid Epithelial/Mesenchymal phenotypes. Our results suggest that dynamics of a gene circuit is mainly determined by its topology, not by detailed circuit parameters. Our work provides a theoretical foundation for circuit-based systems biology modeling. We anticipate RACIPE to be a powerful tool to predict and decode circuit design principles in an unbiased manner, and to quantitatively evaluate the robustness and heterogeneity of gene expression.

  15. Heart morphogenesis gene regulatory networks revealed by temporal expression analysis.

    Science.gov (United States)

    Hill, Jonathon T; Demarest, Bradley; Gorsi, Bushra; Smith, Megan; Yost, H Joseph

    2017-10-01

    During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks (GRNs) driving this phase of heart development, during which many congenital heart disease malformations likely arise, we conducted an RNA-seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern, identified transcription factor binding motifs enriched in each cluster, and generated a model GRN for the major gene batteries in heart morphogenesis. This approach predicted hundreds of regulatory interactions and found batteries enriched in specific cell and tissue types, indicating that the approach can be used to narrow the search for novel genetic markers and regulatory interactions. Subsequent analyses confirmed the GRN using two mutants, Tbx5 and nkx2-5 , and identified sets of duplicated zebrafish genes that do not show temporal subfunctionalization. This dataset provides an essential resource for future studies on the genetic/epigenetic pathways implicated in congenital heart defects and the mechanisms of cardiac transcriptional regulation. © 2017. Published by The Company of Biologists Ltd.

  16. Smoking, genes encoding dopamine pathway and risk for Parkinson's disease.

    Science.gov (United States)

    Gu, Zhuqin; Feng, Xiuli; Dong, Xiumin; Chan, Piu

    2010-09-20

    Smoking has been reported to be inversely associated with Parkinson's disease (PD) in many studies, but a recent study in China found that smoking increased the risk of PD. Variants in genes associated with dopamine metabolism found to increase the risk for PD have also been associated with smoking behavior. To investigate the association between smoking and PD in a Chinese population and determine whether the genetic variants of genes involved in dopamine metabolism influence the relationship between smoking and risk for PD. Chinese PD patients were recruited from Xuanwu Hospital. Controls were sampled from community. Detailed information on life-long smoking behavior was collected by face-to-face interview. Genotypes were determined for SLC6A3 VNTR, COMT Val108/158Met and MAO-B intron13 A/G polymorphisms by PCR-RFLP, DHPLC and sequencing. Chi-square and logistic regression model were used in the analysis. 176 PD cases and 354 controls were enrolled in this study. 23.9% cases are smokers, compared to 48.0% in controls. Ever smoking is inversely associated with PD (odds ratio=0.14, 95% CI 0.08-0.26, adjusted for age and gender). None of the above-mentioned genetic polymorphisms was associated with PD risk or smoking. When each variant was included in the logistic regression model, the inverse association between smoking and PD remained the same, and the interactions between smoking and variants were not significant in the model. Our data support a reduction of PD risk associated with smoking in a Chinese population. These variants of genes associated with DA uptake and metabolism do not affect the inverse association between smoking and PD. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  17. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  18. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Science.gov (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  19. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  20. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  1. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  2. Portrait of Candida Species Biofilm Regulatory Network Genes.

    Science.gov (United States)

    Araújo, Daniela; Henriques, Mariana; Silva, Sónia

    2017-01-01

    Most cases of candidiasis have been attributed to Candida albicans, but Candida glabrata, Candida parapsilosis and Candida tropicalis, designated as non-C. albicans Candida (NCAC), have been identified as frequent human pathogens. Moreover, Candida biofilms are an escalating clinical problem associated with significant rates of mortality. Biofilms have distinct developmental phases, including adhesion/colonisation, maturation and dispersal, controlled by complex regulatory networks. This review discusses recent advances regarding Candida species biofilm regulatory network genes, which are key components for candidiasis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  4. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  5. Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

    Science.gov (United States)

    Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

    1999-04-16

    A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

  6. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  7. Modeling stochasticity and robustness in gene regulatory networks.

    Science.gov (United States)

    Garg, Abhishek; Mohanram, Kartik; Di Cara, Alessandro; De Micheli, Giovanni; Xenarios, Ioannis

    2009-06-15

    Understanding gene regulation in biological processes and modeling the robustness of underlying regulatory networks is an important problem that is currently being addressed by computational systems biologists. Lately, there has been a renewed interest in Boolean modeling techniques for gene regulatory networks (GRNs). However, due to their deterministic nature, it is often difficult to identify whether these modeling approaches are robust to the addition of stochastic noise that is widespread in gene regulatory processes. Stochasticity in Boolean models of GRNs has been addressed relatively sparingly in the past, mainly by flipping the expression of genes between different expression levels with a predefined probability. This stochasticity in nodes (SIN) model leads to over representation of noise in GRNs and hence non-correspondence with biological observations. In this article, we introduce the stochasticity in functions (SIF) model for simulating stochasticity in Boolean models of GRNs. By providing biological motivation behind the use of the SIF model and applying it to the T-helper and T-cell activation networks, we show that the SIF model provides more biologically robust results than the existing SIN model of stochasticity in GRNs. Algorithms are made available under our Boolean modeling toolbox, GenYsis. The software binaries can be downloaded from http://si2.epfl.ch/ approximately garg/genysis.html.

  8. Global transcriptional regulatory network for Escherichia coli robustly connects gene expression to transcription factor activities

    Science.gov (United States)

    Fang, Xin; Sastry, Anand; Mih, Nathan; Kim, Donghyuk; Tan, Justin; Lloyd, Colton J.; Gao, Ye; Yang, Laurence; Palsson, Bernhard O.

    2017-01-01

    Transcriptional regulatory networks (TRNs) have been studied intensely for >25 y. Yet, even for the Escherichia coli TRN—probably the best characterized TRN—several questions remain. Here, we address three questions: (i) How complete is our knowledge of the E. coli TRN; (ii) how well can we predict gene expression using this TRN; and (iii) how robust is our understanding of the TRN? First, we reconstructed a high-confidence TRN (hiTRN) consisting of 147 transcription factors (TFs) regulating 1,538 transcription units (TUs) encoding 1,764 genes. The 3,797 high-confidence regulatory interactions were collected from published, validated chromatin immunoprecipitation (ChIP) data and RegulonDB. For 21 different TF knockouts, up to 63% of the differentially expressed genes in the hiTRN were traced to the knocked-out TF through regulatory cascades. Second, we trained supervised machine learning algorithms to predict the expression of 1,364 TUs given TF activities using 441 samples. The algorithms accurately predicted condition-specific expression for 86% (1,174 of 1,364) of the TUs, while 193 TUs (14%) were predicted better than random TRNs. Third, we identified 10 regulatory modules whose definitions were robust against changes to the TRN or expression compendium. Using surrogate variable analysis, we also identified three unmodeled factors that systematically influenced gene expression. Our computational workflow comprehensively characterizes the predictive capabilities and systems-level functions of an organism’s TRN from disparate data types. PMID:28874552

  9. Genetics and Molecular Biology of Epstein-Barr Virus-Encoded BART MicroRNA: A Paradigm for Viral Modulation of Host Immune Response Genes and Genome Stability

    Directory of Open Access Journals (Sweden)

    David H. Dreyfus

    2017-01-01

    Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.

  10. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  11. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  12. Synchronous versus asynchronous modeling of gene regulatory networks.

    Science.gov (United States)

    Garg, Abhishek; Di Cara, Alessandro; Xenarios, Ioannis; Mendoza, Luis; De Micheli, Giovanni

    2008-09-01

    In silico modeling of gene regulatory networks has gained some momentum recently due to increased interest in analyzing the dynamics of biological systems. This has been further facilitated by the increasing availability of experimental data on gene-gene, protein-protein and gene-protein interactions. The two dynamical properties that are often experimentally testable are perturbations and stable steady states. Although a lot of work has been done on the identification of steady states, not much work has been reported on in silico modeling of cellular differentiation processes. In this manuscript, we provide algorithms based on reduced ordered binary decision diagrams (ROBDDs) for Boolean modeling of gene regulatory networks. Algorithms for synchronous and asynchronous transition models have been proposed and their corresponding computational properties have been analyzed. These algorithms allow users to compute cyclic attractors of large networks that are currently not feasible using existing software. Hereby we provide a framework to analyze the effect of multiple gene perturbation protocols, and their effect on cell differentiation processes. These algorithms were validated on the T-helper model showing the correct steady state identification and Th1-Th2 cellular differentiation process. The software binaries for Windows and Linux platforms can be downloaded from http://si2.epfl.ch/~garg/genysis.html.

  13. Singular Perturbation Analysis and Gene Regulatory Networks with Delay

    Science.gov (United States)

    Shlykova, Irina; Ponosov, Arcady

    2009-09-01

    There are different ways of how to model gene regulatory networks. Differential equations allow for a detailed description of the network's dynamics and provide an explicit model of the gene concentration changes over time. Production and relative degradation rate functions used in such models depend on the vector of steeply sloped threshold functions which characterize the activity of genes. The most popular example of the threshold functions comes from the Boolean network approach, where the threshold functions are given by step functions. The system of differential equations becomes then piecewise linear. The dynamics of this system can be described very easily between the thresholds, but not in the switching domains. For instance this approach fails to analyze stationary points of the system and to define continuous solutions in the switching domains. These problems were studied in [2], [3], but the proposed model did not take into account a time delay in cellular systems. However, analysis of real gene expression data shows a considerable number of time-delayed interactions suggesting that time delay is essential in gene regulation. Therefore, delays may have a great effect on the dynamics of the system presenting one of the critical factors that should be considered in reconstruction of gene regulatory networks. The goal of this work is to apply the singular perturbation analysis to certain systems with delay and to obtain an analog of Tikhonov's theorem, which provides sufficient conditions for constracting the limit system in the delay case.

  14. Small RNA-Controlled Gene Regulatory Networks in Pseudomonas putida

    DEFF Research Database (Denmark)

    Bojanovic, Klara

    evolved numerous mechanisms to controlgene expression in response to specific environmental signals. In addition to two-component systems, small regulatory RNAs (sRNAs) have emerged as major regulators of gene expression. The majority of sRNAs bind to mRNA and regulate their expression. They often have...... multiple targets and are incorporated into large regulatory networks and the RNA chaper one Hfq in many cases facilitates interactions between sRNAs and their targets. Some sRNAs also act by binding to protein targets and sequestering their function. In this PhD thesis we investigated the transcriptional....... Detailed insights into the mechanisms through which P. putida responds to different stress conditions and increased understanding of bacterial adaptation in natural and industrial settings were gained. Additionally, we identified genome-wide transcription start sites, andmany regulatory RNA elements...

  15. Regulatory domain or CpG site variation in SLC12A5, encoding the chloride transporter KCC2, in human autism and schizophrenia

    Directory of Open Access Journals (Sweden)

    Nancy D Merner

    2015-10-01

    Full Text Available Many encoded gene products responsible for neurodevelopmental disorders (NDs like autism spectrum disorders (ASD, schizophrenia (SCZ, intellectual disability (ID, and idiopathic generalized epilepsy (IGE converge on networks controlling synaptic function. An increase in KCC2 (SLC12A5 Cl- transporter activity drives the developmental GABA excitatory-inhibitory sequence, but the role of KCC2 in human NDs is essentially unknown. Here, we report two rare, non-synonymous (NS, functionally-impairing variants in the KCC2 C-terminal regulatory domain (CTRD in human ASD (R952H and R1049C and SCZ (R952H previously linked with IGE and familial febrile seizures, and another novel NS KCC2 variant in ASD (R1048W with highly-predicted pathogenicity. Exome data from 2517 simplex families in the ASD Simon Simplex Collection revealed significantly more KCC2 CTRD variants in ASD cases than controls, and interestingly, these were more often synonymous and predicted to disrupt or introduce a CpG site. Furthermore, full gene analysis showed ASD cases are more likely to contain rare KCC2 variants affecting CpG sites than controls. These data suggest genetically-encoded dysregulation of KCC2-dependent GABA signaling may contribute to multiple human NDs.

  16. COMK ENCODES THE COMPETENCE TRANSCRIPTION FACTOR, THE KEY REGULATORY PROTEIN FOR COMPETENCE DEVELOPMENT IN BACILLUS-SUBTILIS

    NARCIS (Netherlands)

    VANSINDEREN, D; LUTTINGER, A; KONG, LY; DUBNAU, D; VENEMA, G; HAMOEN, L

    comK is a positive autoregulatory gene occupying a central position in the com petence-signal-transduction network. All regulatory routes identified in this network converge at the level of comK expression. The ComK protein is required for the transcriptional induction of comK and the late

  17. Comparative structural and functional analysis of genes encoding pectin methylesterases in Phytophthora spp.

    Science.gov (United States)

    Mingora, Christina; Ewer, Jason; Ospina-Giraldo, Manuel

    2014-03-15

    We have scanned the Phytophthora infestans, P. ramorum, and P. sojae genomes for the presence of putative pectin methylesterase genes and conducted a sequence analysis of all gene models found. We also searched for potential regulatory motifs in the promoter region of the proposed P. infestans models, and investigated the gene expression levels throughout the course of P. infestans infection on potato plants, using in planta and detached leaf assays. We found that genes located on contiguous chromosomal regions contain similar motifs in the promoter region, indicating the possibility of a shared regulatory mechanism. Results of our investigations also suggest that, during the pathogenicity process, the expression levels of some of the analyzed genes vary considerably when compared to basal expression observed in in vitro cultures of non-sporulating mycelium. These results were observed both in planta and in detached leaf assays. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

    Science.gov (United States)

    Hempel, Niels; Görisch, Helmut; Mern, Demissew S

    2013-09-01

    Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

  19. Establishing neural crest identity: a gene regulatory recipe

    Science.gov (United States)

    Simões-Costa, Marcos; Bronner, Marianne E.

    2015-01-01

    The neural crest is a stem/progenitor cell population that contributes to a wide variety of derivatives, including sensory and autonomic ganglia, cartilage and bone of the face and pigment cells of the skin. Unique to vertebrate embryos, it has served as an excellent model system for the study of cell behavior and identity owing to its multipotency, motility and ability to form a broad array of cell types. Neural crest development is thought to be controlled by a suite of transcriptional and epigenetic inputs arranged hierarchically in a gene regulatory network. Here, we examine neural crest development from a gene regulatory perspective and discuss how the underlying genetic circuitry results in the features that define this unique cell population. PMID:25564621

  20. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  1. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  2. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  3. An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response

    Directory of Open Access Journals (Sweden)

    Katherine M. Buckley

    2017-10-01

    Full Text Available The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17, are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism.

  4. On the dynamics of a gene regulatory network

    International Nuclear Information System (INIS)

    Grammaticos, B; Carstea, A S; Ramani, A

    2006-01-01

    We examine the dynamics of a network of genes focusing on a periodic chain of genes, of arbitrary length. We show that within a given class of sigmoids representing the equilibrium probability of the binding of the RNA polymerase to the core promoter, the system possesses a single stable fixed point. By slightly modifying the sigmoid, introducing 'stiffer' forms, we show that it is possible to find network configurations exhibiting bistable behaviour. Our results do not depend crucially on the length of the chain considered: calculations with finite chains lead to similar results. However, a realistic study of regulatory genetic networks would require the consideration of more complex topologies and interactions

  5. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  6. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  7. Inferring the conservative causal core of gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Emmert-Streib Frank

    2010-09-01

    Full Text Available Abstract Background Inferring gene regulatory networks from large-scale expression data is an important problem that received much attention in recent years. These networks have the potential to gain insights into causal molecular interactions of biological processes. Hence, from a methodological point of view, reliable estimation methods based on observational data are needed to approach this problem practically. Results In this paper, we introduce a novel gene regulatory network inference (GRNI algorithm, called C3NET. We compare C3NET with four well known methods, ARACNE, CLR, MRNET and RN, conducting in-depth numerical ensemble simulations and demonstrate also for biological expression data from E. coli that C3NET performs consistently better than the best known GRNI methods in the literature. In addition, it has also a low computational complexity. Since C3NET is based on estimates of mutual information values in conjunction with a maximization step, our numerical investigations demonstrate that our inference algorithm exploits causal structural information in the data efficiently. Conclusions For systems biology to succeed in the long run, it is of crucial importance to establish methods that extract large-scale gene networks from high-throughput data that reflect the underlying causal interactions among genes or gene products. Our method can contribute to this endeavor by demonstrating that an inference algorithm with a neat design permits not only a more intuitive and possibly biological interpretation of its working mechanism but can also result in superior results.

  8. Inferring the conservative causal core of gene regulatory networks.

    Science.gov (United States)

    Altay, Gökmen; Emmert-Streib, Frank

    2010-09-28

    Inferring gene regulatory networks from large-scale expression data is an important problem that received much attention in recent years. These networks have the potential to gain insights into causal molecular interactions of biological processes. Hence, from a methodological point of view, reliable estimation methods based on observational data are needed to approach this problem practically. In this paper, we introduce a novel gene regulatory network inference (GRNI) algorithm, called C3NET. We compare C3NET with four well known methods, ARACNE, CLR, MRNET and RN, conducting in-depth numerical ensemble simulations and demonstrate also for biological expression data from E. coli that C3NET performs consistently better than the best known GRNI methods in the literature. In addition, it has also a low computational complexity. Since C3NET is based on estimates of mutual information values in conjunction with a maximization step, our numerical investigations demonstrate that our inference algorithm exploits causal structural information in the data efficiently. For systems biology to succeed in the long run, it is of crucial importance to establish methods that extract large-scale gene networks from high-throughput data that reflect the underlying causal interactions among genes or gene products. Our method can contribute to this endeavor by demonstrating that an inference algorithm with a neat design permits not only a more intuitive and possibly biological interpretation of its working mechanism but can also result in superior results.

  9. Comparison of evolutionary algorithms in gene regulatory network model inference.

    LENUS (Irish Health Repository)

    2010-01-01

    ABSTRACT: BACKGROUND: The evolution of high throughput technologies that measure gene expression levels has created a data base for inferring GRNs (a process also known as reverse engineering of GRNs). However, the nature of these data has made this process very difficult. At the moment, several methods of discovering qualitative causal relationships between genes with high accuracy from microarray data exist, but large scale quantitative analysis on real biological datasets cannot be performed, to date, as existing approaches are not suitable for real microarray data which are noisy and insufficient. RESULTS: This paper performs an analysis of several existing evolutionary algorithms for quantitative gene regulatory network modelling. The aim is to present the techniques used and offer a comprehensive comparison of approaches, under a common framework. Algorithms are applied to both synthetic and real gene expression data from DNA microarrays, and ability to reproduce biological behaviour, scalability and robustness to noise are assessed and compared. CONCLUSIONS: Presented is a comparison framework for assessment of evolutionary algorithms, used to infer gene regulatory networks. Promising methods are identified and a platform for development of appropriate model formalisms is established.

  10. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  11. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  12. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  13. Understanding Epistatic Interactions between Genes Targeted by Non-coding Regulatory Elements in Complex Diseases

    Directory of Open Access Journals (Sweden)

    Min Kyung Sung

    2014-12-01

    Full Text Available Genome-wide association studies have proven the highly polygenic architecture of complex diseases or traits; therefore, single-locus-based methods are usually unable to detect all involved loci, especially when individual loci exert small effects. Moreover, the majority of associated single-nucleotide polymorphisms resides in non-coding regions, making it difficult to understand their phenotypic contribution. In this work, we studied epistatic interactions associated with three common diseases using Korea Association Resource (KARE data: type 2 diabetes mellitus (DM, hypertension (HT, and coronary artery disease (CAD. We showed that epistatic single-nucleotide polymorphisms (SNPs were enriched in enhancers, as well as in DNase I footprints (the Encyclopedia of DNA Elements [ENCODE] Project Consortium 2012, which suggested that the disruption of the regulatory regions where transcription factors bind may be involved in the disease mechanism. Accordingly, to identify the genes affected by the SNPs, we employed whole-genome multiple-cell-type enhancer data which discovered using DNase I profiles and Cap Analysis Gene Expression (CAGE. Assigned genes were significantly enriched in known disease associated gene sets, which were explored based on the literature, suggesting that this approach is useful for detecting relevant affected genes. In our knowledge-based epistatic network, the three diseases share many associated genes and are also closely related with each other through many epistatic interactions. These findings elucidate the genetic basis of the close relationship between DM, HT, and CAD.

  14. The capacity for multistability in small gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Grotewold Erich

    2009-09-01

    Full Text Available Abstract Background Recent years have seen a dramatic increase in the use of mathematical modeling to gain insight into gene regulatory network behavior across many different organisms. In particular, there has been considerable interest in using mathematical tools to understand how multistable regulatory networks may contribute to developmental processes such as cell fate determination. Indeed, such a network may subserve the formation of unicellular leaf hairs (trichomes in the model plant Arabidopsis thaliana. Results In order to investigate the capacity of small gene regulatory networks to generate multiple equilibria, we present a chemical reaction network (CRN-based modeling formalism and describe a number of methods for CRN analysis in a parameter-free context. These methods are compared and applied to a full set of one-component subnetworks, as well as a large random sample from 40,680 similarly constructed two-component subnetworks. We find that positive feedback and cooperativity mediated by transcription factor (TF dimerization is a requirement for one-component subnetwork bistability. For subnetworks with two components, the presence of these processes increases the probability that a randomly sampled subnetwork will exhibit multiple equilibria, although we find several examples of bistable two-component subnetworks that do not involve cooperative TF-promoter binding. In the specific case of epidermal differentiation in Arabidopsis, dimerization of the GL3-GL1 complex and cooperative sequential binding of GL3-GL1 to the CPC promoter are each independently sufficient for bistability. Conclusion Computational methods utilizing CRN-specific theorems to rule out bistability in small gene regulatory networks are far superior to techniques generally applicable to deterministic ODE systems. Using these methods to conduct an unbiased survey of parameter-free deterministic models of small networks, and the Arabidopsis epidermal cell

  15. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  16. The Reconstruction and Analysis of Gene Regulatory Networks.

    Science.gov (United States)

    Zheng, Guangyong; Huang, Tao

    2018-01-01

    In post-genomic era, an important task is to explore the function of individual biological molecules (i.e., gene, noncoding RNA, protein, metabolite) and their organization in living cells. For this end, gene regulatory networks (GRNs) are constructed to show relationship between biological molecules, in which the vertices of network denote biological molecules and the edges of network present connection between nodes (Strogatz, Nature 410:268-276, 2001; Bray, Science 301:1864-1865, 2003). Biologists can understand not only the function of biological molecules but also the organization of components of living cells through interpreting the GRNs, since a gene regulatory network is a comprehensively physiological map of living cells and reflects influence of genetic and epigenetic factors (Strogatz, Nature 410:268-276, 2001; Bray, Science 301:1864-1865, 2003). In this paper, we will review the inference methods of GRN reconstruction and analysis approaches of network structure. As a powerful tool for studying complex diseases and biological processes, the applications of the network method in pathway analysis and disease gene identification will be introduced.

  17. Fused Regression for Multi-source Gene Regulatory Network Inference.

    Directory of Open Access Journals (Sweden)

    Kari Y Lam

    2016-12-01

    Full Text Available Understanding gene regulatory networks is critical to understanding cellular differentiation and response to external stimuli. Methods for global network inference have been developed and applied to a variety of species. Most approaches consider the problem of network inference independently in each species, despite evidence that gene regulation can be conserved even in distantly related species. Further, network inference is often confined to single data-types (single platforms and single cell types. We introduce a method for multi-source network inference that allows simultaneous estimation of gene regulatory networks in multiple species or biological processes through the introduction of priors based on known gene relationships such as orthology incorporated using fused regression. This approach improves network inference performance even when orthology mapping and conservation are incomplete. We refine this method by presenting an algorithm that extracts the true conserved subnetwork from a larger set of potentially conserved interactions and demonstrate the utility of our method in cross species network inference. Last, we demonstrate our method's utility in learning from data collected on different experimental platforms.

  18. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  19. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  20. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  1. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  2. Regulatory Oversight of Cell and Gene Therapy Products in Canada.

    Science.gov (United States)

    Ridgway, Anthony; Agbanyo, Francisca; Wang, Jian; Rosu-Myles, Michael

    2015-01-01

    Health Canada regulates gene therapy products and many cell therapy products as biological drugs under the Canadian Food and Drugs Act and its attendant regulations. Cellular products that meet certain criteria, including minimal manipulation and homologous use, may be subjected to a standards-based approach under the Safety of Human Cells, Tissues and Organs for Transplantation Regulations. The manufacture and clinical testing of cell and gene therapy products (CGTPs) presents many challenges beyond those for protein biologics. Cells cannot be subjected to pathogen removal or inactivation procedures and must frequently be administered shortly after final formulation. Viral vector design and manufacturing control are critically important to overall product quality and linked to safety and efficacy in patients through concerns such as replication competence, vector integration, and vector shedding. In addition, for many CGTPs, the value of nonclinical studies is largely limited to providing proof of concept, and the first meaningful data relating to appropriate dosing, safety parameters, and validity of surrogate or true determinants of efficacy must come from carefully designed clinical trials in patients. Addressing these numerous challenges requires application of various risk mitigation strategies and meeting regulatory expectations specifically adapted to the product types. Regulatory cooperation and harmonisation at an international level are essential for progress in the development and commercialisation of these products. However, particularly in the area of cell therapy, new regulatory paradigms may be needed to harness the benefits of clinical progress in situations where the resources and motivation to pursue a typical drug product approval pathway may be lacking.

  3. Inferring Gene Regulatory Networks Using Conditional Regulation Pattern to Guide Candidate Genes.

    Directory of Open Access Journals (Sweden)

    Fei Xiao

    Full Text Available Combining path consistency (PC algorithms with conditional mutual information (CMI are widely used in reconstruction of gene regulatory networks. CMI has many advantages over Pearson correlation coefficient in measuring non-linear dependence to infer gene regulatory networks. It can also discriminate the direct regulations from indirect ones. However, it is still a challenge to select the conditional genes in an optimal way, which affects the performance and computation complexity of the PC algorithm. In this study, we develop a novel conditional mutual information-based algorithm, namely RPNI (Regulation Pattern based Network Inference, to infer gene regulatory networks. For conditional gene selection, we define the co-regulation pattern, indirect-regulation pattern and mixture-regulation pattern as three candidate patterns to guide the selection of candidate genes. To demonstrate the potential of our algorithm, we apply it to gene expression data from DREAM challenge. Experimental results show that RPNI outperforms existing conditional mutual information-based methods in both accuracy and time complexity for different sizes of gene samples. Furthermore, the robustness of our algorithm is demonstrated by noisy interference analysis using different types of noise.

  4. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  5. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  6. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  7. The gene regulatory network for breast cancer: Integrated regulatory landscape of cancer hallmarks

    Directory of Open Access Journals (Sweden)

    Frank eEmmert-Streib

    2014-02-01

    Full Text Available In this study, we infer the breast cancer gene regulatory network from gene expression data. This network is obtained from the application of the BC3Net inference algorithm to a large-scale gene expression data set consisting of $351$ patient samples. In order to elucidate the functional relevance of the inferred network, we are performing a Gene Ontology (GO analysis for its structural components. Our analysis reveals that most significant GO-terms we find for the breast cancer network represent functional modules of biological processes that are described by known cancer hallmarks, including translation, immune response, cell cycle, organelle fission, mitosis, cell adhesion, RNA processing, RNA splicing and response to wounding. Furthermore, by using a curated list of census cancer genes, we find an enrichment in these functional modules. Finally, we study cooperative effects of chromosomes based on information of interacting genes in the beast cancer network. We find that chromosome $21$ is most coactive with other chromosomes. To our knowledge this is the first study investigating the genome-scale breast cancer network.

  8. The arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier

    Science.gov (United States)

    Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.

    1998-01-01

    Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.

  9. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  10. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    Science.gov (United States)

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

  11. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  12. The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

    Science.gov (United States)

    Keebaugh, Alaine C; Thomas, James W

    2010-06-01

    Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

  13. Learning gene regulatory networks from gene expression data using weighted consensus

    KAUST Repository

    Fujii, Chisato; Kuwahara, Hiroyuki; Yu, Ge; Guo, Lili; Gao, Xin

    2016-01-01

    An accurate determination of the network structure of gene regulatory systems from high-throughput gene expression data is an essential yet challenging step in studying how the expression of endogenous genes is controlled through a complex interaction of gene products and DNA. While numerous methods have been proposed to infer the structure of gene regulatory networks, none of them seem to work consistently over different data sets with high accuracy. A recent study to compare gene network inference methods showed that an average-ranking-based consensus method consistently performs well under various settings. Here, we propose a linear programming-based consensus method for the inference of gene regulatory networks. Unlike the average-ranking-based one, which treats the contribution of each individual method equally, our new consensus method assigns a weight to each method based on its credibility. As a case study, we applied the proposed consensus method on synthetic and real microarray data sets, and compared its performance to that of the average-ranking-based consensus and individual inference methods. Our results show that our weighted consensus method achieves superior performance over the unweighted one, suggesting that assigning weights to different individual methods rather than giving them equal weights improves the accuracy. © 2016 Elsevier B.V.

  14. Learning gene regulatory networks from gene expression data using weighted consensus

    KAUST Repository

    Fujii, Chisato

    2016-08-25

    An accurate determination of the network structure of gene regulatory systems from high-throughput gene expression data is an essential yet challenging step in studying how the expression of endogenous genes is controlled through a complex interaction of gene products and DNA. While numerous methods have been proposed to infer the structure of gene regulatory networks, none of them seem to work consistently over different data sets with high accuracy. A recent study to compare gene network inference methods showed that an average-ranking-based consensus method consistently performs well under various settings. Here, we propose a linear programming-based consensus method for the inference of gene regulatory networks. Unlike the average-ranking-based one, which treats the contribution of each individual method equally, our new consensus method assigns a weight to each method based on its credibility. As a case study, we applied the proposed consensus method on synthetic and real microarray data sets, and compared its performance to that of the average-ranking-based consensus and individual inference methods. Our results show that our weighted consensus method achieves superior performance over the unweighted one, suggesting that assigning weights to different individual methods rather than giving them equal weights improves the accuracy. © 2016 Elsevier B.V.

  15. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  16. Engineering nucleases for gene targeting: safety and regulatory considerations.

    Science.gov (United States)

    Pauwels, Katia; Podevin, Nancy; Breyer, Didier; Carroll, Dana; Herman, Philippe

    2014-01-25

    Nuclease-based gene targeting (NBGT) represents a significant breakthrough in targeted genome editing since it is applicable from single-celled protozoa to human, including several species of economic importance. Along with the fast progress in NBGT and the increasing availability of customized nucleases, more data are available about off-target effects associated with the use of this approach. We discuss how NBGT may offer a new perspective for genetic modification, we address some aspects crucial for a safety improvement of the corresponding techniques and we also briefly relate the use of NBGT applications and products to the regulatory oversight. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Ground rules of the pluripotency gene regulatory network.

    KAUST Repository

    Li, Mo

    2017-01-03

    Pluripotency is a state that exists transiently in the early embryo and, remarkably, can be recapitulated in vitro by deriving embryonic stem cells or by reprogramming somatic cells to become induced pluripotent stem cells. The state of pluripotency, which is stabilized by an interconnected network of pluripotency-associated genes, integrates external signals and exerts control over the decision between self-renewal and differentiation at the transcriptional, post-transcriptional and epigenetic levels. Recent evidence of alternative pluripotency states indicates the regulatory flexibility of this network. Insights into the underlying principles of the pluripotency network may provide unprecedented opportunities for studying development and for regenerative medicine.

  18. Ground rules of the pluripotency gene regulatory network.

    KAUST Repository

    Li, Mo; Belmonte, Juan Carlos Izpisua

    2017-01-01

    Pluripotency is a state that exists transiently in the early embryo and, remarkably, can be recapitulated in vitro by deriving embryonic stem cells or by reprogramming somatic cells to become induced pluripotent stem cells. The state of pluripotency, which is stabilized by an interconnected network of pluripotency-associated genes, integrates external signals and exerts control over the decision between self-renewal and differentiation at the transcriptional, post-transcriptional and epigenetic levels. Recent evidence of alternative pluripotency states indicates the regulatory flexibility of this network. Insights into the underlying principles of the pluripotency network may provide unprecedented opportunities for studying development and for regenerative medicine.

  19. Learning a Markov Logic network for supervised gene regulatory network inference.

    Science.gov (United States)

    Brouard, Céline; Vrain, Christel; Dubois, Julie; Castel, David; Debily, Marie-Anne; d'Alché-Buc, Florence

    2013-09-12

    Gene regulatory network inference remains a challenging problem in systems biology despite the numerous approaches that have been proposed. When substantial knowledge on a gene regulatory network is already available, supervised network inference is appropriate. Such a method builds a binary classifier able to assign a class (Regulation/No regulation) to an ordered pair of genes. Once learnt, the pairwise classifier can be used to predict new regulations. In this work, we explore the framework of Markov Logic Networks (MLN) that combine features of probabilistic graphical models with the expressivity of first-order logic rules. We propose to learn a Markov Logic network, e.g. a set of weighted rules that conclude on the predicate "regulates", starting from a known gene regulatory network involved in the switch proliferation/differentiation of keratinocyte cells, a set of experimental transcriptomic data and various descriptions of genes all encoded into first-order logic. As training data are unbalanced, we use asymmetric bagging to learn a set of MLNs. The prediction of a new regulation can then be obtained by averaging predictions of individual MLNs. As a side contribution, we propose three in silico tests to assess the performance of any pairwise classifier in various network inference tasks on real datasets. A first test consists of measuring the average performance on balanced edge prediction problem; a second one deals with the ability of the classifier, once enhanced by asymmetric bagging, to update a given network. Finally our main result concerns a third test that measures the ability of the method to predict regulations with a new set of genes. As expected, MLN, when provided with only numerical discretized gene expression data, does not perform as well as a pairwise SVM in terms of AUPR. However, when a more complete description of gene properties is provided by heterogeneous sources, MLN achieves the same performance as a black-box model such as a

  20. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  1. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  2. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  3. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  4. Inferring Drosophila gap gene regulatory network: Pattern analysis of simulated gene expression profiles and stability analysis

    OpenAIRE

    Fomekong-Nanfack, Y.; Postma, M.; Kaandorp, J.A.

    2009-01-01

    Abstract Background Inference of gene regulatory networks (GRNs) requires accurate data, a method to simulate the expression patterns and an efficient optimization algorithm to estimate the unknown parameters. Using this approach it is possible to obtain alternative circuits without making any a priori assumptions about the interactions, which all simulate the observed patterns. It is important to analyze the properties of the circuits. Findings We have analyzed the simulated gene expression ...

  5. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    OpenAIRE

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  6. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  7. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  8. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  9. Learning Gene Regulatory Networks Computationally from Gene Expression Data Using Weighted Consensus

    KAUST Repository

    Fujii, Chisato

    2015-04-16

    Gene regulatory networks analyze the relationships between genes allowing us to un- derstand the gene regulatory interactions in systems biology. Gene expression data from the microarray experiments is used to obtain the gene regulatory networks. How- ever, the microarray data is discrete, noisy and non-linear which makes learning the networks a challenging problem and existing gene network inference methods do not give consistent results. Current state-of-the-art study uses the average-ranking-based consensus method to combine and average the ranked predictions from individual methods. However each individual method has an equal contribution to the consen- sus prediction. We have developed a linear programming-based consensus approach which uses learned weights from linear programming among individual methods such that the methods have di↵erent weights depending on their performance. Our result reveals that assigning di↵erent weights to individual methods rather than giving them equal weights improves the performance of the consensus. The linear programming- based consensus method is evaluated and it had the best performance on in silico and Saccharomyces cerevisiae networks, and the second best on the Escherichia coli network outperformed by Inferelator Pipeline method which gives inconsistent results across a wide range of microarray data sets.

  10. Predictive modelling of gene expression from transcriptional regulatory elements.

    Science.gov (United States)

    Budden, David M; Hurley, Daniel G; Crampin, Edmund J

    2015-07-01

    Predictive modelling of gene expression provides a powerful framework for exploring the regulatory logic underpinning transcriptional regulation. Recent studies have demonstrated the utility of such models in identifying dysregulation of gene and miRNA expression associated with abnormal patterns of transcription factor (TF) binding or nucleosomal histone modifications (HMs). Despite the growing popularity of such approaches, a comparative review of the various modelling algorithms and feature extraction methods is lacking. We define and compare three methods of quantifying pairwise gene-TF/HM interactions and discuss their suitability for integrating the heterogeneous chromatin immunoprecipitation (ChIP)-seq binding patterns exhibited by TFs and HMs. We then construct log-linear and ϵ-support vector regression models from various mouse embryonic stem cell (mESC) and human lymphoblastoid (GM12878) data sets, considering both ChIP-seq- and position weight matrix- (PWM)-derived in silico TF-binding. The two algorithms are evaluated both in terms of their modelling prediction accuracy and ability to identify the established regulatory roles of individual TFs and HMs. Our results demonstrate that TF-binding and HMs are highly predictive of gene expression as measured by mRNA transcript abundance, irrespective of algorithm or cell type selection and considering both ChIP-seq and PWM-derived TF-binding. As we encourage other researchers to explore and develop these results, our framework is implemented using open-source software and made available as a preconfigured bootable virtual environment. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  11. Inferring Drosophila gap gene regulatory network: Pattern analysis of simulated gene expression profiles and stability analysis

    NARCIS (Netherlands)

    Fomekong-Nanfack, Y.; Postma, M.; Kaandorp, J.A.

    2009-01-01

    Background: Inference of gene regulatory networks (GRNs) requires accurate data, a method to simulate the expression patterns and an efficient optimization algorithm to estimate the unknown parameters. Using this approach it is possible to obtain alternative circuits without making any a priori

  12. Neurogenic gene regulatory pathways in the sea urchin embryo.

    Science.gov (United States)

    Wei, Zheng; Angerer, Lynne M; Angerer, Robert C

    2016-01-15

    During embryogenesis the sea urchin early pluteus larva differentiates 40-50 neurons marked by expression of the pan-neural marker synaptotagmin B (SynB) that are distributed along the ciliary band, in the apical plate and pharyngeal endoderm, and 4-6 serotonergic neurons that are confined to the apical plate. Development of all neurons has been shown to depend on the function of Six3. Using a combination of molecular screens and tests of gene function by morpholino-mediated knockdown, we identified SoxC and Brn1/2/4, which function sequentially in the neurogenic regulatory pathway and are also required for the differentiation of all neurons. Misexpression of Brn1/2/4 at low dose caused an increase in the number of serotonin-expressing cells and at higher dose converted most of the embryo to a neurogenic epithelial sphere expressing the Hnf6 ciliary band marker. A third factor, Z167, was shown to work downstream of the Six3 and SoxC core factors and to define a branch specific for the differentiation of serotonergic neurons. These results provide a framework for building a gene regulatory network for neurogenesis in the sea urchin embryo. © 2016. Published by The Company of Biologists Ltd.

  13. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  14. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  15. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  16. SNPs in the 5'-regulatory region of the tyrosinase gene do not affect plumage color in ducks (Anas platyrhynchos).

    Science.gov (United States)

    Zhang, N N; Hu, J W; Liu, H H; Xu, H Y; He, H; Li, L

    2015-12-29

    Tyrosinase, encoded by the TYR gene, is the rate-limiting enzyme in the production of melanin pigment. In this study, plumage color separation was observed in Cherry Valley duck line D and F1 and F2 hybrid generations of Liancheng white ducks. Gene sequencing and bioinformatic analysis were applied to the 5'-regulatory region of TYR, to explore the connection between TYR sequence variation and duck plumage color. Four SNPs were found in the 5'-regulatory region. The SNPs were in tight linkage and formed three haplotypes. However, the genotype distribution in groups with different plumage color was not significantly different, and there were no changes in the transcription factor binding sites between the different genotypes. In conclusion, these SNP variations may not cause the differences in feather color observed in this test group.

  17. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  18. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  19. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  1. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  2. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  3. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  4. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  5. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    International Nuclear Information System (INIS)

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

    2005-01-01

    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  6. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  7. Gene Therapy With Regulatory T Cells: A Beneficial Alliance

    Directory of Open Access Journals (Sweden)

    Moanaro Biswas

    2018-03-01

    Full Text Available Gene therapy aims to replace a defective or a deficient protein at therapeutic or curative levels. Improved vector designs have enhanced safety, efficacy, and delivery, with potential for lasting treatment. However, innate and adaptive immune responses to the viral vector and transgene product remain obstacles to the establishment of therapeutic efficacy. It is widely accepted that endogenous regulatory T cells (Tregs are critical for tolerance induction to the transgene product and in some cases the viral vector. There are two basic strategies to harness the suppressive ability of Tregs: in vivo induction of adaptive Tregs specific to the introduced gene product and concurrent administration of autologous, ex vivo expanded Tregs. The latter may be polyclonal or engineered to direct specificity to the therapeutic antigen. Recent clinical trials have advanced adoptive immunotherapy with Tregs for the treatment of autoimmune disease and in patients receiving cell transplants. Here, we highlight the potential benefit of combining gene therapy with Treg adoptive transfer to achieve a sustained transgene expression. Furthermore, techniques to engineer antigen-specific Treg cell populations, either through reprogramming conventional CD4+ T cells or transferring T cell receptors with known specificity into polyclonal Tregs, are promising in preclinical studies. Thus, based upon these observations and the successful use of chimeric (IgG-based antigen receptors (CARs in antigen-specific effector T cells, different types of CAR-Tregs could be added to the repertoire of inhibitory modalities to suppress immune responses to therapeutic cargos of gene therapy vectors. The diverse approaches to harness the ability of Tregs to suppress unwanted immune responses to gene therapy and their perspectives are reviewed in this article.

  8. Data Integration for Microarrays: Enhanced Inference for Gene Regulatory Networks

    Directory of Open Access Journals (Sweden)

    Alina Sîrbu

    2015-05-01

    Full Text Available Microarray technologies have been the basis of numerous important findings regarding gene expression in the few last decades. Studies have generated large amounts of data describing various processes, which, due to the existence of public databases, are widely available for further analysis. Given their lower cost and higher maturity compared to newer sequencing technologies, these data continue to be produced, even though data quality has been the subject of some debate. However, given the large volume of data generated, integration can help overcome some issues related, e.g., to noise or reduced time resolution, while providing additional insight on features not directly addressed by sequencing methods. Here, we present an integration test case based on public Drosophila melanogaster datasets (gene expression, binding site affinities, known interactions. Using an evolutionary computation framework, we show how integration can enhance the ability to recover transcriptional gene regulatory networks from these data, as well as indicating which data types are more important for quantitative and qualitative network inference. Our results show a clear improvement in performance when multiple datasets are integrated, indicating that microarray data will remain a valuable and viable resource for some time to come.

  9. Data Integration for Microarrays: Enhanced Inference for Gene Regulatory Networks.

    Science.gov (United States)

    Sîrbu, Alina; Crane, Martin; Ruskin, Heather J

    2015-05-14

    Microarray technologies have been the basis of numerous important findings regarding gene expression in the few last decades. Studies have generated large amounts of data describing various processes, which, due to the existence of public databases, are widely available for further analysis. Given their lower cost and higher maturity compared to newer sequencing technologies, these data continue to be produced, even though data quality has been the subject of some debate. However, given the large volume of data generated, integration can help overcome some issues related, e.g., to noise or reduced time resolution, while providing additional insight on features not directly addressed by sequencing methods. Here, we present an integration test case based on public Drosophila melanogaster datasets (gene expression, binding site affinities, known interactions). Using an evolutionary computation framework, we show how integration can enhance the ability to recover transcriptional gene regulatory networks from these data, as well as indicating which data types are more important for quantitative and qualitative network inference. Our results show a clear improvement in performance when multiple datasets are integrated, indicating that microarray data will remain a valuable and viable resource for some time to come.

  10. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  11. Analysis of deterministic cyclic gene regulatory network models with delays

    CERN Document Server

    Ahsen, Mehmet Eren; Niculescu, Silviu-Iulian

    2015-01-01

    This brief examines a deterministic, ODE-based model for gene regulatory networks (GRN) that incorporates nonlinearities and time-delayed feedback. An introductory chapter provides some insights into molecular biology and GRNs. The mathematical tools necessary for studying the GRN model are then reviewed, in particular Hill functions and Schwarzian derivatives. One chapter is devoted to the analysis of GRNs under negative feedback with time delays and a special case of a homogenous GRN is considered. Asymptotic stability analysis of GRNs under positive feedback is then considered in a separate chapter, in which conditions leading to bi-stability are derived. Graduate and advanced undergraduate students and researchers in control engineering, applied mathematics, systems biology and synthetic biology will find this brief to be a clear and concise introduction to the modeling and analysis of GRNs.

  12. Algebraic model checking for Boolean gene regulatory networks.

    Science.gov (United States)

    Tran, Quoc-Nam

    2011-01-01

    We present a computational method in which modular and Groebner bases (GB) computation in Boolean rings are used for solving problems in Boolean gene regulatory networks (BN). In contrast to other known algebraic approaches, the degree of intermediate polynomials during the calculation of Groebner bases using our method will never grow resulting in a significant improvement in running time and memory space consumption. We also show how calculation in temporal logic for model checking can be done by means of our direct and efficient Groebner basis computation in Boolean rings. We present our experimental results in finding attractors and control strategies of Boolean networks to illustrate our theoretical arguments. The results are promising. Our algebraic approach is more efficient than the state-of-the-art model checker NuSMV on BNs. More importantly, our approach finds all solutions for the BN problems.

  13. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  14. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  15. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  16. Memory functions reveal structural properties of gene regulatory networks

    Science.gov (United States)

    Perez-Carrasco, Ruben

    2018-01-01

    Gene regulatory networks (GRNs) control cellular function and decision making during tissue development and homeostasis. Mathematical tools based on dynamical systems theory are often used to model these networks, but the size and complexity of these models mean that their behaviour is not always intuitive and the underlying mechanisms can be difficult to decipher. For this reason, methods that simplify and aid exploration of complex networks are necessary. To this end we develop a broadly applicable form of the Zwanzig-Mori projection. By first converting a thermodynamic state ensemble model of gene regulation into mass action reactions we derive a general method that produces a set of time evolution equations for a subset of components of a network. The influence of the rest of the network, the bulk, is captured by memory functions that describe how the subnetwork reacts to its own past state via components in the bulk. These memory functions provide probes of near-steady state dynamics, revealing information not easily accessible otherwise. We illustrate the method on a simple cross-repressive transcriptional motif to show that memory functions not only simplify the analysis of the subnetwork but also have a natural interpretation. We then apply the approach to a GRN from the vertebrate neural tube, a well characterised developmental transcriptional network composed of four interacting transcription factors. The memory functions reveal the function of specific links within the neural tube network and identify features of the regulatory structure that specifically increase the robustness of the network to initial conditions. Taken together, the study provides evidence that Zwanzig-Mori projections offer powerful and effective tools for simplifying and exploring the behaviour of GRNs. PMID:29470492

  17. The impact of gene expression variation on the robustness and evolvability of a developmental gene regulatory network.

    Directory of Open Access Journals (Sweden)

    David A Garfield

    2013-10-01

    Full Text Available Regulatory interactions buffer development against genetic and environmental perturbations, but adaptation requires phenotypes to change. We investigated the relationship between robustness and evolvability within the gene regulatory network underlying development of the larval skeleton in the sea urchin Strongylocentrotus purpuratus. We find extensive variation in gene expression in this network throughout development in a natural population, some of which has a heritable genetic basis. Switch-like regulatory interactions predominate during early development, buffer expression variation, and may promote the accumulation of cryptic genetic variation affecting early stages. Regulatory interactions during later development are typically more sensitive (linear, allowing variation in expression to affect downstream target genes. Variation in skeletal morphology is associated primarily with expression variation of a few, primarily structural, genes at terminal positions within the network. These results indicate that the position and properties of gene interactions within a network can have important evolutionary consequences independent of their immediate regulatory role.

  18. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  19. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  20. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)

    2013-10-15

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.

  1. CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

    International Nuclear Information System (INIS)

    Wu, Yongyan; Ai, Zhiying; Yao, Kezhen; Cao, Lixia; Du, Juan; Shi, Xiaoyan; Guo, Zekun; Zhang, Yong

    2013-01-01

    Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR

  2. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    Science.gov (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  3. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  4. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  5. Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene

    Directory of Open Access Journals (Sweden)

    Michael Hadjiargyrou

    2018-01-01

    Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.

  6. Discovery of time-delayed gene regulatory networks based on temporal gene expression profiling

    Directory of Open Access Journals (Sweden)

    Guo Zheng

    2006-01-01

    Full Text Available Abstract Background It is one of the ultimate goals for modern biological research to fully elucidate the intricate interplays and the regulations of the molecular determinants that propel and characterize the progression of versatile life phenomena, to name a few, cell cycling, developmental biology, aging, and the progressive and recurrent pathogenesis of complex diseases. The vast amount of large-scale and genome-wide time-resolved data is becoming increasing available, which provides the golden opportunity to unravel the challenging reverse-engineering problem of time-delayed gene regulatory networks. Results In particular, this methodological paper aims to reconstruct regulatory networks from temporal gene expression data by using delayed correlations between genes, i.e., pairwise overlaps of expression levels shifted in time relative each other. We have thus developed a novel model-free computational toolbox termed TdGRN (Time-delayed Gene Regulatory Network to address the underlying regulations of genes that can span any unit(s of time intervals. This bioinformatics toolbox has provided a unified approach to uncovering time trends of gene regulations through decision analysis of the newly designed time-delayed gene expression matrix. We have applied the proposed method to yeast cell cycling and human HeLa cell cycling and have discovered most of the underlying time-delayed regulations that are supported by multiple lines of experimental evidence and that are remarkably consistent with the current knowledge on phase characteristics for the cell cyclings. Conclusion We established a usable and powerful model-free approach to dissecting high-order dynamic trends of gene-gene interactions. We have carefully validated the proposed algorithm by applying it to two publicly available cell cycling datasets. In addition to uncovering the time trends of gene regulations for cell cycling, this unified approach can also be used to study the complex

  7. Finding gene regulatory network candidates using the gene expression knowledge base.

    Science.gov (United States)

    Venkatesan, Aravind; Tripathi, Sushil; Sanz de Galdeano, Alejandro; Blondé, Ward; Lægreid, Astrid; Mironov, Vladimir; Kuiper, Martin

    2014-12-10

    Network-based approaches for the analysis of large-scale genomics data have become well established. Biological networks provide a knowledge scaffold against which the patterns and dynamics of 'omics' data can be interpreted. The background information required for the construction of such networks is often dispersed across a multitude of knowledge bases in a variety of formats. The seamless integration of this information is one of the main challenges in bioinformatics. The Semantic Web offers powerful technologies for the assembly of integrated knowledge bases that are computationally comprehensible, thereby providing a potentially powerful resource for constructing biological networks and network-based analysis. We have developed the Gene eXpression Knowledge Base (GeXKB), a semantic web technology based resource that contains integrated knowledge about gene expression regulation. To affirm the utility of GeXKB we demonstrate how this resource can be exploited for the identification of candidate regulatory network proteins. We present four use cases that were designed from a biological perspective in order to find candidate members relevant for the gastrin hormone signaling network model. We show how a combination of specific query definitions and additional selection criteria derived from gene expression data and prior knowledge concerning candidate proteins can be used to retrieve a set of proteins that constitute valid candidates for regulatory network extensions. Semantic web technologies provide the means for processing and integrating various heterogeneous information sources. The GeXKB offers biologists such an integrated knowledge resource, allowing them to address complex biological questions pertaining to gene expression. This work illustrates how GeXKB can be used in combination with gene expression results and literature information to identify new potential candidates that may be considered for extending a gene regulatory network.

  8. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    Science.gov (United States)

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  10. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  11. Inference of Cancer-specific Gene Regulatory Networks Using Soft Computing Rules

    Directory of Open Access Journals (Sweden)

    Xiaosheng Wang

    2010-03-01

    Full Text Available Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

  12. Inference of cancer-specific gene regulatory networks using soft computing rules.

    Science.gov (United States)

    Wang, Xiaosheng; Gotoh, Osamu

    2010-03-24

    Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

  13. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  14. Gene regulatory networks in lactation: identification of global principles using bioinformatics

    Directory of Open Access Journals (Sweden)

    Pollard Katherine S

    2007-11-01

    Full Text Available Abstract Background The molecular events underlying mammary development during pregnancy, lactation, and involution are incompletely understood. Results Mammary gland microarray data, cellular localization data, protein-protein interactions, and literature-mined genes were integrated and analyzed using statistics, principal component analysis, gene ontology analysis, pathway analysis, and network analysis to identify global biological principles that govern molecular events during pregnancy, lactation, and involution. Conclusion Several key principles were derived: (1 nearly a third of the transcriptome fluctuates to build, run, and disassemble the lactation apparatus; (2 genes encoding the secretory machinery are transcribed prior to lactation; (3 the diversity of the endogenous portion of the milk proteome is derived from fewer than 100 transcripts; (4 while some genes are differentially transcribed near the onset of lactation, the lactation switch is primarily post-transcriptionally mediated; (5 the secretion of materials during lactation occurs not by up-regulation of novel genomic functions, but by widespread transcriptional suppression of functions such as protein degradation and cell-environment communication; (6 the involution switch is primarily transcriptionally mediated; and (7 during early involution, the transcriptional state is partially reverted to the pre-lactation state. A new hypothesis for secretory diminution is suggested – milk production gradually declines because the secretory machinery is not transcriptionally replenished. A comprehensive network of protein interactions during lactation is assembled and new regulatory gene targets are identified. Less than one fifth of the transcriptionally regulated nodes in this lactation network have been previously explored in the context of lactation. Implications for future research in mammary and cancer biology are discussed.

  15. In vivo SPECT reporter gene imaging of regulatory T cells.

    Directory of Open Access Journals (Sweden)

    Ehsan Sharif-Paghaleh

    Full Text Available Regulatory T cells (Tregs were identified several years ago and are key in controlling autoimmune diseases and limiting immune responses to foreign antigens, including alloantigens. In vivo imaging techniques including intravital microscopy as well as whole body imaging using bioluminescence probes have contributed to the understanding of in vivo Treg function, their mechanisms of action and target cells. Imaging of the human sodium/iodide symporter via Single Photon Emission Computed Tomography (SPECT has been used to image various cell types in vivo. It has several advantages over the aforementioned imaging techniques including high sensitivity, it allows non-invasive whole body studies of viable cell migration and localisation of cells over time and lastly it may offer the possibility to be translated to the clinic. This study addresses whether SPECT/CT imaging can be used to visualise the migratory pattern of Tregs in vivo. Treg lines derived from CD4(+CD25(+FoxP3(+ cells were retrovirally transduced with a construct encoding for the human Sodium Iodide Symporter (NIS and the fluorescent protein mCherry and stimulated with autologous DCs. NIS expressing self-specific Tregs were specifically radiolabelled in vitro with Technetium-99m pertechnetate ((99mTcO(4(- and exposure of these cells to radioactivity did not affect cell viability, phenotype or function. In addition adoptively transferred Treg-NIS cells were imaged in vivo in C57BL/6 (BL/6 mice by SPECT/CT using (99mTcO(4(-. After 24 hours NIS expressing Tregs were observed in the spleen and their localisation was further confirmed by organ biodistribution studies and flow cytometry analysis. The data presented here suggests that SPECT/CT imaging can be utilised in preclinical imaging studies of adoptively transferred Tregs without affecting Treg function and viability thereby allowing longitudinal studies within disease models.

  16. Gene regulatory and signaling networks exhibit distinct topological distributions of motifs

    Science.gov (United States)

    Ferreira, Gustavo Rodrigues; Nakaya, Helder Imoto; Costa, Luciano da Fontoura

    2018-04-01

    The biological processes of cellular decision making and differentiation involve a plethora of signaling pathways and gene regulatory circuits. These networks in turn exhibit a multitude of motifs playing crucial parts in regulating network activity. Here we compare the topological placement of motifs in gene regulatory and signaling networks and observe that it suggests different evolutionary strategies in motif distribution for distinct cellular subnetworks.

  17. Mutation of a Rice Gene Encoding a Phenylalanine Biosynthetic Enzyme Results in Accumulation of Phenylalanine and Tryptophan[W

    Science.gov (United States)

    Yamada, Tetsuya; Matsuda, Fumio; Kasai, Koji; Fukuoka, Shuichi; Kitamura, Keisuke; Tozawa, Yuzuru; Miyagawa, Hisashi; Wakasa, Kyo

    2008-01-01

    Two distinct biosynthetic pathways for Phe in plants have been proposed: conversion of prephenate to Phe via phenylpyruvate or arogenate. The reactions catalyzed by prephenate dehydratase (PDT) and arogenate dehydratase (ADT) contribute to these respective pathways. The Mtr1 mutant of rice (Oryza sativa) manifests accumulation of Phe, Trp, and several phenylpropanoids, suggesting a link between the synthesis of Phe and Trp. Here, we show that the Mtr1 mutant gene (mtr1-D) encodes a form of rice PDT with a point mutation in the putative allosteric regulatory region of the protein. Transformed callus lines expressing mtr1-D exhibited all the characteristics of Mtr1 callus tissue. Biochemical analysis revealed that rice PDT possesses both PDT and ADT activities, with a preference for arogenate as substrate, suggesting that it functions primarily as an ADT. The wild-type enzyme is feedback regulated by Phe, whereas the mutant enzyme showed a reduced feedback sensitivity, resulting in Phe accumulation. In addition, these observations indicate that rice PDT is critical for regulating the size of the Phe pool in plant cells. Feeding external Phe to wild-type callus tissue and seedlings resulted in Trp accumulation, demonstrating a connection between Phe accumulation and Trp pool size. PMID:18487352

  18. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  19. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  20. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  1. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  2. Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

    Science.gov (United States)

    Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

    1999-07-01

    The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

  3. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  4. Co-ordinate regulation of Salmonella typhimurium invasion genes by environmental and regulatory factors is mediated by control of hilA expression.

    Science.gov (United States)

    Bajaj, V; Lucas, R L; Hwang, C; Lee, C A

    1996-11-01

    During infection of their hosts, salmonellae enter intestinal epithelial cells. It has been proposed that when Salmonella typhimurium is present in the intestinal lumen, several environmental and regulatory conditions modulate the expression of invasion factors required for bacterial entry into host cells. We report here that the expression of six different S. typhimurium invasion genes encoded on SPI1 (Salmonella pathogenicity island 1) is co-ordinately regulated by oxygen, osmolarity, pH, PhoPQ, and HilA. HilA is a transcriptional activator of the OmpR/ToxR family that is also encoded on SPI1. We have found that HilA plays a central role in the co-ordinated regulation of invasion genes by environmental and regulatory conditions. HilA can activate the expression of two invasion gene-lacZY fusions on reporter plasmids in Escherichia coll, suggesting that HilA acts directly at invasion-gene promoters in S. typhimurium. We have found that the regulation of invasion genes by oxygen, osmolarity, pH, and PhoPQ is indirect and is mediated by regulation of hilA expression by these environmental and regulatory factors. We hypothesize that the complex and co-ordinate regulation of Invasion genes by HilA is an important feature of salmonella pathogenesis and allows salmonellae to enter intestinal epithelial cells.

  5. The upstream regulatory sequence of the light harvesting complex Lhcf2 gene of the marine diatom Phaeodactylum tricornutum enhances transcription in an orientation- and distance-independent fashion.

    Science.gov (United States)

    Russo, Monia Teresa; Annunziata, Rossella; Sanges, Remo; Ferrante, Maria Immacolata; Falciatore, Angela

    2015-12-01

    Diatoms are a key phytoplankton group in the contemporary ocean, showing extraordinary adaptation capacities to rapidly changing environments. The recent availability of whole genome sequences from representative species has revealed distinct features in their genomes, like novel combinations of genes encoding distinct metabolisms and a significant number of diatom-specific genes. However, the regulatory mechanisms driving diatom gene expression are still largely uncharacterized. Considering the wide variety of fields of study orbiting diatoms, ranging from ecology, evolutionary biology to biotechnology, it is thus essential to increase our understanding of fundamental gene regulatory processes such as transcriptional regulation. To this aim, we explored the functional properties of the 5'-flanking region of the Phaeodatylum tricornutum Lhcf2 gene, encoding a member of the Light Harvesting Complex superfamily and we showed that this region enhances transcription of a GUS reporter gene in an orientation- and distance-independent fashion. This represents the first example of a cis-regulatory sequence with enhancer-like features discovered in diatoms and it is instrumental for the generation of novel genetic tools and diatom exploitation in different areas of study. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Regulatory polymorphisms in the cyclophilin A gene, PPIA, accelerate progression to AIDS.

    Directory of Open Access Journals (Sweden)

    Ping An

    2007-06-01

    Full Text Available Human cyclophilin A, or CypA, encoded by the gene peptidyl prolyl isomerase A (PPIA, is incorporated into the HIV type 1 (HIV-1 virion and promotes HIV-1 infectivity by facilitating virus uncoating. We examined the effect of single nucleotide polymorphisms (SNPs and haplotypes within the PPIA gene on HIV-1 infection and disease progression in five HIV-1 longitudinal history cohorts. Kaplan-Meier survival statistics and Cox proportional hazards model were used to assess time to AIDS outcomes. Among eight SNPs tested, two promoter SNPs (SNP3 and SNP4 in perfect linkage disequilibrium were associated with more rapid CD4(+ T-cell loss (relative hazard = 3.7, p = 0.003 in African Americans. Among European Americans, these alleles were also associated with a significant trend to more rapid progression to AIDS in a multi-point categorical analysis (p = 0.005. Both SNPs showed differential nuclear protein-binding efficiencies in a gel shift assay. In addition, one SNP (SNP5 located in the 5' UTR previously shown to be associated with higher ex vivo HIV-1 replication was found to be more frequent in HIV-1-positive individuals than in those highly exposed uninfected individuals. These results implicate regulatory PPIA polymorphisms as a component of genetic susceptibility to HIV-1 infection or disease progression, affirming the important role of PPIA in HIV-1 pathogenesis.

  7. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  8. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

    Science.gov (United States)

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

    2011-01-01

    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  10. Creating and validating cis-regulatory maps of tissue-specific gene expression regulation

    Science.gov (United States)

    O'Connor, Timothy R.; Bailey, Timothy L.

    2014-01-01

    Predicting which genomic regions control the transcription of a given gene is a challenge. We present a novel computational approach for creating and validating maps that associate genomic regions (cis-regulatory modules–CRMs) with genes. The method infers regulatory relationships that explain gene expression observed in a test tissue using widely available genomic data for ‘other’ tissues. To predict the regulatory targets of a CRM, we use cross-tissue correlation between histone modifications present at the CRM and expression at genes within 1 Mbp of it. To validate cis-regulatory maps, we show that they yield more accurate models of gene expression than carefully constructed control maps. These gene expression models predict observed gene expression from transcription factor binding in the CRMs linked to that gene. We show that our maps are able to identify long-range regulatory interactions and improve substantially over maps linking genes and CRMs based on either the control maps or a ‘nearest neighbor’ heuristic. Our results also show that it is essential to include CRMs predicted in multiple tissues during map-building, that H3K27ac is the most informative histone modification, and that CAGE is the most informative measure of gene expression for creating cis-regulatory maps. PMID:25200088

  11. Identification and Functional Analysis of Gene Regulatory Sequences Interacting with Colorectal Tumor Suppressors

    DEFF Research Database (Denmark)

    Dahlgaard, Katja; Troelsen, Jesper

    2018-01-01

    Several tumor suppressors possess gene regulatory activity. Here, we describe how promoter and promoter/enhancer reporter assays can be used to characterize a colorectal tumor suppressor proteins’ gene regulatory activity of possible target genes. In the first part, a bioinformatic approach...... of the quick and efficient In-Fusion cloning method, and how to carry out transient transfections of Caco-2 colon cancer cells with the produced luciferase reporter plasmids using polyethyleneimine (PEI). A plan describing how to set up and carry out the luciferase expression assay is presented. The luciferase...... to identify relevant gene regulatory regions of potential target genes is presented. In the second part, it is demonstrated how to prepare and carry out the functional assay. We explain how to clone the bioinformatically identified gene regulatory regions into luciferase reporter plasmids by the use...

  12. Intervention in gene regulatory networks with maximal phenotype alteration.

    Science.gov (United States)

    Yousefi, Mohammadmahdi R; Dougherty, Edward R

    2013-07-15

    A basic issue for translational genomics is to model gene interaction via gene regulatory networks (GRNs) and thereby provide an informatics environment to study the effects of intervention (say, via drugs) and to derive effective intervention strategies. Taking the view that the phenotype is characterized by the long-run behavior (steady-state distribution) of the network, we desire interventions to optimally move the probability mass from undesirable to desirable states Heretofore, two external control approaches have been taken to shift the steady-state mass of a GRN: (i) use a user-defined cost function for which desirable shift of the steady-state mass is a by-product and (ii) use heuristics to design a greedy algorithm. Neither approach provides an optimal control policy relative to long-run behavior. We use a linear programming approach to optimally shift the steady-state mass from undesirable to desirable states, i.e. optimization is directly based on the amount of shift and therefore must outperform previously proposed methods. Moreover, the same basic linear programming structure is used for both unconstrained and constrained optimization, where in the latter case, constraints on the optimization limit the amount of mass that may be shifted to 'ambiguous' states, these being states that are not directly undesirable relative to the pathology of interest but which bear some perceived risk. We apply the method to probabilistic Boolean networks, but the theory applies to any Markovian GRN. Supplementary materials, including the simulation results, MATLAB source code and description of suboptimal methods are available at http://gsp.tamu.edu/Publications/supplementary/yousefi13b. edward@ece.tamu.edu Supplementary data are available at Bioinformatics online.

  13. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  14. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  15. Causality analysis detects the regulatory role of maternal effect genes in the early Drosophila embryo

    Directory of Open Access Journals (Sweden)

    Zara Ghodsi

    2017-03-01

    Full Text Available In developmental studies, inferring regulatory interactions of segmentation genetic network play a vital role in unveiling the mechanism of pattern formation. As such, there exists an opportune demand for theoretical developments and new mathematical models which can result in a more accurate illustration of this genetic network. Accordingly, this paper seeks to extract the meaningful regulatory role of the maternal effect genes using a variety of causality detection techniques and to explore whether these methods can suggest a new analytical view to the gene regulatory networks. We evaluate the use of three different powerful and widely-used models representing time and frequency domain Granger causality and convergent cross mapping technique with the results being thoroughly evaluated for statistical significance. Our findings show that the regulatory role of maternal effect genes is detectable in different time classes and thereby the method is applicable to infer the possible regulatory interactions present among the other genes of this network.

  16. Overlapping positive and negative regulatory domains of the human β-interferon gene

    International Nuclear Information System (INIS)

    Goodbourn, S.; Maniatis, T.

    1988-01-01

    Virus of poly(I) x poly(C) induction of human β-interferon gene expression requires a 40-base-pair DNA sequence designated the interferon gene regulatory element (IRE). Previous studies have shown that the IRE contains both positive and negative regulatory DNA sequences. To localize these sequences and study their interactions, the authors have examined the effects of a large number of single-base mutations within the IRE on β-interferon gene regulation. They find that the IRE consists of two genetically separable positive regulatory domains and an overlapping negative control sequence. They propose that the β-interferon gene is switched off in uninduced cells by a repressor that blocks the interaction between one of the two positive regulatory sequences and a specific transcription factor. Induction would then lead to inactivation or displacement of the repressor and binding of transcription factors to both positive regulatory domains

  17. Direct activation of EXPANSIN14 by LBD18 in the gene regulatory network of lateral root formation in Arabidopsis.

    Science.gov (United States)

    Kim, Jungmook; Lee, Han Woo

    2013-02-01

    Root system architecture is important for plants to adapt to a changing environment. The major determinant of the root system is lateral roots originating from the primary root. The developmental process of lateral root formation can be divided into priming, initiation, primordium development and the emergence of lateral roots, and is well characterized in Arabidopsis. The hormone auxin plays a critical role in lateral root development, and several auxin response modules involving AUXIN RESPONSE FACTORS (ARFs), transcriptional regulators of auxin-regulated genes and Aux/IAA, negative regulators of ARFs, regulate lateral root formation. The LATERAL ORGAN BOUNDARIES DOMAIN/ASYMMETRIC LEAVES2-LIKE (LBD/ASL) gene family encodes a unique class of transcription factors harbouring a conserved plant-specific lateral organ boundary domain and plays a role in lateral organ development of plants including lateral root formation. In our previous study, we showed that LBD18 stimulates lateral root formation in combination with LBD16 downstream of ARF7 and ARF19 during the auxin response. We have recently demonstrated that LBD18 activates expression of EXP14, a gene encoding the cell-wall loosening factor, by directly binding to the EXP14 promoter to promote lateral root emergence. Here we present the molecular function of LBD18 and its gene regulatory network during lateral root formation.

  18. Comparative analysis of chromatin landscape in regulatory regions of human housekeeping and tissue specific genes

    Directory of Open Access Journals (Sweden)

    Dasgupta Dipayan

    2005-05-01

    Full Text Available Abstract Background Global regulatory mechanisms involving chromatin assembly and remodelling in the promoter regions of genes is implicated in eukaryotic transcription control especially for genes subjected to spatial and temporal regulation. The potential to utilise global regulatory mechanisms for controlling gene expression might depend upon the architecture of the chromatin in and around the gene. In-silico analysis can yield important insights into this aspect, facilitating comparison of two or more classes of genes comprising of a large number of genes within each group. Results In the present study, we carried out a comparative analysis of chromatin characteristics in terms of the scaffold/matrix attachment regions, nucleosome formation potential and the occurrence of repetitive sequences, in the upstream regulatory regions of housekeeping and tissue specific genes. Our data show that putative scaffold/matrix attachment regions are more abundant and nucleosome formation potential is higher in the 5' regions of tissue specific genes as compared to the housekeeping genes. Conclusion The differences in the chromatin features between the two groups of genes indicate the involvement of chromatin organisation in the control of gene expression. The presence of global regulatory mechanisms mediated through chromatin organisation can decrease the burden of invoking gene specific regulators for maintenance of the active/silenced state of gene expression. This could partially explain the lower number of genes estimated in the human genome.

  19. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    Science.gov (United States)

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  20. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  1. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  2. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  3. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  4. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

    Science.gov (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

    2012-07-30

    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  5. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  6. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  7. The nomenclature of MHC class I gene regulatory regions - the case of two different downstream regulatory elements

    Czech Academy of Sciences Publication Activity Database

    Hatina, J.; Jansa, Petr; Forejt, Jiří

    2001-01-01

    Roč. 37, 12-13 (2001), s. 799-800 ISSN 0161-5890 Institutional research plan: CEZ:AV0Z5052915 Keywords : MHC I gene regulatory elements Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.973, year: 2001

  8. DMPD: Type I interferon [corrected] gene induction by the interferon regulatory factorfamily of transcription factors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16979567 Type I interferon [corrected] gene induction by the interferon regulatory factorfamily...ng) (.svg) (.html) (.csml) Show Type I interferon [corrected] gene induction by the interferon regulatory factorfamily...orrected] gene induction by the interferon regulatory factorfamily of transcription factors. Authors Honda K

  9. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  10. Targeted Resequencing and Functional Testing Identifies Low-Frequency Missense Variants in the Gene Encoding GARP as Significant Contributors to Atopic Dermatitis Risk.

    Science.gov (United States)

    Manz, Judith; Rodríguez, Elke; ElSharawy, Abdou; Oesau, Eva-Maria; Petersen, Britt-Sabina; Baurecht, Hansjörg; Mayr, Gabriele; Weber, Susanne; Harder, Jürgen; Reischl, Eva; Schwarz, Agatha; Novak, Natalija; Franke, Andre; Weidinger, Stephan

    2016-12-01

    Gene-mapping studies have consistently identified a susceptibility locus for atopic dermatitis and other inflammatory diseases on chromosome band 11q13.5, with the strongest association observed for a common variant located in an intergenic region between the two annotated genes C11orf30 and LRRC32. Using a targeted resequencing approach we identified low-frequency and rare missense mutations within the LRRC32 gene encoding the protein GARP, a receptor on activated regulatory T cells that binds latent transforming growth factor-β. Subsequent association testing in more than 2,000 atopic dermatitis patients and 2,000 control subjects showed a significant excess of these LRRC32 variants in individuals with atopic dermatitis. Structural protein modeling and bioinformatic analysis predicted a disruption of protein transport upon these variants, and overexpression assays in CD4 + CD25 - T cells showed a significant reduction in surface expression of the mutated protein. Consistently, flow cytometric (FACS) analyses of different T-cell subtypes obtained from atopic dermatitis patients showed a significantly reduced surface expression of GARP and a reduced conversion of CD4 + CD25 - T cells into regulatory T cells, along with lower expression of latency-associated protein upon stimulation in carriers of the LRRC32 A407T variant. These results link inherited disturbances of transforming growth factor-β signaling with atopic dermatitis risk. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  11. The Physiological and Biochemical Mechanisms Providing the Increased Constitutive Cold Resistance in the Potato Plants, Expressing the Yeast SUC2 Gene Encoding Apoplastic Invertase

    Directory of Open Access Journals (Sweden)

    A.N. Deryabin

    2016-05-01

    Full Text Available The expression of heterologous genes in plants is an effective method to improve our understanding of plant resistance mechanisms. The purpose of this work was to investigate the involvement of cell-wall invertase and apoplastic sugars into constitutive cold resistance of potato (Solanum tuberosum L., cv. Dйsirйe plants, which expressed the yeast SUC2 gene encoding apoplastic invertase. WT-plants of a potato served as the control. The increase in the essential cell-wall invertase activity in the leaves of transformed plants indicates significant changes in the cellular carbohydrate metabolism and regulatory function of this enzyme. The activity of yeast invertase changed the composition of intracellular sugars in the leaves of the transformed potato plant. The total content of sugars (sucrose, glucose, fructose in the leaves and apoplast was higher in the transformants, in comparison by WT-plants. Our data indicate higher constitutive resistance of transformants to severe hypothermia conditions compared to WT-plants. This fact allows us to consider cell-wall invertase as a enzyme of carbohydrate metabolism playing an important regulatory role in the metabolic signaling upon forming increased plant resistance to low temperature. Thus, the potato line with the integrated SUC2 gene is a convenient tool to study the role of the apoplastic invertase and the products of its activity during growth, development and formation constitutive resistance to hypothermia.

  12. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  13. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Science.gov (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  14. Mining Gene Regulatory Networks by Neural Modeling of Expression Time-Series.

    Science.gov (United States)

    Rubiolo, Mariano; Milone, Diego H; Stegmayer, Georgina

    2015-01-01

    Discovering gene regulatory networks from data is one of the most studied topics in recent years. Neural networks can be successfully used to infer an underlying gene network by modeling expression profiles as times series. This work proposes a novel method based on a pool of neural networks for obtaining a gene regulatory network from a gene expression dataset. They are used for modeling each possible interaction between pairs of genes in the dataset, and a set of mining rules is applied to accurately detect the subjacent relations among genes. The results obtained on artificial and real datasets confirm the method effectiveness for discovering regulatory networks from a proper modeling of the temporal dynamics of gene expression profiles.

  15. Inherited variants in regulatory T cell genes and outcome of ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Ellen L Goode

    Full Text Available Although ovarian cancer is the most lethal of gynecologic malignancies, wide variation in outcome following conventional therapy continues to exist. The presence of tumor-infiltrating regulatory T cells (Tregs has a role in outcome of this disease, and a growing body of data supports the existence of inherited prognostic factors. However, the role of inherited variants in genes encoding Treg-related immune molecules has not been fully explored. We analyzed expression quantitative trait loci (eQTL and sequence-based tagging single nucleotide polymorphisms (tagSNPs for 54 genes associated with Tregs in 3,662 invasive ovarian cancer cases. With adjustment for known prognostic factors, suggestive results were observed among rarer histological subtypes; poorer survival was associated with minor alleles at SNPs in RGS1 (clear cell, rs10921202, p=2.7×10(-5, LRRC32 and TNFRSF18/TNFRSF4 (mucinous, rs3781699, p=4.5×10(-4, and rs3753348, p=9.0×10(-4, respectively, and CD80 (endometrioid, rs13071247, p=8.0×10(-4. Fo0r the latter, correlative data support a CD80 rs13071247 genotype association with CD80 tumor RNA expression (p=0.006. An additional eQTL SNP in CD80 was associated with shorter survival (rs7804190, p=8.1×10(-4 among all cases combined. As the products of these genes are known to affect induction, trafficking, or immunosuppressive function of Tregs, these results suggest the need for follow-up phenotypic studies.

  16. Inherited variants in regulatory T cell genes and outcome of ovarian cancer.

    Science.gov (United States)

    Goode, Ellen L; DeRycke, Melissa; Kalli, Kimberly R; Oberg, Ann L; Cunningham, Julie M; Maurer, Matthew J; Fridley, Brooke L; Armasu, Sebastian M; Serie, Daniel J; Ramar, Priya; Goergen, Krista; Vierkant, Robert A; Rider, David N; Sicotte, Hugues; Wang, Chen; Winterhoff, Boris; Phelan, Catherine M; Schildkraut, Joellen M; Weber, Rachel P; Iversen, Ed; Berchuck, Andrew; Sutphen, Rebecca; Birrer, Michael J; Hampras, Shalaka; Preus, Leah; Gayther, Simon A; Ramus, Susan J; Wentzensen, Nicolas; Yang, Hannah P; Garcia-Closas, Montserrat; Song, Honglin; Tyrer, Jonathan; Pharoah, Paul P D; Konecny, Gottfried; Sellers, Thomas A; Ness, Roberta B; Sucheston, Lara E; Odunsi, Kunle; Hartmann, Lynn C; Moysich, Kirsten B; Knutson, Keith L

    2013-01-01

    Although ovarian cancer is the most lethal of gynecologic malignancies, wide variation in outcome following conventional therapy continues to exist. The presence of tumor-infiltrating regulatory T cells (Tregs) has a role in outcome of this disease, and a growing body of data supports the existence of inherited prognostic factors. However, the role of inherited variants in genes encoding Treg-related immune molecules has not been fully explored. We analyzed expression quantitative trait loci (eQTL) and sequence-based tagging single nucleotide polymorphisms (tagSNPs) for 54 genes associated with Tregs in 3,662 invasive ovarian cancer cases. With adjustment for known prognostic factors, suggestive results were observed among rarer histological subtypes; poorer survival was associated with minor alleles at SNPs in RGS1 (clear cell, rs10921202, p=2.7×10(-5)), LRRC32 and TNFRSF18/TNFRSF4 (mucinous, rs3781699, p=4.5×10(-4), and rs3753348, p=9.0×10(-4), respectively), and CD80 (endometrioid, rs13071247, p=8.0×10(-4)). Fo0r the latter, correlative data support a CD80 rs13071247 genotype association with CD80 tumor RNA expression (p=0.006). An additional eQTL SNP in CD80 was associated with shorter survival (rs7804190, p=8.1×10(-4)) among all cases combined. As the products of these genes are known to affect induction, trafficking, or immunosuppressive function of Tregs, these results suggest the need for follow-up phenotypic studies.

  17. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  18. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    Science.gov (United States)

    Gazestani, Vahid H; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  19. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  20. Inferring nonlinear gene regulatory networks from gene expression data based on distance correlation.

    Directory of Open Access Journals (Sweden)

    Xiaobo Guo

    Full Text Available Nonlinear dependence is general in regulation mechanism of gene regulatory networks (GRNs. It is vital to properly measure or test nonlinear dependence from real data for reconstructing GRNs and understanding the complex regulatory mechanisms within the cellular system. A recently developed measurement called the distance correlation (DC has been shown powerful and computationally effective in nonlinear dependence for many situations. In this work, we incorporate the DC into inferring GRNs from the gene expression data without any underling distribution assumptions. We propose three DC-based GRNs inference algorithms: CLR-DC, MRNET-DC and REL-DC, and then compare them with the mutual information (MI-based algorithms by analyzing two simulated data: benchmark GRNs from the DREAM challenge and GRNs generated by SynTReN network generator, and an experimentally determined SOS DNA repair network in Escherichia coli. According to both the receiver operator characteristic (ROC curve and the precision-recall (PR curve, our proposed algorithms significantly outperform the MI-based algorithms in GRNs inference.

  1. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  2. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  3. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  4. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  5. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  6. Large-scale modeling of condition-specific gene regulatory networks by information integration and inference.

    Science.gov (United States)

    Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner

    2014-12-01

    Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Human Retrotransposon Insertion Polymorphisms Are Associated with Health and Disease via Gene Regulatory Phenotypes

    Directory of Open Access Journals (Sweden)

    Lu Wang

    2017-08-01

    Full Text Available The human genome hosts several active families of transposable elements (TEs, including the Alu, LINE-1, and SVA retrotransposons that are mobilized via reverse transcription of RNA intermediates. We evaluated how insertion polymorphisms generated by human retrotransposon activity may be related to common health and disease phenotypes that have been previously interrogated through genome-wide association studies (GWAS. To address this question, we performed a genome-wide screen for retrotransposon polymorphism disease associations that are linked to TE induced gene regulatory changes. Our screen first identified polymorphic retrotransposon insertions found in linkage disequilibrium (LD with single nucleotide polymorphisms that were previously associated with common complex diseases by GWAS. We further narrowed this set of candidate disease associated retrotransposon polymorphisms by identifying insertions that are located within tissue-specific enhancer elements. We then performed expression quantitative trait loci analysis on the remaining set of candidates in order to identify polymorphic retrotransposon insertions that are associated with gene expression changes in B-cells of the human immune system. This progressive and stringent screen yielded a list of six retrotransposon insertions as the strongest candidates for TE polymorphisms that lead to disease via enhancer-mediated changes in gene regulation. For example, we found an SVA insertion within a cell-type specific enhancer located in the second intron of the B4GALT1 gene. B4GALT1 encodes a glycosyltransferase that functions in the glycosylation of the Immunoglobulin G (IgG antibody in such a way as to convert its activity from pro- to anti-inflammatory. The disruption of the B4GALT1 enhancer by the SVA insertion is associated with down-regulation of the gene in B-cells, which would serve to keep the IgG molecule in a pro-inflammatory state. Consistent with this idea, the B4GALT1 enhancer

  8. A Regulatory RNA Inducing Transgenerationally Inherited Phenotypes

    DEFF Research Database (Denmark)

    Jensen, Lea Møller

    . The variation in Arabidopsis enables different regulatory networks and mechanisms to shape the phenotypic characteristics. The thesis describes the identification of regulatory RNA encoded by an enzyme encoding gene. The RNA regulates by inducing transgenerationally inherited phenotypes. The function of the RNA...... is dependent on the genetic background illustrating that polymorphisms are found in either interactors or target genes of the RNA. Furthermore, the RNA provides a mechanistic link between accumulation of glucosinolate and onset of flowering....

  9. The Association between Infants' Self-Regulatory Behavior and MAOA Gene Polymorphism

    Science.gov (United States)

    Zhang, Minghao; Chen, Xinyin; Way, Niobe; Yoshikawa, Hirokazu; Deng, Huihua; Ke, Xiaoyan; Yu, Weiwei; Chen, Ping; He, Chuan; Chi, Xia; Lu, Zuhong

    2011-01-01

    Self-regulatory behavior in early childhood is an important characteristic that has considerable implications for the development of adaptive and maladaptive functioning. The present study investigated the relations between a functional polymorphism in the upstream region of monoamine oxidase A gene (MAOA) and self-regulatory behavior in a sample…

  10. A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul

    2005-01-05

    A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.

  11. An extended Kalman filtering approach to modeling nonlinear dynamic gene regulatory networks via short gene expression time series.

    Science.gov (United States)

    Wang, Zidong; Liu, Xiaohui; Liu, Yurong; Liang, Jinling; Vinciotti, Veronica

    2009-01-01

    In this paper, the extended Kalman filter (EKF) algorithm is applied to model the gene regulatory network from gene time series data. The gene regulatory network is considered as a nonlinear dynamic stochastic model that consists of the gene measurement equation and the gene regulation equation. After specifying the model structure, we apply the EKF algorithm for identifying both the model parameters and the actual value of gene expression levels. It is shown that the EKF algorithm is an online estimation algorithm that can identify a large number of parameters (including parameters of nonlinear functions) through iterative procedure by using a small number of observations. Four real-world gene expression data sets are employed to demonstrate the effectiveness of the EKF algorithm, and the obtained models are evaluated from the viewpoint of bioinformatics.

  12. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  13. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  14. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    Science.gov (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  15. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    International Nuclear Information System (INIS)

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin

    2008-01-01

    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy

  16. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    Science.gov (United States)

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  17. Comparative Bioinformatics Analysis of Transcription Factor Genes Indicates Conservation of Key Regulatory Domains among Babesia bovis, Babesia microti, and Theileria equi.

    Science.gov (United States)

    Alzan, Heba F; Knowles, Donald P; Suarez, Carlos E

    2016-11-01

    Apicomplexa tick-borne hemoparasites, including Babesia bovis, Babesia microti, and Theileria equi are responsible for bovine and human babesiosis and equine theileriosis, respectively. These parasites of vast medical, epidemiological, and economic impact have complex life cycles in their vertebrate and tick hosts. Large gaps in knowledge concerning the mechanisms used by these parasites for gene regulation remain. Regulatory genes coding for DNA binding proteins such as members of the Api-AP2, HMG, and Myb families are known to play crucial roles as transcription factors. Although the repertoire of Api-AP2 has been defined and a HMG gene was previously identified in the B. bovis genome, these regulatory genes have not been described in detail in B. microti and T. equi. In this study, comparative bioinformatics was used to: (i) identify and map genes encoding for these transcription factors among three parasites' genomes; (ii) identify a previously unreported HMG gene in B. microti; (iii) define a repertoire of eight conserved Myb genes; and (iv) identify AP2 correlates among B. bovis and the better-studied Plasmodium parasites. Searching the available transcriptome of B. bovis defined patterns of transcription of these three gene families in B. bovis erythrocyte stage parasites. Sequence comparisons show conservation of functional domains and general architecture in the AP2, Myb, and HMG proteins, which may be significant for the regulation of common critical parasite life cycle transitions in B. bovis, B. microti, and T. equi. A detailed understanding of the role of gene families encoding DNA binding proteins will provide new tools for unraveling regulatory mechanisms involved in B. bovis, B. microti, and T. equi life cycles and environmental adaptive responses and potentially contributes to the development of novel convergent strategies for improved control of babesiosis and equine piroplasmosis.

  18. Comparative Bioinformatics Analysis of Transcription Factor Genes Indicates Conservation of Key Regulatory Domains among Babesia bovis, Babesia microti, and Theileria equi.

    Directory of Open Access Journals (Sweden)

    Heba F Alzan

    2016-11-01

    Full Text Available Apicomplexa tick-borne hemoparasites, including Babesia bovis, Babesia microti, and Theileria equi are responsible for bovine and human babesiosis and equine theileriosis, respectively. These parasites of vast medical, epidemiological, and economic impact have complex life cycles in their vertebrate and tick hosts. Large gaps in knowledge concerning the mechanisms used by these parasites for gene regulation remain. Regulatory genes coding for DNA binding proteins such as members of the Api-AP2, HMG, and Myb families are known to play crucial roles as transcription factors. Although the repertoire of Api-AP2 has been defined and a HMG gene was previously identified in the B. bovis genome, these regulatory genes have not been described in detail in B. microti and T. equi. In this study, comparative bioinformatics was used to: (i identify and map genes encoding for these transcription factors among three parasites' genomes; (ii identify a previously unreported HMG gene in B. microti; (iii define a repertoire of eight conserved Myb genes; and (iv identify AP2 correlates among B. bovis and the better-studied Plasmodium parasites. Searching the available transcriptome of B. bovis defined patterns of transcription of these three gene families in B. bovis erythrocyte stage parasites. Sequence comparisons show conservation of functional domains and general architecture in the AP2, Myb, and HMG proteins, which may be significant for the regulation of common critical parasite life cycle transitions in B. bovis, B. microti, and T. equi. A detailed understanding of the role of gene families encoding DNA binding proteins will provide new tools for unraveling regulatory mechanisms involved in B. bovis, B. microti, and T. equi life cycles and environmental adaptive responses and potentially contributes to the development of novel convergent strategies for improved control of babesiosis and equine piroplasmosis.

  19. Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

    Science.gov (United States)

    Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

    2012-11-01

    Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

  20. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  1. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

    Science.gov (United States)

    Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

    2015-04-23

    With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

  2. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    Science.gov (United States)

    Lu, C.; Fedoroff, N.

    2000-01-01

    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  3. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    Science.gov (United States)

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  4. Integration of steady-state and temporal gene expression data for the inference of gene regulatory networks.

    Science.gov (United States)

    Wang, Yi Kan; Hurley, Daniel G; Schnell, Santiago; Print, Cristin G; Crampin, Edmund J

    2013-01-01

    We develop a new regression algorithm, cMIKANA, for inference of gene regulatory networks from combinations of steady-state and time-series gene expression data. Using simulated gene expression datasets to assess the accuracy of reconstructing gene regulatory networks, we show that steady-state and time-series data sets can successfully be combined to identify gene regulatory interactions using the new algorithm. Inferring gene networks from combined data sets was found to be advantageous when using noisy measurements collected with either lower sampling rates or a limited number of experimental replicates. We illustrate our method by applying it to a microarray gene expression dataset from human umbilical vein endothelial cells (HUVECs) which combines time series data from treatment with growth factor TNF and steady state data from siRNA knockdown treatments. Our results suggest that the combination of steady-state and time-series datasets may provide better prediction of RNA-to-RNA interactions, and may also reveal biological features that cannot be identified from dynamic or steady state information alone. Finally, we consider the experimental design of genomics experiments for gene regulatory network inference and show that network inference can be improved by incorporating steady-state measurements with time-series data.

  5. Transcription patterns of genes encoding four metallothionein homologs in Daphnia pulex exposed to copper and cadmium are time- and homolog-dependent

    International Nuclear Information System (INIS)

    Asselman, Jana; Shaw, Joseph R.; Glaholt, Stephen P.; Colbourne, John K.; De Schamphelaere, Karel A.C.

    2013-01-01

    Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species

  6. Transcription patterns of genes encoding four metallothionein homologs in Daphnia pulex exposed to copper and cadmium are time- and homolog-dependent

    Energy Technology Data Exchange (ETDEWEB)

    Asselman, Jana, E-mail: jana.asselman@ugent.be [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium); Shaw, Joseph R.; Glaholt, Stephen P. [The School of Public and Environmental Affairs, Indiana University, Bloomington, IN (United States); Colbourne, John K. [School of Biosciences, The University of Birmingham, Birmingham (United Kingdom); De Schamphelaere, Karel A.C. [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium)

    2013-10-15

    Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species.

  7. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  8. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  9. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  10. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  11. On the role of sparseness in the evolution of modularity in gene regulatory networks.

    Science.gov (United States)

    Espinosa-Soto, Carlos

    2018-05-01

    Modularity is a widespread property in biological systems. It implies that interactions occur mainly within groups of system elements. A modular arrangement facilitates adjustment of one module without perturbing the rest of the system. Therefore, modularity of developmental mechanisms is a major factor for evolvability, the potential to produce beneficial variation from random genetic change. Understanding how modularity evolves in gene regulatory networks, that create the distinct gene activity patterns that characterize different parts of an organism, is key to developmental and evolutionary biology. One hypothesis for the evolution of modules suggests that interactions between some sets of genes become maladaptive when selection favours additional gene activity patterns. The removal of such interactions by selection would result in the formation of modules. A second hypothesis suggests that modularity evolves in response to sparseness, the scarcity of interactions within a system. Here I simulate the evolution of gene regulatory networks and analyse diverse experimentally sustained networks to study the relationship between sparseness and modularity. My results suggest that sparseness alone is neither sufficient nor necessary to explain modularity in gene regulatory networks. However, sparseness amplifies the effects of forms of selection that, like selection for additional gene activity patterns, already produce an increase in modularity. That evolution of new gene activity patterns is frequent across evolution also supports that it is a major factor in the evolution of modularity. That sparseness is widespread across gene regulatory networks indicates that it may have facilitated the evolution of modules in a wide variety of cases.

  12. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  13. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  14. Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa.

    Science.gov (United States)

    Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz

    2013-08-30

    Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Amtyr1: characterization of a gene from honeybee (Apis mellifera) brain encoding a functional tyramine receptor.

    Science.gov (United States)

    Blenau, W; Balfanz, S; Baumann, A

    2000-03-01

    Biogenic amine receptors are involved in the regulation and modulation of various physiological and behavioral processes in both vertebrates and invertebrates. We have cloned a member of this gene family from the CNS of the honeybee, Apis mellifera. The deduced amino acid sequence is homologous to tyramine receptors cloned from Locusta migratoria and Drosophila melanogaster as well as to an octopamine receptor cloned from Heliothis virescens. Functional properties of the honeybee receptor were studied in stably transfected human embryonic kidney 293 cells. Tyramine reduced forskolin-induced cyclic AMP production in a dose-dependent manner with an EC50 of approximately 130 nM. A similar effect of tyramine was observed in membrane homogenates of honeybee brains. Octopamine also reduced cyclic AMP production in the transfected cell line but was both less potent (EC50 of approximately 3 microM) and less efficacious than tyramine. Receptor-encoding mRNA has a wide-spread distribution in the brain and subesophageal ganglion of the honeybee, suggesting that this tyramine receptor is involved in sensory signal processing as well as in higher-order brain functions.

  16. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  17. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  18. Rapid male-specific regulatory divergence and down regulation of spermatogenesis genes in Drosophila species hybrids.

    Directory of Open Access Journals (Sweden)

    Jennifer Ferguson

    Full Text Available In most crosses between closely related species of Drosophila, the male hybrids are sterile and show postmeiotic abnormalities. A series of gene expression studies using genomic approaches have found significant down regulation of postmeiotic spermatogenesis genes in sterile male hybrids. These results have led some to suggest a direct relationship between down regulation in gene expression and hybrid sterility. An alternative explanation to a cause-and-effect relationship between misregulation of gene expression and male sterility is rapid divergence of male sex regulatory elements leading to incompatible interactions in an interspecies hybrid genome. To test the effect of regulatory divergence in spermatogenesis gene expression, we isolated 35 fertile D. simulans strains with D. mauritiana introgressions in either the X, second or third chromosome. We analyzed gene expression in these fertile hybrid strains for a subset of spermatogenesis genes previously reported as significantly under expressed in sterile hybrids relative to D. simulans. We found that fertile autosomal introgressions can cause levels of gene down regulation similar to that of sterile hybrids. We also found that X chromosome heterospecific introgressions cause significantly less gene down regulation than autosomal introgressions. Our results provide evidence that rapid male sex gene regulatory divergence can explain misexpression of spermatogenesis genes in hybrids.

  19. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  20. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  1. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  2. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  3. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

  4. Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data.

    Science.gov (United States)

    Zhu, Mingzhu; Dahmen, Jeremy L; Stacey, Gary; Cheng, Jianlin

    2013-09-22

    High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments.

  5. Molecular characterization and expression analysis of three homoeologous Ta14S genes encoding 14-3-3 proteins in wheat (Triticum aestivum L.

    Directory of Open Access Journals (Sweden)

    Xinguo Wang

    2016-06-01

    Full Text Available The purpose of this study was to characterize Ta14S homoeologs and assess their functions in wheat seed development. The genomic and cDNA sequences of three Ta14S homoeologous genes encoding 14-3-3 proteins were isolated. Sequence analysis revealed that the three homoeologs consisted of five exons and four introns and were very highly conserved in the coding regions and in exon/intron structure, whereas the cDNA sequences were variable in the 5′ and 3′-UTR. The three genes, designated as Ta14S-2A, Ta14S-2B and Ta14S-2D, were located in homoeologous group 2 chromosomes. The polypeptide chains of the three Ta14S genes were highly similar. These genes were most homologous to Hv14A from barley. Real-time quantitative PCR indicated that the three Ta14S genes were differentially expressed in different organs at different developmental stages and all exhibited greater expression in primary roots of 1-day-old germlings than in other tissues. Comparison of the expression patterns of the three homoeologous genes at different times after pollination also revealed that their expression was developmentally regulated. The transcription of Ta14S-2B was clearly higher during seed germination, whereas expressions of Ta14S-2A and Ta14S-2D were up-regulated at the beginning of seed imbibition (0–12 h, but declined thereafter. The results suggested that the three Ta14S homoeologous genes have regulatory roles in seed development and germination.

  6. CoryneRegNet 4.0 – A reference database for corynebacterial gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Baumbach Jan

    2007-11-01

    Full Text Available Abstract Background Detailed information on DNA-binding transcription factors (the key players in the regulation of gene expression and on transcriptional regulatory interactions of microorganisms deduced from literature-derived knowledge, computer predictions and global DNA microarray hybridization experiments, has opened the way for the genome-wide analysis of transcriptional regulatory networks. The large-scale reconstruction of these networks allows the in silico analysis of cell behavior in response to changing environmental conditions. We previously published CoryneRegNet, an ontology-based data warehouse of corynebacterial transcription factors and regulatory networks. Initially, it was designed to provide methods for the analysis and visualization of the gene regulatory network of Corynebacterium glutamicum. Results Now we introduce CoryneRegNet release 4.0, which integrates data on the gene regulatory networks of 4 corynebacteria, 2 mycobacteria and the model organism Escherichia coli K12. As the previous versions, CoryneRegNet provides a web-based user interface to access the database content, to allow various queries, and to support the reconstruction, analysis and visualization of regulatory networks at different hierarchical levels. In this article, we present the further improved database content of CoryneRegNet along with novel analysis features. The network visualization feature GraphVis now allows the inter-species comparisons of reconstructed gene regulatory networks and the projection of gene expression levels onto that networks. Therefore, we added stimulon data directly into the database, but also provide Web Service access to the DNA microarray analysis platform EMMA. Additionally, CoryneRegNet now provides a SOAP based Web Service server, which can easily be consumed by other bioinformatics software systems. Stimulons (imported from the database, or uploaded by the user can be analyzed in the context of known

  7. In silico analysis of cis-acting regulatory elements in 5' regulatory regions of sucrose transporter gene families in rice (Oryza sativa Japonica) and Arabidopsis thaliana.

    Science.gov (United States)

    Ibraheem, Omodele; Botha, Christiaan E J; Bradley, Graeme

    2010-12-01

    The regulation of gene expression involves a multifarious regulatory system. Each gene contains a unique combination of cis-acting regulatory sequence elements in the 5' regulatory region that determines its temporal and spatial expression. Cis-acting regulatory elements are essential transcriptional gene regulatory units; they control many biological processes and stress responses. Thus a full understanding of the transcriptional gene regulation system will depend on successful functional analyses of cis-acting elements. Cis-acting regulatory elements present within the 5' regulatory region of the sucrose transporter gene families in rice (Oryza sativa Japonica cultivar-group) and Arabidopsis thaliana, were identified using a bioinformatics approach. The possible cis-acting regulatory elements were predicted by scanning 1.5kbp of 5' regulatory regions of the sucrose transporter genes translational start sites, using Plant CARE, PLACE and Genomatix Matinspector professional databases. Several cis-acting regulatory elements that are associated with plant development, plant hormonal regulation and stress response were identified, and were present in varying frequencies within the 1.5kbp of 5' regulatory region, among which are; A-box, RY, CAT, Pyrimidine-box, Sucrose-box, ABRE, ARF, ERE, GARE, Me-JA, ARE, DRE, GA-motif, GATA, GT-1, MYC, MYB, W-box, and I-box. This result reveals the probable cis-acting regulatory elements that possibly are involved in the expression and regulation of sucrose transporter gene families in rice and Arabidopsis thaliana during cellular development or environmental stress conditions. Copyright © 2010 Elsevier Ltd. All rights reserved.

  8. Translational Control of Host Gene Expression by a Cys-Motif Protein Encoded in a Bracovirus.

    Directory of Open Access Journals (Sweden)

    Eunseong Kim

    Full Text Available Translational control is a strategy that various viruses use to manipulate their hosts to suppress acute antiviral response. Polydnaviruses, a group of insect double-stranded DNA viruses symbiotic to some endoparasitoid wasps, are divided into two genera: ichnovirus (IV and bracovirus (BV. In IV, some Cys-motif genes are known as host translation-inhibitory factors (HTIF. The genome of endoparasitoid wasp Cotesia plutellae contains a Cys-motif gene (Cp-TSP13 homologous to an HTIF known as teratocyte-secretory protein 14 (TSP14 of Microplitis croceipes. Cp-TSP13 consists of 129 amino acid residues with a predicted molecular weight of 13.987 kDa and pI value of 7.928. Genomic DNA region encoding its open reading frame has three introns. Cp-TSP13 possesses six conserved cysteine residues as other Cys-motif genes functioning as HTIF. Cp-TSP13 was expressed in Plutella xylostella larvae parasitized by C. plutellae. C. plutellae bracovirus (CpBV was purified and injected into non-parasitized P. xylostella that expressed Cp-TSP13. Cp-TSP13 was cloned into a eukaryotic expression vector and used to infect Sf9 cells to transiently express Cp-TSP13. The synthesized Cp-TSP13 protein was detected in culture broth. An overlaying experiment showed that the purified Cp-TSP13 entered hemocytes. It was localized in the cytosol. Recombinant Cp-TSP13 significantly inhibited protein synthesis of secretory proteins when it was added to in vitro cultured fat body. In addition, the recombinant Cp-TSP13 directly inhibited the translation of fat body mRNAs in in vitro translation assay using rabbit reticulocyte lysate. Moreover, the recombinant Cp-TSP13 significantly suppressed cellular immune responses by inhibiting hemocyte-spreading behavior. It also exhibited significant insecticidal activities by both injection and feeding routes. These results indicate that Cp-TSP13 is a viral HTIF.

  9. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  10. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  11. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  12. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  13. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

    2002-01-01

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  14. On the Interplay between Entropy and Robustness of Gene Regulatory Networks

    Directory of Open Access Journals (Sweden)

    Bor-Sen Chen

    2010-05-01

    Full Text Available The interplay between entropy and robustness of gene network is a core mechanism of systems biology. The entropy is a measure of randomness or disorder of a physical system due to random parameter fluctuation and environmental noises in gene regulatory networks. The robustness of a gene regulatory network, which can be measured as the ability to tolerate the random parameter fluctuation and to attenuate the effect of environmental noise, will be discussed from the robust H∞ stabilization and filtering perspective. In this review, we will also discuss their balancing roles in evolution and potential applications in systems and synthetic biology.

  15. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  16. Two potential hookworm DAF-16 target genes, SNR-3 and LPP-1: gene structure, expression profile, and implications of a cis-regulatory element in the regulation of gene expression.

    Science.gov (United States)

    Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M

    2015-01-08

    elements. Aca-snr-3 encodes a core small nuclear ribonucleoprotein, and Aca-lpp-1 encodes a lipid phosphate phosphohydrolase. Expression of both genes peaked at the late L4 stage, suggesting a role in L4 development. The 3'-terminal genomic fragment of the snr-3 gene displayed Ac-DAF-16-dependent cis-regulatory activity.

  17. Medusa structure of the gene regulatory network: dominance of transcription factors in cancer subtype classification.

    Science.gov (United States)

    Guo, Yuchun; Feng, Ying; Trivedi, Niraj S; Huang, Sui

    2011-05-01

    Gene expression profiles consisting of ten thousands of transcripts are used for clustering of tissue, such as tumors, into subtypes, often without considering the underlying reason that the distinct patterns of expression arise because of constraints in the realization of gene expression profiles imposed by the gene regulatory network. The topology of this network has been suggested to consist of a regulatory core of genes represented most prominently by transcription factors (TFs) and microRNAs, that influence the expression of other genes, and of a periphery of 'enslaved' effector genes that are regulated but not regulating. This 'medusa' architecture implies that the core genes are much stronger determinants of the realized gene expression profiles. To test this hypothesis, we examined the clustering of gene expression profiles into known tumor types to quantitatively demonstrate that TFs, and even more pronounced, microRNAs, are much stronger discriminators of tumor type specific gene expression patterns than a same number of randomly selected or metabolic genes. These findings lend support to the hypothesis of a medusa architecture and of the canalizing nature of regulation by microRNAs. They also reveal the degree of freedom for the expression of peripheral genes that are less stringently associated with a tissue type specific global gene expression profile.

  18. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  19. Gene expression of a two-component regulatory system associated with sunscreen biosynthesis in the cyanobacterium Nostoc punctiforme ATCC 29133.

    Science.gov (United States)

    Janssen, Jacob; Soule, Tanya

    2016-01-01

    Long-wavelength ultraviolet radiation (UVA) can damage cells through photooxidative stress, leading to harmful photosensitized proteins and pigments in cyanobacteria. To mitigate damage, some cyanobacteria secrete the UVA-absorbing pigment scytonemin into their extracellular sheath. Comparative genomic analyses suggest that scytonemin biosynthesis is regulated by the two-component regulatory system (TCRS) proteins encoded by Npun_F1277 and Npun_F1278 in the cyanobacterium Nostoc punctiforme ATCC 29133. To understand the dynamics of these genes, their expression was measured following exposure to UVA, UVB, high visible (VIS) irradiance and oxidative stress for 20, 40 and 60 min. Overall, both genes had statistically similar patterns of expression for all four conditions and were generally upregulated, except for those exposed to UVB by 60 min and for the cells under oxidative stress. The greatest UVA response was an upregulation by 20 min, while the response to UVB was the most dramatic and persisted through 40 min. High VIS irradiance resulted in a modest upregulation, while oxidative stress caused a slight downregulation. Both genes were also found to occur on the same transcript. These results demonstrate that these genes are positively responding to several light-associated conditions, which suggests that this TCRS may regulate more than just scytonemin biosynthesis under UVA stress. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. A guide to approaching regulatory considerations for lentiviral-mediated gene therapies.

    Science.gov (United States)

    White, Michael; Whittaker, Roger; Stoll, Elizabeth Ann

    2017-06-12

    Lentiviral vectors are increasingly the gene transfer tool of choice for gene or cell therapies, with multiple clinical investigations showing promise for this viral vector in terms of both safety and efficacy. The third-generation vector system is well-characterized, effectively delivers genetic material and maintains long-term stable expression in target cells, delivers larger amounts of genetic material than other methods, is non-pathogenic and does not cause an inflammatory response in the recipient. This report aims to help academic scientists and regulatory managers negotiate the governance framework to achieve successful translation of a lentiviral vector-based gene therapy. The focus is on European regulations, and how they are administered in the United Kingdom, although many of the principles will be similar for other regions including the United States. The report justifies the rationale for using third-generation lentiviral vectors to achieve gene delivery for in vivo and ex vivo applications; briefly summarises the extant regulatory guidance for gene therapies, categorised as advanced therapeutic medicinal products (ATMPs); provides guidance on specific regulatory issues regarding gene therapies; presents an overview of the key stakeholders to be approached when pursuing clinical trials authorization for an ATMP; and includes a brief catalogue of the documentation required to submit an application for regulatory approval of a new gene therapy.

  1. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  2. A systems level approach reveals new gene regulatory modules in the developing ear

    OpenAIRE

    Chen, Jingchen; Tambalo, Monica; Barembaum, Meyer; Ranganathan, Ramya; Simões-Costa, Marcos; Bronner, Marianne E.; Streit, Andrea

    2017-01-01

    The inner ear is a complex vertebrate sense organ, yet it arises from a simple epithelium, the otic placode. Specification towards otic fate requires diverse signals and transcriptional inputs that act sequentially and/or in parallel. Using the chick embryo, we uncover novel genes in the gene regulatory network underlying otic commitment and reveal dynamic changes in gene expression. Functional analysis of selected transcription factors reveals the genetic hierarchy underlying the transition ...

  3. Inference of gene regulatory networks with sparse structural equation models exploiting genetic perturbations.

    Directory of Open Access Journals (Sweden)

    Xiaodong Cai

    Full Text Available Integrating genetic perturbations with gene expression data not only improves accuracy of regulatory network topology inference, but also enables learning of causal regulatory relations between genes. Although a number of methods have been developed to integrate both types of data, the desiderata of efficient and powerful algorithms still remains. In this paper, sparse structural equation models (SEMs are employed to integrate both gene expression data and cis-expression quantitative trait loci (cis-eQTL, for modeling gene regulatory networks in accordance with biological evidence about genes regulating or being regulated by a small number of genes. A systematic inference method named sparsity-aware maximum likelihood (SML is developed for SEM estimation. Using simulated directed acyclic or cyclic networks, the SML performance is compared with that of two state-of-the-art algorithms: the adaptive Lasso (AL based scheme, and the QTL-directed dependency graph (QDG method. Computer simulations demonstrate that the novel SML algorithm offers significantly better performance than the AL-based and QDG algorithms across all sample sizes from 100 to 1,000, in terms of detection power and false discovery rate, in all the cases tested that include acyclic or cyclic networks of 10, 30 and 300 genes. The SML method is further applied to infer a network of 39 human genes that are related to the immune function and are chosen to have a reliable eQTL per gene. The resulting network consists of 9 genes and 13 edges. Most of the edges represent interactions reasonably expected from experimental evidence, while the remaining may just indicate the emergence of new interactions. The sparse SEM and efficient SML algorithm provide an effective means of exploiting both gene expression and perturbation data to infer gene regulatory networks. An open-source computer program implementing the SML algorithm is freely available upon request.

  4. The Down regulated in Adenoma (dra) gene encodes an intestine-specific membrane sulfate transport protein.

    Science.gov (United States)

    Silberg, D G; Wang, W; Moseley, R H; Traber, P G

    1995-05-19

    A gene has been described, Down Regulated in Adenoma (dra), which is expressed in normal colon but is absent in the majority of colon adenomas and adenocarcinomas. However, the function of this protein is unknown. Because of sequence similarity to a recently cloned membrane sulfate transporter in rat liver, the transport function of Dra was examined. We established that dra encodes for a Na(+)-independent transporter for both sulfate and oxalate using microinjected Xenopus oocytes as an assay system. Sulfate transport was sensitive to the anion exchange inhibitor DIDS (4,4'-diisothiocyano-2,2' disulfonic acid stilbene). Using an RNase protection assay, we found that dra mRNA expression is limited to the small intestine and colon in mouse, therefore identifying Dra as an intestine-specific sulfate transporter. dra also had a unique pattern of expression during intestinal development. Northern blot analysis revealed a low level of expression in colon at birth with a marked increase in the first 2 postnatal weeks. In contrast, there was a lower, constant level of expression in small intestine in the postnatal period. Caco-2 cells, a colon carcinoma cell line that differentiates over time in culture, demonstrated a marked induction of dra mRNA as cells progressed from the preconfluent (undifferentiated) to the postconfluent (differentiated) state. These results show that Dra is an intestine-specific Na(+)-independent sulfate transporter that has differential expression during colonic development. This functional characterization provides the foundation for investigation of the role of Dra in intestinal sulfate transport and in the malignant phenotype.

  5. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  6. Engineering drought tolerant tomato plants over-expressing BcZAT12 gene encoding a C₂H₂ zinc finger transcription factor.

    Science.gov (United States)

    Rai, Avinash Chandra; Singh, Major; Shah, Kavita

    2013-01-01

    Efficient genetic transformation of cotyledonary explants of tomato (Solanum lycopersicum, cv. H-86, Kashi vishesh) was obtained. Disarmed Agrobacterium tumifaciens strain GV 3101 was used in conjugation with binary vector pBinAR containing a construct consisting of the coding sequence of the BcZAT12 gene under the regulatory control of the stress inducible Bclea1a promoter. ZAT12 encodes a C₂H₂ zinc finger protein which confers multiple abiotic stress tolerance to plants. Integration of ZAT12 gene into nuclear genome of individual kanamycin resistant transformed T₀ tomato lines was confirmed by Southern blot hybridization with segregation analysis of T(1) plants showing Mendelian inheritance of the transgene. Expression of ZAT12 in drought-stressed transformed tomato lines was verified in T₂ generation plants using RT-PCR. Of the six transformed tomato lines (ZT1-ZT6) the transformants ZT1 and ZT5 showed maximum expression of BcZAT12 gene transcripts when exposed to 7 days drought stress. Analysis of relative water content (RWC), electrolyte leakage (EL), chlorophyll colour index (CCI), H₂O₂ level and catalase activity suggested that tomato BcZAT12 transformants ZT1 and ZT5 have significantly increased levels of drought tolerance. These results suggest that BcZAT12 transformed tomato cv. H-86 has real potential for molecular breeding programs aimed at augmenting yield of tomato in regions affected with drought stress. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  8. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.

    1986-01-01

    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  9. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    Directory of Open Access Journals (Sweden)

    Shuchi eSmita

    2015-12-01

    Full Text Available MYB transcription factor (TF is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by top down and guide gene approaches. More than 50% of OsMYBs were strongly correlated under fifty experimental conditions with 51 hub genes via top down approach. Further, clusters were identified using Markov Clustering (MCL. To maximize the clustering performance, parameter evaluation of the MCL inflation score (I was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by guide gene approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought

  10. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  11. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  12. Cis-regulatory timers for developmental gene expression.

    Directory of Open Access Journals (Sweden)

    Lionel Christiaen

    2013-10-01

    Full Text Available How does a fertilized egg decode its own genome to eventually develop into a mature animal? Each developing cell must activate a battery of genes in a timely manner and according to the function it will ultimately perform, but how? During development of the notochord--a structure akin to the vertebrate spine--in a simple marine invertebrate, an essential protein called Brachyury binds to specific sites in its target genes. A study just published in PLOS Biology reports that if the target gene contains multiple Brachyury-binding sites it will be activated early in development but if it contains only one site it will be activated later. Genes that contain no binding site can still be activated by Brachyury, but only indirectly by an earlier Brachyury-dependent gene product, so later than the directly activated genes. Thus, this study shows how several genes can interpret the presence of a single factor differently to become active at distinct times in development.

  13. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Science.gov (United States)

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  14. Influence of the experimental design of gene expression studies on the inference of gene regulatory networks: environmental factors

    Directory of Open Access Journals (Sweden)

    Frank Emmert-Streib

    2013-02-01

    Full Text Available The inference of gene regulatory networks gained within recent years a considerable interest in the biology and biomedical community. The purpose of this paper is to investigate the influence that environmental conditions can exhibit on the inference performance of network inference algorithms. Specifically, we study five network inference methods, Aracne, BC3NET, CLR, C3NET and MRNET, and compare the results for three different conditions: (I observational gene expression data: normal environmental condition, (II interventional gene expression data: growth in rich media, (III interventional gene expression data: normal environmental condition interrupted by a positive spike-in stimulation. Overall, we find that different statistical inference methods lead to comparable, but condition-specific results. Further, our results suggest that non-steady-state data enhance the inferability of regulatory networks.

  15. Gene regulatory network inference by point-based Gaussian approximation filters incorporating the prior information.

    Science.gov (United States)

    Jia, Bin; Wang, Xiaodong

    2013-12-17

    : The extended Kalman filter (EKF) has been applied to inferring gene regulatory networks. However, it is well known that the EKF becomes less accurate when the system exhibits high nonlinearity. In addition, certain prior information about the gene regulatory network exists in practice, and no systematic approach has been developed to incorporate such prior information into the Kalman-type filter for inferring the structure of the gene regulatory network. In this paper, an inference framework based on point-based Gaussian approximation filters that can exploit the prior information is developed to solve the gene regulatory network inference problem. Different point-based Gaussian approximation filters, including the unscented Kalman filter (UKF), the third-degree cubature Kalman filter (CKF3), and the fifth-degree cubature Kalman filter (CKF5) are employed. Several types of network prior information, including the existing network structure information, sparsity assumption, and the range constraint of parameters, are considered, and the corresponding filters incorporating the prior information are developed. Experiments on a synthetic network of eight genes and the yeast protein synthesis network of five genes are carried out to demonstrate the performance of the proposed framework. The results show that the proposed methods provide more accurate inference results than existing methods, such as the EKF and the traditional UKF.

  16. Regulatory Considerations for Gene Therapy Products in the US, EU, and Japan.

    Science.gov (United States)

    Halioua-Haubold, Celine-Lea; Peyer, James G; Smith, James A; Arshad, Zeeshaan; Scholz, Matthew; Brindley, David A; MacLaren, Robert E

    2017-12-01

    Developers of gene therapy products (GTPs) must adhere to additional regulation beyond that of traditional small-molecule therapeutics, due to the unique mechanism-of-action of GTPs and the subsequent novel risks arisen. We have provided herein a summary of the regulatory structure under which GTPs fall in the United States, the European Union, and Japan, and a comprehensive overview of the regulatory guidance applicable to the developer of GTP. Understanding the regulatory requirements for seeking GTP market approval in these major jurisdictions is crucial for an effective and expedient path to market. The novel challenges facing GTP developers is highlighted by a case study of alipogene tiparvovec (Glybera).

  17. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  18. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  19. Biological data warehousing system for identifying transcriptional regulatory sites from gene expressions of microarray data.

    Science.gov (United States)

    Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine

    2006-07-01

    Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.

  20. Identifying noncoding risk variants using disease-relevant gene regulatory networks.

    Science.gov (United States)

    Gao, Long; Uzun, Yasin; Gao, Peng; He, Bing; Ma, Xiaoke; Wang, Jiahui; Han, Shizhong; Tan, Kai

    2018-02-16

    Identifying noncoding risk variants remains a challenging task. Because noncoding variants exert their effects in the context of a gene regulatory network (GRN), we hypothesize that explicit use of disease-relevant GRNs can significantly improve the inference accuracy of noncoding risk variants. We describe Annotation of Regulatory Variants using Integrated Networks (ARVIN), a general computational framework for predicting causal noncoding variants. It employs a set of novel regulatory network-based features, combined with sequence-based features to infer noncoding risk variants. Using known causal variants in gene promoters and enhancers in a number of diseases, we show ARVIN outperforms state-of-the-art methods that use sequence-based features alone. Additional experimental validation using reporter assay further demonstrates the accuracy of ARVIN. Application of ARVIN to seven autoimmune diseases provides a holistic view of the gene subnetwork perturbed by the combinatorial action of the entire set of risk noncoding mutations.

  1. Postinduction represssion of the β-interferon gene is mediated through two positive regulatory domains

    International Nuclear Information System (INIS)

    Whittemore, L.A.; Maniatis, T.

    1990-01-01

    Virus induction of the human β-interferon (β-IFN) gene results in an increase in the rate of β-IFN mRNA synthesis, followed by a rapid postinduction decrease. In this paper, the authors show that two β-IFN promoter elements, positive regulatory domains I and II (PRDI and PRDII), which are required for virus induction of the β-IFN gene are also required for the postinduction turnoff. Although protein synthesis is not necessary for activation, it is necessary for repression of these promoter elements. Examination of nuclear extracts from cells infected with virus reveals the presence of virus-inducible, cycloheximide-sensitive, DNA-binding activities that interact specifically with PRDI or PRDII. They propose that the postinduction repression of β-IFN gene transcription involves virus inducible repressors that either bind directly to the positive regulatory elements of the β-IFN promoter or inactivate the positive regulatory factors bound to PRDI and PRDII

  2. Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.

    Science.gov (United States)

    Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav

    2007-08-01

    Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.

  3. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  4. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    Energy Technology Data Exchange (ETDEWEB)

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  5. Feather development genes and associated regulatory innovation predate the origin of Dinosauria.

    Science.gov (United States)

    Lowe, Craig B; Clarke, Julia A; Baker, Allan J; Haussler, David; Edwards, Scott V

    2015-01-01

    The evolution of avian feathers has recently been illuminated by fossils and the identification of genes involved in feather patterning and morphogenesis. However, molecular studies have focused mainly on protein-coding genes. Using comparative genomics and more than 600,000 conserved regulatory elements, we show that patterns of genome evolution in the vicinity of feather genes are consistent with a major role for regulatory innovation in the evolution of feathers. Rates of innovation at feather regulatory elements exhibit an extended period of innovation with peaks in the ancestors of amniotes and archosaurs. We estimate that 86% of such regulatory elements and 100% of the nonkeratin feather gene set were present prior to the origin of Dinosauria. On the branch leading to modern birds, we detect a strong signal of regulatory innovation near insulin-like growth factor binding protein (IGFBP) 2 and IGFBP5, which have roles in body size reduction, and may represent a genomic signature for the miniaturization of dinosaurian body size preceding the origin of flight. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Challenges for modeling global gene regulatory networks during development: insights from Drosophila.

    Science.gov (United States)

    Wilczynski, Bartek; Furlong, Eileen E M

    2010-04-15

    Development is regulated by dynamic patterns of gene expression, which are orchestrated through the action of complex gene regulatory networks (GRNs). Substantial progress has been made in modeling transcriptional regulation in recent years, including qualitative "coarse-grain" models operating at the gene level to very "fine-grain" quantitative models operating at the biophysical "transcription factor-DNA level". Recent advances in genome-wide studies have revealed an enormous increase in the size and complexity or GRNs. Even relatively simple developmental processes can involve hundreds of regulatory molecules, with extensive interconnectivity and cooperative regulation. This leads to an explosion in the number of regulatory functions, effectively impeding Boolean-based qualitative modeling approaches. At the same time, the lack of information on the biophysical properties for the majority of transcription factors within a global network restricts quantitative approaches. In this review, we explore the current challenges in moving from modeling medium scale well-characterized networks to more poorly characterized global networks. We suggest to integrate coarse- and find-grain approaches to model gene regulatory networks in cis. We focus on two very well-studied examples from Drosophila, which likely represent typical developmental regulatory modules across metazoans. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  7. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  8. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  9. Effectively identifying regulatory hotspots while capturing expression heterogeneity in gene expression studies

    Science.gov (United States)

    2014-01-01

    Expression quantitative trait loci (eQTL) mapping is a tool that can systematically identify genetic variation affecting gene expression. eQTL mapping studies have shown that certain genomic locations, referred to as regulatory hotspots, may affect the expression levels of many genes. Recently, studies have shown that various confounding factors may induce spurious regulatory hotspots. Here, we introduce a novel statistical method that effectively eliminates spurious hotspots while retaining genuine hotspots. Applied to simulated and real datasets, we validate that our method achieves greater sensitivity while retaining low false discovery rates compared to previous methods. PMID:24708878

  10. Fractal gene regulatory networks for robust locomotion control of modular robots

    DEFF Research Database (Denmark)

    Zahadat, Payam; Christensen, David Johan; Schultz, Ulrik Pagh

    2010-01-01

    Designing controllers for modular robots is difficult due to the distributed and dynamic nature of the robots. In this paper fractal gene regulatory networks are evolved to control modular robots in a distributed way. Experiments with different morphologies of modular robot are performed and the ......Designing controllers for modular robots is difficult due to the distributed and dynamic nature of the robots. In this paper fractal gene regulatory networks are evolved to control modular robots in a distributed way. Experiments with different morphologies of modular robot are performed...

  11. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-03-05

    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  12. A lepidopteran-specific gene family encoding valine-rich midgut proteins.

    Directory of Open Access Journals (Sweden)

    Jothini Odman-Naresh

    Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran

  13. Harnessing diversity towards the reconstructing of large scale gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Takeshi Hase

    Full Text Available Elucidating gene regulatory network (GRN from large scale experimental data remains a central challenge in systems biology. Recently, numerous techniques, particularly consensus driven approaches combining different algorithms, have become a potentially promising strategy to infer accurate GRNs. Here, we develop a novel consensus inference algorithm, TopkNet that can integrate multiple algorithms to infer GRNs. Comprehensive performance benchmarking on a cloud computing framework demonstrated that (i a simple strategy to combine many algorithms does not always lead to performance improvement compared to the cost of consensus and (ii TopkNet integrating only high-performance algorithms provide significant performance improvement compared to the best individual algorithms and community prediction. These results suggest that a priori determination of high-performance algorithms is a key to reconstruct an unknown regulatory network. Similarity among gene-expression datasets can be useful to determine potential optimal algorithms for reconstruction of unknown regulatory networks, i.e., if expression-data associated with known regulatory network is similar to that with unknown regulatory network, optimal algorithms determined for the known regulatory network can be repurposed to infer the unknown regulatory network. Based on this observation, we developed a quantitative measure of similarity among gene-expression datasets and demonstrated that, if similarity between the two expression datasets is high, TopkNet integrating algorithms that are optimal for known dataset perform well on the unknown dataset. The consensus framework, TopkNet, together with the similarity measure proposed in this study provides a powerful strategy towards harnessing the wisdom of the crowds in reconstruction of unknown regulatory networks.

  14. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  15. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  16. Analysis of regulatory networks constructed based on gene ...

    Indian Academy of Sciences (India)

    2013-12-09

    Dec 9, 2013 ... early diagnosis of complex diseases or cancer without obvious symptoms. [Gong J., Diao B., Yao G. J., ... expression levels of thousands of genes in a specific cell or tissue. Previous ..... base of the brain. It mainly controls the ...

  17. The PAZAR database of gene regulatory information coupled to the ORCA toolkit for the study of regulatory sequences

    Science.gov (United States)

    Portales-Casamar, Elodie; Arenillas, David; Lim, Jonathan; Swanson, Magdalena I.; Jiang, Steven; McCallum, Anthony; Kirov, Stefan; Wasserman, Wyeth W.

    2009-01-01

    The PAZAR database unites independently created and maintained data collections of transcription factor and regulatory sequence annotation. The flexible PAZAR schema permits the representation of diverse information derived from experiments ranging from biochemical protein–DNA binding to cellular reporter gene assays. Data collections can be made available to the public, or restricted to specific system users. The data ‘boutiques’ within the shopping-mall-inspired system facilitate the analysis of genomics data and the creation of predictive models of gene regulation. Since its initial release, PAZAR has grown in terms of data, features and through the addition of an associated package of software tools called the ORCA toolkit (ORCAtk). ORCAtk allows users to rapidly develop analyses based on the information stored in the PAZAR system. PAZAR is available at http://www.pazar.info. ORCAtk can be accessed through convenient buttons located in the PAZAR pages or via our website at http://www.cisreg.ca/ORCAtk. PMID:18971253

  18. Identifying time-delayed gene regulatory networks via an evolvable hierarchical recurrent neural network.

    Science.gov (United States)

    Kordmahalleh, Mina Moradi; Sefidmazgi, Mohammad Gorji; Harrison, Scott H; Homaifar, Abdollah

    2017-01-01

    The modeling of genetic interactions within a cell is crucial for a basic understanding of physiology and for applied areas such as drug design. Interactions in gene regulatory networks (GRNs) include effects of transcription factors, repressors, small metabolites, and microRNA species. In addition, the effects of regulatory interactions are not always simultaneous, but can occur after a finite time delay, or as a combined outcome of simultaneous and time delayed interactions. Powerful biotechnologies have been rapidly and successfully measuring levels of genetic expression to illuminate different states of biological systems. This has led to an ensuing challenge to improve the identification of specific regulatory mechanisms through regulatory network reconstructions. Solutions to this challenge will ultimately help to spur forward efforts based on the usage of regulatory network reconstructions in systems biology applications. We have developed a hierarchical recurrent neural network (HRNN) that identifies time-delayed gene interactions using time-course data. A customized genetic algorithm (GA) was used to optimize hierarchical connectivity of regulatory genes and a target gene. The proposed design provides a non-fully connected network with the flexibility of using recurrent connections inside the network. These features and the non-linearity of the HRNN facilitate the process of identifying temporal patterns of a GRN. Our HRNN method was implemented with the Python language. It was first evaluated on simulated data representing linear and nonlinear time-delayed gene-gene interaction models across a range of network sizes and variances of noise. We then further demonstrated the capability of our method in reconstructing GRNs of the Saccharomyces cerevisiae synthetic network for in vivo benchmarking of reverse-engineering and modeling approaches (IRMA). We compared the performance of our method to TD-ARACNE, HCC-CLINDE, TSNI and ebdbNet across different network

  19. Design of Knowledge Bases for Plant Gene Regulatory Networks.

    Science.gov (United States)

    Mukundi, Eric; Gomez-Cano, Fabio; Ouma, Wilberforce Zachary; Grotewold, Erich

    2017-01-01

    Developing a knowledge base that contains all the information necessary for the researcher studying gene regulation in a particular organism can be accomplished in four stages. This begins with defining the data scope. We describe here the necessary information and resources, and outline the methods for obtaining data. The second stage consists of designing the schema, which involves defining the entire arrangement of the database in a systematic plan. The third stage is the implementation, defined by actualization of the database by using software according to a predefined schema. The final stage is development, where the database is made available to users in a web-accessible system. The result is a knowledgebase that integrates all the information pertaining to gene regulation, and which is easily expandable and transferable.

  20. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  1. Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

    Directory of Open Access Journals (Sweden)

    Moysés Elias-Neto

    2013-06-01

    Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

  2. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  3. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  4. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  5. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  6. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

    Science.gov (United States)

    Shukla, Avi; Chatterjee, Anirvan

    2018-01-01

    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  7. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  8. Genotet: An Interactive Web-based Visual Exploration Framework to Support Validation of Gene Regulatory Networks.

    Science.gov (United States)

    Yu, Bowen; Doraiswamy, Harish; Chen, Xi; Miraldi, Emily; Arrieta-Ortiz, Mario Luis; Hafemeister, Christoph; Madar, Aviv; Bonneau, Richard; Silva, Cláudio T

    2014-12-01

    Elucidation of transcriptional regulatory networks (TRNs) is a fundamental goal in biology, and one of the most important components of TRNs are transcription factors (TFs), proteins that specifically bind to gene promoter and enhancer regions to alter target gene expression patterns. Advances in genomic technologies as well as advances in computational biology have led to multiple large regulatory network models (directed networks) each with a large corpus of supporting data and gene-annotation. There are multiple possible biological motivations for exploring large regulatory network models, including: validating TF-target gene relationships, figuring out co-regulation patterns, and exploring the coordination of cell processes in response to changes in cell state or environment. Here we focus on queries aimed at validating regulatory network models, and on coordinating visualization of primary data and directed weighted gene regulatory networks. The large size of both the network models and the primary data can make such coordinated queries cumbersome with existing tools and, in particular, inhibits the sharing of results between collaborators. In this work, we develop and demonstrate a web-based framework for coordinating visualization and exploration of expression data (RNA-seq, microarray), network models and gene-binding data (ChIP-seq). Using specialized data structures and multiple coordinated views, we design an efficient querying model to support interactive analysis of the data. Finally, we show the effectiveness of our framework through case studies for the mouse immune system (a dataset focused on a subset of key cellular functions) and a model bacteria (a small genome with high data-completeness).

  9. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  10. Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

    Science.gov (United States)

    Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

    2012-08-01

    The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  11. Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.

    Science.gov (United States)

    Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C

    2014-03-07

    To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.

  12. Cooperative adaptive responses in gene regulatory networks with many degrees of freedom.

    Science.gov (United States)

    Inoue, Masayo; Kaneko, Kunihiko

    2013-04-01

    Cells generally adapt to environmental changes by first exhibiting an immediate response and then gradually returning to their original state to achieve homeostasis. Although simple network motifs consisting of a few genes have been shown to exhibit such adaptive dynamics, they do not reflect the complexity of real cells, where the expression of a large number of genes activates or represses other genes, permitting adaptive behaviors. Here, we investigated the responses of gene regulatory networks containing many genes that have undergone numerical evolution to achieve high fitness due to the adaptive response of only a single target gene; this single target gene responds to changes in external inputs and later returns to basal levels. Despite setting a single target, most genes showed adaptive responses after evolution. Such adaptive dynamics were not due to common motifs within a few genes; even without such motifs, almost all genes showed adaptation, albeit sometimes partial adaptation, in the sense that expression levels did not always return to original levels. The genes split into two groups: genes in the first group exhibited an initial increase in expression and then returned to basal levels, while genes in the second group exhibited the opposite changes in expression. From this model, genes in the first group received positive input from other genes within the first group, but negative input from genes in the second group, and vice versa. Thus, the adaptation dynamics of genes from both groups were consolidated. This cooperative adaptive behavior was commonly observed if the number of genes involved was larger than the order of ten. These results have implications in the collective responses of gene expression networks in microarray measurements of yeast Saccharomyces cerevisiae and the significance to the biological homeostasis of systems with many components.

  13. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  14. Multiple post-transcriptional regulatory mechanisms in ferritin gene expression

    International Nuclear Information System (INIS)

    Mattia, E.; Den Blaauwen, J.; Van Renswoude, J.; Ashwell, G.

    1989-01-01

    The authors have investigated the mechanisms involved in the regulation of ferritin biosynthesis in K562 human erythroleukemia cells during prolonged exposure to iron. They show that, upon addition of hemin (an efficient iron donor) to the cell culture, the rate of ferritin biosynthesis reaches a maximum after a few hours and then decreases. During a 24-hr incubation with the iron donor the concentrations of total ferritin heavy (H) and light (L) subunit mRNAs rise 2- to 5-fold and 2- to 3-fold, respectively, over the control values, while the amount of the protein increases 10- to 30-fold. The hemin-induced increment in ferritin subunit mRNA is not prevented by deferoxamine, suggesting that it is not directly mediated by chelatable iron. In vitro nuclear transcription analyses performed on nuclei isolated from control cells and cells grown in the presence of hemin indicate that the rates of synthesis of H- and L-subunit mRNAs remain constant. They conclude that iron-induced ferritin biosynthesis is governed by multiple post-transcriptional regulatory mechanisms. They propose that exposure of cells to iron leads to stabilization of ferritin mRNAs, in addition to activation and translation of stored H-and L-subunit mRNAs

  15. Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

    Science.gov (United States)

    Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

    2017-10-01

    Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

  16. Bottom-up GGM algorithm for constructing multiple layered hierarchical gene regulatory networks

    Science.gov (United States)

    Multilayered hierarchical gene regulatory networks (ML-hGRNs) are very important for understanding genetics regulation of biological pathways. However, there are currently no computational algorithms available for directly building ML-hGRNs that regulate biological pathways. A bottom-up graphic Gaus...

  17. Stage-dependent and temperature-controlled expression of the gene encoding the precursor protein of diapause hormone and pheromone biosynthesis activating neuropeptide in the silkworm, Bombyx mori.

    Science.gov (United States)

    Xu, W H; Sato, Y; Ikeda, M; Yamashita, O

    1995-02-24

    Embryonic diapause and sex pheromone biosynthesis in the silkworm, Bombyx mori, are, respectively, induced by diapause hormone (DH) and pheromone biosynthesis activating neuropeptide (PBAN), which are produced in the subesophageal ganglion from a common polyprotein precursor (DH-PBAN precursor) encoded by a single gene (DH-PBAN gene). Using DH-PBAN cDNA as a probe, we quantitatively measured DH-PBAN mRNA content throughout embryonic and postembryonic development and observed the effects of incubation temperature, which is a key factor for determination of diapause, on DH-PBAN gene expression. The silkworm, which is programmed to lay diapause eggs by being incubated at 25 degrees C, showed peaks of DH-PBAN mRNA content at five different stages throughout the life cycle: at the late embryonic stage, at the middle of the fourth and the fifth larval instars, and at early and late stages of pupal-adult development. In the non-diapause type silkworms programmed by a 15 degrees C incubation, only the last peak of DH-PBAN mRNA in pupal-adult development was found, and the other peaks were absent. Furthermore, interruption of the incubation period at 25 degrees C by incubation at 15 degrees C decreased both DH-PBAN mRNA content in mature embryos and in subesophageal ganglia of day 3 pupae and the incidence of diapause eggs. Thus, there were two types of regulatory mechanisms for DH-PBAN gene expression. One is a temperature-controlled expression that is responsible for diapause induction, and the other is a temperature-independent, stage-dependent expression related to pheromone production.

  18. A novel gene encoding xanthan lyase of Paenibacillus alginolyticus strain XL-1

    NARCIS (Netherlands)

    Ruijssenaars, H.J.; Hartmans, S.; Verdoes, J.C.

    2000-01-01

    Xanthan-modifying enzymes are powerful tools in studying structure-function relationships of this polysaccharide. One of these modifying enzymes is xanthan lyase, which removes the terminal side chain residue of xanthan. In this paper, the cloning and sequencing of the first xanthan lyase-encoding

  19. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  20. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

    Science.gov (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

    1993-09-15

    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  1. Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

    Science.gov (United States)

    Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

    2014-12-13

    The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

  2. A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

    Science.gov (United States)

    Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

    2002-07-01

    Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

  3. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  4. An approach for reduction of false predictions in reverse engineering of gene regulatory networks.

    Science.gov (United States)

    Khan, Abhinandan; Saha, Goutam; Pal, Rajat Kumar

    2018-05-14

    A gene regulatory network discloses the regulatory interactions amongst genes, at a particular condition of the human body. The accurate reconstruction of such networks from time-series genetic expression data using computational tools offers a stiff challenge for contemporary computer scientists. This is crucial to facilitate the understanding of the proper functioning of a living organism. Unfortunately, the computational methods produce many false predictions along with the correct predictions, which is unwanted. Investigations in the domain focus on the identification of as many correct regulations as possible in the reverse engineering of gene regulatory networks to make it more reliable and biologically relevant. One way to achieve this is to reduce the number of incorrect predictions in the reconstructed networks. In the present investigation, we have proposed a novel scheme to decrease the number of false predictions by suitably combining several metaheuristic techniques. We have implemented the same using a dataset ensemble approach (i.e. combining multiple datasets) also. We have employed the proposed methodology on real-world experimental datasets of the SOS DNA Repair network of Escherichia coli and the IMRA network of Saccharomyces cerevisiae. Subsequently, we have experimented upon somewhat larger, in silico networks, namely, DREAM3 and DREAM4 Challenge networks, and 15-gene and 20-gene networks extracted from the GeneNetWeaver database. To study the effect of multiple datasets on the quality of the inferred networks, we have used four datasets in each experiment. The obtained results are encouraging enough as the proposed methodology can reduce the number of false predictions significantly, without using any supplementary prior biological information for larger gene regulatory networks. It is also observed that if a small amount of prior biological information is incorporated here, the results improve further w.r.t. the prediction of true positives

  5. Comparison of Five Major Trichome Regulatory Genes in Brassica villosa with Orthologues within the Brassicaceae

    Science.gov (United States)

    Nayidu, Naghabushana K.; Kagale, Sateesh; Taheri, Ali; Withana-Gamage, Thushan S.; Parkin, Isobel A. P.; Sharpe, Andrew G.; Gruber, Margaret Y.

    2014-01-01

    Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1), GLABRA 2 (GL2), ENHANCER OF GLABRA 3 (EGL3), and TRANSPARENT TESTA GLABRA 1 (TTG1) and the negative regulator TRIPTYCHON (TRY), were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM) levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae. PMID:24755905

  6. Methods for the Isolation of Genes Encoding Novel PHA Metabolism Enzymes from Complex Microbial Communities.

    Science.gov (United States)

    Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C

    2017-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  7. Methods for the isolation of genes encoding novel PHB cycle enzymes from complex microbial communities.

    Science.gov (United States)

    Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C

    2010-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  8. The transcriptional and gene regulatory network of Lactococcus lactis MG1363 during growth in milk.

    Directory of Open Access Journals (Sweden)

    Anne de Jong

    Full Text Available In the present study we examine the changes in the expression of genes of Lactococcus lactis subspecies cremoris MG1363 during growth in milk. To reveal which specific classes of genes (pathways, operons, regulons, COGs are important, we performed a transcriptome time series experiment. Global analysis of gene expression over time showed that L. lactis adapted quickly to the environmental changes. Using upstream sequences of genes with correlated gene expression profiles, we uncovered a substantial number of putative DNA binding motifs that may be relevant for L. lactis fermentative growth in milk. All available novel and literature-derived data were integrated into network reconstruction building blocks, which were used to reconstruct and visualize the L. lactis gene regulatory network. This network enables easy mining in the chrono-transcriptomics data. A freely available website at http://milkts.molgenrug.nl gives full access to all transcriptome data, to the reconstructed network and to the individual network building blocks.

  9. Differentially expressed regulatory genes in honey bee caste development

    Science.gov (United States)

    Hepperle, C.; Hartfelder, K.

    2001-03-01

    In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

  10. PecS is an important player in the regulatory network governing the coordinated expression of virulence genes during the interaction between Dickeya dadantii 3937 and plants.

    Science.gov (United States)

    Mhedbi-Hajri, Nadia; Malfatti, Pierrette; Pédron, Jacques; Gaubert, Stéphane; Reverchon, Sylvie; Van Gijsegem, Frédérique

    2011-11-01

    Successful infection of a pathogen relies on the coordinated expression of numerous virulence factor-encoding genes. In plant-bacteria interactions, this control is very often achieved through the integration of several regulatory circuits controlling cell-cell communication or sensing environmental conditions. Dickeya dadantii (formerly Erwinia chrysanthemi), the causal agent of soft rot on many crops and ornamentals, provokes maceration of infected plants mainly by producing and secreting a battery of plant cell wall-degrading enzymes. However, several other virulence factors have also been characterized. During Arabidopsis infection, most D. dadantii virulence gene transcripts accumulated in a coordinated manner during infection. This activation requires a functional GacA-GacS two-component regulatory system but the Gac system is not involved in the growth phase dependence of virulence gene expression. Here we show that, contrary to Pectobacterium, the AHL-mediated ExpIR quorum-sensing system does not play a major role in the growth phase-dependent control of D. dadantii virulence genes. On the other hand, the global regulator PecS participates in this coordinated expression since, in a pecS mutant, an early activation of virulence genes is observed both in vitro and in planta. This correlated with the known hypervirulence phenotype of the pecS mutant. Analysis of the relationship between the regulatory circuits governed by the PecS and GacA global regulators indicates that these two regulators act independently. PecS prevents a premature expression of virulence genes in the first stages of colonization whereas GacA, presumably in conjunction with other regulators, is required for the activation of virulence genes at the onset of symptom occurrence. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  11. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi

    2013-12-01

    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  12. Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

    Science.gov (United States)

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

    2009-02-27

    All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  13. Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

    2015-12-01

    In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  14. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  15. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  16. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    Science.gov (United States)

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  17. Statistical identification of gene association by CID in application of constructing ER regulatory network

    Directory of Open Access Journals (Sweden)

    Lien Huang-Chun

    2009-03-01

    Full Text Available Abstract Background A variety of high-throughput techniques are now available for constructing comprehensive gene regulatory networks in systems biology. In this study, we report a new statistical approach for facilitating in silico inference of regulatory network structure. The new measure of association, coefficient of intrinsic dependence (CID, is model-free and can be applied to both continuous and categorical distributions. When given two variables X and Y, CID answers whether Y is dependent on X by examining the conditional distribution of Y given X. In this paper, we apply CID to analyze the regulatory relationships between transcription factors (TFs (X and their downstream genes (Y based on clinical data. More specifically, we use estrogen receptor α (ERα as the variable X, and the analyses are based on 48 clinical breast cancer gene expression arrays (48A. Results The analytical utility of CID was evaluated in comparison with four commonly used statistical methods, Galton-Pearson's correlation coefficient (GPCC, Student's t-test (STT, coefficient of determination (CoD, and mutual information (MI. When being compared to GPCC, CoD, and MI, CID reveals its preferential ability to discover the regulatory association where distribution of the mRNA expression levels on X and Y does not fit linear models. On the other hand, when CID is used to measure the association of a continuous variable (Y against a discrete variable (X, it shows similar performance as compared to STT, and appears to outperform CoD and MI. In addition, this study established a two-layer transcriptional regulatory network to exemplify the usage of CID, in combination with GPCC, in deciphering gene networks based on gene expression profiles from patient arrays. Conclusion CID is shown to provide useful information for identifying associations between genes and transcription factors of interest in patient arrays. When coupled with the relationships detected by GPCC, the

  18. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  19. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Causal structure of oscillations in gene regulatory networks: Boolean analysis of ordinary differential equation attractors.

    Science.gov (United States)

    Sun, Mengyang; Cheng, Xianrui; Socolar, Joshua E S

    2013-06-01

    A common approach to the modeling of gene regulatory networks is to represent activating or repressing interactions using ordinary differential equations for target gene concentrations that include Hill function dependences on regulator gene concentrations. An alternative formulation represents the same interactions using Boolean logic with time delays associated with each network link. We consider the attractors that emerge from the two types of models in the case of a simple but nontrivial network: a figure-8 network with one positive and one negative feedback loop. We show that the different modeling approaches give rise to the same qualitative set of attractors with the exception of a possible fixed point in the ordinary differential equation model in which concentrations sit at intermediate values. The properties of the attractors are most easily understood from the Boolean perspective, suggesting that time-delay Boolean modeling is a useful tool for understanding the logic of regulatory networks.

  1. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  2. Transcriptome of Atoh7 retinal progenitor cells identifies new Atoh7-dependent regulatory genes for retinal ganglion cell formation.

    Science.gov (United States)

    Gao, Zhiguang; Mao, Chai-An; Pan, Ping; Mu, Xiuqian; Klein, William H

    2014-11-01

    The bHLH transcription factor ATOH7 (Math5) is essential for establishing retinal ganglion cell (RGC) fate. However, Atoh7-expressing retinal progenitor cells (RPCs) can give rise to all retinal cell types, suggesting that other factors are involved in specifying RGCs. The basis by which a subpopulation of Atoh7-expressing RPCs commits to an RGC fate remains uncertain but is of critical importance to retinal development since RGCs are the earliest cell type to differentiate. To better understand the regulatory mechanisms leading to cell-fate specification, a binary genetic system was generated to specifically label Atoh7-expressing cells with green fluorescent protein (GFP). Fluorescence-activated cell sorting (FACS)-purified GFP(+) and GFP(-) cells were profiled by RNA-seq. Here, we identify 1497 transcripts that were differentially expressed between the two RPC populations. Pathway analysis revealed diminished growth factor signaling in Atoh7-expressing RPCs, indicating that these cells had exited the cell cycle. In contrast, axon guidance signals were enriched, suggesting that axons of Atoh7-expressing RPCs were already making synaptic connections. Notably, many genes enriched in Atoh7-expressing RPCs encoded transcriptional regulators, and several were direct targets of ATOH7, including, and unexpectedly, Ebf3 and Eya2. We present evidence for a Pax6-Atoh7-Eya2 pathway that acts downstream of Atoh7 but upstream of differentiation factor Pou4f2. EYA2 is a protein phosphatase involved in protein-protein interactions and posttranslational regulation. These properties, along with Eya2 as an early target gene of ATOH7, suggest that EYA2 functions in RGC specification. Our results expand current knowledge of the regulatory networks operating in Atoh7-expressing RPCs and offer new directions for exploring the earliest aspects of retinogenesis. © 2014 Wiley Periodicals, Inc.

  3. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  4. Expression of genes encoding F-1-ATPase results in uncoupling of glycolysis from biomass production in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Pedersen, M.B.

    2002-01-01

    of the genes encoding F-1-ATPase was found to decrease the intracellular energy level and resulted in a decrease in the growth rate. The yield of biomass also decreased, which showed that the incorporated F-1-ATPase activity caused glycolysis to be uncoupled from biomass production. The increase in ATPase...... threefold in nongrowing cells resuspended in buffer, but in steadily growing cells no increase in flux was observed. The latter result shows that glycolysis occurs close to its maximal capacity and indicates that control of the glycolytic flux under these conditions resides in the glycolytic reactions...

  5. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    ). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  6. An integer optimization algorithm for robust identification of non-linear gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Chemmangattuvalappil Nishanth

    2012-09-01

    Full Text Available Abstract Background Reverse engineering gene networks and identifying regulatory interactions are integral to understanding cellular decision making processes. Advancement in high throughput experimental techniques has initiated innovative data driven analysis of gene regulatory networks. However, inherent noise associated with biological systems requires numerous experimental replicates for reliable conclusions. Furthermore, evidence of robust algorithms directly exploiting basic biological traits are few. Such algorithms are expected to be efficient in their performance and robust in their prediction. Results We have developed a network identification algorithm to accurately infer both the topology and strength of regulatory interactions from time series gene expression data in the presence of significant experimental noise and non-linear behavior. In this novel formulism, we have addressed data variability in biological systems by integrating network identification with the bootstrap resampling technique, hence predicting robust interactions from limited experimental replicates subjected to noise. Furthermore, we have incorporated non-linearity in gene dynamics using the S-system formulation. The basic network identification formulation exploits the trait of sparsity of biological interactions. Towards that, the identification algorithm is formulated as an integer-programming problem by introducing binary variables for each network component. The objective function is targeted to minimize the network connections subjected to the constraint of maximal agreement between the experimental and predicted gene dynamics. The developed algorithm is validated using both in silico and experimental data-sets. These studies show that the algorithm can accurately predict the topology and connection strength of the in silico networks, as quantified by high precision and recall, and small discrepancy between the actual and predicted kinetic parameters

  7. Mutual information and the fidelity of response of gene regulatory models

    International Nuclear Information System (INIS)

    Tabbaa, Omar P; Jayaprakash, C

    2014-01-01

    We investigate cellular response to extracellular signals by using information theory techniques motivated by recent experiments. We present results for the steady state of the following gene regulatory models found in both prokaryotic and eukaryotic cells: a linear transcription-translation model and a positive or negative auto-regulatory model. We calculate both the information capacity and the mutual information exactly for simple models and approximately for the full model. We find that (1) small changes in mutual information can lead to potentially important changes in cellular response and (2) there are diminishing returns in the fidelity of response as the mutual information increases. We calculate the information capacity using Gillespie simulations of a model for the TNF-α-NF-κ B network and find good agreement with the measured value for an experimental realization of this network. Our results provide a quantitative understanding of the differences in cellular response when comparing experimentally measured mutual information values of different gene regulatory models. Our calculations demonstrate that Gillespie simulations can be used to compute the mutual information of more complex gene regulatory models, providing a potentially useful tool in synthetic biology. (paper)

  8. Construction of an integrated gene regulatory network link to stress-related immune system in cattle.

    Science.gov (United States)

    Behdani, Elham; Bakhtiarizadeh, Mohammad Reza

    2017-10-01

    The immune system is an important biological system that is negatively impacted by stress. This study constructed an integrated regulatory network to enhance our understanding of the regulatory gene network used in the stress-related immune system. Module inference was used to construct modules of co-expressed genes with bovine leukocyte RNA-Seq data. Transcription factors (TFs) were then assigned to these modules using Lemon-Tree algorithms. In addition, the TFs assigned to each module were confirmed using the promoter analysis and protein-protein interactions data. Therefore, our integrated method identified three TFs which include one TF that is previously known to be involved in immune response (MYBL2) and two TFs (E2F8 and FOXS1) that had not been recognized previously and were identified for the first time in this study as novel regulatory candidates in immune response. This study provides valuable insights on the regulatory programs of genes involved in the stress-related immune system.

  9. Analysis of a Gene Regulatory Cascade Mediating Circadian Rhythm in Zebrafish

    Science.gov (United States)

    Wang, Haifang; Du, Jiulin; Yan, Jun

    2013-01-01

    In the study of circadian rhythms, it has been a puzzle how a limited number of circadian clock genes can control diverse aspects of physiology. Here we investigate circadian gene expression genome-wide using larval zebrafish as a model system. We made use of a spatial gene expression atlas to investigate the expression of circadian genes in various tissues and cell types. Comparison of genome-wide circadian gene expression data between zebrafish and mouse revealed a nearly anti-phase relationship and allowed us to detect novel evolutionarily conserved circadian genes in vertebrates. We identified three groups of zebrafish genes with distinct responses to light entrainment: fast light-induced genes, slow light-induced genes, and dark-induced genes. Our computational analysis of the circadian gene regulatory network revealed several transcription factors (TFs) involved in diverse aspects of circadian physiology through transcriptional cascade. Of these, microphthalmia-associated transcription factor a (mitfa), a dark-induced TF, mediates a circadian rhythm of melanin synthesis, which may be involved in zebrafish's adaptation to daily light cycling. Our study describes a systematic method to discover previously unidentified TFs involved in circadian physiology in complex organisms. PMID:23468616

  10. Characterization of regulatory pathways in Xylella fastidiosa: genes and phenotypes controlled by algU.

    Science.gov (United States)

    Shi, Xiang Yang; Dumenyo, C Korsi; Hernandez-Martinez, Rufina; Azad, Hamid; Cooksey, Donald A

    2007-11-01

    Many virulence genes in plant bacterial pathogens are coordinately regulated by "global" regulatory genes. Conducting DNA microarray analysis of bacterial mutants of such genes, compared with the wild type, can help to refine the list of genes that may contribute to virulence in bacterial pathogens. The regulatory gene algU, with roles in stress response and regulation of the biosynthesis of the exopolysaccharide alginate in Pseudomonas aeruginosa and many other bacteria, has been extensively studied. The role of algU in Xylella fastidiosa, the cause of Pierce's disease of grapevines, was analyzed by mutation and whole-genome microarray analysis to define its involvement in aggregation, biofilm formation, and virulence. In this study, an algU::nptII mutant had reduced cell-cell aggregation, attachment, and biofilm formation and lower virulence in grapevines. Microarray analysis showed that 42 genes had significantly lower expression in the algU::nptII mutant than in the wild type. Among these are several genes that could contribute to cell aggregation and biofilm formation, as well as other physiological processes such as virulence, competition, and survival.

  11. Conserved gene regulatory module specifies lateral neural borders across bilaterians.

    Science.gov (United States)

    Li, Yongbin; Zhao, Di; Horie, Takeo; Chen, Geng; Bao, Hongcun; Chen, Siyu; Liu, Weihong; Horie, Ryoko; Liang, Tao; Dong, Biyu; Feng, Qianqian; Tao, Qinghua; Liu, Xiao

    2017-08-01

    The lateral neural plate border (NPB), the neural part of the vertebrate neural border, is composed of central nervous system (CNS) progenitors and peripheral nervous system (PNS) progenitors. In invertebrates, PNS progenitors are also juxtaposed to the lateral boundary of the CNS. Whether there are conserved molecular mechanisms determining vertebrate and invertebrate lateral neural borders remains unclear. Using single-cell-resolution gene-expression profiling and genetic analysis, we present evidence that orthologs of the NPB specification module specify the invertebrate lateral neural border, which is composed of CNS and PNS progenitors. First, like in vertebrates, the conserved neuroectoderm lateral border specifier Msx/vab-15 specifies lateral neuroblasts in Caenorhabditis elegans Second, orthologs of the vertebrate NPB specification module ( Msx/vab-15 , Pax3/7/pax-3 , and Zic/ref-2 ) are significantly enriched in worm lateral neuroblasts. In addition, like in other bilaterians, the expression domain of Msx/vab-15 is more lateral than those of Pax3/7/pax-3 and Zic/ref- 2 in C. elegans Third, we show that Msx/vab-15 regulates the development of mechanosensory neurons derived from lateral neural progenitors in multiple invertebrate species, including C. elegans , Drosophila melanogaster , and Ciona intestinalis We also identify a novel lateral neural border specifier, ZNF703/tlp-1 , which functions synergistically with Msx/vab- 15 in both C. elegans and Xenopus laevis These data suggest a common origin of the molecular mechanism specifying lateral neural borders across bilaterians.

  12. A Drosophila gene encoding a protein resembling the human β-amyloid protein precursor

    International Nuclear Information System (INIS)

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K.

    1989-01-01

    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human β-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human β-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development

  13. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  14. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

    Science.gov (United States)

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

    2018-01-01

    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

  15. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil.

    Science.gov (United States)

    Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso

    2017-12-18

    Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

  16. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  17. The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

    Science.gov (United States)

    Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

    2005-06-01

    Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

  18. Cloning and analysis of the genes encoding the type IIS restriction-modification system HphI from Haemophilus parahaemolyticus.

    Science.gov (United States)

    Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A

    1996-07-15

    The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.

  19. Identification of sparsely distributed clusters of cis-regulatory elements in sets of co-expressed genes

    OpenAIRE

    Kreiman, Gabriel

    2004-01-01

    Sequence information and high‐throughput methods to measure gene expression levels open the door to explore transcriptional regulation using computational tools. Combinatorial regulation and sparseness of regulatory elements throughout the genome allow organisms to control the spatial and temporal patterns of gene expression. Here we study the organization of cis‐regulatory elements in sets of co‐regulated genes. We build an algorithm to search for combinations of transcription factor binding...

  20. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang

    2008-01-01

    This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

  1. A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation.

    Science.gov (United States)

    Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S

    1996-01-01

    we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

  2. Thermal response of rat fibroblasts stably transfected with the human 70-kDa heat shock protein-encoding gene

    International Nuclear Information System (INIS)

    Li, G.C.; Li, Ligeng; Liu, Yunkang; Mak, J.Y.; Chen, Lili; Lee, W.M.F.

    1991-01-01

    The major heat shock protein hsp70 is synthesized by cells of a wide variety of organisms in response to heat shock or other environmental stresses and is assumed to play an important role in protecting cells from thermal stress. The authors have tested this hypothesis directly by transfecting a constitutively expressed recombinant human hsp70-encoding gene into rat fibroblasts and examining the relationship between the levels of human hsp70 expressed and thermal resistance of the stably transfected rat cells. Successful transfection and expression of the gene for human hsp70 were characterized by RNA hybridization analysis, low-dimensional gel electrophoresis, and immunoblot analysis. When individual cloned cell lines were exposed to 45C and their thermal survivals were determined by colony-formation assay, they found that the expression of human hsp70 conferred heat resistance to the rat cells. These results reinforce the hypothesis that hsp70 has a protective function against thermal stress

  3. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

    Science.gov (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

    2017-09-01

    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  4. Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

    International Nuclear Information System (INIS)

    Menaa, F.

    2003-12-01

    Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

  5. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

    2015-01-01

    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  6. Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

    Science.gov (United States)

    Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

    1988-01-01

    We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

  7. A comparative study of covariance selection models for the inference of gene regulatory networks.

    Science.gov (United States)

    Stifanelli, Patrizia F; Creanza, Teresa M; Anglani, Roberto; Liuzzi, Vania C; Mukherjee, Sayan; Schena, Francesco P; Ancona, Nicola

    2013-10-01

    The inference, or 'reverse-engineering', of gene regulatory networks from expression data and the description of the complex dependency structures among genes are open issues in modern molecular biology. In this paper we compared three regularized methods of covariance selection for the inference of gene regulatory networks, developed to circumvent the problems raising when the number of observations n is smaller than the number of genes p. The examined approaches provided three alternative estimates of the inverse covariance matrix: (a) the 'PINV' method is based on the Moore-Penrose pseudoinverse, (b) the 'RCM' method performs correlation between regression residuals and (c) 'ℓ(2C)' method maximizes a properly regularized log-likelihood function. Our extensive simulation studies showed that ℓ(2C) outperformed the other two methods having the most predictive partial correlation estimates and the highest values of sensitivity to infer conditional dependencies between genes even when a few number of observations was available. The application of this method for inferring gene networks of the isoprenoid biosynthesis pathways in Arabidopsis thaliana allowed to enlighten a negative partial correlation coefficient between the two hubs in the two isoprenoid pathways and, more importantly, provided an evidence of cross-talk between genes in the plastidial and the cytosolic pathways. When applied to gene expression data relative to a signature of HRAS oncogene in human cell cultures, the method revealed 9 genes (p-value<0.0005) directly interacting with HRAS, sharing the same Ras-responsive binding site for the transcription factor RREB1. This result suggests that the transcriptional activation of these genes is mediated by a common transcription factor downstream of Ras signaling. Software implementing the methods in the form of Matlab scripts are available at: http://users.ba.cnr.it/issia/iesina18/CovSelModelsCodes.zip. Copyright © 2013 The Authors. Published by

  8. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

    Science.gov (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

    2018-02-01

    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  9. The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

    Science.gov (United States)

    Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

    2005-05-15

    Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

  10. Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

    Directory of Open Access Journals (Sweden)

    Farré Domènec

    2007-12-01

    Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

  11. Evolutionary changes of Hox genes and relevant regulatory factors provide novel insights into mammalian morphological modifications.

    Science.gov (United States)

    Li, Kui; Sun, Xiaohui; Chen, Meixiu; Sun, Yingying; Tian, Ran; Wang, Zhengfei; Xu, Shixia; Yang, Guang

    2018-01-01

    The diversity of body plans of mammals accelerates the innovation of lifestyles and the extensive adaptation to different habitats, including terrestrial, aerial and aquatic habitats. However, the genetic basis of those phenotypic modifications, which have occurred during mammalian evolution, remains poorly explored. In the present study, we synthetically surveyed the evolutionary pattern of Hox clusters that played a powerful role in the morphogenesis along the head-tail axis of animal embryos and the main regulatory factors (Mll, Bmi1 and E2f6) that control the expression of Hox genes. A deflected density of repetitive elements and lineage-specific radical mutations of Mll have been determined in marine mammals with morphological changes, suggesting that evolutionary changes may alter Hox gene expression in these lineages, leading to the morphological modification of these lineages. Although no positive selection was detected at certain ancestor nodes of lineages, the increased ω values of Hox genes implied the relaxation of functional constraints of these genes during the mammalian evolutionary process. More importantly, 49 positively-selected sites were identified in mammalian lineages with phenotypic modifications, indicating adaptive evolution acting on Hox genes and regulatory factors. In addition, 3 parallel amino acid substitutions in some Hox genes were examined in marine mammals, which might be responsible for their streamlined body. © 2017 The Authors. Integrative Zoology published by International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

  12. DNA-binding site of major regulatory protein alpha 4 specifically associated with promoter-regulatory domains of alpha genes of herpes simplex virus type 1.

    OpenAIRE

    Kristie, T M; Roizman, B

    1986-01-01

    Herpes simplex virus type 1 genes form at least five groups (alpha, beta 1, beta 2, gamma 1, and gamma 2) whose expression is coordinately regulated and sequentially ordered in a cascade fashion. Previous studies have shown that functional alpha 4 gene product is essential for the transition from alpha to beta protein synthesis and have suggested that alpha 4 gene expression is autoregulatory. We have previously reported that labeled DNA fragments containing promoter-regulatory domains of thr...

  13. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  14. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    Directory of Open Access Journals (Sweden)

    Aaron E Walworth

    Full Text Available In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L., a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora', which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT. Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5 gene was down-regulated and associated with five other differentially expressed (DE genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2, a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5, and a VERNALIZATION1-like gene (VcVRN1, may function as integrators in place of FLOWERING LOCUS C (FLC in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1, LEAFY-like (VcLFY, APETALA1-like (VcAP1, CAULIFLOWER 1-like (VcCAL1, and FRUITFULL-like (VcFUL genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of

  15. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants

    Science.gov (United States)

    Walworth, Aaron E.; Chai, Benli; Song, Guo-qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all

  16. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    Science.gov (United States)

    Walworth, Aaron E; Chai, Benli; Song, Guo-Qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these

  17. A highly divergent gene cluster in honey bees encodes a novel silk family

    OpenAIRE

    Sutherland, Tara D.; Campbell, Peter M.; Weisman, Sarah; Trueman, Holly E.; Sriskantha, Alagacone; Wanjura, Wolfgang J.; Haritos, Victoria S.

    2006-01-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1–4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-r...

  18. The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

  19. Primary angle closure glaucoma (PACG) susceptibility gene PLEKHA7 encodes a novel Rac1/Cdc42 GAP that modulates cell migration and blood-aqueous barrier function.

    Science.gov (United States)

    Lee, Mei-Chin; Shei, William; Chan, Anita S; Chua, Boon-Tin; Goh, Shuang-Ru; Chong, Yaan-Fun; Hilmy, Maryam H; Nongpiur, Monisha E; Baskaran, Mani; Khor, Chiea-Chuen; Aung, Tin; Hunziker, Walter; Vithana, Eranga N

    2017-10-15

    PLEKHA7, a gene recently associated with primary angle closure glaucoma (PACG), encodes an apical junctional protein expressed in components of the blood aqueous barrier (BAB). We found that PLEKHA7 is down-regulated in lens epithelial cells and in iris tissue of PACG patients. PLEKHA7 expression also correlated with the C risk allele of the sentinel SNP rs11024102 with the risk allele carrier groups having significantly reduced PLEKHA7 levels compared to non-risk allele carriers. Silencing of PLEKHA7 in human immortalized non-pigmented ciliary epithelium (h-iNPCE) and primary trabecular meshwork cells, which are intimately linked to BAB and aqueous humor outflow respectively, affected actin cytoskeleton organization. PLEKHA7 specifically interacts with GTP-bound Rac1 and Cdc42, but not RhoA, and the activation status of the two small GTPases is linked to PLEKHA7 expression levels. PLEKHA7 stimulates Rac1 and Cdc42 GTP hydrolysis, without affecting nucleotide exchange, identifying PLEKHA7 as a novel Rac1/Cdc42 GAP. Consistent with the regulatory role of Rac1 and Cdc42 in maintaining the tight junction permeability, silencing of PLEKHA7 compromises the paracellular barrier between h-iNPCE cells. Thus, downregulation of PLEKHA7 in PACG may affect BAB integrity and aqueous humor outflow via its Rac1/Cdc42 GAP activity, thereby contributing to disease etiology. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. The SUD1 gene encodes a putative E3 ubiquitin ligase and is a positive regulator of 3-hydroxy-3-methylglutaryl coenzyme a reductase activity in Arabidopsis.

    Science.gov (United States)

    Doblas, Verónica G; Amorim-Silva, Vítor; Posé, David; Rosado, Abel; Esteban, Alicia; Arró, Montserrat; Azevedo, Herlander; Bombarely, Aureliano; Borsani, Omar; Valpuesta, Victoriano; Ferrer, Albert; Tavares, Rui M; Botella, Miguel A

    2013-02-01

    The 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) enzyme catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. In contrast with our extensive knowledge of the regulation of HMGR in yeast and animals, little is known about this process in plants. To identify regulatory components of the MVA pathway in plants, we performed a genetic screen for second-site suppressor mutations of the Arabidopsis thaliana highly drought-sensitive drought hypersensitive2 (dry2) mutant that shows decreased squalene epoxidase activity. We show that mutations in SUPPRESSOR OF DRY2 DEFECTS1 (SUD1) gene recover most developmental defects in dry2 through changes in HMGR activity. SUD1 encodes a putative E3 ubiquitin ligase that shows sequence and structural similarity to yeast Degradation of α factor (Doα10) and human TEB4, components of the endoplasmic reticulum-associated degradation C (ERAD-C) pathway. While in yeast and animals, the alternative ERAD-L/ERAD-M pathway regulates HMGR activity by controlling protein stability, SUD1 regulates HMGR activity without apparent changes in protein content. These results highlight similarities, as well as important mechanistic differences, among the components involved in HMGR regulation in plants, yeast, and animals.

  1. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  2. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway.

    Science.gov (United States)

    Bassler, B L; Wright, M; Silverman, M R

    1994-07-01

    Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.

  3. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-01-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

  4. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase