DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas
2013-09-01
GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
DEFF Research Database (Denmark)
Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner
2014-01-01
. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Cloning and bioinformatic analysis of lovastatin biosynthesis regulatory gene lovE.
Huang, Xin; Li, Hao-ming
2009-08-05
Lovastatin is an effective drug for treatment of hyperlipidemia. This study aimed to clone lovastatin biosynthesis regulatory gene lovE and analyze the structure and function of its encoding protein. According to the lovastatin synthase gene sequence from genebank, primers were designed to amplify and clone the lovastatin biosynthesis regulatory gene lovE from Aspergillus terrus genomic DNA. Bioinformatic analysis of lovE and its encoding animo acid sequence was performed through internet resources and software like DNAMAN. Target fragment lovE, almost 1500 bp in length, was amplified from Aspergillus terrus genomic DNA and the secondary and three-dimensional structures of LovE protein were predicted. In the lovastatin biosynthesis process lovE is a regulatory gene and LovE protein is a GAL4-like transcriptional factor.
Identification of functional elements and regulatory circuits by Drosophila modENCODE
Energy Technology Data Exchange (ETDEWEB)
Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis
2010-12-22
To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions
DEFF Research Database (Denmark)
Kalmykova, Alla I; Shevelyov, Yuri Y; Polesskaya, Oksana O
2002-01-01
An earlier described CK2(beta)tes gene of Drosophila melanogaster is shown to encode a male germline specific isoform of regulatory beta subunit of casein kinase 2. Western-analysis using anti-CK2(beta)tes Ig revealed CK2(beta)tes protein in Drosophila testes extract. Expression of a CK2(beta...... and coimmunoprecipitation analysis of protein extract from Drosophila testes, we demonstrated an association between CK2(beta)tes and CK2alpha. Northern-analysis has shown that another regulatory (beta') subunit found recently in D. melanogaster genome is also testis-specific. Thus, we describe the first example of two...
Identification of functional elements and regulatory circuits by Drosophila modENCODE.
Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L; Landolin, Jane M; Bristow, Christopher A; Ma, Lijia; Lin, Michael F; Washietl, Stefan; Arshinoff, Bradley I; Ay, Ferhat; Meyer, Patrick E; Robine, Nicolas; Washington, Nicole L; Di Stefano, Luisa; Berezikov, Eugene; Brown, Christopher D; Candeias, Rogerio; Carlson, Joseph W; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y; Will, Sebastian; Alekseyenko, Artyom A; Artieri, Carlo; Booth, Benjamin W; Brooks, Angela N; Dai, Qi; Davis, Carrie A; Duff, Michael O; Feng, Xin; Gorchakov, Andrey A; Gu, Tingting; Henikoff, Jorja G; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K; Riddle, Nicole C; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E; Schwartz, Yuri B; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E; Brent, Michael R; Cherbas, Lucy; Elgin, Sarah C R; Gingeras, Thomas R; Grossman, Robert; Hoskins, Roger A; Kaufman, Thomas C; Kent, William; Kuroda, Mitzi I; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J; Celniker, Susan E; Henikoff, Steven; Karpen, Gary H; Lai, Eric C; MacAlpine, David M; Stein, Lincoln D; White, Kevin P; Kellis, Manolis
2010-12-24
To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation.
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Directory of Open Access Journals (Sweden)
McCallion Andrew S
2009-01-01
Full Text Available Abstract Background Transcriptional regulatory elements are central to development and interspecific phenotypic variation. Current regulatory element prediction tools rely heavily upon conservation for prediction of putative elements. Recent in vitro observations from the ENCODE project combined with in vivo analyses at the zebrafish phox2b locus suggests that a significant fraction of regulatory elements may fall below commonly applied metrics of conservation. We propose to explore these observations in vivo at the human PHOX2B locus, and also evaluate the potential evidence for genome-wide applicability of these observations through a novel analysis of extant data. Results Transposon-based transgenic analysis utilizing a tiling path proximal to human PHOX2B in zebrafish recapitulates the observations at the zebrafish phox2b locus of both conserved and non-conserved regulatory elements. Analysis of human sequences conserved with previously identified zebrafish phox2b regulatory elements demonstrates that the orthologous sequences exhibit overlapping regulatory control. Additionally, analysis of non-conserved sequences scattered over 135 kb 5' to PHOX2B, provides evidence of non-conserved regulatory elements positively biased with close proximity to the gene. Furthermore, we provide a novel analysis of data from the ENCODE project, finding a non-uniform distribution of regulatory elements consistent with our in vivo observations at PHOX2B. These observations remain largely unchanged when one accounts for the sequence repeat content of the assayed intervals, when the intervals are sub-classified by biological role (developmental versus non-developmental, or by gene density (gene desert versus non-gene desert. Conclusion While regulatory elements frequently display evidence of evolutionary conservation, a fraction appears to be undetected by current metrics of conservation. In vivo observations at the PHOX2B locus, supported by our analyses of in
Predictive minimum description length principle approach to inferring gene regulatory networks.
Chaitankar, Vijender; Zhang, Chaoyang; Ghosh, Preetam; Gong, Ping; Perkins, Edward J; Deng, Youping
2011-01-01
Reverse engineering of gene regulatory networks using information theory models has received much attention due to its simplicity, low computational cost, and capability of inferring large networks. One of the major problems with information theory models is to determine the threshold that defines the regulatory relationships between genes. The minimum description length (MDL) principle has been implemented to overcome this problem. The description length of the MDL principle is the sum of model length and data encoding length. A user-specified fine tuning parameter is used as control mechanism between model and data encoding, but it is difficult to find the optimal parameter. In this work, we propose a new inference algorithm that incorporates mutual information (MI), conditional mutual information (CMI), and predictive minimum description length (PMDL) principle to infer gene regulatory networks from DNA microarray data. In this algorithm, the information theoretic quantities MI and CMI determine the regulatory relationships between genes and the PMDL principle method attempts to determine the best MI threshold without the need of a user-specified fine tuning parameter. The performance of the proposed algorithm is evaluated using both synthetic time series data sets and a biological time series data set (Saccharomyces cerevisiae). The results show that the proposed algorithm produced fewer false edges and significantly improved the precision when compared to existing MDL algorithm.
Directory of Open Access Journals (Sweden)
Richard A Jorgensen
2012-08-01
Full Text Available Upstream open reading frames (uORFs are common in eukaryotic transcripts, but those that encode conserved peptides (CPuORFs occur in less than 1% of transcripts. The peptides encoded by three plant CPuORF families are known to control translation of the downstream ORF in response to a small signal molecule (sucrose, polyamines and phosphocholine. In flowering plants, transcription factors are statistically over-represented among genes that possess CPuORFs, and in general it appeared that many CPuORF genes also had other regulatory functions, though the significance of this suggestion was uncertain (Hayden and Jorgensen, 2007. Five years later the literature provides much more information on the functions of many CPuORF genes. Here we reassess the functions of 27 known CPuORF gene families and find that 22 of these families play a variety of different regulatory roles, from transcriptional control to protein turnover, and from small signal molecules to signal transduction kinases. Clearly then, there is indeed a strong association of CPuORFs with regulatory genes. In addition, 16 of these families play key roles in a variety of different biological processes. Most strikingly, the core sucrose response network includes three different CPuORFs, creating the potential for sophisticated balancing of the network in response to three different molecular inputs. We propose that the function of most CPuORFs is to modulate translation of a downstream major ORF (mORF in response to a signal molecule recognized by the conserved peptide and that because the mORFs of CPuORF genes generally encode regulatory proteins, many of them centrally important in the biology of plants, CPuORFs play key roles in balancing such regulatory networks.
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
Automated Identification of Core Regulatory Genes in Human Gene Regulatory Networks.
Directory of Open Access Journals (Sweden)
Vipin Narang
Full Text Available Human gene regulatory networks (GRN can be difficult to interpret due to a tangle of edges interconnecting thousands of genes. We constructed a general human GRN from extensive transcription factor and microRNA target data obtained from public databases. In a subnetwork of this GRN that is active during estrogen stimulation of MCF-7 breast cancer cells, we benchmarked automated algorithms for identifying core regulatory genes (transcription factors and microRNAs. Among these algorithms, we identified K-core decomposition, pagerank and betweenness centrality algorithms as the most effective for discovering core regulatory genes in the network evaluated based on previously known roles of these genes in MCF-7 biology as well as in their ability to explain the up or down expression status of up to 70% of the remaining genes. Finally, we validated the use of K-core algorithm for organizing the GRN in an easier to interpret layered hierarchy where more influential regulatory genes percolate towards the inner layers. The integrated human gene and miRNA network and software used in this study are provided as supplementary materials (S1 Data accompanying this manuscript.
Mitchison, A
1997-01-01
In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.
Prioritization of gene regulatory interactions from large-scale modules in yeast
Directory of Open Access Journals (Sweden)
Bringas Ricardo
2008-01-01
Full Text Available Abstract Background The identification of groups of co-regulated genes and their transcription factors, called transcriptional modules, has been a focus of many studies about biological systems. While methods have been developed to derive numerous modules from genome-wide data, individual links between regulatory proteins and target genes still need experimental verification. In this work, we aim to prioritize regulator-target links within transcriptional modules based on three types of large-scale data sources. Results Starting with putative transcriptional modules from ChIP-chip data, we first derive modules in which target genes show both expression and function coherence. The most reliable regulatory links between transcription factors and target genes are established by identifying intersection of target genes in coherent modules for each enriched functional category. Using a combination of genome-wide yeast data in normal growth conditions and two different reference datasets, we show that our method predicts regulatory interactions with significantly higher predictive power than ChIP-chip binding data alone. A comparison with results from other studies highlights that our approach provides a reliable and complementary set of regulatory interactions. Based on our results, we can also identify functionally interacting target genes, for instance, a group of co-regulated proteins related to cell wall synthesis. Furthermore, we report novel conserved binding sites of a glycoprotein-encoding gene, CIS3, regulated by Swi6-Swi4 and Ndd1-Fkh2-Mcm1 complexes. Conclusion We provide a simple method to prioritize individual TF-gene interactions from large-scale transcriptional modules. In comparison with other published works, we predict a complementary set of regulatory interactions which yields a similar or higher prediction accuracy at the expense of sensitivity. Therefore, our method can serve as an alternative approach to prioritization for
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
Syndromes associated with Homo sapiens pol II regulatory genes.
Bina, M; Demmon, S; Pares-Matos, E I
2000-01-01
The molecular basis of human characteristics is an intriguing but an unresolved problem. Human characteristics cover a broad spectrum, from the obvious to the abstract. Obvious characteristics may include morphological features such as height, shape, and facial form. Abstract characteristics may be hidden in processes that are controlled by hormones and the human brain. In this review we examine exaggerated characteristics presented as syndromes. Specifically, we focus on human genes that encode transcription factors to examine morphological, immunological, and hormonal anomalies that result from deletion, insertion, or mutation of genes that regulate transcription by RNA polymerase II (the Pol II genes). A close analysis of abnormal phenotypes can give clues into how sequence variations in regulatory genes and changes in transcriptional control may give rise to characteristics defined as complex traits.
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
International Nuclear Information System (INIS)
Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.
2005-01-01
Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
A Regulatory RNA Inducing Transgenerationally Inherited Phenotypes
DEFF Research Database (Denmark)
Jensen, Lea Møller
. The variation in Arabidopsis enables different regulatory networks and mechanisms to shape the phenotypic characteristics. The thesis describes the identification of regulatory RNA encoded by an enzyme encoding gene. The RNA regulates by inducing transgenerationally inherited phenotypes. The function of the RNA...... is dependent on the genetic background illustrating that polymorphisms are found in either interactors or target genes of the RNA. Furthermore, the RNA provides a mechanistic link between accumulation of glucosinolate and onset of flowering....
Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.
Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L
2015-12-01
Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Overexpression of maize anthocyanin regulatory gene Lc affects rice fertility.
Li, Yuan; Zhang, Tao; Shen, Zhong-Wei; Xu, Yu; Li, Jian-Yue
2013-01-01
Seventeen independent transgenic rice plants with the maize anthocyanin regulatory gene Lc under control of the CaMV 35S promoter were obtained and verified by molecular identification. Ten plants showed red spikelets during early development of florets, and the degenerate florets were still red after heading. Additionally, these plants exhibited intense pigmentation on the surface of the anther and the bottom of the ovary. They were unable to properly bloom and were completely sterile. Following pollination with normal pollen, these plants yielded red caryopses but did not mature normally. QRT-PCR analysis indicated that mRNA accumulation of the CHS-like gene encoding a chalcone synthase-related protein was increased significantly in the sterile plant. This is the first report to suggest that upregulation of the CHS gene expression may result in rice sterility and affect the normal development of rice seeds.
Pavlogiannis, Andreas; Mozhayskiy, Vadim; Tagkopoulos, Ilias
2013-04-24
Biological networks tend to have high interconnectivity, complex topologies and multiple types of interactions. This renders difficult the identification of sub-networks that are involved in condition- specific responses. In addition, we generally lack scalable methods that can reveal the information flow in gene regulatory and biochemical pathways. Doing so will help us to identify key participants and paths under specific environmental and cellular context. This paper introduces the theory of network flooding, which aims to address the problem of network minimization and regulatory information flow in gene regulatory networks. Given a regulatory biological network, a set of source (input) nodes and optionally a set of sink (output) nodes, our task is to find (a) the minimal sub-network that encodes the regulatory program involving all input and output nodes and (b) the information flow from the source to the sink nodes of the network. Here, we describe a novel, scalable, network traversal algorithm and we assess its potential to achieve significant network size reduction in both synthetic and E. coli networks. Scalability and sensitivity analysis show that the proposed method scales well with the size of the network, and is robust to noise and missing data. The method of network flooding proves to be a useful, practical approach towards information flow analysis in gene regulatory networks. Further extension of the proposed theory has the potential to lead in a unifying framework for the simultaneous network minimization and information flow analysis across various "omics" levels.
Bajaj, V; Lucas, R L; Hwang, C; Lee, C A
1996-11-01
During infection of their hosts, salmonellae enter intestinal epithelial cells. It has been proposed that when Salmonella typhimurium is present in the intestinal lumen, several environmental and regulatory conditions modulate the expression of invasion factors required for bacterial entry into host cells. We report here that the expression of six different S. typhimurium invasion genes encoded on SPI1 (Salmonella pathogenicity island 1) is co-ordinately regulated by oxygen, osmolarity, pH, PhoPQ, and HilA. HilA is a transcriptional activator of the OmpR/ToxR family that is also encoded on SPI1. We have found that HilA plays a central role in the co-ordinated regulation of invasion genes by environmental and regulatory conditions. HilA can activate the expression of two invasion gene-lacZY fusions on reporter plasmids in Escherichia coll, suggesting that HilA acts directly at invasion-gene promoters in S. typhimurium. We have found that the regulation of invasion genes by oxygen, osmolarity, pH, and PhoPQ is indirect and is mediated by regulation of hilA expression by these environmental and regulatory factors. We hypothesize that the complex and co-ordinate regulation of Invasion genes by HilA is an important feature of salmonella pathogenesis and allows salmonellae to enter intestinal epithelial cells.
Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A
2009-12-30
Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements
2009-01-01
Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis
Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon
2013-01-01
The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Directory of Open Access Journals (Sweden)
Riana Cockeran
2014-01-01
Full Text Available Alterations in whole genome expression profiles following exposure of the pneumococcus (strain 172, serotype 23F to cigarette smoke condensate (160 μg/mL for 15 and 60 min have been determined using the TIGR4 DNA microarray chip. Exposure to CSC resulted in the significant (P<0.014–0.0006 upregulation of the genes encoding the two-component regulatory system 11 (TCS11, consisting of the sensor kinase, hk11, and its cognate response regulator, rr11, in the setting of increased biofilm formation. These effects of cigarette smoke on the pneumococcus may contribute to colonization of the airways by this microbial pathogen.
Directory of Open Access Journals (Sweden)
David H. Dreyfus
2017-01-01
Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.
Russo, Monia Teresa; Annunziata, Rossella; Sanges, Remo; Ferrante, Maria Immacolata; Falciatore, Angela
2015-12-01
Diatoms are a key phytoplankton group in the contemporary ocean, showing extraordinary adaptation capacities to rapidly changing environments. The recent availability of whole genome sequences from representative species has revealed distinct features in their genomes, like novel combinations of genes encoding distinct metabolisms and a significant number of diatom-specific genes. However, the regulatory mechanisms driving diatom gene expression are still largely uncharacterized. Considering the wide variety of fields of study orbiting diatoms, ranging from ecology, evolutionary biology to biotechnology, it is thus essential to increase our understanding of fundamental gene regulatory processes such as transcriptional regulation. To this aim, we explored the functional properties of the 5'-flanking region of the Phaeodatylum tricornutum Lhcf2 gene, encoding a member of the Light Harvesting Complex superfamily and we showed that this region enhances transcription of a GUS reporter gene in an orientation- and distance-independent fashion. This represents the first example of a cis-regulatory sequence with enhancer-like features discovered in diatoms and it is instrumental for the generation of novel genetic tools and diatom exploitation in different areas of study. Copyright © 2015 Elsevier B.V. All rights reserved.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Fang, Xin; Sastry, Anand; Mih, Nathan; Kim, Donghyuk; Tan, Justin; Lloyd, Colton J.; Gao, Ye; Yang, Laurence; Palsson, Bernhard O.
2017-01-01
Transcriptional regulatory networks (TRNs) have been studied intensely for >25 y. Yet, even for the Escherichia coli TRN—probably the best characterized TRN—several questions remain. Here, we address three questions: (i) How complete is our knowledge of the E. coli TRN; (ii) how well can we predict gene expression using this TRN; and (iii) how robust is our understanding of the TRN? First, we reconstructed a high-confidence TRN (hiTRN) consisting of 147 transcription factors (TFs) regulating 1,538 transcription units (TUs) encoding 1,764 genes. The 3,797 high-confidence regulatory interactions were collected from published, validated chromatin immunoprecipitation (ChIP) data and RegulonDB. For 21 different TF knockouts, up to 63% of the differentially expressed genes in the hiTRN were traced to the knocked-out TF through regulatory cascades. Second, we trained supervised machine learning algorithms to predict the expression of 1,364 TUs given TF activities using 441 samples. The algorithms accurately predicted condition-specific expression for 86% (1,174 of 1,364) of the TUs, while 193 TUs (14%) were predicted better than random TRNs. Third, we identified 10 regulatory modules whose definitions were robust against changes to the TRN or expression compendium. Using surrogate variable analysis, we also identified three unmodeled factors that systematically influenced gene expression. Our computational workflow comprehensively characterizes the predictive capabilities and systems-level functions of an organism’s TRN from disparate data types. PMID:28874552
International Nuclear Information System (INIS)
Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.
1987-01-01
A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene
Guo, Liyuan; Wang, Jing
2018-01-04
Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Prediction of regulatory gene pairs using dynamic time warping and gene ontology.
Yang, Andy C; Hsu, Hui-Huang; Lu, Ming-Da; Tseng, Vincent S; Shih, Timothy K
2014-01-01
Selecting informative genes is the most important task for data analysis on microarray gene expression data. In this work, we aim at identifying regulatory gene pairs from microarray gene expression data. However, microarray data often contain multiple missing expression values. Missing value imputation is thus needed before further processing for regulatory gene pairs becomes possible. We develop a novel approach to first impute missing values in microarray time series data by combining k-Nearest Neighbour (KNN), Dynamic Time Warping (DTW) and Gene Ontology (GO). After missing values are imputed, we then perform gene regulation prediction based on our proposed DTW-GO distance measurement of gene pairs. Experimental results show that our approach is more accurate when compared with existing missing value imputation methods on real microarray data sets. Furthermore, our approach can also discover more regulatory gene pairs that are known in the literature than other methods.
Alzan, Heba F; Knowles, Donald P; Suarez, Carlos E
2016-11-01
Apicomplexa tick-borne hemoparasites, including Babesia bovis, Babesia microti, and Theileria equi are responsible for bovine and human babesiosis and equine theileriosis, respectively. These parasites of vast medical, epidemiological, and economic impact have complex life cycles in their vertebrate and tick hosts. Large gaps in knowledge concerning the mechanisms used by these parasites for gene regulation remain. Regulatory genes coding for DNA binding proteins such as members of the Api-AP2, HMG, and Myb families are known to play crucial roles as transcription factors. Although the repertoire of Api-AP2 has been defined and a HMG gene was previously identified in the B. bovis genome, these regulatory genes have not been described in detail in B. microti and T. equi. In this study, comparative bioinformatics was used to: (i) identify and map genes encoding for these transcription factors among three parasites' genomes; (ii) identify a previously unreported HMG gene in B. microti; (iii) define a repertoire of eight conserved Myb genes; and (iv) identify AP2 correlates among B. bovis and the better-studied Plasmodium parasites. Searching the available transcriptome of B. bovis defined patterns of transcription of these three gene families in B. bovis erythrocyte stage parasites. Sequence comparisons show conservation of functional domains and general architecture in the AP2, Myb, and HMG proteins, which may be significant for the regulation of common critical parasite life cycle transitions in B. bovis, B. microti, and T. equi. A detailed understanding of the role of gene families encoding DNA binding proteins will provide new tools for unraveling regulatory mechanisms involved in B. bovis, B. microti, and T. equi life cycles and environmental adaptive responses and potentially contributes to the development of novel convergent strategies for improved control of babesiosis and equine piroplasmosis.
Directory of Open Access Journals (Sweden)
Heba F Alzan
2016-11-01
Full Text Available Apicomplexa tick-borne hemoparasites, including Babesia bovis, Babesia microti, and Theileria equi are responsible for bovine and human babesiosis and equine theileriosis, respectively. These parasites of vast medical, epidemiological, and economic impact have complex life cycles in their vertebrate and tick hosts. Large gaps in knowledge concerning the mechanisms used by these parasites for gene regulation remain. Regulatory genes coding for DNA binding proteins such as members of the Api-AP2, HMG, and Myb families are known to play crucial roles as transcription factors. Although the repertoire of Api-AP2 has been defined and a HMG gene was previously identified in the B. bovis genome, these regulatory genes have not been described in detail in B. microti and T. equi. In this study, comparative bioinformatics was used to: (i identify and map genes encoding for these transcription factors among three parasites' genomes; (ii identify a previously unreported HMG gene in B. microti; (iii define a repertoire of eight conserved Myb genes; and (iv identify AP2 correlates among B. bovis and the better-studied Plasmodium parasites. Searching the available transcriptome of B. bovis defined patterns of transcription of these three gene families in B. bovis erythrocyte stage parasites. Sequence comparisons show conservation of functional domains and general architecture in the AP2, Myb, and HMG proteins, which may be significant for the regulation of common critical parasite life cycle transitions in B. bovis, B. microti, and T. equi. A detailed understanding of the role of gene families encoding DNA binding proteins will provide new tools for unraveling regulatory mechanisms involved in B. bovis, B. microti, and T. equi life cycles and environmental adaptive responses and potentially contributes to the development of novel convergent strategies for improved control of babesiosis and equine piroplasmosis.
Learning a Markov Logic network for supervised gene regulatory network inference.
Brouard, Céline; Vrain, Christel; Dubois, Julie; Castel, David; Debily, Marie-Anne; d'Alché-Buc, Florence
2013-09-12
Gene regulatory network inference remains a challenging problem in systems biology despite the numerous approaches that have been proposed. When substantial knowledge on a gene regulatory network is already available, supervised network inference is appropriate. Such a method builds a binary classifier able to assign a class (Regulation/No regulation) to an ordered pair of genes. Once learnt, the pairwise classifier can be used to predict new regulations. In this work, we explore the framework of Markov Logic Networks (MLN) that combine features of probabilistic graphical models with the expressivity of first-order logic rules. We propose to learn a Markov Logic network, e.g. a set of weighted rules that conclude on the predicate "regulates", starting from a known gene regulatory network involved in the switch proliferation/differentiation of keratinocyte cells, a set of experimental transcriptomic data and various descriptions of genes all encoded into first-order logic. As training data are unbalanced, we use asymmetric bagging to learn a set of MLNs. The prediction of a new regulation can then be obtained by averaging predictions of individual MLNs. As a side contribution, we propose three in silico tests to assess the performance of any pairwise classifier in various network inference tasks on real datasets. A first test consists of measuring the average performance on balanced edge prediction problem; a second one deals with the ability of the classifier, once enhanced by asymmetric bagging, to update a given network. Finally our main result concerns a third test that measures the ability of the method to predict regulations with a new set of genes. As expected, MLN, when provided with only numerical discretized gene expression data, does not perform as well as a pairwise SVM in terms of AUPR. However, when a more complete description of gene properties is provided by heterogeneous sources, MLN achieves the same performance as a black-box model such as a
Sequence-based model of gap gene regulatory network.
Kozlov, Konstantin; Gursky, Vitaly; Kulakovskiy, Ivan; Samsonova, Maria
2014-01-01
The detailed analysis of transcriptional regulation is crucially important for understanding biological processes. The gap gene network in Drosophila attracts large interest among researches studying mechanisms of transcriptional regulation. It implements the most upstream regulatory layer of the segmentation gene network. The knowledge of molecular mechanisms involved in gap gene regulation is far less complete than that of genetics of the system. Mathematical modeling goes beyond insights gained by genetics and molecular approaches. It allows us to reconstruct wild-type gene expression patterns in silico, infer underlying regulatory mechanism and prove its sufficiency. We developed a new model that provides a dynamical description of gap gene regulatory systems, using detailed DNA-based information, as well as spatial transcription factor concentration data at varying time points. We showed that this model correctly reproduces gap gene expression patterns in wild type embryos and is able to predict gap expression patterns in Kr mutants and four reporter constructs. We used four-fold cross validation test and fitting to random dataset to validate the model and proof its sufficiency in data description. The identifiability analysis showed that most model parameters are well identifiable. We reconstructed the gap gene network topology and studied the impact of individual transcription factor binding sites on the model output. We measured this impact by calculating the site regulatory weight as a normalized difference between the residual sum of squares error for the set of all annotated sites and for the set with the site of interest excluded. The reconstructed topology of the gap gene network is in agreement with previous modeling results and data from literature. We showed that 1) the regulatory weights of transcription factor binding sites show very weak correlation with their PWM score; 2) sites with low regulatory weight are important for the model output; 3
Inference of cancer-specific gene regulatory networks using soft computing rules.
Wang, Xiaosheng; Gotoh, Osamu
2010-03-24
Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.
Inference of Cancer-specific Gene Regulatory Networks Using Soft Computing Rules
Directory of Open Access Journals (Sweden)
Xiaosheng Wang
2010-03-01
Full Text Available Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
A system-level model for the microbial regulatory genome.
Brooks, Aaron N; Reiss, David J; Allard, Antoine; Wu, Wei-Ju; Salvanha, Diego M; Plaisier, Christopher L; Chandrasekaran, Sriram; Pan, Min; Kaur, Amardeep; Baliga, Nitin S
2014-07-15
Microbes can tailor transcriptional responses to diverse environmental challenges despite having streamlined genomes and a limited number of regulators. Here, we present data-driven models that capture the dynamic interplay of the environment and genome-encoded regulatory programs of two types of prokaryotes: Escherichia coli (a bacterium) and Halobacterium salinarum (an archaeon). The models reveal how the genome-wide distributions of cis-acting gene regulatory elements and the conditional influences of transcription factors at each of those elements encode programs for eliciting a wide array of environment-specific responses. We demonstrate how these programs partition transcriptional regulation of genes within regulons and operons to re-organize gene-gene functional associations in each environment. The models capture fitness-relevant co-regulation by different transcriptional control mechanisms acting across the entire genome, to define a generalized, system-level organizing principle for prokaryotic gene regulatory networks that goes well beyond existing paradigms of gene regulation. An online resource (http://egrin2.systemsbiology.net) has been developed to facilitate multiscale exploration of conditional gene regulation in the two prokaryotes. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.
Current approaches to gene regulatory network modelling
Directory of Open Access Journals (Sweden)
Brazma Alvis
2007-09-01
Full Text Available Abstract Many different approaches have been developed to model and simulate gene regulatory networks. We proposed the following categories for gene regulatory network models: network parts lists, network topology models, network control logic models, and dynamic models. Here we will describe some examples for each of these categories. We will study the topology of gene regulatory networks in yeast in more detail, comparing a direct network derived from transcription factor binding data and an indirect network derived from genome-wide expression data in mutants. Regarding the network dynamics we briefly describe discrete and continuous approaches to network modelling, then describe a hybrid model called Finite State Linear Model and demonstrate that some simple network dynamics can be simulated in this model.
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
Transcription factor trapping by RNA in gene regulatory elements.
Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A
2015-11-20
Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Learning gene regulatory networks from gene expression data using weighted consensus
Fujii, Chisato; Kuwahara, Hiroyuki; Yu, Ge; Guo, Lili; Gao, Xin
2016-01-01
An accurate determination of the network structure of gene regulatory systems from high-throughput gene expression data is an essential yet challenging step in studying how the expression of endogenous genes is controlled through a complex interaction of gene products and DNA. While numerous methods have been proposed to infer the structure of gene regulatory networks, none of them seem to work consistently over different data sets with high accuracy. A recent study to compare gene network inference methods showed that an average-ranking-based consensus method consistently performs well under various settings. Here, we propose a linear programming-based consensus method for the inference of gene regulatory networks. Unlike the average-ranking-based one, which treats the contribution of each individual method equally, our new consensus method assigns a weight to each method based on its credibility. As a case study, we applied the proposed consensus method on synthetic and real microarray data sets, and compared its performance to that of the average-ranking-based consensus and individual inference methods. Our results show that our weighted consensus method achieves superior performance over the unweighted one, suggesting that assigning weights to different individual methods rather than giving them equal weights improves the accuracy. © 2016 Elsevier B.V.
Learning gene regulatory networks from gene expression data using weighted consensus
Fujii, Chisato
2016-08-25
An accurate determination of the network structure of gene regulatory systems from high-throughput gene expression data is an essential yet challenging step in studying how the expression of endogenous genes is controlled through a complex interaction of gene products and DNA. While numerous methods have been proposed to infer the structure of gene regulatory networks, none of them seem to work consistently over different data sets with high accuracy. A recent study to compare gene network inference methods showed that an average-ranking-based consensus method consistently performs well under various settings. Here, we propose a linear programming-based consensus method for the inference of gene regulatory networks. Unlike the average-ranking-based one, which treats the contribution of each individual method equally, our new consensus method assigns a weight to each method based on its credibility. As a case study, we applied the proposed consensus method on synthetic and real microarray data sets, and compared its performance to that of the average-ranking-based consensus and individual inference methods. Our results show that our weighted consensus method achieves superior performance over the unweighted one, suggesting that assigning weights to different individual methods rather than giving them equal weights improves the accuracy. © 2016 Elsevier B.V.
Inferring Gene Regulatory Networks Using Conditional Regulation Pattern to Guide Candidate Genes.
Directory of Open Access Journals (Sweden)
Fei Xiao
Full Text Available Combining path consistency (PC algorithms with conditional mutual information (CMI are widely used in reconstruction of gene regulatory networks. CMI has many advantages over Pearson correlation coefficient in measuring non-linear dependence to infer gene regulatory networks. It can also discriminate the direct regulations from indirect ones. However, it is still a challenge to select the conditional genes in an optimal way, which affects the performance and computation complexity of the PC algorithm. In this study, we develop a novel conditional mutual information-based algorithm, namely RPNI (Regulation Pattern based Network Inference, to infer gene regulatory networks. For conditional gene selection, we define the co-regulation pattern, indirect-regulation pattern and mixture-regulation pattern as three candidate patterns to guide the selection of candidate genes. To demonstrate the potential of our algorithm, we apply it to gene expression data from DREAM challenge. Experimental results show that RPNI outperforms existing conditional mutual information-based methods in both accuracy and time complexity for different sizes of gene samples. Furthermore, the robustness of our algorithm is demonstrated by noisy interference analysis using different types of noise.
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Zhang, N N; Hu, J W; Liu, H H; Xu, H Y; He, H; Li, L
2015-12-29
Tyrosinase, encoded by the TYR gene, is the rate-limiting enzyme in the production of melanin pigment. In this study, plumage color separation was observed in Cherry Valley duck line D and F1 and F2 hybrid generations of Liancheng white ducks. Gene sequencing and bioinformatic analysis were applied to the 5'-regulatory region of TYR, to explore the connection between TYR sequence variation and duck plumage color. Four SNPs were found in the 5'-regulatory region. The SNPs were in tight linkage and formed three haplotypes. However, the genotype distribution in groups with different plumage color was not significantly different, and there were no changes in the transcription factor binding sites between the different genotypes. In conclusion, these SNP variations may not cause the differences in feather color observed in this test group.
Dose response relationship in anti-stress gene regulatory networks.
Zhang, Qiang; Andersen, Melvin E
2007-03-02
To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products) in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear) depends on changes in the specific values of local response coefficients (gains) distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear, and depending on
Dose response relationship in anti-stress gene regulatory networks.
Directory of Open Access Journals (Sweden)
Qiang Zhang
2007-03-01
Full Text Available To maintain a stable intracellular environment, cells utilize complex and specialized defense systems against a variety of external perturbations, such as electrophilic stress, heat shock, and hypoxia, etc. Irrespective of the type of stress, many adaptive mechanisms contributing to cellular homeostasis appear to operate through gene regulatory networks that are organized into negative feedback loops. In general, the degree of deviation of the controlled variables, such as electrophiles, misfolded proteins, and O2, is first detected by specialized sensor molecules, then the signal is transduced to specific transcription factors. Transcription factors can regulate the expression of a suite of anti-stress genes, many of which encode enzymes functioning to counteract the perturbed variables. The objective of this study was to explore, using control theory and computational approaches, the theoretical basis that underlies the steady-state dose response relationship between cellular stressors and intracellular biochemical species (controlled variables, transcription factors, and gene products in these gene regulatory networks. Our work indicated that the shape of dose response curves (linear, superlinear, or sublinear depends on changes in the specific values of local response coefficients (gains distributed in the feedback loop. Multimerization of anti-stress enzymes and transcription factors into homodimers, homotrimers, or even higher-order multimers, play a significant role in maintaining robust homeostasis. Moreover, our simulation noted that dose response curves for the controlled variables can transition sequentially through four distinct phases as stressor level increases: initial superlinear with lesser control, superlinear more highly controlled, linear uncontrolled, and sublinear catastrophic. Each phase relies on specific gain-changing events that come into play as stressor level increases. The low-dose region is intrinsically nonlinear
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
Mutational robustness of gene regulatory networks.
Directory of Open Access Journals (Sweden)
Aalt D J van Dijk
Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
A Regulatory Network Analysis of Orphan Genes in Arabidopsis Thaliana
Singh, Pramesh; Chen, Tianlong; Arendsee, Zebulun; Wurtele, Eve S.; Bassler, Kevin E.
Orphan genes, which are genes unique to each particular species, have recently drawn significant attention for their potential usefulness for organismal robustness. Their origin and regulatory interaction patterns remain largely undiscovered. Recently, methods that use the context likelihood of relatedness to infer a network followed by modularity maximizing community detection algorithms on the inferred network to find the functional structure of regulatory networks were shown to be effective. We apply improved versions of these methods to gene expression data from Arabidopsis thaliana, identify groups (clusters) of interacting genes with related patterns of expression and analyze the structure within those groups. Focusing on clusters that contain orphan genes, we compare the identified clusters to gene ontology (GO) terms, regulons, and pathway designations and analyze their hierarchical structure. We predict new regulatory interactions and unravel the structure of the regulatory interaction patterns of orphan genes. Work supported by the NSF through Grants DMR-1507371 and IOS-1546858.
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Learning gene regulatory networks from only positive and unlabeled data
Directory of Open Access Journals (Sweden)
Elkan Charles
2010-05-01
Full Text Available Abstract Background Recently, supervised learning methods have been exploited to reconstruct gene regulatory networks from gene expression data. The reconstruction of a network is modeled as a binary classification problem for each pair of genes. A statistical classifier is trained to recognize the relationships between the activation profiles of gene pairs. This approach has been proven to outperform previous unsupervised methods. However, the supervised approach raises open questions. In particular, although known regulatory connections can safely be assumed to be positive training examples, obtaining negative examples is not straightforward, because definite knowledge is typically not available that a given pair of genes do not interact. Results A recent advance in research on data mining is a method capable of learning a classifier from only positive and unlabeled examples, that does not need labeled negative examples. Applied to the reconstruction of gene regulatory networks, we show that this method significantly outperforms the current state of the art of machine learning methods. We assess the new method using both simulated and experimental data, and obtain major performance improvement. Conclusions Compared to unsupervised methods for gene network inference, supervised methods are potentially more accurate, but for training they need a complete set of known regulatory connections. A supervised method that can be trained using only positive and unlabeled data, as presented in this paper, is especially beneficial for the task of inferring gene regulatory networks, because only an incomplete set of known regulatory connections is available in public databases such as RegulonDB, TRRD, KEGG, Transfac, and IPA.
Sparsity in Model Gene Regulatory Networks
International Nuclear Information System (INIS)
Zagorski, M.
2011-01-01
We propose a gene regulatory network model which incorporates the microscopic interactions between genes and transcription factors. In particular the gene's expression level is determined by deterministic synchronous dynamics with contribution from excitatory interactions. We study the structure of networks that have a particular '' function '' and are subject to the natural selection pressure. The question of network robustness against point mutations is addressed, and we conclude that only a small part of connections defined as '' essential '' for cell's existence is fragile. Additionally, the obtained networks are sparse with narrow in-degree and broad out-degree, properties well known from experimental study of biological regulatory networks. Furthermore, during sampling procedure we observe that significantly different genotypes can emerge under mutation-selection balance. All the preceding features hold for the model parameters which lay in the experimentally relevant range. (author)
Robustness and accuracy in sea urchin developmental gene regulatory networks
Directory of Open Access Journals (Sweden)
Smadar eBen-Tabou De-Leon
2016-02-01
Full Text Available Developmental gene regulatory networks robustly control the timely activation of regulatory and differentiation genes. The structure of these networks underlies their capacity to buffer intrinsic and extrinsic noise and maintain embryonic morphology. Here I illustrate how the use of specific architectures by the sea urchin developmental regulatory networks enables the robust control of cell fate decisions. The Wnt-βcatenin signaling pathway patterns the primary embryonic axis while the BMP signaling pathway patterns the secondary embryonic axis in the sea urchin embryo and across bilateria. Interestingly, in the sea urchin in both cases, the signaling pathway that defines the axis controls directly the expression of a set of downstream regulatory genes. I propose that this direct activation of a set of regulatory genes enables a uniform regulatory response and a clear cut cell fate decision in the endoderm and in the dorsal ectoderm. The specification of the mesodermal pigment cell lineage is activated by Delta signaling that initiates a triple positive feedback loop that locks down the pigment specification state. I propose that the use of compound positive feedback circuitry provides the endodermal cells enough time to turn off mesodermal genes and ensures correct mesoderm vs. endoderm fate decision. Thus, I argue that understanding the control properties of repeatedly used regulatory architectures illuminates their role in embryogenesis and provides possible explanations to their resistance to evolutionary change.
Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M
2015-01-08
elements. Aca-snr-3 encodes a core small nuclear ribonucleoprotein, and Aca-lpp-1 encodes a lipid phosphate phosphohydrolase. Expression of both genes peaked at the late L4 stage, suggesting a role in L4 development. The 3'-terminal genomic fragment of the snr-3 gene displayed Ac-DAF-16-dependent cis-regulatory activity.
Learning Gene Regulatory Networks Computationally from Gene Expression Data Using Weighted Consensus
Fujii, Chisato
2015-04-16
Gene regulatory networks analyze the relationships between genes allowing us to un- derstand the gene regulatory interactions in systems biology. Gene expression data from the microarray experiments is used to obtain the gene regulatory networks. How- ever, the microarray data is discrete, noisy and non-linear which makes learning the networks a challenging problem and existing gene network inference methods do not give consistent results. Current state-of-the-art study uses the average-ranking-based consensus method to combine and average the ranked predictions from individual methods. However each individual method has an equal contribution to the consen- sus prediction. We have developed a linear programming-based consensus approach which uses learned weights from linear programming among individual methods such that the methods have di↵erent weights depending on their performance. Our result reveals that assigning di↵erent weights to individual methods rather than giving them equal weights improves the performance of the consensus. The linear programming- based consensus method is evaluated and it had the best performance on in silico and Saccharomyces cerevisiae networks, and the second best on the Escherichia coli network outperformed by Inferelator Pipeline method which gives inconsistent results across a wide range of microarray data sets.
Noda, Masafumi; Miyauchi, Rumi; Danshiitsoodol, Narandalai; Matoba, Yasuyuki; Kumagai, Takanori; Sugiyama, Masanori
2018-04-01
We have previously shown that the lactic acid bacterium Lactobacillus brevis 174A, isolated from Citrus iyo fruit, produces a bacteriocin designated brevicin 174A, which is comprised of two antibacterial polypeptides (designated brevicins 174A-β and 174A-γ). We have also found a gene cluster, composed of eight open reading frames (ORFs), that contains genes for the biosynthesis of brevicin 174A, self-resistance to its own bacteriocin, and two transcriptional regulatory proteins. Some lactic acid bacterial strains have a system to start the production of bacteriocin at an adequate stage of growth. Generally, the system consists of a membrane-bound histidine protein kinase (HPK) that senses a specific environmental stimulus and a corresponding response regulator (RR) that mediates the cellular response. We have previously shown that although the HPK- and RR-encoding genes are not found on the brevicin 174A biosynthetic gene cluster in the 174A strain, two putative regulatory genes, designated breD and breG , are in the gene cluster. In the present study, we demonstrate that the expression of brevicin 174A production and self-resistance is positively controlled by two transcriptional regulatory proteins, designated BreD and BreG. BreD is expressed together with BreE as the self-resistance determinant of L. brevis 174A. DNase I footprinting analysis and a promoter assay demonstrated that BreD binds to the breED promoter as a positive autoregulator. The present study also demonstrates that BreG, carrying a transmembrane domain, binds to the common promoter of breB and breC , encoding brevicins 174A-β and 174A-γ, respectively, for positive regulation. IMPORTANCE The problem of the appearance of bacteria that are resistant to practical antibiotics and the increasing demand for safe foods have increased interest in replacing conventional antibiotics with bacteriocin produced by the lactic acid bacteria. This antibacterial substance can inhibit the growth of pathogenic
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Creating and validating cis-regulatory maps of tissue-specific gene expression regulation
O'Connor, Timothy R.; Bailey, Timothy L.
2014-01-01
Predicting which genomic regions control the transcription of a given gene is a challenge. We present a novel computational approach for creating and validating maps that associate genomic regions (cis-regulatory modules–CRMs) with genes. The method infers regulatory relationships that explain gene expression observed in a test tissue using widely available genomic data for ‘other’ tissues. To predict the regulatory targets of a CRM, we use cross-tissue correlation between histone modifications present at the CRM and expression at genes within 1 Mbp of it. To validate cis-regulatory maps, we show that they yield more accurate models of gene expression than carefully constructed control maps. These gene expression models predict observed gene expression from transcription factor binding in the CRMs linked to that gene. We show that our maps are able to identify long-range regulatory interactions and improve substantially over maps linking genes and CRMs based on either the control maps or a ‘nearest neighbor’ heuristic. Our results also show that it is essential to include CRMs predicted in multiple tissues during map-building, that H3K27ac is the most informative histone modification, and that CAGE is the most informative measure of gene expression for creating cis-regulatory maps. PMID:25200088
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Mining Gene Regulatory Networks by Neural Modeling of Expression Time-Series.
Rubiolo, Mariano; Milone, Diego H; Stegmayer, Georgina
2015-01-01
Discovering gene regulatory networks from data is one of the most studied topics in recent years. Neural networks can be successfully used to infer an underlying gene network by modeling expression profiles as times series. This work proposes a novel method based on a pool of neural networks for obtaining a gene regulatory network from a gene expression dataset. They are used for modeling each possible interaction between pairs of genes in the dataset, and a set of mining rules is applied to accurately detect the subjacent relations among genes. The results obtained on artificial and real datasets confirm the method effectiveness for discovering regulatory networks from a proper modeling of the temporal dynamics of gene expression profiles.
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Westenberg, M.A.; Hijum, van S.A.F.T.; Lulko, A.T.; Kuipers, O.P.; Roerdink, J.B.T.M.; Linsen, L.; Hagen, H.; Hamann, B.
2008-01-01
We present GENeVis, an application to visualize gene expression time series data in a gene regulatory network context. This is a network of regulator proteins that regulate the expression of their respective target genes. The networks are represented as graphs, in which the nodes represent genes,
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Deconstructing the pluripotency gene regulatory network
Li, Mo
2018-04-04
Pluripotent stem cells can be isolated from embryos or derived by reprogramming. Pluripotency is stabilized by an interconnected network of pluripotency genes that cooperatively regulate gene expression. Here we describe the molecular principles of pluripotency gene function and highlight post-transcriptional controls, particularly those induced by RNA-binding proteins and alternative splicing, as an important regulatory layer of pluripotency. We also discuss heterogeneity in pluripotency regulation, alternative pluripotency states and future directions of pluripotent stem cell research.
Deconstructing the pluripotency gene regulatory network
Li, Mo; Belmonte, Juan Carlos Izpisua
2018-01-01
Pluripotent stem cells can be isolated from embryos or derived by reprogramming. Pluripotency is stabilized by an interconnected network of pluripotency genes that cooperatively regulate gene expression. Here we describe the molecular principles of pluripotency gene function and highlight post-transcriptional controls, particularly those induced by RNA-binding proteins and alternative splicing, as an important regulatory layer of pluripotency. We also discuss heterogeneity in pluripotency regulation, alternative pluripotency states and future directions of pluripotent stem cell research.
Directory of Open Access Journals (Sweden)
David A Garfield
2013-10-01
Full Text Available Regulatory interactions buffer development against genetic and environmental perturbations, but adaptation requires phenotypes to change. We investigated the relationship between robustness and evolvability within the gene regulatory network underlying development of the larval skeleton in the sea urchin Strongylocentrotus purpuratus. We find extensive variation in gene expression in this network throughout development in a natural population, some of which has a heritable genetic basis. Switch-like regulatory interactions predominate during early development, buffer expression variation, and may promote the accumulation of cryptic genetic variation affecting early stages. Regulatory interactions during later development are typically more sensitive (linear, allowing variation in expression to affect downstream target genes. Variation in skeletal morphology is associated primarily with expression variation of a few, primarily structural, genes at terminal positions within the network. These results indicate that the position and properties of gene interactions within a network can have important evolutionary consequences independent of their immediate regulatory role.
Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.
Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P
2015-04-23
With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.
Anthocyanin biosynthesis in fruit tree crops: Genes and their regulation
African Journals Online (AJOL)
The anthocyanin biosynthesis pathway is a little complex with branches responsible for the synthesis of a variety of metabolites. In fruit tree crops, during the past decade, many structural genes encoding enzymes in the anthocyanin biosynthetic pathway and various regulatory genes encoding transcription factors that ...
Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters
Energy Technology Data Exchange (ETDEWEB)
Santini, Simona; Boore, Jeffrey L.; Meyer, Axel
2003-12-31
Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.
A gene regulatory network armature for T-lymphocyte specification
Energy Technology Data Exchange (ETDEWEB)
Fung, Elizabeth-sharon [Los Alamos National Laboratory
2008-01-01
Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through which T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.
Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T
1999-04-16
A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
Wang, Yi Kan; Hurley, Daniel G; Schnell, Santiago; Print, Cristin G; Crampin, Edmund J
2013-01-01
We develop a new regression algorithm, cMIKANA, for inference of gene regulatory networks from combinations of steady-state and time-series gene expression data. Using simulated gene expression datasets to assess the accuracy of reconstructing gene regulatory networks, we show that steady-state and time-series data sets can successfully be combined to identify gene regulatory interactions using the new algorithm. Inferring gene networks from combined data sets was found to be advantageous when using noisy measurements collected with either lower sampling rates or a limited number of experimental replicates. We illustrate our method by applying it to a microarray gene expression dataset from human umbilical vein endothelial cells (HUVECs) which combines time series data from treatment with growth factor TNF and steady state data from siRNA knockdown treatments. Our results suggest that the combination of steady-state and time-series datasets may provide better prediction of RNA-to-RNA interactions, and may also reveal biological features that cannot be identified from dynamic or steady state information alone. Finally, we consider the experimental design of genomics experiments for gene regulatory network inference and show that network inference can be improved by incorporating steady-state measurements with time-series data.
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Energy Technology Data Exchange (ETDEWEB)
Wu, Yongyan [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Ai, Zhiying [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Yao, Kezhen [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Cao, Lixia; Du, Juan; Shi, Xiaoyan [Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); College of Life Sciences, Northwest A and F University, Yangling 712100, Shaanxi (China); Guo, Zekun, E-mail: gzk@nwsuaf.edu.cn [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China); Zhang, Yong, E-mail: zhylab@hotmail.com [College of Veterinary Medicine, Northwest A and F University, Yangling 712100, Shaanxi (China); Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi (China)
2013-10-15
Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.
International Nuclear Information System (INIS)
Wu, Yongyan; Ai, Zhiying; Yao, Kezhen; Cao, Lixia; Du, Juan; Shi, Xiaoyan; Guo, Zekun; Zhang, Yong
2013-01-01
Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway by stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR
Grimm, Frauke; Dobler, Nadine; Dahl, Christiane
2010-03-01
Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Computational and molecular dissection of an X-box cis-Regulatory module
Warrington, Timothy Burton
2015-01-01
Ciliopathies are a class of human diseases marked by dysfunction of the cellular organelle, cilia. While many of the molecular components that make up cilia have been identified and studied, comparatively little is understood about the transcriptional regulation of genes encoding these components. The conserved transcription factor Regulatory Factor X (RFX)/DAF-19, which acts through binding to the cis-regulatory motif known as X-box, has been shown to regulate ciliary genes in many animals f...
Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice
Directory of Open Access Journals (Sweden)
Shuchi eSmita
2015-12-01
Full Text Available MYB transcription factor (TF is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by top down and guide gene approaches. More than 50% of OsMYBs were strongly correlated under fifty experimental conditions with 51 hub genes via top down approach. Further, clusters were identified using Markov Clustering (MCL. To maximize the clustering performance, parameter evaluation of the MCL inflation score (I was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by guide gene approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
Efficient Reverse-Engineering of a Developmental Gene Regulatory Network
Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes
2012-01-01
Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to
Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene
Directory of Open Access Journals (Sweden)
Michael Hadjiargyrou
2018-01-01
Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.
Cheung, Gordon Y C; Villaruz, Amer E; Joo, Hwang-Soo; Duong, Anthony C; Yeh, Anthony J; Nguyen, Thuan H; Sturdevant, Daniel E; Queck, S Y; Otto, M
2014-07-01
Several methicillin resistance (SCCmec) clusters characteristic of hospital-associated methicillin-resistant Staphylococcus aureus (MRSA) strains harbor the psm-mec locus. In addition to encoding the cytolysin, phenol-soluble modulin (PSM)-mec, this locus has been attributed gene regulatory functions. Here we employed genome-wide transcriptional profiling to define the regulatory function of the psm-mec locus. The immune evasion factor protein A emerged as the primary conserved and strongly regulated target of psm-mec, an effect we show is mediated by the psm-mec RNA. Furthermore, the psm-mec locus exerted regulatory effects that were more moderate in extent. For example, expression of PSM-mec limited expression of mecA, thereby decreasing methicillin resistance. Our study shows that the psm-mec locus has a rare dual regulatory RNA and encoded cytolysin function. Furthermore, our findings reveal a specific mechanism underscoring the recently emerging concept that S. aureus strains balance pronounced virulence and high expression of antibiotic resistance. Published by Elsevier GmbH.
Finding gene regulatory network candidates using the gene expression knowledge base.
Venkatesan, Aravind; Tripathi, Sushil; Sanz de Galdeano, Alejandro; Blondé, Ward; Lægreid, Astrid; Mironov, Vladimir; Kuiper, Martin
2014-12-10
Network-based approaches for the analysis of large-scale genomics data have become well established. Biological networks provide a knowledge scaffold against which the patterns and dynamics of 'omics' data can be interpreted. The background information required for the construction of such networks is often dispersed across a multitude of knowledge bases in a variety of formats. The seamless integration of this information is one of the main challenges in bioinformatics. The Semantic Web offers powerful technologies for the assembly of integrated knowledge bases that are computationally comprehensible, thereby providing a potentially powerful resource for constructing biological networks and network-based analysis. We have developed the Gene eXpression Knowledge Base (GeXKB), a semantic web technology based resource that contains integrated knowledge about gene expression regulation. To affirm the utility of GeXKB we demonstrate how this resource can be exploited for the identification of candidate regulatory network proteins. We present four use cases that were designed from a biological perspective in order to find candidate members relevant for the gastrin hormone signaling network model. We show how a combination of specific query definitions and additional selection criteria derived from gene expression data and prior knowledge concerning candidate proteins can be used to retrieve a set of proteins that constitute valid candidates for regulatory network extensions. Semantic web technologies provide the means for processing and integrating various heterogeneous information sources. The GeXKB offers biologists such an integrated knowledge resource, allowing them to address complex biological questions pertaining to gene expression. This work illustrates how GeXKB can be used in combination with gene expression results and literature information to identify new potential candidates that may be considered for extending a gene regulatory network.
Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.
Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang
2012-02-01
In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.
Lu, C.; Fedoroff, N.
2000-01-01
Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.
LENUS (Irish Health Repository)
Whan, Vicki
2010-11-23
Abstract Background About forty human diseases are caused by repeat instability mutations. A distinct subset of these diseases is the result of extreme expansions of polymorphic trinucleotide repeats; typically CAG repeats encoding poly-glutamine (poly-Q) tracts in proteins. Polymorphic repeat length variation is also apparent in human poly-Q encoding genes from normal individuals. As these coding sequence repeats are subject to selection in mammals, it has been suggested that normal variations in some of these typically highly conserved genes are implicated in morphological differences between species and phenotypic variations within species. At present, poly-Q encoding genes in non-human mammalian species are poorly documented, as are their functions and propensities for polymorphic variation. Results The current investigation identified 178 bovine poly-Q encoding genes (Q ≥ 5) and within this group, 26 genes with orthologs in both human and mouse that did not contain poly-Q repeats. The bovine poly-Q encoding genes typically had ubiquitous expression patterns although there was bias towards expression in epithelia, brain and testes. They were also characterised by unusually large sizes. Analysis of gene ontology terms revealed that the encoded proteins were strongly enriched for functions associated with transcriptional regulation and many contributed to physical interaction networks in the nucleus where they presumably act cooperatively in transcriptional regulatory complexes. In addition, the coding sequence CAG repeats in some bovine genes impacted mRNA splicing thereby generating unusual transcriptional diversity, which in at least one instance was tissue-specific. The poly-Q encoding genes were prioritised using multiple criteria for their likelihood of being polymorphic and then the highest ranking group was experimentally tested for polymorphic variation within a cattle diversity panel. Extensive and meiotically stable variation was identified
Overlapping positive and negative regulatory domains of the human β-interferon gene
International Nuclear Information System (INIS)
Goodbourn, S.; Maniatis, T.
1988-01-01
Virus of poly(I) x poly(C) induction of human β-interferon gene expression requires a 40-base-pair DNA sequence designated the interferon gene regulatory element (IRE). Previous studies have shown that the IRE contains both positive and negative regulatory DNA sequences. To localize these sequences and study their interactions, the authors have examined the effects of a large number of single-base mutations within the IRE on β-interferon gene regulation. They find that the IRE consists of two genetically separable positive regulatory domains and an overlapping negative control sequence. They propose that the β-interferon gene is switched off in uninduced cells by a repressor that blocks the interaction between one of the two positive regulatory sequences and a specific transcription factor. Induction would then lead to inactivation or displacement of the repressor and binding of transcription factors to both positive regulatory domains
Directory of Open Access Journals (Sweden)
Nancy D Merner
2015-10-01
Full Text Available Many encoded gene products responsible for neurodevelopmental disorders (NDs like autism spectrum disorders (ASD, schizophrenia (SCZ, intellectual disability (ID, and idiopathic generalized epilepsy (IGE converge on networks controlling synaptic function. An increase in KCC2 (SLC12A5 Cl- transporter activity drives the developmental GABA excitatory-inhibitory sequence, but the role of KCC2 in human NDs is essentially unknown. Here, we report two rare, non-synonymous (NS, functionally-impairing variants in the KCC2 C-terminal regulatory domain (CTRD in human ASD (R952H and R1049C and SCZ (R952H previously linked with IGE and familial febrile seizures, and another novel NS KCC2 variant in ASD (R1048W with highly-predicted pathogenicity. Exome data from 2517 simplex families in the ASD Simon Simplex Collection revealed significantly more KCC2 CTRD variants in ASD cases than controls, and interestingly, these were more often synonymous and predicted to disrupt or introduce a CpG site. Furthermore, full gene analysis showed ASD cases are more likely to contain rare KCC2 variants affecting CpG sites than controls. These data suggest genetically-encoded dysregulation of KCC2-dependent GABA signaling may contribute to multiple human NDs.
Modeling stochasticity and robustness in gene regulatory networks.
Garg, Abhishek; Mohanram, Kartik; Di Cara, Alessandro; De Micheli, Giovanni; Xenarios, Ioannis
2009-06-15
Understanding gene regulation in biological processes and modeling the robustness of underlying regulatory networks is an important problem that is currently being addressed by computational systems biologists. Lately, there has been a renewed interest in Boolean modeling techniques for gene regulatory networks (GRNs). However, due to their deterministic nature, it is often difficult to identify whether these modeling approaches are robust to the addition of stochastic noise that is widespread in gene regulatory processes. Stochasticity in Boolean models of GRNs has been addressed relatively sparingly in the past, mainly by flipping the expression of genes between different expression levels with a predefined probability. This stochasticity in nodes (SIN) model leads to over representation of noise in GRNs and hence non-correspondence with biological observations. In this article, we introduce the stochasticity in functions (SIF) model for simulating stochasticity in Boolean models of GRNs. By providing biological motivation behind the use of the SIF model and applying it to the T-helper and T-cell activation networks, we show that the SIF model provides more biologically robust results than the existing SIN model of stochasticity in GRNs. Algorithms are made available under our Boolean modeling toolbox, GenYsis. The software binaries can be downloaded from http://si2.epfl.ch/ approximately garg/genysis.html.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data.
Zhu, Mingzhu; Dahmen, Jeremy L; Stacey, Gary; Cheng, Jianlin
2013-09-22
High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments.
Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V
2012-11-01
Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Gene regulatory networks in lactation: identification of global principles using bioinformatics
Directory of Open Access Journals (Sweden)
Pollard Katherine S
2007-11-01
Full Text Available Abstract Background The molecular events underlying mammary development during pregnancy, lactation, and involution are incompletely understood. Results Mammary gland microarray data, cellular localization data, protein-protein interactions, and literature-mined genes were integrated and analyzed using statistics, principal component analysis, gene ontology analysis, pathway analysis, and network analysis to identify global biological principles that govern molecular events during pregnancy, lactation, and involution. Conclusion Several key principles were derived: (1 nearly a third of the transcriptome fluctuates to build, run, and disassemble the lactation apparatus; (2 genes encoding the secretory machinery are transcribed prior to lactation; (3 the diversity of the endogenous portion of the milk proteome is derived from fewer than 100 transcripts; (4 while some genes are differentially transcribed near the onset of lactation, the lactation switch is primarily post-transcriptionally mediated; (5 the secretion of materials during lactation occurs not by up-regulation of novel genomic functions, but by widespread transcriptional suppression of functions such as protein degradation and cell-environment communication; (6 the involution switch is primarily transcriptionally mediated; and (7 during early involution, the transcriptional state is partially reverted to the pre-lactation state. A new hypothesis for secretory diminution is suggested – milk production gradually declines because the secretory machinery is not transcriptionally replenished. A comprehensive network of protein interactions during lactation is assembled and new regulatory gene targets are identified. Less than one fifth of the transcriptionally regulated nodes in this lactation network have been previously explored in the context of lactation. Implications for future research in mammary and cancer biology are discussed.
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Semi-supervised prediction of gene regulatory networks using ...
Indian Academy of Sciences (India)
2015-09-28
Sep 28, 2015 ... Use of computational methods to predict gene regulatory networks (GRNs) from gene expression data is a challenging ... two types of methods differ primarily based on whether ..... negligible, allowing us to draw the qualitative conclusions .... research will be conducted to develop additional biologically.
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
An algebra-based method for inferring gene regulatory networks.
Vera-Licona, Paola; Jarrah, Abdul; Garcia-Puente, Luis David; McGee, John; Laubenbacher, Reinhard
2014-03-26
The inference of gene regulatory networks (GRNs) from experimental observations is at the heart of systems biology. This includes the inference of both the network topology and its dynamics. While there are many algorithms available to infer the network topology from experimental data, less emphasis has been placed on methods that infer network dynamics. Furthermore, since the network inference problem is typically underdetermined, it is essential to have the option of incorporating into the inference process, prior knowledge about the network, along with an effective description of the search space of dynamic models. Finally, it is also important to have an understanding of how a given inference method is affected by experimental and other noise in the data used. This paper contains a novel inference algorithm using the algebraic framework of Boolean polynomial dynamical systems (BPDS), meeting all these requirements. The algorithm takes as input time series data, including those from network perturbations, such as knock-out mutant strains and RNAi experiments. It allows for the incorporation of prior biological knowledge while being robust to significant levels of noise in the data used for inference. It uses an evolutionary algorithm for local optimization with an encoding of the mathematical models as BPDS. The BPDS framework allows an effective representation of the search space for algebraic dynamic models that improves computational performance. The algorithm is validated with both simulated and experimental microarray expression profile data. Robustness to noise is tested using a published mathematical model of the segment polarity gene network in Drosophila melanogaster. Benchmarking of the algorithm is done by comparison with a spectrum of state-of-the-art network inference methods on data from the synthetic IRMA network to demonstrate that our method has good precision and recall for the network reconstruction task, while also predicting several of the
DEFF Research Database (Denmark)
Dahlgaard, Katja; Troelsen, Jesper
2018-01-01
Several tumor suppressors possess gene regulatory activity. Here, we describe how promoter and promoter/enhancer reporter assays can be used to characterize a colorectal tumor suppressor proteins’ gene regulatory activity of possible target genes. In the first part, a bioinformatic approach...... of the quick and efficient In-Fusion cloning method, and how to carry out transient transfections of Caco-2 colon cancer cells with the produced luciferase reporter plasmids using polyethyleneimine (PEI). A plan describing how to set up and carry out the luciferase expression assay is presented. The luciferase...... to identify relevant gene regulatory regions of potential target genes is presented. In the second part, it is demonstrated how to prepare and carry out the functional assay. We explain how to clone the bioinformatically identified gene regulatory regions into luciferase reporter plasmids by the use...
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
Directory of Open Access Journals (Sweden)
Flavia Vischi Winck
Full Text Available The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1 gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF and transcription regulator (TR genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1 and Lcr2 (Low-CO2 response regulator 2, may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome
A guide to approaching regulatory considerations for lentiviral-mediated gene therapies.
White, Michael; Whittaker, Roger; Stoll, Elizabeth Ann
2017-06-12
Lentiviral vectors are increasingly the gene transfer tool of choice for gene or cell therapies, with multiple clinical investigations showing promise for this viral vector in terms of both safety and efficacy. The third-generation vector system is well-characterized, effectively delivers genetic material and maintains long-term stable expression in target cells, delivers larger amounts of genetic material than other methods, is non-pathogenic and does not cause an inflammatory response in the recipient. This report aims to help academic scientists and regulatory managers negotiate the governance framework to achieve successful translation of a lentiviral vector-based gene therapy. The focus is on European regulations, and how they are administered in the United Kingdom, although many of the principles will be similar for other regions including the United States. The report justifies the rationale for using third-generation lentiviral vectors to achieve gene delivery for in vivo and ex vivo applications; briefly summarises the extant regulatory guidance for gene therapies, categorised as advanced therapeutic medicinal products (ATMPs); provides guidance on specific regulatory issues regarding gene therapies; presents an overview of the key stakeholders to be approached when pursuing clinical trials authorization for an ATMP; and includes a brief catalogue of the documentation required to submit an application for regulatory approval of a new gene therapy.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
Ibraheem, Omodele; Botha, Christiaan E J; Bradley, Graeme
2010-12-01
The regulation of gene expression involves a multifarious regulatory system. Each gene contains a unique combination of cis-acting regulatory sequence elements in the 5' regulatory region that determines its temporal and spatial expression. Cis-acting regulatory elements are essential transcriptional gene regulatory units; they control many biological processes and stress responses. Thus a full understanding of the transcriptional gene regulation system will depend on successful functional analyses of cis-acting elements. Cis-acting regulatory elements present within the 5' regulatory region of the sucrose transporter gene families in rice (Oryza sativa Japonica cultivar-group) and Arabidopsis thaliana, were identified using a bioinformatics approach. The possible cis-acting regulatory elements were predicted by scanning 1.5kbp of 5' regulatory regions of the sucrose transporter genes translational start sites, using Plant CARE, PLACE and Genomatix Matinspector professional databases. Several cis-acting regulatory elements that are associated with plant development, plant hormonal regulation and stress response were identified, and were present in varying frequencies within the 1.5kbp of 5' regulatory region, among which are; A-box, RY, CAT, Pyrimidine-box, Sucrose-box, ABRE, ARF, ERE, GARE, Me-JA, ARE, DRE, GA-motif, GATA, GT-1, MYC, MYB, W-box, and I-box. This result reveals the probable cis-acting regulatory elements that possibly are involved in the expression and regulation of sucrose transporter gene families in rice and Arabidopsis thaliana during cellular development or environmental stress conditions. Copyright © 2010 Elsevier Ltd. All rights reserved.
Discovery of time-delayed gene regulatory networks based on temporal gene expression profiling
Directory of Open Access Journals (Sweden)
Guo Zheng
2006-01-01
Full Text Available Abstract Background It is one of the ultimate goals for modern biological research to fully elucidate the intricate interplays and the regulations of the molecular determinants that propel and characterize the progression of versatile life phenomena, to name a few, cell cycling, developmental biology, aging, and the progressive and recurrent pathogenesis of complex diseases. The vast amount of large-scale and genome-wide time-resolved data is becoming increasing available, which provides the golden opportunity to unravel the challenging reverse-engineering problem of time-delayed gene regulatory networks. Results In particular, this methodological paper aims to reconstruct regulatory networks from temporal gene expression data by using delayed correlations between genes, i.e., pairwise overlaps of expression levels shifted in time relative each other. We have thus developed a novel model-free computational toolbox termed TdGRN (Time-delayed Gene Regulatory Network to address the underlying regulations of genes that can span any unit(s of time intervals. This bioinformatics toolbox has provided a unified approach to uncovering time trends of gene regulations through decision analysis of the newly designed time-delayed gene expression matrix. We have applied the proposed method to yeast cell cycling and human HeLa cell cycling and have discovered most of the underlying time-delayed regulations that are supported by multiple lines of experimental evidence and that are remarkably consistent with the current knowledge on phase characteristics for the cell cyclings. Conclusion We established a usable and powerful model-free approach to dissecting high-order dynamic trends of gene-gene interactions. We have carefully validated the proposed algorithm by applying it to two publicly available cell cycling datasets. In addition to uncovering the time trends of gene regulations for cell cycling, this unified approach can also be used to study the complex
Weterings, K; Schrauwen, J; Wullems, G; Twell, D
1995-07-01
Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.
Jauch, Eike; Wecklein, Heike; Stark, Felix; Jauch, Mandy; Raabe, Thomas
2006-06-07
Genes encoding for the two evolutionary highly conserved subunits of a heterotetrameric protein kinase CK2 holoenzyme are present in all examined eukaryotic genomes. Depending on the organism, multiple transcription units encoding for a catalytically active CK2alpha subunit and/or a regulatory CK2beta subunit may exist. The phosphotransferase activity of members of the protein kinase CK2alpha family is thought to be independent of second messengers but is modulated by interaction with CK2beta-like proteins. In the genome of Drosophila melanogaster, one gene encoding for a CK2alpha subunit and three genes encoding for CK2beta-like proteins are present. The X-linked DmCK2beta transcription unit encodes for several CK2beta protein isoforms due to alternative splicing of its primary transcript. We addressed the question whether CK2beta-like proteins are redundant in function. Our in vivo experiments show that variations of the very C-terminal tail of CK2beta isoforms encoded by the X-linked DmCK2beta transcription unit influence their functional properties. In addition, we find that CK2beta-like proteins encoded by the autosomal D. melanogaster genes CK2betates and CK2beta' cannot fully substitute for a loss of CK2beta isoforms encoded by DmCK2beta.
An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response
Directory of Open Access Journals (Sweden)
Katherine M. Buckley
2017-10-01
Full Text Available The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17, are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Kim, Jungmook; Lee, Han Woo
2013-02-01
Root system architecture is important for plants to adapt to a changing environment. The major determinant of the root system is lateral roots originating from the primary root. The developmental process of lateral root formation can be divided into priming, initiation, primordium development and the emergence of lateral roots, and is well characterized in Arabidopsis. The hormone auxin plays a critical role in lateral root development, and several auxin response modules involving AUXIN RESPONSE FACTORS (ARFs), transcriptional regulators of auxin-regulated genes and Aux/IAA, negative regulators of ARFs, regulate lateral root formation. The LATERAL ORGAN BOUNDARIES DOMAIN/ASYMMETRIC LEAVES2-LIKE (LBD/ASL) gene family encodes a unique class of transcription factors harbouring a conserved plant-specific lateral organ boundary domain and plays a role in lateral organ development of plants including lateral root formation. In our previous study, we showed that LBD18 stimulates lateral root formation in combination with LBD16 downstream of ARF7 and ARF19 during the auxin response. We have recently demonstrated that LBD18 activates expression of EXP14, a gene encoding the cell-wall loosening factor, by directly binding to the EXP14 promoter to promote lateral root emergence. Here we present the molecular function of LBD18 and its gene regulatory network during lateral root formation.
Global Regulatory Differences for Gene- and Cell-Based Therapies
DEFF Research Database (Denmark)
Coppens, Delphi G M; De Bruin, Marie L; Leufkens, Hubert G M
2017-01-01
Gene- and cell-based therapies (GCTs) offer potential new treatment options for unmet medical needs. However, the use of conventional regulatory requirements for medicinal products to approve GCTs may impede patient access and therapeutic innovation. Furthermore, requirements differ between...... jurisdictions, complicating the global regulatory landscape. We provide a comparative overview of regulatory requirements for GCT approval in five jurisdictions and hypothesize on the consequences of the observed global differences on patient access and therapeutic innovation....
SELANSI: a toolbox for simulation of stochastic gene regulatory networks.
Pájaro, Manuel; Otero-Muras, Irene; Vázquez, Carlos; Alonso, Antonio A
2018-03-01
Gene regulation is inherently stochastic. In many applications concerning Systems and Synthetic Biology such as the reverse engineering and the de novo design of genetic circuits, stochastic effects (yet potentially crucial) are often neglected due to the high computational cost of stochastic simulations. With advances in these fields there is an increasing need of tools providing accurate approximations of the stochastic dynamics of gene regulatory networks (GRNs) with reduced computational effort. This work presents SELANSI (SEmi-LAgrangian SImulation of GRNs), a software toolbox for the simulation of stochastic multidimensional gene regulatory networks. SELANSI exploits intrinsic structural properties of gene regulatory networks to accurately approximate the corresponding Chemical Master Equation with a partial integral differential equation that is solved by a semi-lagrangian method with high efficiency. Networks under consideration might involve multiple genes with self and cross regulations, in which genes can be regulated by different transcription factors. Moreover, the validity of the method is not restricted to a particular type of kinetics. The tool offers total flexibility regarding network topology, kinetics and parameterization, as well as simulation options. SELANSI runs under the MATLAB environment, and is available under GPLv3 license at https://sites.google.com/view/selansi. antonio@iim.csic.es. © The Author(s) 2017. Published by Oxford University Press.
Heart morphogenesis gene regulatory networks revealed by temporal expression analysis.
Hill, Jonathon T; Demarest, Bradley; Gorsi, Bushra; Smith, Megan; Yost, H Joseph
2017-10-01
During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks (GRNs) driving this phase of heart development, during which many congenital heart disease malformations likely arise, we conducted an RNA-seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern, identified transcription factor binding motifs enriched in each cluster, and generated a model GRN for the major gene batteries in heart morphogenesis. This approach predicted hundreds of regulatory interactions and found batteries enriched in specific cell and tissue types, indicating that the approach can be used to narrow the search for novel genetic markers and regulatory interactions. Subsequent analyses confirmed the GRN using two mutants, Tbx5 and nkx2-5 , and identified sets of duplicated zebrafish genes that do not show temporal subfunctionalization. This dataset provides an essential resource for future studies on the genetic/epigenetic pathways implicated in congenital heart defects and the mechanisms of cardiac transcriptional regulation. © 2017. Published by The Company of Biologists Ltd.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Synchronous versus asynchronous modeling of gene regulatory networks.
Garg, Abhishek; Di Cara, Alessandro; Xenarios, Ioannis; Mendoza, Luis; De Micheli, Giovanni
2008-09-01
In silico modeling of gene regulatory networks has gained some momentum recently due to increased interest in analyzing the dynamics of biological systems. This has been further facilitated by the increasing availability of experimental data on gene-gene, protein-protein and gene-protein interactions. The two dynamical properties that are often experimentally testable are perturbations and stable steady states. Although a lot of work has been done on the identification of steady states, not much work has been reported on in silico modeling of cellular differentiation processes. In this manuscript, we provide algorithms based on reduced ordered binary decision diagrams (ROBDDs) for Boolean modeling of gene regulatory networks. Algorithms for synchronous and asynchronous transition models have been proposed and their corresponding computational properties have been analyzed. These algorithms allow users to compute cyclic attractors of large networks that are currently not feasible using existing software. Hereby we provide a framework to analyze the effect of multiple gene perturbation protocols, and their effect on cell differentiation processes. These algorithms were validated on the T-helper model showing the correct steady state identification and Th1-Th2 cellular differentiation process. The software binaries for Windows and Linux platforms can be downloaded from http://si2.epfl.ch/~garg/genysis.html.
The Reconstruction and Analysis of Gene Regulatory Networks.
Zheng, Guangyong; Huang, Tao
2018-01-01
In post-genomic era, an important task is to explore the function of individual biological molecules (i.e., gene, noncoding RNA, protein, metabolite) and their organization in living cells. For this end, gene regulatory networks (GRNs) are constructed to show relationship between biological molecules, in which the vertices of network denote biological molecules and the edges of network present connection between nodes (Strogatz, Nature 410:268-276, 2001; Bray, Science 301:1864-1865, 2003). Biologists can understand not only the function of biological molecules but also the organization of components of living cells through interpreting the GRNs, since a gene regulatory network is a comprehensively physiological map of living cells and reflects influence of genetic and epigenetic factors (Strogatz, Nature 410:268-276, 2001; Bray, Science 301:1864-1865, 2003). In this paper, we will review the inference methods of GRN reconstruction and analysis approaches of network structure. As a powerful tool for studying complex diseases and biological processes, the applications of the network method in pathway analysis and disease gene identification will be introduced.
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
Identifying noncoding risk variants using disease-relevant gene regulatory networks.
Gao, Long; Uzun, Yasin; Gao, Peng; He, Bing; Ma, Xiaoke; Wang, Jiahui; Han, Shizhong; Tan, Kai
2018-02-16
Identifying noncoding risk variants remains a challenging task. Because noncoding variants exert their effects in the context of a gene regulatory network (GRN), we hypothesize that explicit use of disease-relevant GRNs can significantly improve the inference accuracy of noncoding risk variants. We describe Annotation of Regulatory Variants using Integrated Networks (ARVIN), a general computational framework for predicting causal noncoding variants. It employs a set of novel regulatory network-based features, combined with sequence-based features to infer noncoding risk variants. Using known causal variants in gene promoters and enhancers in a number of diseases, we show ARVIN outperforms state-of-the-art methods that use sequence-based features alone. Additional experimental validation using reporter assay further demonstrates the accuracy of ARVIN. Application of ARVIN to seven autoimmune diseases provides a holistic view of the gene subnetwork perturbed by the combinatorial action of the entire set of risk noncoding mutations.
Directory of Open Access Journals (Sweden)
Lior Levy
2017-10-01
Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
Feather development genes and associated regulatory innovation predate the origin of Dinosauria.
Lowe, Craig B; Clarke, Julia A; Baker, Allan J; Haussler, David; Edwards, Scott V
2015-01-01
The evolution of avian feathers has recently been illuminated by fossils and the identification of genes involved in feather patterning and morphogenesis. However, molecular studies have focused mainly on protein-coding genes. Using comparative genomics and more than 600,000 conserved regulatory elements, we show that patterns of genome evolution in the vicinity of feather genes are consistent with a major role for regulatory innovation in the evolution of feathers. Rates of innovation at feather regulatory elements exhibit an extended period of innovation with peaks in the ancestors of amniotes and archosaurs. We estimate that 86% of such regulatory elements and 100% of the nonkeratin feather gene set were present prior to the origin of Dinosauria. On the branch leading to modern birds, we detect a strong signal of regulatory innovation near insulin-like growth factor binding protein (IGFBP) 2 and IGFBP5, which have roles in body size reduction, and may represent a genomic signature for the miniaturization of dinosaurian body size preceding the origin of flight. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas
2014-01-01
Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Gene regulatory and signaling networks exhibit distinct topological distributions of motifs
Ferreira, Gustavo Rodrigues; Nakaya, Helder Imoto; Costa, Luciano da Fontoura
2018-04-01
The biological processes of cellular decision making and differentiation involve a plethora of signaling pathways and gene regulatory circuits. These networks in turn exhibit a multitude of motifs playing crucial parts in regulating network activity. Here we compare the topological placement of motifs in gene regulatory and signaling networks and observe that it suggests different evolutionary strategies in motif distribution for distinct cellular subnetworks.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Directory of Open Access Journals (Sweden)
Min Kyung Sung
2014-12-01
Full Text Available Genome-wide association studies have proven the highly polygenic architecture of complex diseases or traits; therefore, single-locus-based methods are usually unable to detect all involved loci, especially when individual loci exert small effects. Moreover, the majority of associated single-nucleotide polymorphisms resides in non-coding regions, making it difficult to understand their phenotypic contribution. In this work, we studied epistatic interactions associated with three common diseases using Korea Association Resource (KARE data: type 2 diabetes mellitus (DM, hypertension (HT, and coronary artery disease (CAD. We showed that epistatic single-nucleotide polymorphisms (SNPs were enriched in enhancers, as well as in DNase I footprints (the Encyclopedia of DNA Elements [ENCODE] Project Consortium 2012, which suggested that the disruption of the regulatory regions where transcription factors bind may be involved in the disease mechanism. Accordingly, to identify the genes affected by the SNPs, we employed whole-genome multiple-cell-type enhancer data which discovered using DNase I profiles and Cap Analysis Gene Expression (CAGE. Assigned genes were significantly enriched in known disease associated gene sets, which were explored based on the literature, suggesting that this approach is useful for detecting relevant affected genes. In our knowledge-based epistatic network, the three diseases share many associated genes and are also closely related with each other through many epistatic interactions. These findings elucidate the genetic basis of the close relationship between DM, HT, and CAD.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Harnessing diversity towards the reconstructing of large scale gene regulatory networks.
Directory of Open Access Journals (Sweden)
Takeshi Hase
Full Text Available Elucidating gene regulatory network (GRN from large scale experimental data remains a central challenge in systems biology. Recently, numerous techniques, particularly consensus driven approaches combining different algorithms, have become a potentially promising strategy to infer accurate GRNs. Here, we develop a novel consensus inference algorithm, TopkNet that can integrate multiple algorithms to infer GRNs. Comprehensive performance benchmarking on a cloud computing framework demonstrated that (i a simple strategy to combine many algorithms does not always lead to performance improvement compared to the cost of consensus and (ii TopkNet integrating only high-performance algorithms provide significant performance improvement compared to the best individual algorithms and community prediction. These results suggest that a priori determination of high-performance algorithms is a key to reconstruct an unknown regulatory network. Similarity among gene-expression datasets can be useful to determine potential optimal algorithms for reconstruction of unknown regulatory networks, i.e., if expression-data associated with known regulatory network is similar to that with unknown regulatory network, optimal algorithms determined for the known regulatory network can be repurposed to infer the unknown regulatory network. Based on this observation, we developed a quantitative measure of similarity among gene-expression datasets and demonstrated that, if similarity between the two expression datasets is high, TopkNet integrating algorithms that are optimal for known dataset perform well on the unknown dataset. The consensus framework, TopkNet, together with the similarity measure proposed in this study provides a powerful strategy towards harnessing the wisdom of the crowds in reconstruction of unknown regulatory networks.
Establishing neural crest identity: a gene regulatory recipe
Simões-Costa, Marcos; Bronner, Marianne E.
2015-01-01
The neural crest is a stem/progenitor cell population that contributes to a wide variety of derivatives, including sensory and autonomic ganglia, cartilage and bone of the face and pigment cells of the skin. Unique to vertebrate embryos, it has served as an excellent model system for the study of cell behavior and identity owing to its multipotency, motility and ability to form a broad array of cell types. Neural crest development is thought to be controlled by a suite of transcriptional and epigenetic inputs arranged hierarchically in a gene regulatory network. Here, we examine neural crest development from a gene regulatory perspective and discuss how the underlying genetic circuitry results in the features that define this unique cell population. PMID:25564621
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Mingora, Christina; Ewer, Jason; Ospina-Giraldo, Manuel
2014-03-15
We have scanned the Phytophthora infestans, P. ramorum, and P. sojae genomes for the presence of putative pectin methylesterase genes and conducted a sequence analysis of all gene models found. We also searched for potential regulatory motifs in the promoter region of the proposed P. infestans models, and investigated the gene expression levels throughout the course of P. infestans infection on potato plants, using in planta and detached leaf assays. We found that genes located on contiguous chromosomal regions contain similar motifs in the promoter region, indicating the possibility of a shared regulatory mechanism. Results of our investigations also suggest that, during the pathogenicity process, the expression levels of some of the analyzed genes vary considerably when compared to basal expression observed in in vitro cultures of non-sporulating mycelium. These results were observed both in planta and in detached leaf assays. Copyright © 2014 Elsevier B.V. All rights reserved.
Wilczynski, Bartek; Furlong, Eileen E M
2010-04-15
Development is regulated by dynamic patterns of gene expression, which are orchestrated through the action of complex gene regulatory networks (GRNs). Substantial progress has been made in modeling transcriptional regulation in recent years, including qualitative "coarse-grain" models operating at the gene level to very "fine-grain" quantitative models operating at the biophysical "transcription factor-DNA level". Recent advances in genome-wide studies have revealed an enormous increase in the size and complexity or GRNs. Even relatively simple developmental processes can involve hundreds of regulatory molecules, with extensive interconnectivity and cooperative regulation. This leads to an explosion in the number of regulatory functions, effectively impeding Boolean-based qualitative modeling approaches. At the same time, the lack of information on the biophysical properties for the majority of transcription factors within a global network restricts quantitative approaches. In this review, we explore the current challenges in moving from modeling medium scale well-characterized networks to more poorly characterized global networks. We suggest to integrate coarse- and find-grain approaches to model gene regulatory networks in cis. We focus on two very well-studied examples from Drosophila, which likely represent typical developmental regulatory modules across metazoans. Copyright (c) 2009 Elsevier Inc. All rights reserved.
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Regulatory role of XynR (YagI) in catabolism of xylonate in Escherichia coli K-12.
Shimada, Tomohiro; Momiyama, Eri; Yamanaka, Yuki; Watanabe, Hiroki; Yamamoto, Kaneyoshi; Ishihama, Akira
2017-12-01
The genome of Escherichia coli K-12 contains ten cryptic phages, altogether constituting about 3.6% of the genome in sequence. Among more than 200 predicted genes in these cryptic phages, 14 putative transcription factor (TF) genes exist, but their regulatory functions remain unidentified. As an initial attempt to make a breakthrough for understanding the regulatory roles of cryptic phage-encoded TFs, we tried to identify the regulatory function of CP4-6 cryptic prophage-encoded YagI with unknown function. After SELEX screening, YagI was found to bind mainly at a single site within the spacer of bidirectional transcription units, yagA (encoding another uncharacterized TF) and yagEF (encoding 2-keto-3-deoxy gluconate aldolase, and dehydratase, respectively) within this prophage region. YagEF enzymes are involved in the catabolism of xylose downstream from xylonate. We then designated YagI as XynR (regulator of xylonate catabolism), one of the rare single-target TFs. In agreement with this predicted regulatory function, the activity of XynR was suggested to be controlled by xylonate. Even though low-affinity binding sites of XynR were identified in the E. coli K-12 genome, they all were inside open reading frames, implying that the regulation network of XynR is still fixed within the CR4-6 prophage without significant influence over the host E. coli K-12. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner
2014-12-01
Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
CoryneRegNet 4.0 – A reference database for corynebacterial gene regulatory networks
Directory of Open Access Journals (Sweden)
Baumbach Jan
2007-11-01
Full Text Available Abstract Background Detailed information on DNA-binding transcription factors (the key players in the regulation of gene expression and on transcriptional regulatory interactions of microorganisms deduced from literature-derived knowledge, computer predictions and global DNA microarray hybridization experiments, has opened the way for the genome-wide analysis of transcriptional regulatory networks. The large-scale reconstruction of these networks allows the in silico analysis of cell behavior in response to changing environmental conditions. We previously published CoryneRegNet, an ontology-based data warehouse of corynebacterial transcription factors and regulatory networks. Initially, it was designed to provide methods for the analysis and visualization of the gene regulatory network of Corynebacterium glutamicum. Results Now we introduce CoryneRegNet release 4.0, which integrates data on the gene regulatory networks of 4 corynebacteria, 2 mycobacteria and the model organism Escherichia coli K12. As the previous versions, CoryneRegNet provides a web-based user interface to access the database content, to allow various queries, and to support the reconstruction, analysis and visualization of regulatory networks at different hierarchical levels. In this article, we present the further improved database content of CoryneRegNet along with novel analysis features. The network visualization feature GraphVis now allows the inter-species comparisons of reconstructed gene regulatory networks and the projection of gene expression levels onto that networks. Therefore, we added stimulon data directly into the database, but also provide Web Service access to the DNA microarray analysis platform EMMA. Additionally, CoryneRegNet now provides a SOAP based Web Service server, which can easily be consumed by other bioinformatics software systems. Stimulons (imported from the database, or uploaded by the user can be analyzed in the context of known
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.
1998-01-01
Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.
On the Interplay between Entropy and Robustness of Gene Regulatory Networks
Directory of Open Access Journals (Sweden)
Bor-Sen Chen
2010-05-01
Full Text Available The interplay between entropy and robustness of gene network is a core mechanism of systems biology. The entropy is a measure of randomness or disorder of a physical system due to random parameter fluctuation and environmental noises in gene regulatory networks. The robustness of a gene regulatory network, which can be measured as the ability to tolerate the random parameter fluctuation and to attenuate the effect of environmental noise, will be discussed from the robust H∞ stabilization and filtering perspective. In this review, we will also discuss their balancing roles in evolution and potential applications in systems and synthetic biology.
Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M
1999-07-01
The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
Conserved Transcriptional Regulatory Programs Underlying Rice and Barley Germination
Lin, Li; Tian, Shulan; Kaeppler, Shawn; Liu, Zongrang; An, Yong-Qiang (Charles)
2014-01-01
Germination is a biological process important to plant development and agricultural production. Barley and rice diverged 50 million years ago, but share a similar germination process. To gain insight into the conservation of their underlying gene regulatory programs, we compared transcriptomes of barley and rice at start, middle and end points of germination, and revealed that germination regulated barley and rice genes (BRs) diverged significantly in expression patterns and/or protein sequences. However, BRs with higher protein sequence similarity tended to have more conserved expression patterns. We identified and characterized 316 sets of conserved barley and rice genes (cBRs) with high similarity in both protein sequences and expression patterns, and provided a comprehensive depiction of the transcriptional regulatory program conserved in barley and rice germination at gene, pathway and systems levels. The cBRs encoded proteins involved in a variety of biological pathways and had a wide range of expression patterns. The cBRs encoding key regulatory components in signaling pathways often had diverse expression patterns. Early germination up-regulation of cell wall metabolic pathway and peroxidases, and late germination up-regulation of chromatin structure and remodeling pathways were conserved in both barley and rice. Protein sequence and expression pattern of a gene change quickly if it is not subjected to a functional constraint. Preserving germination-regulated expression patterns and protein sequences of those cBRs for 50 million years strongly suggests that the cBRs are functionally significant and equivalent in germination, and contribute to the ancient characteristics of germination preserved in barley and rice. The functional significance and equivalence of the cBR genes predicted here can serve as a foundation to further characterize their biological functions and facilitate bridging rice and barley germination research with greater confidence. PMID
Interrogating the topological robustness of gene regulatory circuits by randomization.
Directory of Open Access Journals (Sweden)
Bin Huang
2017-03-01
Full Text Available One of the most important roles of cells is performing their cellular tasks properly for survival. Cells usually achieve robust functionality, for example, cell-fate decision-making and signal transduction, through multiple layers of regulation involving many genes. Despite the combinatorial complexity of gene regulation, its quantitative behavior has been typically studied on the basis of experimentally verified core gene regulatory circuitry, composed of a small set of important elements. It is still unclear how such a core circuit operates in the presence of many other regulatory molecules and in a crowded and noisy cellular environment. Here we report a new computational method, named random circuit perturbation (RACIPE, for interrogating the robust dynamical behavior of a gene regulatory circuit even without accurate measurements of circuit kinetic parameters. RACIPE generates an ensemble of random kinetic models corresponding to a fixed circuit topology, and utilizes statistical tools to identify generic properties of the circuit. By applying RACIPE to simple toggle-switch-like motifs, we observed that the stable states of all models converge to experimentally observed gene state clusters even when the parameters are strongly perturbed. RACIPE was further applied to a proposed 22-gene network of the Epithelial-to-Mesenchymal Transition (EMT, from which we identified four experimentally observed gene states, including the states that are associated with two different types of hybrid Epithelial/Mesenchymal phenotypes. Our results suggest that dynamics of a gene circuit is mainly determined by its topology, not by detailed circuit parameters. Our work provides a theoretical foundation for circuit-based systems biology modeling. We anticipate RACIPE to be a powerful tool to predict and decode circuit design principles in an unbiased manner, and to quantitatively evaluate the robustness and heterogeneity of gene expression.
International Nuclear Information System (INIS)
Asselman, Jana; Shaw, Joseph R.; Glaholt, Stephen P.; Colbourne, John K.; De Schamphelaere, Karel A.C.
2013-01-01
Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species
Energy Technology Data Exchange (ETDEWEB)
Asselman, Jana, E-mail: jana.asselman@ugent.be [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium); Shaw, Joseph R.; Glaholt, Stephen P. [The School of Public and Environmental Affairs, Indiana University, Bloomington, IN (United States); Colbourne, John K. [School of Biosciences, The University of Birmingham, Birmingham (United Kingdom); De Schamphelaere, Karel A.C. [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium)
2013-10-15
Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species.
The European Regulatory Environment of RNA-Based Vaccines.
Hinz, Thomas; Kallen, Kajo; Britten, Cedrik M; Flamion, Bruno; Granzer, Ulrich; Hoos, Axel; Huber, Christoph; Khleif, Samir; Kreiter, Sebastian; Rammensee, Hans-Georg; Sahin, Ugur; Singh-Jasuja, Harpreet; Türeci, Özlem; Kalinke, Ulrich
2017-01-01
A variety of different mRNA-based drugs are currently in development. This became possible, since major breakthroughs in RNA research during the last decades allowed impressive improvements of translation, stability and delivery of mRNA. This article focuses on antigen-encoding RNA-based vaccines that are either directed against tumors or pathogens. mRNA-encoded vaccines are developed both for preventive or therapeutic purposes. Most mRNA-based vaccines are directly administered to patients. Alternatively, primary autologous cells from cancer patients are modified ex vivo by the use of mRNA and then are adoptively transferred to patients. In the EU no regulatory guidelines presently exist that specifically address mRNA-based vaccines. The existing regulatory framework, however, clearly defines that mRNA-based vaccines in most cases have to be centrally approved. Interestingly, depending on whether RNA-based vaccines are directed against tumors or infectious disease, they are formally considered gene therapy products or not, respectively. Besides an overview on the current clinical use of mRNA vaccines in various therapeutic areas a detailed discussion of the current regulatory situation is provided and regulatory perspectives are discussed.
Wang, Zidong; Liu, Xiaohui; Liu, Yurong; Liang, Jinling; Vinciotti, Veronica
2009-01-01
In this paper, the extended Kalman filter (EKF) algorithm is applied to model the gene regulatory network from gene time series data. The gene regulatory network is considered as a nonlinear dynamic stochastic model that consists of the gene measurement equation and the gene regulation equation. After specifying the model structure, we apply the EKF algorithm for identifying both the model parameters and the actual value of gene expression levels. It is shown that the EKF algorithm is an online estimation algorithm that can identify a large number of parameters (including parameters of nonlinear functions) through iterative procedure by using a small number of observations. Four real-world gene expression data sets are employed to demonstrate the effectiveness of the EKF algorithm, and the obtained models are evaluated from the viewpoint of bioinformatics.
Fused Regression for Multi-source Gene Regulatory Network Inference.
Directory of Open Access Journals (Sweden)
Kari Y Lam
2016-12-01
Full Text Available Understanding gene regulatory networks is critical to understanding cellular differentiation and response to external stimuli. Methods for global network inference have been developed and applied to a variety of species. Most approaches consider the problem of network inference independently in each species, despite evidence that gene regulation can be conserved even in distantly related species. Further, network inference is often confined to single data-types (single platforms and single cell types. We introduce a method for multi-source network inference that allows simultaneous estimation of gene regulatory networks in multiple species or biological processes through the introduction of priors based on known gene relationships such as orthology incorporated using fused regression. This approach improves network inference performance even when orthology mapping and conservation are incomplete. We refine this method by presenting an algorithm that extracts the true conserved subnetwork from a larger set of potentially conserved interactions and demonstrate the utility of our method in cross species network inference. Last, we demonstrate our method's utility in learning from data collected on different experimental platforms.
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Mutual information and the fidelity of response of gene regulatory models
International Nuclear Information System (INIS)
Tabbaa, Omar P; Jayaprakash, C
2014-01-01
We investigate cellular response to extracellular signals by using information theory techniques motivated by recent experiments. We present results for the steady state of the following gene regulatory models found in both prokaryotic and eukaryotic cells: a linear transcription-translation model and a positive or negative auto-regulatory model. We calculate both the information capacity and the mutual information exactly for simple models and approximately for the full model. We find that (1) small changes in mutual information can lead to potentially important changes in cellular response and (2) there are diminishing returns in the fidelity of response as the mutual information increases. We calculate the information capacity using Gillespie simulations of a model for the TNF-α-NF-κ B network and find good agreement with the measured value for an experimental realization of this network. Our results provide a quantitative understanding of the differences in cellular response when comparing experimentally measured mutual information values of different gene regulatory models. Our calculations demonstrate that Gillespie simulations can be used to compute the mutual information of more complex gene regulatory models, providing a potentially useful tool in synthetic biology. (paper)
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Computational challenges in modeling gene regulatory events.
Pataskar, Abhijeet; Tiwari, Vijay K
2016-10-19
Cellular transcriptional programs driven by genetic and epigenetic mechanisms could be better understood by integrating "omics" data and subsequently modeling the gene-regulatory events. Toward this end, computational biology should keep pace with evolving experimental procedures and data availability. This article gives an exemplified account of the current computational challenges in molecular biology.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Kirm, Benjamin; Magdevska, Vasilka; Tome, Miha; Horvat, Marinka; Karničar, Katarina; Petek, Marko; Vidmar, Robert; Baebler, Spela; Jamnik, Polona; Fujs, Štefan; Horvat, Jaka; Fonovič, Marko; Turk, Boris; Gruden, Kristina; Petković, Hrvoje; Kosec, Gregor
2013-12-17
Erythromycin is a medically important antibiotic, biosynthesized by the actinomycete Saccharopolyspora erythraea. Genes encoding erythromycin biosynthesis are organized in a gene cluster, spanning over 60 kbp of DNA. Most often, gene clusters encoding biosynthesis of secondary metabolites contain regulatory genes. In contrast, the erythromycin gene cluster does not contain regulatory genes and regulation of its biosynthesis has therefore remained poorly understood, which has for a long time limited genetic engineering approaches for erythromycin yield improvement. We used a comparative proteomic approach to screen for potential regulatory proteins involved in erythromycin biosynthesis. We have identified a putative regulatory protein SACE_5599 which shows significantly higher levels of expression in an erythromycin high-producing strain, compared to the wild type S. erythraea strain. SACE_5599 is a member of an uncharacterized family of putative regulatory genes, located in several actinomycete biosynthetic gene clusters. Importantly, increased expression of SACE_5599 was observed in the complex fermentation medium and at controlled bioprocess conditions, simulating a high-yield industrial fermentation process in the bioreactor. Inactivation of SACE_5599 in the high-producing strain significantly reduced erythromycin yield, in addition to drastically decreasing sporulation intensity of the SACE_5599-inactivated strains when cultivated on ABSM4 agar medium. In contrast, constitutive overexpression of SACE_5599 in the wild type NRRL23338 strain resulted in an increase of erythromycin yield by 32%. Similar yield increase was also observed when we overexpressed the bldD gene, a previously identified regulator of erythromycin biosynthesis, thereby for the first time revealing its potential for improving erythromycin biosynthesis. SACE_5599 is the second putative regulatory gene to be identified in S. erythraea which has positive influence on erythromycin yield. Like bld
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
Energy Technology Data Exchange (ETDEWEB)
Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.
2003-06-01
OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
Directory of Open Access Journals (Sweden)
Dasgupta Dipayan
2005-05-01
Full Text Available Abstract Background Global regulatory mechanisms involving chromatin assembly and remodelling in the promoter regions of genes is implicated in eukaryotic transcription control especially for genes subjected to spatial and temporal regulation. The potential to utilise global regulatory mechanisms for controlling gene expression might depend upon the architecture of the chromatin in and around the gene. In-silico analysis can yield important insights into this aspect, facilitating comparison of two or more classes of genes comprising of a large number of genes within each group. Results In the present study, we carried out a comparative analysis of chromatin characteristics in terms of the scaffold/matrix attachment regions, nucleosome formation potential and the occurrence of repetitive sequences, in the upstream regulatory regions of housekeeping and tissue specific genes. Our data show that putative scaffold/matrix attachment regions are more abundant and nucleosome formation potential is higher in the 5' regions of tissue specific genes as compared to the housekeeping genes. Conclusion The differences in the chromatin features between the two groups of genes indicate the involvement of chromatin organisation in the control of gene expression. The presence of global regulatory mechanisms mediated through chromatin organisation can decrease the burden of invoking gene specific regulators for maintenance of the active/silenced state of gene expression. This could partially explain the lower number of genes estimated in the human genome.
O’Keeffe, Triona; Hill, Colin; Ross, R. Paul
1999-01-01
Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Portrait of Candida Species Biofilm Regulatory Network Genes.
Araújo, Daniela; Henriques, Mariana; Silva, Sónia
2017-01-01
Most cases of candidiasis have been attributed to Candida albicans, but Candida glabrata, Candida parapsilosis and Candida tropicalis, designated as non-C. albicans Candida (NCAC), have been identified as frequent human pathogens. Moreover, Candida biofilms are an escalating clinical problem associated with significant rates of mortality. Biofilms have distinct developmental phases, including adhesion/colonisation, maturation and dispersal, controlled by complex regulatory networks. This review discusses recent advances regarding Candida species biofilm regulatory network genes, which are key components for candidiasis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Manz, Judith; Rodríguez, Elke; ElSharawy, Abdou; Oesau, Eva-Maria; Petersen, Britt-Sabina; Baurecht, Hansjörg; Mayr, Gabriele; Weber, Susanne; Harder, Jürgen; Reischl, Eva; Schwarz, Agatha; Novak, Natalija; Franke, Andre; Weidinger, Stephan
2016-12-01
Gene-mapping studies have consistently identified a susceptibility locus for atopic dermatitis and other inflammatory diseases on chromosome band 11q13.5, with the strongest association observed for a common variant located in an intergenic region between the two annotated genes C11orf30 and LRRC32. Using a targeted resequencing approach we identified low-frequency and rare missense mutations within the LRRC32 gene encoding the protein GARP, a receptor on activated regulatory T cells that binds latent transforming growth factor-β. Subsequent association testing in more than 2,000 atopic dermatitis patients and 2,000 control subjects showed a significant excess of these LRRC32 variants in individuals with atopic dermatitis. Structural protein modeling and bioinformatic analysis predicted a disruption of protein transport upon these variants, and overexpression assays in CD4 + CD25 - T cells showed a significant reduction in surface expression of the mutated protein. Consistently, flow cytometric (FACS) analyses of different T-cell subtypes obtained from atopic dermatitis patients showed a significantly reduced surface expression of GARP and a reduced conversion of CD4 + CD25 - T cells into regulatory T cells, along with lower expression of latency-associated protein upon stimulation in carriers of the LRRC32 A407T variant. These results link inherited disturbances of transforming growth factor-β signaling with atopic dermatitis risk. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Directory of Open Access Journals (Sweden)
Xiaodong Cai
Full Text Available Integrating genetic perturbations with gene expression data not only improves accuracy of regulatory network topology inference, but also enables learning of causal regulatory relations between genes. Although a number of methods have been developed to integrate both types of data, the desiderata of efficient and powerful algorithms still remains. In this paper, sparse structural equation models (SEMs are employed to integrate both gene expression data and cis-expression quantitative trait loci (cis-eQTL, for modeling gene regulatory networks in accordance with biological evidence about genes regulating or being regulated by a small number of genes. A systematic inference method named sparsity-aware maximum likelihood (SML is developed for SEM estimation. Using simulated directed acyclic or cyclic networks, the SML performance is compared with that of two state-of-the-art algorithms: the adaptive Lasso (AL based scheme, and the QTL-directed dependency graph (QDG method. Computer simulations demonstrate that the novel SML algorithm offers significantly better performance than the AL-based and QDG algorithms across all sample sizes from 100 to 1,000, in terms of detection power and false discovery rate, in all the cases tested that include acyclic or cyclic networks of 10, 30 and 300 genes. The SML method is further applied to infer a network of 39 human genes that are related to the immune function and are chosen to have a reliable eQTL per gene. The resulting network consists of 9 genes and 13 edges. Most of the edges represent interactions reasonably expected from experimental evidence, while the remaining may just indicate the emergence of new interactions. The sparse SEM and efficient SML algorithm provide an effective means of exploiting both gene expression and perturbation data to infer gene regulatory networks. An open-source computer program implementing the SML algorithm is freely available upon request.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
Gene activated by growth factors is related to the oncogene v-jun
International Nuclear Information System (INIS)
Ryder, K.; Lau, L.F.; Nathans, D.
1988-01-01
The authors have recently identified by cDNA cloning a set of genes that are rapidly activated in cultured mouse cells by protein growth factors. Here they report that the nucleotide sequence of a cDNA (clone 465) derived from one of these immediate early genes (hereafter called jun-B) encodes a protein homologous to that encoded by the avian sarcoma virus 17 oncogene v-jun. Homology between the jun-B and v-jun proteins is in two regions: one near the N terminus and the other at the C terminus. The latter sequence was shown to have regions of sequence similarity to the DNA-binding domain of the yeast transcriptional regulatory protein GCN4 and to the oncogenic protein fos. Southern blots of human, mouse, and chicken DNA demonstrate that jun-B and c-jun are different genes and that there may be other vertebrate genes related to jun-B and c-jun. These findings suggest that there is a jun family of genes encoding related transcriptional regulatory proteins. The jun-B protein, and perhaps other members of the jun family, may play a role in regulating the genomic response to growth factors
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Directory of Open Access Journals (Sweden)
Zara Ghodsi
2017-03-01
Full Text Available In developmental studies, inferring regulatory interactions of segmentation genetic network play a vital role in unveiling the mechanism of pattern formation. As such, there exists an opportune demand for theoretical developments and new mathematical models which can result in a more accurate illustration of this genetic network. Accordingly, this paper seeks to extract the meaningful regulatory role of the maternal effect genes using a variety of causality detection techniques and to explore whether these methods can suggest a new analytical view to the gene regulatory networks. We evaluate the use of three different powerful and widely-used models representing time and frequency domain Granger causality and convergent cross mapping technique with the results being thoroughly evaluated for statistical significance. Our findings show that the regulatory role of maternal effect genes is detectable in different time classes and thereby the method is applicable to infer the possible regulatory interactions present among the other genes of this network.
A saturation screen for cis-acting regulatory DNA in the Hox genes of Ciona intestinalis
Energy Technology Data Exchange (ETDEWEB)
Keys, David N.; Lee, Byung-in; Di Gregorio, Anna; Harafuji, Naoe; Detter, Chris; Wang, Mei; Kahsai, Orsalem; Ahn, Sylvia; Arellano, Andre; Zhang, Quin; Trong, Stephan; Doyle, Sharon A.; Satoh, Noriyuki; Satou, Yutaka; Saiga, Hidetoshi; Christian, Allen; Rokhsar, Dan; Hawkins, Trevor L.; Levine, Mike; Richardson, Paul
2005-01-05
A screen for the systematic identification of cis-regulatory elements within large (>100 kb) genomic domains containing Hox genes was performed by using the basal chordate Ciona intestinalis. Randomly generated DNA fragments from bacterial artificial chromosomes containing two clusters of Hox genes were inserted into a vector upstream of a minimal promoter and lacZ reporter gene. A total of 222 resultant fusion genes were separately electroporated into fertilized eggs, and their regulatory activities were monitored in larvae. In sum, 21 separable cis-regulatory elements were found. These include eight Hox linked domains that drive expression in nested anterior-posterior domains of ectodermally derived tissues. In addition to vertebrate-like CNS regulation, the discovery of cis-regulatory domains that drive epidermal transcription suggests that C. intestinalis has arthropod-like Hox patterning in the epidermis.
Directory of Open Access Journals (Sweden)
A.N. Deryabin
2016-05-01
Full Text Available The expression of heterologous genes in plants is an effective method to improve our understanding of plant resistance mechanisms. The purpose of this work was to investigate the involvement of cell-wall invertase and apoplastic sugars into constitutive cold resistance of potato (Solanum tuberosum L., cv. Dйsirйe plants, which expressed the yeast SUC2 gene encoding apoplastic invertase. WT-plants of a potato served as the control. The increase in the essential cell-wall invertase activity in the leaves of transformed plants indicates significant changes in the cellular carbohydrate metabolism and regulatory function of this enzyme. The activity of yeast invertase changed the composition of intracellular sugars in the leaves of the transformed potato plant. The total content of sugars (sucrose, glucose, fructose in the leaves and apoplast was higher in the transformants, in comparison by WT-plants. Our data indicate higher constitutive resistance of transformants to severe hypothermia conditions compared to WT-plants. This fact allows us to consider cell-wall invertase as a enzyme of carbohydrate metabolism playing an important regulatory role in the metabolic signaling upon forming increased plant resistance to low temperature. Thus, the potato line with the integrated SUC2 gene is a convenient tool to study the role of the apoplastic invertase and the products of its activity during growth, development and formation constitutive resistance to hypothermia.
Simple mathematical models of gene regulatory dynamics
Mackey, Michael C; Tyran-Kamińska, Marta; Zeron, Eduardo S
2016-01-01
This is a short and self-contained introduction to the field of mathematical modeling of gene-networks in bacteria. As an entry point to the field, we focus on the analysis of simple gene-network dynamics. The notes commence with an introduction to the deterministic modeling of gene-networks, with extensive reference to applicable results coming from dynamical systems theory. The second part of the notes treats extensively several approaches to the study of gene-network dynamics in the presence of noise—either arising from low numbers of molecules involved, or due to noise external to the regulatory process. The third and final part of the notes gives a detailed treatment of three well studied and concrete examples of gene-network dynamics by considering the lactose operon, the tryptophan operon, and the lysis-lysogeny switch. The notes contain an index for easy location of particular topics as well as an extensive bibliography of the current literature. The target audience of these notes are mainly graduat...
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Fractal gene regulatory networks for robust locomotion control of modular robots
DEFF Research Database (Denmark)
Zahadat, Payam; Christensen, David Johan; Schultz, Ulrik Pagh
2010-01-01
Designing controllers for modular robots is difficult due to the distributed and dynamic nature of the robots. In this paper fractal gene regulatory networks are evolved to control modular robots in a distributed way. Experiments with different morphologies of modular robot are performed and the ......Designing controllers for modular robots is difficult due to the distributed and dynamic nature of the robots. In this paper fractal gene regulatory networks are evolved to control modular robots in a distributed way. Experiments with different morphologies of modular robot are performed...
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
Kordmahalleh, Mina Moradi; Sefidmazgi, Mohammad Gorji; Harrison, Scott H; Homaifar, Abdollah
2017-01-01
The modeling of genetic interactions within a cell is crucial for a basic understanding of physiology and for applied areas such as drug design. Interactions in gene regulatory networks (GRNs) include effects of transcription factors, repressors, small metabolites, and microRNA species. In addition, the effects of regulatory interactions are not always simultaneous, but can occur after a finite time delay, or as a combined outcome of simultaneous and time delayed interactions. Powerful biotechnologies have been rapidly and successfully measuring levels of genetic expression to illuminate different states of biological systems. This has led to an ensuing challenge to improve the identification of specific regulatory mechanisms through regulatory network reconstructions. Solutions to this challenge will ultimately help to spur forward efforts based on the usage of regulatory network reconstructions in systems biology applications. We have developed a hierarchical recurrent neural network (HRNN) that identifies time-delayed gene interactions using time-course data. A customized genetic algorithm (GA) was used to optimize hierarchical connectivity of regulatory genes and a target gene. The proposed design provides a non-fully connected network with the flexibility of using recurrent connections inside the network. These features and the non-linearity of the HRNN facilitate the process of identifying temporal patterns of a GRN. Our HRNN method was implemented with the Python language. It was first evaluated on simulated data representing linear and nonlinear time-delayed gene-gene interaction models across a range of network sizes and variances of noise. We then further demonstrated the capability of our method in reconstructing GRNs of the Saccharomyces cerevisiae synthetic network for in vivo benchmarking of reverse-engineering and modeling approaches (IRMA). We compared the performance of our method to TD-ARACNE, HCC-CLINDE, TSNI and ebdbNet across different network
The Association between Infants' Self-Regulatory Behavior and MAOA Gene Polymorphism
Zhang, Minghao; Chen, Xinyin; Way, Niobe; Yoshikawa, Hirokazu; Deng, Huihua; Ke, Xiaoyan; Yu, Weiwei; Chen, Ping; He, Chuan; Chi, Xia; Lu, Zuhong
2011-01-01
Self-regulatory behavior in early childhood is an important characteristic that has considerable implications for the development of adaptive and maladaptive functioning. The present study investigated the relations between a functional polymorphism in the upstream region of monoamine oxidase A gene (MAOA) and self-regulatory behavior in a sample…
Identifying Regulatory Patterns at the 3'end Regions of Over-expressed and Under-expressed Genes
Othoum, Ghofran K
2013-05-01
Promoters, neighboring regulatory regions and those extending further upstream of the 5’end of genes, are considered one of the main components affecting the expression status of genes in a specific phenotype. More recently research by Chen et al. (2006, 2012) and Mapendano et al. (2010) demonstrated that the 3’end regulatory regions of genes also influence gene expression. However, the association between the regulatory regions surrounding 3’end of genes and their over- or under-expression status in a particular phenotype has not been systematically studied. The aim of this study is to ascertain if regulatory regions surrounding the 3’end of genes contain sufficient regulatory information to correlate genes with their expression status in a particular phenotype. Over- and under-expressed ovarian cancer (OC) genes were used as a model. Exploratory analysis of the 3’end regions were performed by transforming the annotated regions using principal component analysis (PCA), followed by clustering the transformed data thereby achieving a clear separation of genes with different expression status. Additionally, several classification algorithms such as Naïve Bayes, Random Forest and Support Vector Machine (SVM) were tested with different parameter settings to analyze the discriminatory capacity of the 3’end regions of genes related to their gene expression status. The best performance was achieved using the SVM classification model with 10-fold cross-validation that yielded an accuracy of 98.4%, sensitivity of 99.5% and specificity of 92.5%. For gene expression status for newly available instances, based on information derived from the 3’end regions, an SVM predictive model was developed with 10-fold cross-validation that yielded an accuracy of 67.0%, sensitivity of 73.2% and specificity of 61.0%. Moreover, building an SVM with polynomial kernel model to PCA transformed data yielded an accuracy of 83.1%, sensitivity of 92.5% and specificity of 74.8% using
Identifying Regulatory Patterns at the 3'end Regions of Over-expressed and Under-expressed Genes
Othoum, Ghofran K
2013-01-01
Promoters, neighboring regulatory regions and those extending further upstream of the 5’end of genes, are considered one of the main components affecting the expression status of genes in a specific phenotype. More recently research by Chen et al. (2006, 2012) and Mapendano et al. (2010) demonstrated that the 3’end regulatory regions of genes also influence gene expression. However, the association between the regulatory regions surrounding 3’end of genes and their over- or under-expression status in a particular phenotype has not been systematically studied. The aim of this study is to ascertain if regulatory regions surrounding the 3’end of genes contain sufficient regulatory information to correlate genes with their expression status in a particular phenotype. Over- and under-expressed ovarian cancer (OC) genes were used as a model. Exploratory analysis of the 3’end regions were performed by transforming the annotated regions using principal component analysis (PCA), followed by clustering the transformed data thereby achieving a clear separation of genes with different expression status. Additionally, several classification algorithms such as Naïve Bayes, Random Forest and Support Vector Machine (SVM) were tested with different parameter settings to analyze the discriminatory capacity of the 3’end regions of genes related to their gene expression status. The best performance was achieved using the SVM classification model with 10-fold cross-validation that yielded an accuracy of 98.4%, sensitivity of 99.5% and specificity of 92.5%. For gene expression status for newly available instances, based on information derived from the 3’end regions, an SVM predictive model was developed with 10-fold cross-validation that yielded an accuracy of 67.0%, sensitivity of 73.2% and specificity of 61.0%. Moreover, building an SVM with polynomial kernel model to PCA transformed data yielded an accuracy of 83.1%, sensitivity of 92.5% and specificity of 74.8% using
Regulatory polymorphisms in the cyclophilin A gene, PPIA, accelerate progression to AIDS.
Directory of Open Access Journals (Sweden)
Ping An
2007-06-01
Full Text Available Human cyclophilin A, or CypA, encoded by the gene peptidyl prolyl isomerase A (PPIA, is incorporated into the HIV type 1 (HIV-1 virion and promotes HIV-1 infectivity by facilitating virus uncoating. We examined the effect of single nucleotide polymorphisms (SNPs and haplotypes within the PPIA gene on HIV-1 infection and disease progression in five HIV-1 longitudinal history cohorts. Kaplan-Meier survival statistics and Cox proportional hazards model were used to assess time to AIDS outcomes. Among eight SNPs tested, two promoter SNPs (SNP3 and SNP4 in perfect linkage disequilibrium were associated with more rapid CD4(+ T-cell loss (relative hazard = 3.7, p = 0.003 in African Americans. Among European Americans, these alleles were also associated with a significant trend to more rapid progression to AIDS in a multi-point categorical analysis (p = 0.005. Both SNPs showed differential nuclear protein-binding efficiencies in a gel shift assay. In addition, one SNP (SNP5 located in the 5' UTR previously shown to be associated with higher ex vivo HIV-1 replication was found to be more frequent in HIV-1-positive individuals than in those highly exposed uninfected individuals. These results implicate regulatory PPIA polymorphisms as a component of genetic susceptibility to HIV-1 infection or disease progression, affirming the important role of PPIA in HIV-1 pathogenesis.
Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.
Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav
2007-08-01
Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.
Inherited variants in regulatory T cell genes and outcome of ovarian cancer.
Directory of Open Access Journals (Sweden)
Ellen L Goode
Full Text Available Although ovarian cancer is the most lethal of gynecologic malignancies, wide variation in outcome following conventional therapy continues to exist. The presence of tumor-infiltrating regulatory T cells (Tregs has a role in outcome of this disease, and a growing body of data supports the existence of inherited prognostic factors. However, the role of inherited variants in genes encoding Treg-related immune molecules has not been fully explored. We analyzed expression quantitative trait loci (eQTL and sequence-based tagging single nucleotide polymorphisms (tagSNPs for 54 genes associated with Tregs in 3,662 invasive ovarian cancer cases. With adjustment for known prognostic factors, suggestive results were observed among rarer histological subtypes; poorer survival was associated with minor alleles at SNPs in RGS1 (clear cell, rs10921202, p=2.7×10(-5, LRRC32 and TNFRSF18/TNFRSF4 (mucinous, rs3781699, p=4.5×10(-4, and rs3753348, p=9.0×10(-4, respectively, and CD80 (endometrioid, rs13071247, p=8.0×10(-4. Fo0r the latter, correlative data support a CD80 rs13071247 genotype association with CD80 tumor RNA expression (p=0.006. An additional eQTL SNP in CD80 was associated with shorter survival (rs7804190, p=8.1×10(-4 among all cases combined. As the products of these genes are known to affect induction, trafficking, or immunosuppressive function of Tregs, these results suggest the need for follow-up phenotypic studies.
Inherited variants in regulatory T cell genes and outcome of ovarian cancer.
Goode, Ellen L; DeRycke, Melissa; Kalli, Kimberly R; Oberg, Ann L; Cunningham, Julie M; Maurer, Matthew J; Fridley, Brooke L; Armasu, Sebastian M; Serie, Daniel J; Ramar, Priya; Goergen, Krista; Vierkant, Robert A; Rider, David N; Sicotte, Hugues; Wang, Chen; Winterhoff, Boris; Phelan, Catherine M; Schildkraut, Joellen M; Weber, Rachel P; Iversen, Ed; Berchuck, Andrew; Sutphen, Rebecca; Birrer, Michael J; Hampras, Shalaka; Preus, Leah; Gayther, Simon A; Ramus, Susan J; Wentzensen, Nicolas; Yang, Hannah P; Garcia-Closas, Montserrat; Song, Honglin; Tyrer, Jonathan; Pharoah, Paul P D; Konecny, Gottfried; Sellers, Thomas A; Ness, Roberta B; Sucheston, Lara E; Odunsi, Kunle; Hartmann, Lynn C; Moysich, Kirsten B; Knutson, Keith L
2013-01-01
Although ovarian cancer is the most lethal of gynecologic malignancies, wide variation in outcome following conventional therapy continues to exist. The presence of tumor-infiltrating regulatory T cells (Tregs) has a role in outcome of this disease, and a growing body of data supports the existence of inherited prognostic factors. However, the role of inherited variants in genes encoding Treg-related immune molecules has not been fully explored. We analyzed expression quantitative trait loci (eQTL) and sequence-based tagging single nucleotide polymorphisms (tagSNPs) for 54 genes associated with Tregs in 3,662 invasive ovarian cancer cases. With adjustment for known prognostic factors, suggestive results were observed among rarer histological subtypes; poorer survival was associated with minor alleles at SNPs in RGS1 (clear cell, rs10921202, p=2.7×10(-5)), LRRC32 and TNFRSF18/TNFRSF4 (mucinous, rs3781699, p=4.5×10(-4), and rs3753348, p=9.0×10(-4), respectively), and CD80 (endometrioid, rs13071247, p=8.0×10(-4)). Fo0r the latter, correlative data support a CD80 rs13071247 genotype association with CD80 tumor RNA expression (p=0.006). An additional eQTL SNP in CD80 was associated with shorter survival (rs7804190, p=8.1×10(-4)) among all cases combined. As the products of these genes are known to affect induction, trafficking, or immunosuppressive function of Tregs, these results suggest the need for follow-up phenotypic studies.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Jia, Bin; Wang, Xiaodong
2013-12-17
: The extended Kalman filter (EKF) has been applied to inferring gene regulatory networks. However, it is well known that the EKF becomes less accurate when the system exhibits high nonlinearity. In addition, certain prior information about the gene regulatory network exists in practice, and no systematic approach has been developed to incorporate such prior information into the Kalman-type filter for inferring the structure of the gene regulatory network. In this paper, an inference framework based on point-based Gaussian approximation filters that can exploit the prior information is developed to solve the gene regulatory network inference problem. Different point-based Gaussian approximation filters, including the unscented Kalman filter (UKF), the third-degree cubature Kalman filter (CKF3), and the fifth-degree cubature Kalman filter (CKF5) are employed. Several types of network prior information, including the existing network structure information, sparsity assumption, and the range constraint of parameters, are considered, and the corresponding filters incorporating the prior information are developed. Experiments on a synthetic network of eight genes and the yeast protein synthesis network of five genes are carried out to demonstrate the performance of the proposed framework. The results show that the proposed methods provide more accurate inference results than existing methods, such as the EKF and the traditional UKF.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Liu, Junli; Liu, Jianjian; Chen, Aiqun; Ji, Minjie; Chen, Jiadong; Yang, Xiaofeng; Gu, Mian; Qu, Hongye; Xu, Guohua
2016-10-01
In plants, the plasma membrane H(+)-ATPase (HA) is considered to play a crucial role in regulating plant growth and respoding to environment stresses. Multiple paralogous genes encoding different isozymes of HA have been identified and characterized in several model plants, while limited information of the HA gene family is available to date for tomato. Here, we describe the molecular and expression features of eight HA-encoding genes (SlHA1-8) from tomato. All these genes are interrupted by multiple introns with conserved positions. SlHA1, 2, and 4 were widely expressed in all tissues, while SlHA5, 6, and 7 were almost only expressed in flowers. SlHA8, the transcripts of which were barely detectable under normal or nutrient-/salt-stress growth conditions, was strongly activated in arbuscular mycorrhizal (AM) fungal-colonized roots. Extreme lack of SlHA8 expression in M161, a mutant defective to AM fungal colonization, provided genetic evidence towards the dependence of its expression on AM symbiosis. A 1521-bp SlHA8 promoter could direct the GUS reporter expression specifically in colonized cells of transgenic tobacco, soybean, and rice mycorrhizal roots. Promoter deletion assay revealed a 223-bp promoter fragment of SlHA8 containing a variant of AM-specific cis-element MYCS (vMYCS) sufficient to confer the AM-induced activity. Targeted deletion of this motif in the corresponding promoter region causes complete abolishment of GUS staining in mycorrhizal roots. Together, these results lend cogent evidence towards the evolutionary conservation of a potential regulatory mechanism mediating the activation of AM-responsive HA genes in diverse mycorrhizal plant species.
Comparison of evolutionary algorithms in gene regulatory network model inference.
LENUS (Irish Health Repository)
2010-01-01
ABSTRACT: BACKGROUND: The evolution of high throughput technologies that measure gene expression levels has created a data base for inferring GRNs (a process also known as reverse engineering of GRNs). However, the nature of these data has made this process very difficult. At the moment, several methods of discovering qualitative causal relationships between genes with high accuracy from microarray data exist, but large scale quantitative analysis on real biological datasets cannot be performed, to date, as existing approaches are not suitable for real microarray data which are noisy and insufficient. RESULTS: This paper performs an analysis of several existing evolutionary algorithms for quantitative gene regulatory network modelling. The aim is to present the techniques used and offer a comprehensive comparison of approaches, under a common framework. Algorithms are applied to both synthetic and real gene expression data from DNA microarrays, and ability to reproduce biological behaviour, scalability and robustness to noise are assessed and compared. CONCLUSIONS: Presented is a comparison framework for assessment of evolutionary algorithms, used to infer gene regulatory networks. Promising methods are identified and a platform for development of appropriate model formalisms is established.
Singular Perturbation Analysis and Gene Regulatory Networks with Delay
Shlykova, Irina; Ponosov, Arcady
2009-09-01
There are different ways of how to model gene regulatory networks. Differential equations allow for a detailed description of the network's dynamics and provide an explicit model of the gene concentration changes over time. Production and relative degradation rate functions used in such models depend on the vector of steeply sloped threshold functions which characterize the activity of genes. The most popular example of the threshold functions comes from the Boolean network approach, where the threshold functions are given by step functions. The system of differential equations becomes then piecewise linear. The dynamics of this system can be described very easily between the thresholds, but not in the switching domains. For instance this approach fails to analyze stationary points of the system and to define continuous solutions in the switching domains. These problems were studied in [2], [3], but the proposed model did not take into account a time delay in cellular systems. However, analysis of real gene expression data shows a considerable number of time-delayed interactions suggesting that time delay is essential in gene regulation. Therefore, delays may have a great effect on the dynamics of the system presenting one of the critical factors that should be considered in reconstruction of gene regulatory networks. The goal of this work is to apply the singular perturbation analysis to certain systems with delay and to obtain an analog of Tikhonov's theorem, which provides sufficient conditions for constracting the limit system in the delay case.
The capacity for multistability in small gene regulatory networks
Directory of Open Access Journals (Sweden)
Grotewold Erich
2009-09-01
Full Text Available Abstract Background Recent years have seen a dramatic increase in the use of mathematical modeling to gain insight into gene regulatory network behavior across many different organisms. In particular, there has been considerable interest in using mathematical tools to understand how multistable regulatory networks may contribute to developmental processes such as cell fate determination. Indeed, such a network may subserve the formation of unicellular leaf hairs (trichomes in the model plant Arabidopsis thaliana. Results In order to investigate the capacity of small gene regulatory networks to generate multiple equilibria, we present a chemical reaction network (CRN-based modeling formalism and describe a number of methods for CRN analysis in a parameter-free context. These methods are compared and applied to a full set of one-component subnetworks, as well as a large random sample from 40,680 similarly constructed two-component subnetworks. We find that positive feedback and cooperativity mediated by transcription factor (TF dimerization is a requirement for one-component subnetwork bistability. For subnetworks with two components, the presence of these processes increases the probability that a randomly sampled subnetwork will exhibit multiple equilibria, although we find several examples of bistable two-component subnetworks that do not involve cooperative TF-promoter binding. In the specific case of epidermal differentiation in Arabidopsis, dimerization of the GL3-GL1 complex and cooperative sequential binding of GL3-GL1 to the CPC promoter are each independently sufficient for bistability. Conclusion Computational methods utilizing CRN-specific theorems to rule out bistability in small gene regulatory networks are far superior to techniques generally applicable to deterministic ODE systems. Using these methods to conduct an unbiased survey of parameter-free deterministic models of small networks, and the Arabidopsis epidermal cell
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
Directory of Open Access Journals (Sweden)
Simon Marissa K
2012-11-01
Full Text Available Abstract Background The INNER NO OUTER (INO gene, which encodes a YABBY-type transcription factor, specifies and promotes the growth of the outer integument of the ovule in Arabidopsis. INO expression is limited to the abaxial cell layer of the developing outer integument of the ovule and is regulated by multiple regions of the INO promoter, including POS9, a positive element that when present in quadruplicate can produce low-level expression in the normal INO pattern. Results Significant redundancy in activity between different regions of the INO promoter is demonstrated. For specific regulatory elements, multimerization or the addition of the cauliflower mosaic virus 35S general enhancer was able to activate expression of reporter gene constructs that were otherwise incapable of expression on their own. A new promoter element, POS6, is defined and is shown to include sufficient positive regulatory information to reproduce the endogenous pattern of expression in ovules, but other promoter regions are necessary to fully suppress expression outside of ovules. The full-length INO promoter, but not any of the INO promoter deletions tested, is able to act as an enhancer-blocking insulator to prevent the ectopic activation of expression by the 35S enhancer. Sequence conservation between the promoter regions of Arabidopsis thaliana, Brassica oleracea and Brassica rapa aligns closely with the functional definition of the POS6 and POS9 regions, and with a defined INO minimal promoter. The B. oleracea INO promoter is sufficient to promote a similar pattern and level of reporter gene expression in Arabidopsis to that observed for the Arabidopsis promoter. Conclusions At least two independent regions of the INO promoter contain sufficient regulatory information to direct the specific pattern but not the level of INO gene expression. These regulatory regions act in a partially redundant manner to promote the expression in a specific pattern in the ovule and
On the role of sparseness in the evolution of modularity in gene regulatory networks.
Espinosa-Soto, Carlos
2018-05-01
Modularity is a widespread property in biological systems. It implies that interactions occur mainly within groups of system elements. A modular arrangement facilitates adjustment of one module without perturbing the rest of the system. Therefore, modularity of developmental mechanisms is a major factor for evolvability, the potential to produce beneficial variation from random genetic change. Understanding how modularity evolves in gene regulatory networks, that create the distinct gene activity patterns that characterize different parts of an organism, is key to developmental and evolutionary biology. One hypothesis for the evolution of modules suggests that interactions between some sets of genes become maladaptive when selection favours additional gene activity patterns. The removal of such interactions by selection would result in the formation of modules. A second hypothesis suggests that modularity evolves in response to sparseness, the scarcity of interactions within a system. Here I simulate the evolution of gene regulatory networks and analyse diverse experimentally sustained networks to study the relationship between sparseness and modularity. My results suggest that sparseness alone is neither sufficient nor necessary to explain modularity in gene regulatory networks. However, sparseness amplifies the effects of forms of selection that, like selection for additional gene activity patterns, already produce an increase in modularity. That evolution of new gene activity patterns is frequent across evolution also supports that it is a major factor in the evolution of modularity. That sparseness is widespread across gene regulatory networks indicates that it may have facilitated the evolution of modules in a wide variety of cases.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
Longo, Francesca; Motta, Sara; Mauri, Pierluigi; Landini, Paolo; Rossi, Elio
2016-11-25
In the bacterium Escherichia coli, some intermediates of the sulfate assimilation and cysteine biosynthesis pathway can act as signal molecules and modulate gene expression. In addition to sensing and utilization of sulphur sources, these signaling mechanisms also impact more global cell processes, such as resistance to antimicrobial agents and biofilm formation. In a recent work, we have shown that inactivation of the cysH gene, encoding phosphoadenosine-phosphosulfate (PAPS) reductase, and the consequent increase in intracellular PAPS concentration, strongly affect production of several cell surface-associated structures, enhancing surface adhesion and cell aggregation. In order to identify the molecular mechanism relaying intracellular PAPS concentration to regulation of cell surface-associated structures, we looked for mutations able to suppress the effects of cysH inactivation. We found that mutations in the adenylate cyclase-encoding cyaA gene abolished the effects of PAPS accumulation; consistent with this result, cyclic AMP (cAMP)-dependent gene expression appears to be increased in the cysH mutant. Experiments aimed at the direct identification of proteins interacting with either CysC or CysH, i.e. the PAPS-related proteins APS kinase and PAPS reductase, allowed us to identify several regulators, namely, CspC, CspE, HNS and HupA. Protein-protein interaction between HupA and CysH was confirmed by a bacterial two hybrid system, and inactivation of the hupA gene enhanced the effects of the cysH mutation in terms of production of cell surface-associated factors. Our results indicate that PAPS can modulate different regulatory systems, providing evidence that this molecule acts as a global signal molecule in E. coli. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
The gene regulatory network for breast cancer: Integrated regulatory landscape of cancer hallmarks
Directory of Open Access Journals (Sweden)
Frank eEmmert-Streib
2014-02-01
Full Text Available In this study, we infer the breast cancer gene regulatory network from gene expression data. This network is obtained from the application of the BC3Net inference algorithm to a large-scale gene expression data set consisting of $351$ patient samples. In order to elucidate the functional relevance of the inferred network, we are performing a Gene Ontology (GO analysis for its structural components. Our analysis reveals that most significant GO-terms we find for the breast cancer network represent functional modules of biological processes that are described by known cancer hallmarks, including translation, immune response, cell cycle, organelle fission, mitosis, cell adhesion, RNA processing, RNA splicing and response to wounding. Furthermore, by using a curated list of census cancer genes, we find an enrichment in these functional modules. Finally, we study cooperative effects of chromosomes based on information of interacting genes in the beast cancer network. We find that chromosome $21$ is most coactive with other chromosomes. To our knowledge this is the first study investigating the genome-scale breast cancer network.
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
An integer optimization algorithm for robust identification of non-linear gene regulatory networks
Directory of Open Access Journals (Sweden)
Chemmangattuvalappil Nishanth
2012-09-01
Full Text Available Abstract Background Reverse engineering gene networks and identifying regulatory interactions are integral to understanding cellular decision making processes. Advancement in high throughput experimental techniques has initiated innovative data driven analysis of gene regulatory networks. However, inherent noise associated with biological systems requires numerous experimental replicates for reliable conclusions. Furthermore, evidence of robust algorithms directly exploiting basic biological traits are few. Such algorithms are expected to be efficient in their performance and robust in their prediction. Results We have developed a network identification algorithm to accurately infer both the topology and strength of regulatory interactions from time series gene expression data in the presence of significant experimental noise and non-linear behavior. In this novel formulism, we have addressed data variability in biological systems by integrating network identification with the bootstrap resampling technique, hence predicting robust interactions from limited experimental replicates subjected to noise. Furthermore, we have incorporated non-linearity in gene dynamics using the S-system formulation. The basic network identification formulation exploits the trait of sparsity of biological interactions. Towards that, the identification algorithm is formulated as an integer-programming problem by introducing binary variables for each network component. The objective function is targeted to minimize the network connections subjected to the constraint of maximal agreement between the experimental and predicted gene dynamics. The developed algorithm is validated using both in silico and experimental data-sets. These studies show that the algorithm can accurately predict the topology and connection strength of the in silico networks, as quantified by high precision and recall, and small discrepancy between the actual and predicted kinetic parameters
Directory of Open Access Journals (Sweden)
Xiaobo Guo
Full Text Available Nonlinear dependence is general in regulation mechanism of gene regulatory networks (GRNs. It is vital to properly measure or test nonlinear dependence from real data for reconstructing GRNs and understanding the complex regulatory mechanisms within the cellular system. A recently developed measurement called the distance correlation (DC has been shown powerful and computationally effective in nonlinear dependence for many situations. In this work, we incorporate the DC into inferring GRNs from the gene expression data without any underling distribution assumptions. We propose three DC-based GRNs inference algorithms: CLR-DC, MRNET-DC and REL-DC, and then compare them with the mutual information (MI-based algorithms by analyzing two simulated data: benchmark GRNs from the DREAM challenge and GRNs generated by SynTReN network generator, and an experimentally determined SOS DNA repair network in Escherichia coli. According to both the receiver operator characteristic (ROC curve and the precision-recall (PR curve, our proposed algorithms significantly outperform the MI-based algorithms in GRNs inference.
Directory of Open Access Journals (Sweden)
Frank Emmert-Streib
2013-02-01
Full Text Available The inference of gene regulatory networks gained within recent years a considerable interest in the biology and biomedical community. The purpose of this paper is to investigate the influence that environmental conditions can exhibit on the inference performance of network inference algorithms. Specifically, we study five network inference methods, Aracne, BC3NET, CLR, C3NET and MRNET, and compare the results for three different conditions: (I observational gene expression data: normal environmental condition, (II interventional gene expression data: growth in rich media, (III interventional gene expression data: normal environmental condition interrupted by a positive spike-in stimulation. Overall, we find that different statistical inference methods lead to comparable, but condition-specific results. Further, our results suggest that non-steady-state data enhance the inferability of regulatory networks.
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Mhedbi-Hajri, Nadia; Malfatti, Pierrette; Pédron, Jacques; Gaubert, Stéphane; Reverchon, Sylvie; Van Gijsegem, Frédérique
2011-11-01
Successful infection of a pathogen relies on the coordinated expression of numerous virulence factor-encoding genes. In plant-bacteria interactions, this control is very often achieved through the integration of several regulatory circuits controlling cell-cell communication or sensing environmental conditions. Dickeya dadantii (formerly Erwinia chrysanthemi), the causal agent of soft rot on many crops and ornamentals, provokes maceration of infected plants mainly by producing and secreting a battery of plant cell wall-degrading enzymes. However, several other virulence factors have also been characterized. During Arabidopsis infection, most D. dadantii virulence gene transcripts accumulated in a coordinated manner during infection. This activation requires a functional GacA-GacS two-component regulatory system but the Gac system is not involved in the growth phase dependence of virulence gene expression. Here we show that, contrary to Pectobacterium, the AHL-mediated ExpIR quorum-sensing system does not play a major role in the growth phase-dependent control of D. dadantii virulence genes. On the other hand, the global regulator PecS participates in this coordinated expression since, in a pecS mutant, an early activation of virulence genes is observed both in vitro and in planta. This correlated with the known hypervirulence phenotype of the pecS mutant. Analysis of the relationship between the regulatory circuits governed by the PecS and GacA global regulators indicates that these two regulators act independently. PecS prevents a premature expression of virulence genes in the first stages of colonization whereas GacA, presumably in conjunction with other regulators, is required for the activation of virulence genes at the onset of symptom occurrence. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.
Directory of Open Access Journals (Sweden)
Benjamin C Hitz
Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.
Kreiman, Gabriel
2004-01-01
Sequence information and high‐throughput methods to measure gene expression levels open the door to explore transcriptional regulation using computational tools. Combinatorial regulation and sparseness of regulatory elements throughout the genome allow organisms to control the spatial and temporal patterns of gene expression. Here we study the organization of cis‐regulatory elements in sets of co‐regulated genes. We build an algorithm to search for combinations of transcription factor binding...
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Inferring the conservative causal core of gene regulatory networks
Directory of Open Access Journals (Sweden)
Emmert-Streib Frank
2010-09-01
Full Text Available Abstract Background Inferring gene regulatory networks from large-scale expression data is an important problem that received much attention in recent years. These networks have the potential to gain insights into causal molecular interactions of biological processes. Hence, from a methodological point of view, reliable estimation methods based on observational data are needed to approach this problem practically. Results In this paper, we introduce a novel gene regulatory network inference (GRNI algorithm, called C3NET. We compare C3NET with four well known methods, ARACNE, CLR, MRNET and RN, conducting in-depth numerical ensemble simulations and demonstrate also for biological expression data from E. coli that C3NET performs consistently better than the best known GRNI methods in the literature. In addition, it has also a low computational complexity. Since C3NET is based on estimates of mutual information values in conjunction with a maximization step, our numerical investigations demonstrate that our inference algorithm exploits causal structural information in the data efficiently. Conclusions For systems biology to succeed in the long run, it is of crucial importance to establish methods that extract large-scale gene networks from high-throughput data that reflect the underlying causal interactions among genes or gene products. Our method can contribute to this endeavor by demonstrating that an inference algorithm with a neat design permits not only a more intuitive and possibly biological interpretation of its working mechanism but can also result in superior results.
Inferring the conservative causal core of gene regulatory networks.
Altay, Gökmen; Emmert-Streib, Frank
2010-09-28
Inferring gene regulatory networks from large-scale expression data is an important problem that received much attention in recent years. These networks have the potential to gain insights into causal molecular interactions of biological processes. Hence, from a methodological point of view, reliable estimation methods based on observational data are needed to approach this problem practically. In this paper, we introduce a novel gene regulatory network inference (GRNI) algorithm, called C3NET. We compare C3NET with four well known methods, ARACNE, CLR, MRNET and RN, conducting in-depth numerical ensemble simulations and demonstrate also for biological expression data from E. coli that C3NET performs consistently better than the best known GRNI methods in the literature. In addition, it has also a low computational complexity. Since C3NET is based on estimates of mutual information values in conjunction with a maximization step, our numerical investigations demonstrate that our inference algorithm exploits causal structural information in the data efficiently. For systems biology to succeed in the long run, it is of crucial importance to establish methods that extract large-scale gene networks from high-throughput data that reflect the underlying causal interactions among genes or gene products. Our method can contribute to this endeavor by demonstrating that an inference algorithm with a neat design permits not only a more intuitive and possibly biological interpretation of its working mechanism but can also result in superior results.
Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes
Directory of Open Access Journals (Sweden)
Allan Andrew C
2008-07-01
Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Chen, Y M; Zhu, Y; Lin, E C
1987-12-01
In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans.
Directory of Open Access Journals (Sweden)
Jennifer Ferguson
Full Text Available In most crosses between closely related species of Drosophila, the male hybrids are sterile and show postmeiotic abnormalities. A series of gene expression studies using genomic approaches have found significant down regulation of postmeiotic spermatogenesis genes in sterile male hybrids. These results have led some to suggest a direct relationship between down regulation in gene expression and hybrid sterility. An alternative explanation to a cause-and-effect relationship between misregulation of gene expression and male sterility is rapid divergence of male sex regulatory elements leading to incompatible interactions in an interspecies hybrid genome. To test the effect of regulatory divergence in spermatogenesis gene expression, we isolated 35 fertile D. simulans strains with D. mauritiana introgressions in either the X, second or third chromosome. We analyzed gene expression in these fertile hybrid strains for a subset of spermatogenesis genes previously reported as significantly under expressed in sterile hybrids relative to D. simulans. We found that fertile autosomal introgressions can cause levels of gene down regulation similar to that of sterile hybrids. We also found that X chromosome heterospecific introgressions cause significantly less gene down regulation than autosomal introgressions. Our results provide evidence that rapid male sex gene regulatory divergence can explain misexpression of spermatogenesis genes in hybrids.
Small RNA-Controlled Gene Regulatory Networks in Pseudomonas putida
DEFF Research Database (Denmark)
Bojanovic, Klara
evolved numerous mechanisms to controlgene expression in response to specific environmental signals. In addition to two-component systems, small regulatory RNAs (sRNAs) have emerged as major regulators of gene expression. The majority of sRNAs bind to mRNA and regulate their expression. They often have...... multiple targets and are incorporated into large regulatory networks and the RNA chaper one Hfq in many cases facilitates interactions between sRNAs and their targets. Some sRNAs also act by binding to protein targets and sequestering their function. In this PhD thesis we investigated the transcriptional....... Detailed insights into the mechanisms through which P. putida responds to different stress conditions and increased understanding of bacterial adaptation in natural and industrial settings were gained. Additionally, we identified genome-wide transcription start sites, andmany regulatory RNA elements...
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
Yu, Bowen; Doraiswamy, Harish; Chen, Xi; Miraldi, Emily; Arrieta-Ortiz, Mario Luis; Hafemeister, Christoph; Madar, Aviv; Bonneau, Richard; Silva, Cláudio T
2014-12-01
Elucidation of transcriptional regulatory networks (TRNs) is a fundamental goal in biology, and one of the most important components of TRNs are transcription factors (TFs), proteins that specifically bind to gene promoter and enhancer regions to alter target gene expression patterns. Advances in genomic technologies as well as advances in computational biology have led to multiple large regulatory network models (directed networks) each with a large corpus of supporting data and gene-annotation. There are multiple possible biological motivations for exploring large regulatory network models, including: validating TF-target gene relationships, figuring out co-regulation patterns, and exploring the coordination of cell processes in response to changes in cell state or environment. Here we focus on queries aimed at validating regulatory network models, and on coordinating visualization of primary data and directed weighted gene regulatory networks. The large size of both the network models and the primary data can make such coordinated queries cumbersome with existing tools and, in particular, inhibits the sharing of results between collaborators. In this work, we develop and demonstrate a web-based framework for coordinating visualization and exploration of expression data (RNA-seq, microarray), network models and gene-binding data (ChIP-seq). Using specialized data structures and multiple coordinated views, we design an efficient querying model to support interactive analysis of the data. Finally, we show the effectiveness of our framework through case studies for the mouse immune system (a dataset focused on a subset of key cellular functions) and a model bacteria (a small genome with high data-completeness).
Lifescience Database Archive (English)
Full Text Available 16979567 Type I interferon [corrected] gene induction by the interferon regulatory factorfamily...ng) (.svg) (.html) (.csml) Show Type I interferon [corrected] gene induction by the interferon regulatory factorfamily...orrected] gene induction by the interferon regulatory factorfamily of transcription factors. Authors Honda K
2014-01-01
Expression quantitative trait loci (eQTL) mapping is a tool that can systematically identify genetic variation affecting gene expression. eQTL mapping studies have shown that certain genomic locations, referred to as regulatory hotspots, may affect the expression levels of many genes. Recently, studies have shown that various confounding factors may induce spurious regulatory hotspots. Here, we introduce a novel statistical method that effectively eliminates spurious hotspots while retaining genuine hotspots. Applied to simulated and real datasets, we validate that our method achieves greater sensitivity while retaining low false discovery rates compared to previous methods. PMID:24708878
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Directory of Open Access Journals (Sweden)
Daniel Meier
Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Directory of Open Access Journals (Sweden)
Samuel A Shelburne
2010-03-01
Full Text Available Transcriptional regulatory networks are fundamental to how microbes alter gene expression in response to environmental stimuli, thereby playing a critical role in bacterial pathogenesis. However, understanding how bacterial transcriptional regulatory networks function during host-pathogen interaction is limited. Recent studies in group A Streptococcus (GAS suggested that the transcriptional regulator catabolite control protein A (CcpA influences many of the same genes as the control of virulence (CovRS two-component gene regulatory system. To provide new information about the CcpA and CovRS networks, we compared the CcpA and CovR transcriptomes in a serotype M1 GAS strain. The transcript levels of several of the same genes encoding virulence factors and proteins involved in basic metabolic processes were affected in both DeltaccpA and DeltacovR isogenic mutant strains. Recombinant CcpA and CovR bound with high-affinity to the promoter regions of several co-regulated genes, including those encoding proteins involved in carbohydrate and amino acid metabolism. Compared to the wild-type parental strain, DeltaccpA and DeltacovRDeltaccpA isogenic mutant strains were significantly less virulent in a mouse myositis model. Inactivation of CcpA and CovR alone and in combination led to significant alterations in the transcript levels of several key GAS virulence factor encoding genes during infection. Importantly, the transcript level alterations in the DeltaccpA and DeltacovRDeltaccpA isogenic mutant strains observed during infection were distinct from those occurring during growth in laboratory medium. These data provide new knowledge regarding the molecular mechanisms by which pathogenic bacteria respond to environmental signals to regulate virulence factor production and basic metabolic processes during infection.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Czech Academy of Sciences Publication Activity Database
Hatina, J.; Jansa, Petr; Forejt, Jiří
2001-01-01
Roč. 37, 12-13 (2001), s. 799-800 ISSN 0161-5890 Institutional research plan: CEZ:AV0Z5052915 Keywords : MHC I gene regulatory elements Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.973, year: 2001
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Newton, Richard; Wernisch, Lorenz
2014-01-01
Inferring gene regulatory relationships from observational data is challenging. Manipulation and intervention is often required to unravel causal relationships unambiguously. However, gene copy number changes, as they frequently occur in cancer cells, might be considered natural manipulation experiments on gene expression. An increasing number of data sets on matched array comparative genomic hybridisation and transcriptomics experiments from a variety of cancer pathologies are becoming publicly available. Here we explore the potential of a meta-analysis of thirty such data sets. The aim of our analysis was to assess the potential of in silico inference of trans-acting gene regulatory relationships from this type of data. We found sufficient correlation signal in the data to infer gene regulatory relationships, with interesting similarities between data sets. A number of genes had highly correlated copy number and expression changes in many of the data sets and we present predicted potential trans-acted regulatory relationships for each of these genes. The study also investigates to what extent heterogeneity between cell types and between pathologies determines the number of statistically significant predictions available from a meta-analysis of experiments. PMID:25148247
Loregic: A Method to Characterize the Cooperative Logic of Regulatory Factors
Wang, Daifeng; Yan, Koon-Kiu; Sisu, Cristina; Cheng, Chao; Rozowsky, Joel; Meyerson, William; Gerstein, Mark B.
2015-01-01
The topology of the gene-regulatory network has been extensively analyzed. Now, given the large amount of available functional genomic data, it is possible to go beyond this and systematically study regulatory circuits in terms of logic elements. To this end, we present Loregic, a computational method integrating gene expression and regulatory network data, to characterize the cooperativity of regulatory factors. Loregic uses all 16 possible two-input-one-output logic gates (e.g. AND or XOR) to describe triplets of two factors regulating a common target. We attempt to find the gate that best matches each triplet’s observed gene expression pattern across many conditions. We make Loregic available as a general-purpose tool (github.com/gersteinlab/loregic). We validate it with known yeast transcription-factor knockout experiments. Next, using human ENCODE ChIP-Seq and TCGA RNA-Seq data, we are able to demonstrate how Loregic characterizes complex circuits involving both proximally and distally regulating transcription factors (TFs) and also miRNAs. Furthermore, we show that MYC, a well-known oncogenic driving TF, can be modeled as acting independently from other TFs (e.g., using OR gates) but antagonistically with repressing miRNAs. Finally, we inter-relate Loregic’s gate logic with other aspects of regulation, such as indirect binding via protein-protein interactions, feed-forward loop motifs and global regulatory hierarchy. PMID:25884877
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Directory of Open Access Journals (Sweden)
Hyun Uk Kim
2014-01-01
Full Text Available The LEAFY COTYLEDON2 (LEC2 gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis, and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1, LEAFY COTYLEDON1-LIKE (L1L, FUSCA3 (FUS3, and ABSCISIC ACID INSENSITIVE 3 (ABI3 transcripts for seed maturation, and WRINKELED1 (WRI1 transcripts for fatty acid biosynthesis, as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1 and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1Δ11, in vegetative tissues.
Kim, Hyun Uk; Jung, Su-Jin; Lee, Kyeong-Ryeol; Kim, Eun Ha; Lee, Sang-Min; Roh, Kyung Hee; Kim, Jong-Bum
2013-01-01
The LEAFY COTYLEDON2 (LEC2) gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis), and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV) 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON1-LIKE (L1L), FUSCA3 (FUS3), and ABSCISIC ACID INSENSITIVE 3 (ABI3) transcripts for seed maturation, and WRINKELED1 (WRI1) transcripts for fatty acid biosynthesis), as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1) and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1(Δ11)), in vegetative tissues.
Kim, Hyun Uk; Jung, Su-Jin; Lee, Kyeong-Ryeol; Kim, Eun Ha; Lee, Sang-Min; Roh, Kyung Hee; Kim, Jong-Bum
2013-01-01
The LEAFY COTYLEDON2 (LEC2) gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis), and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV) 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON1-LIKE (L1L), FUSCA3 (FUS3), and ABSCISIC ACID INSENSITIVE 3 (ABI3) transcripts for seed maturation, and WRINKELED1 (WRI1) transcripts for fatty acid biosynthesis), as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1) and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1Δ11), in vegetative tissues. PMID:24363987
Behdani, Elham; Bakhtiarizadeh, Mohammad Reza
2017-10-01
The immune system is an important biological system that is negatively impacted by stress. This study constructed an integrated regulatory network to enhance our understanding of the regulatory gene network used in the stress-related immune system. Module inference was used to construct modules of co-expressed genes with bovine leukocyte RNA-Seq data. Transcription factors (TFs) were then assigned to these modules using Lemon-Tree algorithms. In addition, the TFs assigned to each module were confirmed using the promoter analysis and protein-protein interactions data. Therefore, our integrated method identified three TFs which include one TF that is previously known to be involved in immune response (MYBL2) and two TFs (E2F8 and FOXS1) that had not been recognized previously and were identified for the first time in this study as novel regulatory candidates in immune response. This study provides valuable insights on the regulatory programs of genes involved in the stress-related immune system.
On the dynamics of a gene regulatory network
International Nuclear Information System (INIS)
Grammaticos, B; Carstea, A S; Ramani, A
2006-01-01
We examine the dynamics of a network of genes focusing on a periodic chain of genes, of arbitrary length. We show that within a given class of sigmoids representing the equilibrium probability of the binding of the RNA polymerase to the core promoter, the system possesses a single stable fixed point. By slightly modifying the sigmoid, introducing 'stiffer' forms, we show that it is possible to find network configurations exhibiting bistable behaviour. Our results do not depend crucially on the length of the chain considered: calculations with finite chains lead to similar results. However, a realistic study of regulatory genetic networks would require the consideration of more complex topologies and interactions
Directory of Open Access Journals (Sweden)
Lien Huang-Chun
2009-03-01
Full Text Available Abstract Background A variety of high-throughput techniques are now available for constructing comprehensive gene regulatory networks in systems biology. In this study, we report a new statistical approach for facilitating in silico inference of regulatory network structure. The new measure of association, coefficient of intrinsic dependence (CID, is model-free and can be applied to both continuous and categorical distributions. When given two variables X and Y, CID answers whether Y is dependent on X by examining the conditional distribution of Y given X. In this paper, we apply CID to analyze the regulatory relationships between transcription factors (TFs (X and their downstream genes (Y based on clinical data. More specifically, we use estrogen receptor α (ERα as the variable X, and the analyses are based on 48 clinical breast cancer gene expression arrays (48A. Results The analytical utility of CID was evaluated in comparison with four commonly used statistical methods, Galton-Pearson's correlation coefficient (GPCC, Student's t-test (STT, coefficient of determination (CoD, and mutual information (MI. When being compared to GPCC, CoD, and MI, CID reveals its preferential ability to discover the regulatory association where distribution of the mRNA expression levels on X and Y does not fit linear models. On the other hand, when CID is used to measure the association of a continuous variable (Y against a discrete variable (X, it shows similar performance as compared to STT, and appears to outperform CoD and MI. In addition, this study established a two-layer transcriptional regulatory network to exemplify the usage of CID, in combination with GPCC, in deciphering gene networks based on gene expression profiles from patient arrays. Conclusion CID is shown to provide useful information for identifying associations between genes and transcription factors of interest in patient arrays. When coupled with the relationships detected by GPCC, the
Gazestani, Vahid H; Salavati, Reza
2015-01-01
Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
Directory of Open Access Journals (Sweden)
Hassan A. Aziz
2018-06-01
Full Text Available Tobacco smoking is widespread behavior in Qatar and worldwide and is considered one of the major preventable causes of ill health and death. Nicotine is part of tobacco smoke that causes numerous health risks and is incredibly addictive; it binds to the α7 nicotinic acetylcholine receptor (α7nAChR in the brain. Recent studies showed α7nAChR involvement in the initiation and addiction of smoking. Kynurenic acid (KA, a significant tryptophan metabolite, is an antagonist of α7nAChR. Inhibition of kynurenine 3-monooxygenase enzyme encoded by KMO enhances the KA levels. Modulating KMO gene expression could be a useful tactic for the treatment of tobacco initiation and dependence. Since KMO regulation is still poorly understood, we aimed to investigate the 5′ and 3′-regulatory factors of KMO gene to advance our knowledge to modulate KMO gene expression. In this study, bioinformatics methods were used to identify the regulatory sequences associated with expression of KMO. The displayed differential expression of KMO mRNA in the same tissue and different tissues suggested the specific usage of the KMO multiple alternative promoters. Eleven KMO alternative promoters identified at 5′-regulatory region contain TATA-Box, lack CpG Island (CGI and showed dinucleotide base-stacking energy values specific to transcription factor binding sites (TFBSs. The structural features of regulatory sequences can influence the transcription process and cell type-specific expression. The uncharacterized LOC105373233 locus coding for non-coding RNA (ncRNA located on the reverse strand in a convergent manner at the 3′-side of KMO locus. The two genes likely expressed by a promoter that lacks TATA-Box harbor CGI and two TFBSs linked to the bidirectional transcription, the NRF1, and ZNF14 motifs. We identified two types of microRNA (miR in the uncharacterized LOC105373233 ncRNA, which are like hsa-miR-5096 and hsa-miR-1285-3p and can target the miR recognition
Directory of Open Access Journals (Sweden)
Xinguo Wang
2016-06-01
Full Text Available The purpose of this study was to characterize Ta14S homoeologs and assess their functions in wheat seed development. The genomic and cDNA sequences of three Ta14S homoeologous genes encoding 14-3-3 proteins were isolated. Sequence analysis revealed that the three homoeologs consisted of five exons and four introns and were very highly conserved in the coding regions and in exon/intron structure, whereas the cDNA sequences were variable in the 5′ and 3′-UTR. The three genes, designated as Ta14S-2A, Ta14S-2B and Ta14S-2D, were located in homoeologous group 2 chromosomes. The polypeptide chains of the three Ta14S genes were highly similar. These genes were most homologous to Hv14A from barley. Real-time quantitative PCR indicated that the three Ta14S genes were differentially expressed in different organs at different developmental stages and all exhibited greater expression in primary roots of 1-day-old germlings than in other tissues. Comparison of the expression patterns of the three homoeologous genes at different times after pollination also revealed that their expression was developmentally regulated. The transcription of Ta14S-2B was clearly higher during seed germination, whereas expressions of Ta14S-2A and Ta14S-2D were up-regulated at the beginning of seed imbibition (0–12 h, but declined thereafter. The results suggested that the three Ta14S homoeologous genes have regulatory roles in seed development and germination.
VANSINDEREN, D; LUTTINGER, A; KONG, LY; DUBNAU, D; VENEMA, G; HAMOEN, L
comK is a positive autoregulatory gene occupying a central position in the com petence-signal-transduction network. All regulatory routes identified in this network converge at the level of comK expression. The ComK protein is required for the transcriptional induction of comK and the late
An approach for reduction of false predictions in reverse engineering of gene regulatory networks.
Khan, Abhinandan; Saha, Goutam; Pal, Rajat Kumar
2018-05-14
A gene regulatory network discloses the regulatory interactions amongst genes, at a particular condition of the human body. The accurate reconstruction of such networks from time-series genetic expression data using computational tools offers a stiff challenge for contemporary computer scientists. This is crucial to facilitate the understanding of the proper functioning of a living organism. Unfortunately, the computational methods produce many false predictions along with the correct predictions, which is unwanted. Investigations in the domain focus on the identification of as many correct regulations as possible in the reverse engineering of gene regulatory networks to make it more reliable and biologically relevant. One way to achieve this is to reduce the number of incorrect predictions in the reconstructed networks. In the present investigation, we have proposed a novel scheme to decrease the number of false predictions by suitably combining several metaheuristic techniques. We have implemented the same using a dataset ensemble approach (i.e. combining multiple datasets) also. We have employed the proposed methodology on real-world experimental datasets of the SOS DNA Repair network of Escherichia coli and the IMRA network of Saccharomyces cerevisiae. Subsequently, we have experimented upon somewhat larger, in silico networks, namely, DREAM3 and DREAM4 Challenge networks, and 15-gene and 20-gene networks extracted from the GeneNetWeaver database. To study the effect of multiple datasets on the quality of the inferred networks, we have used four datasets in each experiment. The obtained results are encouraging enough as the proposed methodology can reduce the number of false predictions significantly, without using any supplementary prior biological information for larger gene regulatory networks. It is also observed that if a small amount of prior biological information is incorporated here, the results improve further w.r.t. the prediction of true positives
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
An Unusual Phage Repressor Encoded by Mycobacteriophage BPs.
Directory of Open Access Journals (Sweden)
Valerie M Villanueva
Full Text Available Temperate bacteriophages express transcription repressors that maintain lysogeny by down-regulating lytic promoters and confer superinfection immunity. Repressor regulation is critical to the outcome of infection-lysogenic or lytic growth-as well as prophage induction into lytic replication. Mycobacteriophage BPs and its relatives use an unusual integration-dependent immunity system in which the phage attachment site (attP is located within the repressor gene (33 such that site-specific integration leads to synthesis of a prophage-encoded product (gp33103 that is 33 residues shorter at its C-terminus than the virally-encoded protein (gp33136. However, the shorter form of the repressor (gp33103 is stable and active in repression of the early lytic promoter PR, whereas the longer virally-encoded form (gp33136 is inactive due to targeted degradation via a C-terminal ssrA-like tag. We show here that both forms of the repressor bind similarly to the 33-34 intergenic regulatory region, and that BPs gp33103 is a tetramer in solution. The BPs gp33103 repressor binds to five regulatory regions spanning the BPs genome, and regulates four promoters including the early lytic promoter, PR. BPs gp33103 has a complex pattern of DNA recognition in which a full operator binding site contains two half sites separated by a variable spacer, and BPs gp33103 induces a DNA bend at the full operator site but not a half site. The operator site structure is unusual in that one half site corresponds to a 12 bp palindrome identified previously, but the other half site is a highly variable variant of the palindrome.
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
Fomekong-Nanfack, Y.; Postma, M.; Kaandorp, J.A.
2009-01-01
Abstract Background Inference of gene regulatory networks (GRNs) requires accurate data, a method to simulate the expression patterns and an efficient optimization algorithm to estimate the unknown parameters. Using this approach it is possible to obtain alternative circuits without making any a priori assumptions about the interactions, which all simulate the observed patterns. It is important to analyze the properties of the circuits. Findings We have analyzed the simulated gene expression ...
Kalinina, T S; Kononchuk, V V; Gulyaeva, L F
2017-10-01
The insecticide dichlorodiphenyltrichloroethane (DDT) is a nonmutagenic xenobiotic compound able to exert estrogen-like effects resulting in activation of estrogen receptor-α (ERα) followed by changed expression of its downstream target genes. In addition, studies performed over recent years suggest that DDT may also influence expression of microRNAs. However, an impact of DDT on expression of ER, microRNAs, and related target genes has not been fully elucidated. Here, using real-time PCR, we assessed changes in expression of key genes involved in hormonal carcinogenesis as well as potentially related regulatory oncogenic/tumor suppressor microRNAs and their target genes in the uterus and ovaries of female Wistar rats during single and chronic multiple-dose DDT exposure. We found that applying DDT results in altered expression of microRNAs-221, -222, -205, -126a, and -429, their target genes (Pten, Dicer1), as well as genes involved in hormonal carcinogenesis (Esr1, Pgr, Ccnd1, Cyp19a1). Notably, Cyp19a1 expression seems to be also regulated by microRNAs-221, -222, and -205. The data suggest that epigenetic effects induced by DDT as a potential carcinogen may be based on at least two mechanisms: (i) activation of ERα followed by altered expression of the target genes encoding receptor Pgr and Ccnd1 as well as impaired expression of Cyp19a1, affecting, thereby, cell hormone balance; and (ii) changed expression of microRNAs resulting in impaired expression of related target genes including reduced level of Cyp19a1 mRNA.
Rai, Avinash Chandra; Singh, Major; Shah, Kavita
2013-01-01
Efficient genetic transformation of cotyledonary explants of tomato (Solanum lycopersicum, cv. H-86, Kashi vishesh) was obtained. Disarmed Agrobacterium tumifaciens strain GV 3101 was used in conjugation with binary vector pBinAR containing a construct consisting of the coding sequence of the BcZAT12 gene under the regulatory control of the stress inducible Bclea1a promoter. ZAT12 encodes a C₂H₂ zinc finger protein which confers multiple abiotic stress tolerance to plants. Integration of ZAT12 gene into nuclear genome of individual kanamycin resistant transformed T₀ tomato lines was confirmed by Southern blot hybridization with segregation analysis of T(1) plants showing Mendelian inheritance of the transgene. Expression of ZAT12 in drought-stressed transformed tomato lines was verified in T₂ generation plants using RT-PCR. Of the six transformed tomato lines (ZT1-ZT6) the transformants ZT1 and ZT5 showed maximum expression of BcZAT12 gene transcripts when exposed to 7 days drought stress. Analysis of relative water content (RWC), electrolyte leakage (EL), chlorophyll colour index (CCI), H₂O₂ level and catalase activity suggested that tomato BcZAT12 transformants ZT1 and ZT5 have significantly increased levels of drought tolerance. These results suggest that BcZAT12 transformed tomato cv. H-86 has real potential for molecular breeding programs aimed at augmenting yield of tomato in regions affected with drought stress. Copyright © 2012 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
International Nuclear Information System (INIS)
Whittemore, L.A.; Maniatis, T.
1990-01-01
Virus induction of the human β-interferon (β-IFN) gene results in an increase in the rate of β-IFN mRNA synthesis, followed by a rapid postinduction decrease. In this paper, the authors show that two β-IFN promoter elements, positive regulatory domains I and II (PRDI and PRDII), which are required for virus induction of the β-IFN gene are also required for the postinduction turnoff. Although protein synthesis is not necessary for activation, it is necessary for repression of these promoter elements. Examination of nuclear extracts from cells infected with virus reveals the presence of virus-inducible, cycloheximide-sensitive, DNA-binding activities that interact specifically with PRDI or PRDII. They propose that the postinduction repression of β-IFN gene transcription involves virus inducible repressors that either bind directly to the positive regulatory elements of the β-IFN promoter or inactivate the positive regulatory factors bound to PRDI and PRDII
Predictive modelling of gene expression from transcriptional regulatory elements.
Budden, David M; Hurley, Daniel G; Crampin, Edmund J
2015-07-01
Predictive modelling of gene expression provides a powerful framework for exploring the regulatory logic underpinning transcriptional regulation. Recent studies have demonstrated the utility of such models in identifying dysregulation of gene and miRNA expression associated with abnormal patterns of transcription factor (TF) binding or nucleosomal histone modifications (HMs). Despite the growing popularity of such approaches, a comparative review of the various modelling algorithms and feature extraction methods is lacking. We define and compare three methods of quantifying pairwise gene-TF/HM interactions and discuss their suitability for integrating the heterogeneous chromatin immunoprecipitation (ChIP)-seq binding patterns exhibited by TFs and HMs. We then construct log-linear and ϵ-support vector regression models from various mouse embryonic stem cell (mESC) and human lymphoblastoid (GM12878) data sets, considering both ChIP-seq- and position weight matrix- (PWM)-derived in silico TF-binding. The two algorithms are evaluated both in terms of their modelling prediction accuracy and ability to identify the established regulatory roles of individual TFs and HMs. Our results demonstrate that TF-binding and HMs are highly predictive of gene expression as measured by mRNA transcript abundance, irrespective of algorithm or cell type selection and considering both ChIP-seq and PWM-derived TF-binding. As we encourage other researchers to explore and develop these results, our framework is implemented using open-source software and made available as a preconfigured bootable virtual environment. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.
Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C
2014-03-07
To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.
[Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].
Fukuda, H; Hiramatsu, K
1997-05-01
Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.
Luisier, Raphaëlle; Unterberger, Elif B.; Goodman, Jay I.; Schwarz, Michael; Moggs, Jonathan; Terranova, Rémi; van Nimwegen, Erik
2014-01-01
Gene regulatory interactions underlying the early stages of non-genotoxic carcinogenesis are poorly understood. Here, we have identified key candidate regulators of phenobarbital (PB)-mediated mouse liver tumorigenesis, a well-characterized model of non-genotoxic carcinogenesis, by applying a new computational modeling approach to a comprehensive collection of in vivo gene expression studies. We have combined our previously developed motif activity response analysis (MARA), which models gene expression patterns in terms of computationally predicted transcription factor binding sites with singular value decomposition (SVD) of the inferred motif activities, to disentangle the roles that different transcriptional regulators play in specific biological pathways of tumor promotion. Furthermore, transgenic mouse models enabled us to identify which of these regulatory activities was downstream of constitutive androstane receptor and β-catenin signaling, both crucial components of PB-mediated liver tumorigenesis. We propose novel roles for E2F and ZFP161 in PB-mediated hepatocyte proliferation and suggest that PB-mediated suppression of ESR1 activity contributes to the development of a tumor-prone environment. Our study shows that combining MARA with SVD allows for automated identification of independent transcription regulatory programs within a complex in vivo tissue environment and provides novel mechanistic insights into PB-mediated hepatocarcinogenesis. PMID:24464994
Regulatory structures for gene therapy medicinal products in the European Union.
Klug, Bettina; Celis, Patrick; Carr, Melanie; Reinhardt, Jens
2012-01-01
Taking into account the complexity and technical specificity of advanced therapy medicinal products: (gene and cell therapy medicinal products and tissue engineered products), a dedicated European regulatory framework was needed. Regulation (EC) No. 1394/2007, the "ATMP Regulation" provides tailored regulatory principles for the evaluation and authorization of these innovative medicines. The majority of gene or cell therapy product development is carried out by academia, hospitals, and small- and medium-sized enterprises (SMEs). Thus, acknowledging the particular needs of these types of sponsors, the legislation also provides incentives for product development tailored to them. The European Medicines Agency (EMA) and, in particular, its Committee for Advanced Therapies (CAT) provide a variety of opportunities for early interaction with developers of ATMPs to enable them to have early regulatory and scientific input. An important tool to promote innovation and the development of new medicinal products by micro-, small-, and medium-sized enterprises is the EMA's SME initiative launched in December 2005 to offer financial and administrative assistance to smaller companies. The European legislation also foresees the involvement of stakeholders, such as patient organizations, in the development of new medicines. Considering that gene therapy medicinal products are developed in many cases for treatment of rare diseases often of monogenic origin, the involvement of patient organizations, which focus on rare diseases and genetic and congenital disorders, is fruitful. Two such organizations are represented in the CAT. Research networks play another important role in the development of gene therapy medicinal products. The European Commission is funding such networks through the EU Sixth Framework Program. Copyright © 2012 Elsevier Inc. All rights reserved.
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Janssen, Jacob; Soule, Tanya
2016-01-01
Long-wavelength ultraviolet radiation (UVA) can damage cells through photooxidative stress, leading to harmful photosensitized proteins and pigments in cyanobacteria. To mitigate damage, some cyanobacteria secrete the UVA-absorbing pigment scytonemin into their extracellular sheath. Comparative genomic analyses suggest that scytonemin biosynthesis is regulated by the two-component regulatory system (TCRS) proteins encoded by Npun_F1277 and Npun_F1278 in the cyanobacterium Nostoc punctiforme ATCC 29133. To understand the dynamics of these genes, their expression was measured following exposure to UVA, UVB, high visible (VIS) irradiance and oxidative stress for 20, 40 and 60 min. Overall, both genes had statistically similar patterns of expression for all four conditions and were generally upregulated, except for those exposed to UVB by 60 min and for the cells under oxidative stress. The greatest UVA response was an upregulation by 20 min, while the response to UVB was the most dramatic and persisted through 40 min. High VIS irradiance resulted in a modest upregulation, while oxidative stress caused a slight downregulation. Both genes were also found to occur on the same transcript. These results demonstrate that these genes are positively responding to several light-associated conditions, which suggests that this TCRS may regulate more than just scytonemin biosynthesis under UVA stress. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K
1989-01-01
Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, bu...
Regression Analysis of Combined Gene Expression Regulation in Acute Myeloid Leukemia
Li, Yue; Liang, Minggao; Zhang, Zhaolei
2014-01-01
Gene expression is a combinatorial function of genetic/epigenetic factors such as copy number variation (CNV), DNA methylation (DM), transcription factors (TF) occupancy, and microRNA (miRNA) post-transcriptional regulation. At the maturity of microarray/sequencing technologies, large amounts of data measuring the genome-wide signals of those factors became available from Encyclopedia of DNA Elements (ENCODE) and The Cancer Genome Atlas (TCGA). However, there is a lack of an integrative model to take full advantage of these rich yet heterogeneous data. To this end, we developed RACER (Regression Analysis of Combined Expression Regulation), which fits the mRNA expression as response using as explanatory variables, the TF data from ENCODE, and CNV, DM, miRNA expression signals from TCGA. Briefly, RACER first infers the sample-specific regulatory activities by TFs and miRNAs, which are then used as inputs to infer specific TF/miRNA-gene interactions. Such a two-stage regression framework circumvents a common difficulty in integrating ENCODE data measured in generic cell-line with the sample-specific TCGA measurements. As a case study, we integrated Acute Myeloid Leukemia (AML) data from TCGA and the related TF binding data measured in K562 from ENCODE. As a proof-of-concept, we first verified our model formalism by 10-fold cross-validation on predicting gene expression. We next evaluated RACER on recovering known regulatory interactions, and demonstrated its superior statistical power over existing methods in detecting known miRNA/TF targets. Additionally, we developed a feature selection procedure, which identified 18 regulators, whose activities clustered consistently with cytogenetic risk groups. One of the selected regulators is miR-548p, whose inferred targets were significantly enriched for leukemia-related pathway, implicating its novel role in AML pathogenesis. Moreover, survival analysis using the inferred activities identified C-Fos as a potential AML
Fomekong-Nanfack, Y.; Postma, M.; Kaandorp, J.A.
2009-01-01
Background: Inference of gene regulatory networks (GRNs) requires accurate data, a method to simulate the expression patterns and an efficient optimization algorithm to estimate the unknown parameters. Using this approach it is possible to obtain alternative circuits without making any a priori
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Shi, Xiang Yang; Dumenyo, C Korsi; Hernandez-Martinez, Rufina; Azad, Hamid; Cooksey, Donald A
2007-11-01
Many virulence genes in plant bacterial pathogens are coordinately regulated by "global" regulatory genes. Conducting DNA microarray analysis of bacterial mutants of such genes, compared with the wild type, can help to refine the list of genes that may contribute to virulence in bacterial pathogens. The regulatory gene algU, with roles in stress response and regulation of the biosynthesis of the exopolysaccharide alginate in Pseudomonas aeruginosa and many other bacteria, has been extensively studied. The role of algU in Xylella fastidiosa, the cause of Pierce's disease of grapevines, was analyzed by mutation and whole-genome microarray analysis to define its involvement in aggregation, biofilm formation, and virulence. In this study, an algU::nptII mutant had reduced cell-cell aggregation, attachment, and biofilm formation and lower virulence in grapevines. Microarray analysis showed that 42 genes had significantly lower expression in the algU::nptII mutant than in the wild type. Among these are several genes that could contribute to cell aggregation and biofilm formation, as well as other physiological processes such as virulence, competition, and survival.
Directory of Open Access Journals (Sweden)
Lan Chung-Yu
2008-09-01
Full Text Available Abstract Background Inflammation is a hallmark of many human diseases. Elucidating the mechanisms underlying systemic inflammation has long been an important topic in basic and clinical research. When primary pathogenetic events remains unclear due to its immense complexity, construction and analysis of the gene regulatory network of inflammation at times becomes the best way to understand the detrimental effects of disease. However, it is difficult to recognize and evaluate relevant biological processes from the huge quantities of experimental data. It is hence appealing to find an algorithm which can generate a gene regulatory network of systemic inflammation from high-throughput genomic studies of human diseases. Such network will be essential for us to extract valuable information from the complex and chaotic network under diseased conditions. Results In this study, we construct a gene regulatory network of inflammation using data extracted from the Ensembl and JASPAR databases. We also integrate and apply a number of systematic algorithms like cross correlation threshold, maximum likelihood estimation method and Akaike Information Criterion (AIC on time-lapsed microarray data to refine the genome-wide transcriptional regulatory network in response to bacterial endotoxins in the context of dynamic activated genes, which are regulated by transcription factors (TFs such as NF-κB. This systematic approach is used to investigate the stochastic interaction represented by the dynamic leukocyte gene expression profiles of human subject exposed to an inflammatory stimulus (bacterial endotoxin. Based on the kinetic parameters of the dynamic gene regulatory network, we identify important properties (such as susceptibility to infection of the immune system, which may be useful for translational research. Finally, robustness of the inflammatory gene network is also inferred by analyzing the hubs and "weak ties" structures of the gene network
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Mohamed Salleh, Faridah Hani; Arif, Shereena Mohd; Zainudin, Suhaila; Firdaus-Raih, Mohd
2015-12-01
A gene regulatory network (GRN) is a large and complex network consisting of interacting elements that, over time, affect each other's state. The dynamics of complex gene regulatory processes are difficult to understand using intuitive approaches alone. To overcome this problem, we propose an algorithm for inferring the regulatory interactions from knock-out data using a Gaussian model combines with Pearson Correlation Coefficient (PCC). There are several problems relating to GRN construction that have been outlined in this paper. We demonstrated the ability of our proposed method to (1) predict the presence of regulatory interactions between genes, (2) their directionality and (3) their states (activation or suppression). The algorithm was applied to network sizes of 10 and 50 genes from DREAM3 datasets and network sizes of 10 from DREAM4 datasets. The predicted networks were evaluated based on AUROC and AUPR. We discovered that high false positive values were generated by our GRN prediction methods because the indirect regulations have been wrongly predicted as true relationships. We achieved satisfactory results as the majority of sub-networks achieved AUROC values above 0.5. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
Gene expression patterns of oxidative phosphorylation complex I subunits are organized in clusters.
Directory of Open Access Journals (Sweden)
Yael Garbian
Full Text Available After the radiation of eukaryotes, the NUO operon, controlling the transcription of the NADH dehydrogenase complex of the oxidative phosphorylation system (OXPHOS complex I, was broken down and genes encoding this protein complex were dispersed across the nuclear genome. Seven genes, however, were retained in the genome of the mitochondrion, the ancient symbiote of eukaryotes. This division, in combination with the three-fold increase in subunit number from bacteria (N = approximately 14 to man (N = 45, renders the transcription regulation of OXPHOS complex I a challenge. Recently bioinformatics analysis of the promoter regions of all OXPHOS genes in mammals supported patterns of co-regulation, suggesting that natural selection favored a mechanism facilitating the transcriptional regulatory control of genes encoding subunits of these large protein complexes. Here, using real time PCR of mitochondrial (mtDNA- and nuclear DNA (nDNA-encoded transcripts in a panel of 13 different human tissues, we show that the expression pattern of OXPHOS complex I genes is regulated in several clusters. Firstly, all mtDNA-encoded complex I subunits (N = 7 share a similar expression pattern, distinct from all tested nDNA-encoded subunits (N = 10. Secondly, two sub-clusters of nDNA-encoded transcripts with significantly different expression patterns were observed. Thirdly, the expression patterns of two nDNA-encoded genes, NDUFA4 and NDUFA5, notably diverged from the rest of the nDNA-encoded subunits, suggesting a certain degree of tissue specificity. Finally, the expression pattern of the mtDNA-encoded ND4L gene diverged from the rest of the tested mtDNA-encoded transcripts that are regulated by the same promoter, consistent with post-transcriptional regulation. These findings suggest, for the first time, that the regulation of complex I subunits expression in humans is complex rather than reflecting global co-regulation.
HLA-E regulatory and coding region variability and haplotypes in a Brazilian population sample.
Ramalho, Jaqueline; Veiga-Castelli, Luciana C; Donadi, Eduardo A; Mendes-Junior, Celso T; Castelli, Erick C
2017-11-01
The HLA-E gene is characterized by low but wide expression on different tissues. HLA-E is considered a conserved gene, being one of the least polymorphic class I HLA genes. The HLA-E molecule interacts with Natural Killer cell receptors and T lymphocytes receptors, and might activate or inhibit immune responses depending on the peptide associated with HLA-E and with which receptors HLA-E interacts to. Variable sites within the HLA-E regulatory and coding segments may influence the gene function by modifying its expression pattern or encoded molecule, thus, influencing its interaction with receptors and the peptide. Here we propose an approach to evaluate the gene structure, haplotype pattern and the complete HLA-E variability, including regulatory (promoter and 3'UTR) and coding segments (with introns), by using massively parallel sequencing. We investigated the variability of 420 samples from a very admixed population such as Brazilians by using this approach. Considering a segment of about 7kb, 63 variable sites were detected, arranged into 75 extended haplotypes. We detected 37 different promoter sequences (but few frequent ones), 27 different coding sequences (15 representing new HLA-E alleles) and 12 haplotypes at the 3'UTR segment, two of them presenting a summed frequency of 90%. Despite the number of coding alleles, they encode mainly two different full-length molecules, known as E*01:01 and E*01:03, which corresponds to about 90% of all. In addition, differently from what has been previously observed for other non classical HLA genes, the relationship among the HLA-E promoter, coding and 3'UTR haplotypes is not straightforward because the same promoter and 3'UTR haplotypes were many times associated with different HLA-E coding haplotypes. This data reinforces the presence of only two main full-length HLA-E molecules encoded by the many HLA-E alleles detected in our population sample. In addition, this data does indicate that the distal HLA-E promoter is by
Carey, Michelle; Ramírez, Juan Camilo; Wu, Shuang; Wu, Hulin
2018-07-01
A biological host response to an external stimulus or intervention such as a disease or infection is a dynamic process, which is regulated by an intricate network of many genes and their products. Understanding the dynamics of this gene regulatory network allows us to infer the mechanisms involved in a host response to an external stimulus, and hence aids the discovery of biomarkers of phenotype and biological function. In this article, we propose a modeling/analysis pipeline for dynamic gene expression data, called Pipeline4DGEData, which consists of a series of statistical modeling techniques to construct dynamic gene regulatory networks from the large volumes of high-dimensional time-course gene expression data that are freely available in the Gene Expression Omnibus repository. This pipeline has a consistent and scalable structure that allows it to simultaneously analyze a large number of time-course gene expression data sets, and then integrate the results across different studies. We apply the proposed pipeline to influenza infection data from nine studies and demonstrate that interesting biological findings can be discovered with its implementation.
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine
2006-07-01
Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
The Regulatory Small RNA MarS Supports Virulence of Streptococcus pyogenes.
Pappesch, Roberto; Warnke, Philipp; Mikkat, Stefan; Normann, Jana; Wisniewska-Kucper, Aleksandra; Huschka, Franziska; Wittmann, Maja; Khani, Afsaneh; Schwengers, Oliver; Oehmcke-Hecht, Sonja; Hain, Torsten; Kreikemeyer, Bernd; Patenge, Nadja
2017-09-25
Small regulatory RNAs (sRNAs) play a role in the control of bacterial virulence gene expression. In this study, we investigated an sRNA that was identified in Streptococcus pyogenes (group A Streptococcus, GAS) but is conserved throughout various streptococci. In a deletion strain, expression of mga, the gene encoding the multiple virulence gene regulator, was reduced. Accordingly, transcript and proteome analyses revealed decreased expression of several Mga-activated genes. Therefore, and because the sRNA was shown to interact with the 5' UTR of the mga transcript in a gel-shift assay, we designated it MarS for m ga-activating regulatory sRNA. Down-regulation of important virulence factors, including the antiphagocytic M-protein, led to increased susceptibility of the deletion strain to phagocytosis and reduced adherence to human keratinocytes. In a mouse infection model, the marS deletion mutant showed reduced dissemination to the liver, kidney, and spleen. Additionally, deletion of marS led to increased tolerance towards oxidative stress. Our in vitro and in vivo results indicate a modulating effect of MarS on virulence gene expression and on the pathogenic potential of GAS.
Nayidu, Naghabushana K.; Kagale, Sateesh; Taheri, Ali; Withana-Gamage, Thushan S.; Parkin, Isobel A. P.; Sharpe, Andrew G.; Gruber, Margaret Y.
2014-01-01
Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1), GLABRA 2 (GL2), ENHANCER OF GLABRA 3 (EGL3), and TRANSPARENT TESTA GLABRA 1 (TTG1) and the negative regulator TRIPTYCHON (TRY), were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM) levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae. PMID:24755905
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki
2011-01-01
The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
HoxA Genes and the Fin-to-Limb Transition in Vertebrates
Directory of Open Access Journals (Sweden)
João Leite-Castro
2016-02-01
Full Text Available HoxA genes encode for important DNA-binding transcription factors that act during limb development, regulating primarily gene expression and, consequently, morphogenesis and skeletal differentiation. Within these genes, HoxA11 and HoxA13 were proposed to have played an essential role in the enigmatic evolutionary transition from fish fins to tetrapod limbs. Indeed, comparative gene expression analyses led to the suggestion that changes in their regulation might have been essential for the diversification of vertebrates’ appendages. In this review, we highlight three potential modifications in the regulation and function of these genes that may have boosted appendage evolution: (1 the expansion of polyalanine repeats in the HoxA11 and HoxA13 proteins; (2 the origin of +a novel long-non-coding RNA with a possible inhibitory function on HoxA11; and (3 the acquisition of cis-regulatory elements modulating 5’ HoxA transcription. We discuss the relevance of these mechanisms for appendage diversification reviewing the current state of the art and performing additional comparative analyses to characterize, in a phylogenetic framework, HoxA11 and HoxA13 expression, alanine composition within the encoded proteins, long-non-coding RNAs and cis-regulatory elements.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
A Systems’ Biology Approach to Study MicroRNA-Mediated Gene Regulatory Networks
Directory of Open Access Journals (Sweden)
Xin Lai
2013-01-01
Full Text Available MicroRNAs (miRNAs are potent effectors in gene regulatory networks where aberrant miRNA expression can contribute to human diseases such as cancer. For a better understanding of the regulatory role of miRNAs in coordinating gene expression, we here present a systems biology approach combining data-driven modeling and model-driven experiments. Such an approach is characterized by an iterative process, including biological data acquisition and integration, network construction, mathematical modeling and experimental validation. To demonstrate the application of this approach, we adopt it to investigate mechanisms of collective repression on p21 by multiple miRNAs. We first construct a p21 regulatory network based on data from the literature and further expand it using algorithms that predict molecular interactions. Based on the network structure, a detailed mechanistic model is established and its parameter values are determined using data. Finally, the calibrated model is used to study the effect of different miRNA expression profiles and cooperative target regulation on p21 expression levels in different biological contexts.
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J
1989-11-25
Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids
Directory of Open Access Journals (Sweden)
Victoria L. Pritchard
2017-01-01
Full Text Available Much adaptive evolutionary change is underlain by mutational variation in regions of the genome that regulate gene expression rather than in the coding regions of the genes themselves. An understanding of the role of gene expression variation in facilitating local adaptation will be aided by an understanding of underlying regulatory networks. Here, we characterize the genetic architecture of gene expression variation in the threespine stickleback (Gasterosteus aculeatus, an important model in the study of adaptive evolution. We collected transcriptomic and genomic data from 60 half-sib families using an expression microarray and genotyping-by-sequencing, and located expression quantitative trait loci (eQTL underlying the variation in gene expression in liver tissue using an interval mapping approach. We identified eQTL for several thousand expression traits. Expression was influenced by polymorphism in both cis- and trans-regulatory regions. Trans-eQTL clustered into hotspots. We did not identify master transcriptional regulators in hotspot locations: rather, the presence of hotspots may be driven by complex interactions between multiple transcription factors. One observed hotspot colocated with a QTL recently found to underlie salinity tolerance in the threespine stickleback. However, most other observed hotspots did not colocate with regions of the genome known to be involved in adaptive divergence between marine and freshwater habitats.
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Regulatory Considerations for Gene Therapy Products in the US, EU, and Japan.
Halioua-Haubold, Celine-Lea; Peyer, James G; Smith, James A; Arshad, Zeeshaan; Scholz, Matthew; Brindley, David A; MacLaren, Robert E
2017-12-01
Developers of gene therapy products (GTPs) must adhere to additional regulation beyond that of traditional small-molecule therapeutics, due to the unique mechanism-of-action of GTPs and the subsequent novel risks arisen. We have provided herein a summary of the regulatory structure under which GTPs fall in the United States, the European Union, and Japan, and a comprehensive overview of the regulatory guidance applicable to the developer of GTP. Understanding the regulatory requirements for seeking GTP market approval in these major jurisdictions is crucial for an effective and expedient path to market. The novel challenges facing GTP developers is highlighted by a case study of alipogene tiparvovec (Glybera).
Functional evolution of cis-regulatory modules at a homeotic gene in Drosophila.
Directory of Open Access Journals (Sweden)
Margaret C W Ho
2009-11-01
Full Text Available It is a long-held belief in evolutionary biology that the rate of molecular evolution for a given DNA sequence is inversely related to the level of functional constraint. This belief holds true for the protein-coding homeotic (Hox genes originally discovered in Drosophila melanogaster. Expression of the Hox genes in Drosophila embryos is essential for body patterning and is controlled by an extensive array of cis-regulatory modules (CRMs. How the regulatory modules functionally evolve in different species is not clear. A comparison of the CRMs for the Abdominal-B gene from different Drosophila species reveals relatively low levels of overall sequence conservation. However, embryonic enhancer CRMs from other Drosophila species direct transgenic reporter gene expression in the same spatial and temporal patterns during development as their D. melanogaster orthologs. Bioinformatic analysis reveals the presence of short conserved sequences within defined CRMs, representing gap and pair-rule transcription factor binding sites. One predicted binding site for the gap transcription factor KRUPPEL in the IAB5 CRM was found to be altered in Superabdominal (Sab mutations. In Sab mutant flies, the third abdominal segment is transformed into a copy of the fifth abdominal segment. A model for KRUPPEL-mediated repression at this binding site is presented. These findings challenge our current understanding of the relationship between sequence evolution at the molecular level and functional activity of a CRM. While the overall sequence conservation at Drosophila CRMs is not distinctive from neighboring genomic regions, functionally critical transcription factor binding sites within embryonic enhancer CRMs are highly conserved. These results have implications for understanding mechanisms of gene expression during embryonic development, enhancer function, and the molecular evolution of eukaryotic regulatory modules.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
NIMEFI: gene regulatory network inference using multiple ensemble feature importance algorithms.
Directory of Open Access Journals (Sweden)
Joeri Ruyssinck
Full Text Available One of the long-standing open challenges in computational systems biology is the topology inference of gene regulatory networks from high-throughput omics data. Recently, two community-wide efforts, DREAM4 and DREAM5, have been established to benchmark network inference techniques using gene expression measurements. In these challenges the overall top performer was the GENIE3 algorithm. This method decomposes the network inference task into separate regression problems for each gene in the network in which the expression values of a particular target gene are predicted using all other genes as possible predictors. Next, using tree-based ensemble methods, an importance measure for each predictor gene is calculated with respect to the target gene and a high feature importance is considered as putative evidence of a regulatory link existing between both genes. The contribution of this work is twofold. First, we generalize the regression decomposition strategy of GENIE3 to other feature importance methods. We compare the performance of support vector regression, the elastic net, random forest regression, symbolic regression and their ensemble variants in this setting to the original GENIE3 algorithm. To create the ensemble variants, we propose a subsampling approach which allows us to cast any feature selection algorithm that produces a feature ranking into an ensemble feature importance algorithm. We demonstrate that the ensemble setting is key to the network inference task, as only ensemble variants achieve top performance. As second contribution, we explore the effect of using rankwise averaged predictions of multiple ensemble algorithms as opposed to only one. We name this approach NIMEFI (Network Inference using Multiple Ensemble Feature Importance algorithms and show that this approach outperforms all individual methods in general, although on a specific network a single method can perform better. An implementation of NIMEFI has been made
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
2013-01-01
Background The production of enzymes by an industrial strain requires a complex adaption of the bacterial metabolism to the conditions within the fermenter. Regulatory events within the process result in a dynamic change of the transcriptional activity of the genome. This complex network of genes is orchestrated by proteins as well as regulatory RNA elements. Here we present an RNA-Seq based study considering selected phases of an industry-oriented fermentation of Bacillus licheniformis. Results A detailed analysis of 20 strand-specific RNA-Seq datasets revealed a multitude of transcriptionally active genomic regions. 3314 RNA features encoded by such active loci have been identified and sorted into ten functional classes. The identified sequences include the expected RNA features like housekeeping sRNAs, metabolic riboswitches and RNA switches well known from studies on Bacillus subtilis as well as a multitude of completely new candidates for regulatory RNAs. An unexpectedly high number of 855 RNA features are encoded antisense to annotated protein and RNA genes, in addition to 461 independently transcribed small RNAs. These antisense transcripts contain molecules with a remarkable size range variation from 38 to 6348 base pairs in length. The genome of the type strain B. licheniformis DSM13 was completely reannotated using data obtained from RNA-Seq analyses and from public databases. Conclusion The hereby generated data-sets represent a solid amount of knowledge on the dynamic transcriptional activities during the investigated fermentation stages. The identified regulatory elements enable research on the understanding and the optimization of crucial metabolic activities during a productive fermentation of Bacillus licheniformis strains. PMID:24079885
Wiegand, Sandra; Dietrich, Sascha; Hertel, Robert; Bongaerts, Johannes; Evers, Stefan; Volland, Sonja; Daniel, Rolf; Liesegang, Heiko
2013-10-01
The production of enzymes by an industrial strain requires a complex adaption of the bacterial metabolism to the conditions within the fermenter. Regulatory events within the process result in a dynamic change of the transcriptional activity of the genome. This complex network of genes is orchestrated by proteins as well as regulatory RNA elements. Here we present an RNA-Seq based study considering selected phases of an industry-oriented fermentation of Bacillus licheniformis. A detailed analysis of 20 strand-specific RNA-Seq datasets revealed a multitude of transcriptionally active genomic regions. 3314 RNA features encoded by such active loci have been identified and sorted into ten functional classes. The identified sequences include the expected RNA features like housekeeping sRNAs, metabolic riboswitches and RNA switches well known from studies on Bacillus subtilis as well as a multitude of completely new candidates for regulatory RNAs. An unexpectedly high number of 855 RNA features are encoded antisense to annotated protein and RNA genes, in addition to 461 independently transcribed small RNAs. These antisense transcripts contain molecules with a remarkable size range variation from 38 to 6348 base pairs in length. The genome of the type strain B. licheniformis DSM13 was completely reannotated using data obtained from RNA-Seq analyses and from public databases. The hereby generated data-sets represent a solid amount of knowledge on the dynamic transcriptional activities during the investigated fermentation stages. The identified regulatory elements enable research on the understanding and the optimization of crucial metabolic activities during a productive fermentation of Bacillus licheniformis strains.
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
Guo, Yuchun; Feng, Ying; Trivedi, Niraj S; Huang, Sui
2011-05-01
Gene expression profiles consisting of ten thousands of transcripts are used for clustering of tissue, such as tumors, into subtypes, often without considering the underlying reason that the distinct patterns of expression arise because of constraints in the realization of gene expression profiles imposed by the gene regulatory network. The topology of this network has been suggested to consist of a regulatory core of genes represented most prominently by transcription factors (TFs) and microRNAs, that influence the expression of other genes, and of a periphery of 'enslaved' effector genes that are regulated but not regulating. This 'medusa' architecture implies that the core genes are much stronger determinants of the realized gene expression profiles. To test this hypothesis, we examined the clustering of gene expression profiles into known tumor types to quantitatively demonstrate that TFs, and even more pronounced, microRNAs, are much stronger discriminators of tumor type specific gene expression patterns than a same number of randomly selected or metabolic genes. These findings lend support to the hypothesis of a medusa architecture and of the canalizing nature of regulation by microRNAs. They also reveal the degree of freedom for the expression of peripheral genes that are less stringently associated with a tissue type specific global gene expression profile.
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Chen, Wei; Zhao, Wenshan; Yang, Aiting; Xu, Anjian; Wang, Huan; Cong, Min; Liu, Tianhui; Wang, Ping; You, Hong
2017-12-15
Liver fibrosis, characterized with the excessive accumulation of extracellular matrix (ECM) proteins, represents the final common pathway of chronic liver inflammation. Ever-increasing evidence indicates microRNAs (miRNAs) dysregulation has important implications in the different stages of liver fibrosis. However, our knowledge of miRNA-gene regulation details pertaining to such disease remains unclear. The publicly available Gene Expression Omnibus (GEO) datasets of patients suffered from cirrhosis were extracted for integrated analysis. Differentially expressed miRNAs (DEMs) and genes (DEGs) were identified using GEO2R web tool. Putative target gene prediction of DEMs was carried out using the intersection of five major algorithms: DIANA-microT, TargetScan, miRanda, PICTAR5 and miRWalk. Functional miRNA-gene regulatory network (FMGRN) was constructed based on the computational target predictions at the sequence level and the inverse expression relationships between DEMs and DEGs. DAVID web server was selected to perform KEGG pathway enrichment analysis. Functional miRNA-gene regulatory module was generated based on the biological interpretation. Internal connections among genes in liver fibrosis-related module were determined using String database. MiRNA-gene regulatory modules related to liver fibrosis were experimentally verified in recombinant human TGFβ1 stimulated and specific miRNA inhibitor treated LX-2 cells. We totally identified 85 and 923 dysregulated miRNAs and genes in liver cirrhosis biopsy samples compared to their normal controls. All evident miRNA-gene pairs were identified and assembled into FMGRN which consisted of 990 regulations between 51 miRNAs and 275 genes, forming two big sub-networks that were defined as down-network and up-network, respectively. KEGG pathway enrichment analysis revealed that up-network was prominently involved in several KEGG pathways, in which "Focal adhesion", "PI3K-Akt signaling pathway" and "ECM
Isolation of two tissue-specific Drosophila paired box genes, Pox meso and Pox neuro.
Bopp, D; Jamet, E; Baumgartner, S; Burri, M; Noll, M
1989-01-01
Two new paired domain genes of Drosophila, Pox meso and Pox neuro, are described. In contrast to the previously isolated paired domain genes, paired and gooseberry, which contain both a paired and a homeo-domain (PHox genes), Pox meso and Pox neuro possess no homeodomain. Evidence suggesting that the new genes encode tissue-specific transcriptional factors and belong to the same regulatory cascade as the other paired domain genes includes (i) tissue-specific expression of Pox meso in the soma...
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
Kreikemeyer, Bernd; Nakata, Masanobu; Köller, Thomas; Hildisch, Hendrikje; Kourakos, Vassilios; Standar, Kerstin; Kawabata, Shigetada; Glocker, Michael O; Podbielski, Andreas
2007-12-01
Many Streptococcus pyogenes (group A streptococcus [GAS]) virulence factor- and transcriptional regulator-encoding genes cluster together in discrete genomic regions. Nra is a central regulator of the FCT region. Previous studies exclusively described Nra as a transcriptional repressor of adhesin and toxin genes. Here transcriptome and proteome analysis of a serotype M49 GAS strain and an isogenic Nra mutant of this strain revealed the complete Nra regulon profile. Nra is active in all growth phases tested, with the largest regulon in the transition phase. Almost exclusively, virulence factor-encoding genes are repressed by Nra; these genes include the GAS pilus operon, the capsule synthesis operon, the cytolysin-mediated translocation system genes, all Mga region core virulence genes, and genes encoding other regulators, like the Ihk/Irr system, Rgg, and two additional RofA-like protein family regulators. Surprisingly, our experiments revealed that Nra additionally acts as a positive regulator, mostly for genes encoding proteins and enzymes with metabolic functions. Epidemiological investigations revealed strong genetic linkage of one particular Nra-repressed regulator, Ralp3 (SPy0735), with a gene encoding Epf (extracellular protein factor from Streptococcus suis). In a serotype-specific fashion, this ralp3 epf gene block is integrated, most likely via transposition, into the eno sagA virulence gene block, which is present in all GAS serotypes. In GAS serotypes M1, M4, M12, M28, and M49 this novel discrete genetic region is therefore designated the eno ralp3 epf sagA (ERES) pathogenicity region. Functional experiments showed that Epf is a novel GAS plasminogen-binding protein and revealed that Ralp3 activity counteracts Nra and MsmR regulatory activity. In addition to the Mga and FCT regions, the ERES region is the third discrete chromosomal pathogenicity region. All of these regions are transcriptionally linked, adding another level of complexity to the known
Directory of Open Access Journals (Sweden)
Alexandra Saudemont
2010-12-01
Full Text Available Echinoderms, which are phylogenetically related to vertebrates and produce large numbers of transparent embryos that can be experimentally manipulated, offer many advantages for the analysis of the gene regulatory networks (GRN regulating germ layer formation. During development of the sea urchin embryo, the ectoderm is the source of signals that pattern all three germ layers along the dorsal-ventral axis. How this signaling center controls patterning and morphogenesis of the embryo is not understood. Here, we report a large-scale analysis of the GRN deployed in response to the activity of this signaling center in the embryos of the Mediterranean sea urchin Paracentrotus lividus, in which studies with high spatial resolution are possible. By using a combination of in situ hybridization screening, overexpression of mRNA, recombinant ligand treatments, and morpholino-based loss-of-function studies, we identified a cohort of transcription factors and signaling molecules expressed in the ventral ectoderm, dorsal ectoderm, and interposed neurogenic ("ciliary band" region in response to the known key signaling molecules Nodal and BMP2/4 and defined the epistatic relationships between the most important genes. The resultant GRN showed a number of striking features. First, Nodal was found to be essential for the expression of all ventral and dorsal marker genes, and BMP2/4 for all dorsal genes. Second, goosecoid was identified as a central player in a regulatory sub-circuit controlling mouth formation, while tbx2/3 emerged as a critical factor for differentiation of the dorsal ectoderm. Finally, and unexpectedly, a neurogenic ectoderm regulatory circuit characterized by expression of "ciliary band" genes was triggered in the absence of TGF beta signaling. We propose a novel model for ectoderm regionalization, in which neural ectoderm is the default fate in the absence of TGF beta signaling, and suggest that the stomodeal and neural subcircuits that we
Chromosomal Arrangement of Phosphorelay Genes Couples Sporulation and DNA Replication.
Narula, Jatin; Kuchina, Anna; Lee, Dong-Yeon D; Fujita, Masaya; Süel, Gürol M; Igoshin, Oleg A
2015-07-16
Genes encoding proteins in a common regulatory network are frequently located close to one another on the chromosome to facilitate co-regulation or couple gene expression to growth rate. Contrasting with these observations, here, we demonstrate a functional role for the arrangement of Bacillus subtilis sporulation network genes on opposite sides of the chromosome. We show that the arrangement of two sporulation network genes, one located close to the origin and the other close to the terminus, leads to a transient gene dosage imbalance during chromosome replication. This imbalance is detected by the sporulation network to produce cell-cycle coordinated pulses of the sporulation master regulator Spo0A∼P. This pulsed response allows cells to decide between sporulation and continued vegetative growth during each cell cycle spent in starvation. The simplicity of this coordination mechanism suggests that it may be widely applicable in a variety of gene regulatory and stress-response settings. VIDEO ABSTRACT. Copyright © 2015 Elsevier Inc. All rights reserved.
A systems level approach reveals new gene regulatory modules in the developing ear
Chen, Jingchen; Tambalo, Monica; Barembaum, Meyer; Ranganathan, Ramya; Simões-Costa, Marcos; Bronner, Marianne E.; Streit, Andrea
2017-01-01
The inner ear is a complex vertebrate sense organ, yet it arises from a simple epithelium, the otic placode. Specification towards otic fate requires diverse signals and transcriptional inputs that act sequentially and/or in parallel. Using the chick embryo, we uncover novel genes in the gene regulatory network underlying otic commitment and reveal dynamic changes in gene expression. Functional analysis of selected transcription factors reveals the genetic hierarchy underlying the transition ...
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
A novel gene network inference algorithm using predictive minimum description length approach.
Chaitankar, Vijender; Ghosh, Preetam; Perkins, Edward J; Gong, Ping; Deng, Youping; Zhang, Chaoyang
2010-05-28
Reverse engineering of gene regulatory networks using information theory models has received much attention due to its simplicity, low computational cost, and capability of inferring large networks. One of the major problems with information theory models is to determine the threshold which defines the regulatory relationships between genes. The minimum description length (MDL) principle has been implemented to overcome this problem. The description length of the MDL principle is the sum of model length and data encoding length. A user-specified fine tuning parameter is used as control mechanism between model and data encoding, but it is difficult to find the optimal parameter. In this work, we proposed a new inference algorithm which incorporated mutual information (MI), conditional mutual information (CMI) and predictive minimum description length (PMDL) principle to infer gene regulatory networks from DNA microarray data. In this algorithm, the information theoretic quantities MI and CMI determine the regulatory relationships between genes and the PMDL principle method attempts to determine the best MI threshold without the need of a user-specified fine tuning parameter. The performance of the proposed algorithm was evaluated using both synthetic time series data sets and a biological time series data set for the yeast Saccharomyces cerevisiae. The benchmark quantities precision and recall were used as performance measures. The results show that the proposed algorithm produced less false edges and significantly improved the precision, as compared to the existing algorithm. For further analysis the performance of the algorithms was observed over different sizes of data. We have proposed a new algorithm that implements the PMDL principle for inferring gene regulatory networks from time series DNA microarray data that eliminates the need of a fine tuning parameter. The evaluation results obtained from both synthetic and actual biological data sets show that the
FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT
Directory of Open Access Journals (Sweden)
Khlestkina E.
2012-08-01
Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.
Neurogenic gene regulatory pathways in the sea urchin embryo.
Wei, Zheng; Angerer, Lynne M; Angerer, Robert C
2016-01-15
During embryogenesis the sea urchin early pluteus larva differentiates 40-50 neurons marked by expression of the pan-neural marker synaptotagmin B (SynB) that are distributed along the ciliary band, in the apical plate and pharyngeal endoderm, and 4-6 serotonergic neurons that are confined to the apical plate. Development of all neurons has been shown to depend on the function of Six3. Using a combination of molecular screens and tests of gene function by morpholino-mediated knockdown, we identified SoxC and Brn1/2/4, which function sequentially in the neurogenic regulatory pathway and are also required for the differentiation of all neurons. Misexpression of Brn1/2/4 at low dose caused an increase in the number of serotonin-expressing cells and at higher dose converted most of the embryo to a neurogenic epithelial sphere expressing the Hnf6 ciliary band marker. A third factor, Z167, was shown to work downstream of the Six3 and SoxC core factors and to define a branch specific for the differentiation of serotonergic neurons. These results provide a framework for building a gene regulatory network for neurogenesis in the sea urchin embryo. © 2016. Published by The Company of Biologists Ltd.
Pritchard, Victoria L; Viitaniemi, Heidi M; McCairns, R J Scott; Merilä, Juha; Nikinmaa, Mikko; Primmer, Craig R; Leder, Erica H
2017-01-05
Much adaptive evolutionary change is underlain by mutational variation in regions of the genome that regulate gene expression rather than in the coding regions of the genes themselves. An understanding of the role of gene expression variation in facilitating local adaptation will be aided by an understanding of underlying regulatory networks. Here, we characterize the genetic architecture of gene expression variation in the threespine stickleback (Gasterosteus aculeatus), an important model in the study of adaptive evolution. We collected transcriptomic and genomic data from 60 half-sib families using an expression microarray and genotyping-by-sequencing, and located expression quantitative trait loci (eQTL) underlying the variation in gene expression in liver tissue using an interval mapping approach. We identified eQTL for several thousand expression traits. Expression was influenced by polymorphism in both cis- and trans-regulatory regions. Trans-eQTL clustered into hotspots. We did not identify master transcriptional regulators in hotspot locations: rather, the presence of hotspots may be driven by complex interactions between multiple transcription factors. One observed hotspot colocated with a QTL recently found to underlie salinity tolerance in the threespine stickleback. However, most other observed hotspots did not colocate with regions of the genome known to be involved in adaptive divergence between marine and freshwater habitats. Copyright © 2017 Pritchard et al.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Modularity of gene-regulatory networks revealed in sea-star development
Directory of Open Access Journals (Sweden)
Degnan Bernard M
2011-01-01
Full Text Available Abstract Evidence that conserved developmental gene-regulatory networks can change as a unit during deutersostome evolution emerges from a study published in BMC Biology. This shows that genes consistently expressed in anterior brain patterning in hemichordates and chordates are expressed in a similar spatial pattern in another deuterostome, an asteroid echinoderm (sea star, but in a completely different developmental context (the animal-vegetal axis. This observation has implications for hypotheses on the type of development present in the deuterostome common ancestor. See research article: http://www.biomedcentral.com/1741-7007/8/143/abstract
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.
2000-01-01
The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were
Kreikemeyer, Bernd; Nakata, Masanobu; Köller, Thomas; Hildisch, Hendrikje; Kourakos, Vassilios; Standar, Kerstin; Kawabata, Shigetada; Glocker, Michael O.; Podbielski, Andreas
2007-01-01
Many Streptococcus pyogenes (group A streptococcus [GAS]) virulence factor- and transcriptional regulator-encoding genes cluster together in discrete genomic regions. Nra is a central regulator of the FCT region. Previous studies exclusively described Nra as a transcriptional repressor of adhesin and toxin genes. Here transcriptome and proteome analysis of a serotype M49 GAS strain and an isogenic Nra mutant of this strain revealed the complete Nra regulon profile. Nra is active in all growth phases tested, with the largest regulon in the transition phase. Almost exclusively, virulence factor-encoding genes are repressed by Nra; these genes include the GAS pilus operon, the capsule synthesis operon, the cytolysin-mediated translocation system genes, all Mga region core virulence genes, and genes encoding other regulators, like the Ihk/Irr system, Rgg, and two additional RofA-like protein family regulators. Surprisingly, our experiments revealed that Nra additionally acts as a positive regulator, mostly for genes encoding proteins and enzymes with metabolic functions. Epidemiological investigations revealed strong genetic linkage of one particular Nra-repressed regulator, Ralp3 (SPy0735), with a gene encoding Epf (extracellular protein factor from Streptococcus suis). In a serotype-specific fashion, this ralp3 epf gene block is integrated, most likely via transposition, into the eno sagA virulence gene block, which is present in all GAS serotypes. In GAS serotypes M1, M4, M12, M28, and M49 this novel discrete genetic region is therefore designated the eno ralp3 epf sagA (ERES) pathogenicity region. Functional experiments showed that Epf is a novel GAS plasminogen-binding protein and revealed that Ralp3 activity counteracts Nra and MsmR regulatory activity. In addition to the Mga and FCT regions, the ERES region is the third discrete chromosomal pathogenicity region. All of these regions are transcriptionally linked, adding another level of complexity to the known
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Regulatory divergence of X-linked genes and hybrid male sterility in mice.
Oka, Ayako; Shiroishi, Toshihiko
2014-01-01
Postzygotic reproductive isolation is the reduction of fertility or viability in hybrids between genetically diverged populations. One example of reproductive isolation, hybrid male sterility, may be caused by genetic incompatibility between diverged genetic factors in two distinct populations. Genetic factors involved in hybrid male sterility are disproportionately located on the X chromosome. Recent studies showing the evolutionary divergence in gene regulatory networks or epigenetic effects suggest that the genetic incompatibilities occur at much broader levels than had previously been thought (e.g., incompatibility of protein-protein interactions). The latest studies suggest that evolutionary divergence of transcriptional regulation causes genetic incompatibilities in hybrid animals, and that such incompatibilities preferentially involve X-linked genes. In this review, we focus on recent progress in understanding hybrid sterility in mice, including our studies, and we discuss the evolutionary significance of regulatory divergence for speciation.
Directory of Open Access Journals (Sweden)
Lu Wang
2017-08-01
Full Text Available The human genome hosts several active families of transposable elements (TEs, including the Alu, LINE-1, and SVA retrotransposons that are mobilized via reverse transcription of RNA intermediates. We evaluated how insertion polymorphisms generated by human retrotransposon activity may be related to common health and disease phenotypes that have been previously interrogated through genome-wide association studies (GWAS. To address this question, we performed a genome-wide screen for retrotransposon polymorphism disease associations that are linked to TE induced gene regulatory changes. Our screen first identified polymorphic retrotransposon insertions found in linkage disequilibrium (LD with single nucleotide polymorphisms that were previously associated with common complex diseases by GWAS. We further narrowed this set of candidate disease associated retrotransposon polymorphisms by identifying insertions that are located within tissue-specific enhancer elements. We then performed expression quantitative trait loci analysis on the remaining set of candidates in order to identify polymorphic retrotransposon insertions that are associated with gene expression changes in B-cells of the human immune system. This progressive and stringent screen yielded a list of six retrotransposon insertions as the strongest candidates for TE polymorphisms that lead to disease via enhancer-mediated changes in gene regulation. For example, we found an SVA insertion within a cell-type specific enhancer located in the second intron of the B4GALT1 gene. B4GALT1 encodes a glycosyltransferase that functions in the glycosylation of the Immunoglobulin G (IgG antibody in such a way as to convert its activity from pro- to anti-inflammatory. The disruption of the B4GALT1 enhancer by the SVA insertion is associated with down-regulation of the gene in B-cells, which would serve to keep the IgG molecule in a pro-inflammatory state. Consistent with this idea, the B4GALT1 enhancer
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Directory of Open Access Journals (Sweden)
Jeane Eliete Laguila Visentainer
2008-12-01
Full Text Available A compatibilidade genética HLA entre doador e receptor é um fator importante para o sucesso do transplante de células progenitoras hematopoiéticas (TCPH. No entanto, outros genes não-HLA estão sendo investigados em relação ao seu papel na incidência e gravidade da doença do enxerto contra o hospedeiro e na sobrevida, por modularem a intensidade da inflamação e os danos teciduais. Estes genes, não-HLA, incluem os genes de citocinas com polimorfismos dentro das seqüências 5' ou 3' regulatórias dos genes. Os polimorfismos ou microssatélites podem alterar a ligação dos fatores de transcrição aos sítios dentro dos genes promotores e a quantidade de citocina produzida. Este estudo revisa o papel potencial destes polimorfismos genéticos relativos às citocinas em prever o curso do TCPH.HLA genetic matching of donor and recipient is an important requirement for optimizing outcome following hematopoietic stem cell transplantation (HSCT. However, other non-HLA genes are being investigated for their role in graft-versus-host disease incidence and severity and in survival, by modulating the intensity of inflammation and tissue injury. These non-HLA-encoded genes include cytokine genes with polymorphisms within the 5' or 3' regulatory sequences of the genes. The polymorphisms or microsatellites may alter the transcription factor binding sites within the gene promoters and the amount of cytokine produced. This chapter summarizes the potential role of these genetic polymorphisms regarding the cytokines in predicting outcome of HSCT.
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
Bottom-up GGM algorithm for constructing multiple layered hierarchical gene regulatory networks
Multilayered hierarchical gene regulatory networks (ML-hGRNs) are very important for understanding genetics regulation of biological pathways. However, there are currently no computational algorithms available for directly building ML-hGRNs that regulate biological pathways. A bottom-up graphic Gaus...
Directory of Open Access Journals (Sweden)
Seung Hee Cho
2017-12-01
Full Text Available Regulatory RNA regions within a transcript, particularly in the 5′ untranslated region (5′UTR, have been shown in a variety of organisms to control the expression levels of these mRNAs in response to various metabolites or environmental conditions. Considering the unique tolerance of Zymomonas mobilis to ethanol and the growing interest in engineering microbial strains with enhanced tolerance to industrial inhibitors, we searched natural cis-regulatory regions in this microorganism using transcriptomic data and bioinformatics analysis. Potential regulatory 5′UTRs were identified and filtered based on length, gene function, relative gene counts, and conservation in other organisms. An in vivo fluorescence-based screening system was developed to confirm the responsiveness of 36 5′UTR candidates to ethanol, acetate, and xylose stresses. UTR_ZMO0347 (5′UTR of gene ZMO0347 encoding the RNA binding protein Hfq was found to down-regulate downstream gene expression under ethanol stress. Genomic deletion of UTR_ZMO0347 led to a general decrease of hfq expression at the transcript level and increased sensitivity for observed changes in Hfq expression at the protein level. The role of UTR_ZMO0347 and other 5′UTRs gives us insight into the regulatory network of Z. mobilis in response to stress and unlocks new strategies for engineering robust industrial strains as well as for harvesting novel responsive regulatory biological parts for controllable gene expression platforms in this organism.
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S
2005-07-15
A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.
Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R
1988-01-01
We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
Directory of Open Access Journals (Sweden)
Jensen Paul A
2011-09-01
Full Text Available Abstract Background Several methods have been developed for analyzing genome-scale models of metabolism and transcriptional regulation. Many of these methods, such as Flux Balance Analysis, use constrained optimization to predict relationships between metabolic flux and the genes that encode and regulate enzyme activity. Recently, mixed integer programming has been used to encode these gene-protein-reaction (GPR relationships into a single optimization problem, but these techniques are often of limited generality and lack a tool for automating the conversion of rules to a coupled regulatory/metabolic model. Results We present TIGER, a Toolbox for Integrating Genome-scale Metabolism, Expression, and Regulation. TIGER converts a series of generalized, Boolean or multilevel rules into a set of mixed integer inequalities. The package also includes implementations of existing algorithms to integrate high-throughput expression data with genome-scale models of metabolism and transcriptional regulation. We demonstrate how TIGER automates the coupling of a genome-scale metabolic model with GPR logic and models of transcriptional regulation, thereby serving as a platform for algorithm development and large-scale metabolic analysis. Additionally, we demonstrate how TIGER's algorithms can be used to identify inconsistencies and improve existing models of transcriptional regulation with examples from the reconstructed transcriptional regulatory network of Saccharomyces cerevisiae. Conclusion The TIGER package provides a consistent platform for algorithm development and extending existing genome-scale metabolic models with regulatory networks and high-throughput data.
Gerstein, Mark
2016-01-01
Gene expression is controlled by the combinatorial effects of regulatory factors from different biological subsystems such as general transcription factors (TFs), cellular growth factors and microRNAs. A subsystem’s gene expression may be controlled by its internal regulatory factors, exclusively, or by external subsystems, or by both. It is thus useful to distinguish the degree to which a subsystem is regulated internally or externally–e.g., how non-conserved, species-specific TFs affect the expression of conserved, cross-species genes during evolution. We developed a computational method (DREISS, dreiss.gerteinlab.org) for analyzing the Dynamics of gene expression driven by Regulatory networks, both External and Internal based on State Space models. Given a subsystem, the “state” and “control” in the model refer to its own (internal) and another subsystem’s (external) gene expression levels. The state at a given time is determined by the state and control at a previous time. Because typical time-series data do not have enough samples to fully estimate the model’s parameters, DREISS uses dimensionality reduction, and identifies canonical temporal expression trajectories (e.g., degradation, growth and oscillation) representing the regulatory effects emanating from various subsystems. To demonstrate capabilities of DREISS, we study the regulatory effects of evolutionarily conserved vs. divergent TFs across distant species. In particular, we applied DREISS to the time-series gene expression datasets of C. elegans and D. melanogaster during their embryonic development. We analyzed the expression dynamics of the conserved, orthologous genes (orthologs), seeing the degree to which these can be accounted for by orthologous (internal) versus species-specific (external) TFs. We found that between two species, the orthologs have matched, internally driven expression patterns but very different externally driven ones. This is particularly true for genes with
Directory of Open Access Journals (Sweden)
Daifeng Wang
2016-10-01
Full Text Available Gene expression is controlled by the combinatorial effects of regulatory factors from different biological subsystems such as general transcription factors (TFs, cellular growth factors and microRNAs. A subsystem's gene expression may be controlled by its internal regulatory factors, exclusively, or by external subsystems, or by both. It is thus useful to distinguish the degree to which a subsystem is regulated internally or externally-e.g., how non-conserved, species-specific TFs affect the expression of conserved, cross-species genes during evolution. We developed a computational method (DREISS, dreiss.gerteinlab.org for analyzing the Dynamics of gene expression driven by Regulatory networks, both External and Internal based on State Space models. Given a subsystem, the "state" and "control" in the model refer to its own (internal and another subsystem's (external gene expression levels. The state at a given time is determined by the state and control at a previous time. Because typical time-series data do not have enough samples to fully estimate the model's parameters, DREISS uses dimensionality reduction, and identifies canonical temporal expression trajectories (e.g., degradation, growth and oscillation representing the regulatory effects emanating from various subsystems. To demonstrate capabilities of DREISS, we study the regulatory effects of evolutionarily conserved vs. divergent TFs across distant species. In particular, we applied DREISS to the time-series gene expression datasets of C. elegans and D. melanogaster during their embryonic development. We analyzed the expression dynamics of the conserved, orthologous genes (orthologs, seeing the degree to which these can be accounted for by orthologous (internal versus species-specific (external TFs. We found that between two species, the orthologs have matched, internally driven expression patterns but very different externally driven ones. This is particularly true for genes with
Analysis of a Gene Regulatory Cascade Mediating Circadian Rhythm in Zebrafish
Wang, Haifang; Du, Jiulin; Yan, Jun
2013-01-01
In the study of circadian rhythms, it has been a puzzle how a limited number of circadian clock genes can control diverse aspects of physiology. Here we investigate circadian gene expression genome-wide using larval zebrafish as a model system. We made use of a spatial gene expression atlas to investigate the expression of circadian genes in various tissues and cell types. Comparison of genome-wide circadian gene expression data between zebrafish and mouse revealed a nearly anti-phase relationship and allowed us to detect novel evolutionarily conserved circadian genes in vertebrates. We identified three groups of zebrafish genes with distinct responses to light entrainment: fast light-induced genes, slow light-induced genes, and dark-induced genes. Our computational analysis of the circadian gene regulatory network revealed several transcription factors (TFs) involved in diverse aspects of circadian physiology through transcriptional cascade. Of these, microphthalmia-associated transcription factor a (mitfa), a dark-induced TF, mediates a circadian rhythm of melanin synthesis, which may be involved in zebrafish's adaptation to daily light cycling. Our study describes a systematic method to discover previously unidentified TFs involved in circadian physiology in complex organisms. PMID:23468616
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Directory of Open Access Journals (Sweden)
Hyun-Eui Park
Full Text Available Johne's disease is a chronic wasting disease of ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP, resulting in inflammation of intestines and persistent diarrhea. The initial host response against MAP infections is mainly regulated by the Th1 response, which is characterized by the production of IFN-γ. With the progression of disease, MAP can survive in the host through the evasion of the host's immune response by manipulating the host immune response. However, the host response during subclinical phases has not been fully understood. Immune regulatory genes, including Th17-derived cytokines, interferon regulatory factors, and calcium signaling-associated genes, are hypothesized to play an important role during subclinical phases of Johne's disease. Therefore, the present study was conducted to analyze the expression profiles of immune regulatory genes during MAP infection in whole blood. Different expression patterns of genes were identified depending on the infection stages. Downregulation of IL-17A, IL-17F, IL-22, IL-26, HMGB1, and IRF4 and upregulation of PIP5K1C indicate suppression of the Th1 response due to MAP infection and loss of granuloma integrity. In addition, increased expression of IRF5 and IRF7 suggest activation of IFN-α/β signaling during subclinical stages, which induced indoleamine 2,3-dioxygenase mediated depletion of tryptophan metabolism. Increased expression of CORO1A indicate modulation of calcium signaling, which enhanced the survival of MAP. Taken together, distinct host gene expression induced by MAP infection indicates enhanced survival of MAP during subclinical stages.
Regulatory Oversight of Cell and Gene Therapy Products in Canada.
Ridgway, Anthony; Agbanyo, Francisca; Wang, Jian; Rosu-Myles, Michael
2015-01-01
Health Canada regulates gene therapy products and many cell therapy products as biological drugs under the Canadian Food and Drugs Act and its attendant regulations. Cellular products that meet certain criteria, including minimal manipulation and homologous use, may be subjected to a standards-based approach under the Safety of Human Cells, Tissues and Organs for Transplantation Regulations. The manufacture and clinical testing of cell and gene therapy products (CGTPs) presents many challenges beyond those for protein biologics. Cells cannot be subjected to pathogen removal or inactivation procedures and must frequently be administered shortly after final formulation. Viral vector design and manufacturing control are critically important to overall product quality and linked to safety and efficacy in patients through concerns such as replication competence, vector integration, and vector shedding. In addition, for many CGTPs, the value of nonclinical studies is largely limited to providing proof of concept, and the first meaningful data relating to appropriate dosing, safety parameters, and validity of surrogate or true determinants of efficacy must come from carefully designed clinical trials in patients. Addressing these numerous challenges requires application of various risk mitigation strategies and meeting regulatory expectations specifically adapted to the product types. Regulatory cooperation and harmonisation at an international level are essential for progress in the development and commercialisation of these products. However, particularly in the area of cell therapy, new regulatory paradigms may be needed to harness the benefits of clinical progress in situations where the resources and motivation to pursue a typical drug product approval pathway may be lacking.
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
Antoneli, Fernando; Ferreira, Renata C; Briones, Marcelo R S
2016-06-01
Here we propose a new approach to modeling gene expression based on the theory of random dynamical systems (RDS) that provides a general coupling prescription between the nodes of any given regulatory network given the dynamics of each node is modeled by a RDS. The main virtues of this approach are the following: (i) it provides a natural way to obtain arbitrarily large networks by coupling together simple basic pieces, thus revealing the modularity of regulatory networks; (ii) the assumptions about the stochastic processes used in the modeling are fairly general, in the sense that the only requirement is stationarity; (iii) there is a well developed mathematical theory, which is a blend of smooth dynamical systems theory, ergodic theory and stochastic analysis that allows one to extract relevant dynamical and statistical information without solving the system; (iv) one may obtain the classical rate equations form the corresponding stochastic version by averaging the dynamic random variables (small noise limit). It is important to emphasize that unlike the deterministic case, where coupling two equations is a trivial matter, coupling two RDS is non-trivial, specially in our case, where the coupling is performed between a state variable of one gene and the switching stochastic process of another gene and, hence, it is not a priori true that the resulting coupled system will satisfy the definition of a random dynamical system. We shall provide the necessary arguments that ensure that our coupling prescription does indeed furnish a coupled regulatory network of random dynamical systems. Finally, the fact that classical rate equations are the small noise limit of our stochastic model ensures that any validation or prediction made on the basis of the classical theory is also a validation or prediction of our model. We illustrate our framework with some simple examples of single-gene system and network motifs. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Stochastic Boolean networks: An efficient approach to modeling gene regulatory networks
Directory of Open Access Journals (Sweden)
Liang Jinghang
2012-08-01
Full Text Available Abstract Background Various computational models have been of interest due to their use in the modelling of gene regulatory networks (GRNs. As a logical model, probabilistic Boolean networks (PBNs consider molecular and genetic noise, so the study of PBNs provides significant insights into the understanding of the dynamics of GRNs. This will ultimately lead to advances in developing therapeutic methods that intervene in the process of disease development and progression. The applications of PBNs, however, are hindered by the complexities involved in the computation of the state transition matrix and the steady-state distribution of a PBN. For a PBN with n genes and N Boolean networks, the complexity to compute the state transition matrix is O(nN22n or O(nN2n for a sparse matrix. Results This paper presents a novel implementation of PBNs based on the notions of stochastic logic and stochastic computation. This stochastic implementation of a PBN is referred to as a stochastic Boolean network (SBN. An SBN provides an accurate and efficient simulation of a PBN without and with random gene perturbation. The state transition matrix is computed in an SBN with a complexity of O(nL2n, where L is a factor related to the stochastic sequence length. Since the minimum sequence length required for obtaining an evaluation accuracy approximately increases in a polynomial order with the number of genes, n, and the number of Boolean networks, N, usually increases exponentially with n, L is typically smaller than N, especially in a network with a large number of genes. Hence, the computational efficiency of an SBN is primarily limited by the number of genes, but not directly by the total possible number of Boolean networks. Furthermore, a time-frame expanded SBN enables an efficient analysis of the steady-state distribution of a PBN. These findings are supported by the simulation results of a simplified p53 network, several randomly generated networks and a
Directory of Open Access Journals (Sweden)
Junhua Li
2014-01-01
Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
Savic, Daniel; Ramaker, Ryne C; Roberts, Brian S; Dean, Emma C; Burwell, Todd C; Meadows, Sarah K; Cooper, Sara J; Garabedian, Michael J; Gertz, Jason; Myers, Richard M
2016-07-11
The liver X receptors (LXRs, NR1H2 and NR1H3) and peroxisome proliferator-activated receptor gamma (PPARG, NR1C3) nuclear receptor transcription factors (TFs) are master regulators of energy homeostasis. Intriguingly, recent studies suggest that these metabolic regulators also impact tumor cell proliferation. However, a comprehensive temporal molecular characterization of the LXR and PPARG gene regulatory responses in tumor cells is still lacking. To better define the underlying molecular processes governing the genetic control of cellular growth in response to extracellular metabolic signals, we performed a comprehensive, genome-wide characterization of the temporal regulatory cascades mediated by LXR and PPARG signaling in HT29 colorectal cancer cells. For this analysis, we applied a multi-tiered approach that incorporated cellular phenotypic assays, gene expression profiles, chromatin state dynamics, and nuclear receptor binding patterns. Our results illustrate that the activation of both nuclear receptors inhibited cell proliferation and further decreased glutathione levels, consistent with increased cellular oxidative stress. Despite a common metabolic reprogramming, the gene regulatory network programs initiated by these nuclear receptors were widely distinct. PPARG generated a rapid and short-term response while maintaining a gene activator role. By contrast, LXR signaling was prolonged, with initial, predominantly activating functions that transitioned to repressive gene regulatory activities at late time points. Through the use of a multi-tiered strategy that integrated various genomic datasets, our data illustrate that distinct gene regulatory programs elicit common phenotypic effects, highlighting the complexity of the genome. These results further provide a detailed molecular map of metabolic reprogramming in cancer cells through LXR and PPARG activation. As ligand-inducible TFs, these nuclear receptors can potentially serve as attractive therapeutic
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters
Directory of Open Access Journals (Sweden)
Farré Domènec
2007-12-01
Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
Neural model of gene regulatory network: a survey on supportive meta-heuristics.
Biswas, Surama; Acharyya, Sriyankar
2016-06-01
Gene regulatory network (GRN) is produced as a result of regulatory interactions between different genes through their coded proteins in cellular context. Having immense importance in disease detection and drug finding, GRN has been modelled through various mathematical and computational schemes and reported in survey articles. Neural and neuro-fuzzy models have been the focus of attraction in bioinformatics. Predominant use of meta-heuristic algorithms in training neural models has proved its excellence. Considering these facts, this paper is organized to survey neural modelling schemes of GRN and the efficacy of meta-heuristic algorithms towards parameter learning (i.e. weighting connections) within the model. This survey paper renders two different structure-related approaches to infer GRN which are global structure approach and substructure approach. It also describes two neural modelling schemes, such as artificial neural network/recurrent neural network based modelling and neuro-fuzzy modelling. The meta-heuristic algorithms applied so far to learn the structure and parameters of neutrally modelled GRN have been reviewed here.
Shafiee, Mohamad N; Mongan, Nigel; Seedhouse, Claire; Chapman, Caroline; Deen, Suha; Abu, Jafaru; Atiomo, William
2017-05-01
Women with polycystic ovary syndrome have a three-fold higher risk of endometrial cancer. Insulin resistance and hyperlipidemia may be pertinent factors in the pathogenesis of both conditions. The aim of this study was to investigate endometrial sterol regulatory element binding protein-1 gene expression in polycystic ovary syndrome and endometrial cancer endometrium, and to correlate endometrial sterol regulatory element binding protein-1 gene expression with serum lipid profiles. A cross-sectional study was performed at Nottingham University Hospital, UK. A total of 102 women (polycystic ovary syndrome, endometrial cancer and controls; 34 participants in each group) were recruited. Clinical and biochemical assessments were performed before endometrial biopsies were obtained from all participants. Taqman real-time polymerase chain reaction for endometrial sterol regulatory element binding protein-1 gene and its systemic protein expression were analyzed. The body mass indices of women with polycystic ovary syndrome (29.28 ± 2.91 kg/m 2 ) and controls (28.58 ± 2.62 kg/m 2 ) were not significantly different. Women with endometrial cancer had a higher mean body mass index (32.22 ± 5.70 kg/m 2 ). Sterol regulatory element binding protein-1 gene expression was significantly increased in polycystic ovary syndrome and endometrial cancer endometrium compared with controls (p ovary syndrome, but this was not statistically significant. Similarly, statistically insignificant positive correlations were found between endometrial sterol regulatory element binding protein-1 gene expression and body mass index in endometrial cancer (r = 0.643, p = 0.06) and waist-hip ratio (r = 0.096, p = 0.073). Sterol regulatory element binding protein-1 gene expression was significantly positively correlated with triglyceride in both polycystic ovary syndrome and endometrial cancer (p = 0.028 and p = 0.027, respectively). Quantitative serum sterol regulatory element
DEFF Research Database (Denmark)
Sjöström, H; Norén, O; Olsen, Jørgen
1989-01-01
. By sequence comparisons we have found three domains showing similarity to promoter regions of the genes encoding human alpha 1-antitrypsin and human intestinal alkaline phosphatase. The gene sequence includes the first three exons and two introns. It shows that a single exon encodes the cytoplasmic tail...
Gene expression patterns of sulfur starvation in Synechocystis sp. PCC 6803
Directory of Open Access Journals (Sweden)
Pendse Ninad D
2008-07-01
Full Text Available Abstract Background The unicellular cyanobacterium Synechocystis sp. PCC 6803 is a model microbe for studying biochemistry, genetics and molecular biology of photobiological processes. Importance of this bacterium in basic and applied research calls for a systematic, genome-wide description of its transcriptional regulatory capacity. Characteristic transcriptional responses to changes in the growth environment are expected to provide a scaffold for describing the Synechocystis transcriptional regulatory network as well as efficient means for functional annotation of genes in the genome. Results We designed, validated and used Synechocystis genome-wide oligonucleotide (70-mer microarray (representing 96.7% of all chromosomal ORFs annotated at the time of the beginning of this project to study transcriptional activity of the cyanobacterial genome in response to sulfur (S starvation. The microarray data were verified by quantitative RT-PCR. We made five main observations: 1 Transcriptional changes upon sulfate starvation were relatively moderate, but significant and consistent with growth kinetics; 2 S acquisition genes encoding for a high-affinity sulfate transporter were significantly induced, while decreased transcription of genes for phycobilisome, photosystems I and II, cytochrome b6/f, and ATP synthase indicated reduced light-harvesting and photosynthetic activity; 3 S starvation elicited transcriptional responses associated with general growth arrest and stress; 4 A large number of genes regulated by S availability encode hypothetical proteins or proteins of unknown function; 5 Hydrogenase structural and maturation accessory genes were not identified as differentially expressed, even though increased hydrogen evolution was observed. Conclusion The expression profiles recorded by using this oligonucleotide-based microarray platform revealed that during transition from the condition of plentiful S to S starvation, Synechocystis undergoes
Natural biased coin encoded in the genome determines cell strategy.
Directory of Open Access Journals (Sweden)
Faezeh Dorri
Full Text Available Decision making at a cellular level determines different fates for isogenic cells. However, it is not yet clear how rational decisions are encoded in the genome, how they are transmitted to their offspring, and whether they evolve and become optimized throughout generations. In this paper, we use a game theoretic approach to explain how rational decisions are made in the presence of cooperators and competitors. Our results suggest the existence of an internal switch that operates as a biased coin. The biased coin is, in fact, a biochemical bistable network of interacting genes that can flip to one of its stable states in response to different environmental stimuli. We present a framework to describe how the positions of attractors in such a gene regulatory network correspond to the behavior of a rational player in a competing environment. We evaluate our model by considering lysis/lysogeny decision making of bacteriophage lambda in E. coli.
Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.; van Dijl, Jan Maarten
2016-01-01
Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5= untranslated region. Thus far, most regulatory RNA research has focused on
Zhong , Lei; Yu , Xiaomu; Tong , Jingou
2006-01-01
Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
Plasticity of the cis-regulatory input function of a gene.
Directory of Open Access Journals (Sweden)
Avraham E Mayo
2006-04-01
Full Text Available The transcription rate of a gene is often controlled by several regulators that bind specific sites in the gene's cis-regulatory region. The combined effect of these regulators is described by a cis-regulatory input function. What determines the form of an input function, and how variable is it with respect to mutations? To address this, we employ the well-characterized lac operon of Escherichia coli, which has an elaborate input function, intermediate between Boolean AND-gate and OR-gate logic. We mapped in detail the input function of 12 variants of the lac promoter, each with different point mutations in the regulator binding sites, by means of accurate expression measurements from living cells. We find that even a few mutations can significantly change the input function, resulting in functions that resemble Pure AND gates, OR gates, or single-input switches. Other types of gates were not found. The variant input functions can be described in a unified manner by a mathematical model. The model also lets us predict which functions cannot be reached by point mutations. The input function that we studied thus appears to be plastic, in the sense that many of the mutations do not ruin the regulation completely but rather result in new ways to integrate the inputs.
Yamada, Tetsuya; Matsuda, Fumio; Kasai, Koji; Fukuoka, Shuichi; Kitamura, Keisuke; Tozawa, Yuzuru; Miyagawa, Hisashi; Wakasa, Kyo
2008-01-01
Two distinct biosynthetic pathways for Phe in plants have been proposed: conversion of prephenate to Phe via phenylpyruvate or arogenate. The reactions catalyzed by prephenate dehydratase (PDT) and arogenate dehydratase (ADT) contribute to these respective pathways. The Mtr1 mutant of rice (Oryza sativa) manifests accumulation of Phe, Trp, and several phenylpropanoids, suggesting a link between the synthesis of Phe and Trp. Here, we show that the Mtr1 mutant gene (mtr1-D) encodes a form of rice PDT with a point mutation in the putative allosteric regulatory region of the protein. Transformed callus lines expressing mtr1-D exhibited all the characteristics of Mtr1 callus tissue. Biochemical analysis revealed that rice PDT possesses both PDT and ADT activities, with a preference for arogenate as substrate, suggesting that it functions primarily as an ADT. The wild-type enzyme is feedback regulated by Phe, whereas the mutant enzyme showed a reduced feedback sensitivity, resulting in Phe accumulation. In addition, these observations indicate that rice PDT is critical for regulating the size of the Phe pool in plant cells. Feeding external Phe to wild-type callus tissue and seedlings resulted in Trp accumulation, demonstrating a connection between Phe accumulation and Trp pool size. PMID:18487352
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Fischer, Martin; Grossmann, Patrick; Padi, Megha; DeCaprio, James A
2016-07-27
Cell cycle (CC) and TP53 regulatory networks are frequently deregulated in cancer. While numerous genome-wide studies of TP53 and CC-regulated genes have been performed, significant variation between studies has made it difficult to assess regulation of any given gene of interest. To overcome the limitation of individual studies, we developed a meta-analysis approach to identify high confidence target genes that reflect their frequency of identification in independent datasets. Gene regulatory networks were generated by comparing differential expression of TP53 and CC-regulated genes with chromatin immunoprecipitation studies for TP53, RB1, E2F, DREAM, B-MYB, FOXM1 and MuvB. RNA-seq data from p21-null cells revealed that gene downregulation by TP53 generally requires p21 (CDKN1A). Genes downregulated by TP53 were also identified as CC genes bound by the DREAM complex. The transcription factors RB, E2F1 and E2F7 bind to a subset of DREAM target genes that function in G1/S of the CC while B-MYB, FOXM1 and MuvB control G2/M gene expression. Our approach yields high confidence ranked target gene maps for TP53, DREAM, MMB-FOXM1 and RB-E2F and enables prediction and distinction of CC regulation. A web-based atlas at www.targetgenereg.org enables assessing the regulation of any human gene of interest. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Yoichiro Shibata
2012-06-01
Full Text Available Understanding the molecular basis for phenotypic differences between humans and other primates remains an outstanding challenge. Mutations in non-coding regulatory DNA that alter gene expression have been hypothesized as a key driver of these phenotypic differences. This has been supported by differential gene expression analyses in general, but not by the identification of specific regulatory elements responsible for changes in transcription and phenotype. To identify the genetic source of regulatory differences, we mapped DNaseI hypersensitive (DHS sites, which mark all types of active gene regulatory elements, genome-wide in the same cell type isolated from human, chimpanzee, and macaque. Most DHS sites were conserved among all three species, as expected based on their central role in regulating transcription. However, we found evidence that several hundred DHS sites were gained or lost on the lineages leading to modern human and chimpanzee. Species-specific DHS site gains are enriched near differentially expressed genes, are positively correlated with increased transcription, show evidence of branch-specific positive selection, and overlap with active chromatin marks. Species-specific sequence differences in transcription factor motifs found within these DHS sites are linked with species-specific changes in chromatin accessibility. Together, these indicate that the regulatory elements identified here are genetic contributors to transcriptional and phenotypic differences among primate species.
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Dichotomous noise models of gene switches
Energy Technology Data Exchange (ETDEWEB)
Potoyan, Davit A., E-mail: potoyan@rice.edu; Wolynes, Peter G., E-mail: pwolynes@rice.edu [Department of Chemistry and Center for Theoretical Biological Physics, Rice University, Houston, Texas 77005 (United States)
2015-11-21
Molecular noise in gene regulatory networks has two intrinsic components, one part being due to fluctuations caused by the birth and death of protein or mRNA molecules which are often present in small numbers and the other part arising from gene state switching, a single molecule event. Stochastic dynamics of gene regulatory circuits appears to be largely responsible for bifurcations into a set of multi-attractor states that encode different cell phenotypes. The interplay of dichotomous single molecule gene noise with the nonlinear architecture of genetic networks generates rich and complex phenomena. In this paper, we elaborate on an approximate framework that leads to simple hybrid multi-scale schemes well suited for the quantitative exploration of the steady state properties of large-scale cellular genetic circuits. Through a path sum based analysis of trajectory statistics, we elucidate the connection of these hybrid schemes to the underlying master equation and provide a rigorous justification for using dichotomous noise based models to study genetic networks. Numerical simulations of circuit models reveal that the contribution of the genetic noise of single molecule origin to the total noise is significant for a wide range of kinetic regimes.
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene
International Nuclear Information System (INIS)
Gorodetskii, S.I.; Tkach, T.M.; Kapelinskaya, T.V.
1988-01-01
The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
International Nuclear Information System (INIS)
Kogure, Takahisa; Takagi, Masamichi; Ohta, Akinori
2005-01-01
The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated that three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism
Gao, Zhiguang; Mao, Chai-An; Pan, Ping; Mu, Xiuqian; Klein, William H
2014-11-01
The bHLH transcription factor ATOH7 (Math5) is essential for establishing retinal ganglion cell (RGC) fate. However, Atoh7-expressing retinal progenitor cells (RPCs) can give rise to all retinal cell types, suggesting that other factors are involved in specifying RGCs. The basis by which a subpopulation of Atoh7-expressing RPCs commits to an RGC fate remains uncertain but is of critical importance to retinal development since RGCs are the earliest cell type to differentiate. To better understand the regulatory mechanisms leading to cell-fate specification, a binary genetic system was generated to specifically label Atoh7-expressing cells with green fluorescent protein (GFP). Fluorescence-activated cell sorting (FACS)-purified GFP(+) and GFP(-) cells were profiled by RNA-seq. Here, we identify 1497 transcripts that were differentially expressed between the two RPC populations. Pathway analysis revealed diminished growth factor signaling in Atoh7-expressing RPCs, indicating that these cells had exited the cell cycle. In contrast, axon guidance signals were enriched, suggesting that axons of Atoh7-expressing RPCs were already making synaptic connections. Notably, many genes enriched in Atoh7-expressing RPCs encoded transcriptional regulators, and several were direct targets of ATOH7, including, and unexpectedly, Ebf3 and Eya2. We present evidence for a Pax6-Atoh7-Eya2 pathway that acts downstream of Atoh7 but upstream of differentiation factor Pou4f2. EYA2 is a protein phosphatase involved in protein-protein interactions and posttranslational regulation. These properties, along with Eya2 as an early target gene of ATOH7, suggest that EYA2 functions in RGC specification. Our results expand current knowledge of the regulatory networks operating in Atoh7-expressing RPCs and offer new directions for exploring the earliest aspects of retinogenesis. © 2014 Wiley Periodicals, Inc.
Li, Jinyang; Pan, Yuanyuan; Liu, Gang
2013-12-01
AcareA, encoding a homologue of the fungal nitrogen regulatory GATA zinc-finger proteins, was cloned from Acremonium chrysogenum. Gene disruption and genetic complementation revealed that AcareA was required for nitrogen metabolism and cephalosporin production. Disruption of AcareA resulted in growth defect in the medium using nitrate, uric acid and low concentration of ammonium, glutamine or urea as sole nitrogen source. Transcriptional analysis showed that the transcription of niaD/niiA was increased drastically when induced with nitrate in the wild-type and AcareA complemented strains but not in AcareA disruption mutant. Consistent with the reduction of cephalosporin production, the transcription of pcbAB, cefD2, cefEF and cefG encoding the enzymes for cephalosporin production was reduced in AcareA disruption mutant. Band shift assays showed that AcAREA bound to the promoter regions of niaD, niiA and the bidirectional promoter region of pcbAB-pcbC. Sequence analysis showed that all the AcAREA binding sites contain the consensus GATA elements. These results indicated that AcAREA plays an important role both in the regulation of nitrogen metabolism and cephalosporin production in A. chrysogenum. Copyright © 2013 Elsevier Inc. All rights reserved.
Trichothecenes are mycotoxins produced by Trichoderma, Fusarium and at least four other genera in the fungal order Hypocreales. Fusarium has a trichothecene biosynthetic gene (TRI) cluster that encodes transport and regulatory proteins as well as most enzymes required for formation of the mycotoxin...
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
Directory of Open Access Journals (Sweden)
Claire L. Anderson
2003-01-01
Full Text Available Over the past 10-15 years there has been an explosion of interest in apoptosis. The delayed realisation that cell death is an essential part of life for any multicellular organism has meant that, despite the recent and rapid developments of the last decade, the precise biochemical pathways involved in apoptosis remain incomplete and potentially novel genes may, as yet, remain undiscovered. The hunt is therefore on to bridge the remaining gaps in our knowledge. Our contribution to this research effort utilises a functional cloning approach to isolate important regulatory genes involved in apoptosis. This mini-review focuses on the use and advantages of a retroviral expression cloning strategy and describes the isolation and identification of one such potential apoptosis regulatory gene, namely that encoding vacuolar ATPase subunit E.
Ground rules of the pluripotency gene regulatory network.
Li, Mo
2017-01-03
Pluripotency is a state that exists transiently in the early embryo and, remarkably, can be recapitulated in vitro by deriving embryonic stem cells or by reprogramming somatic cells to become induced pluripotent stem cells. The state of pluripotency, which is stabilized by an interconnected network of pluripotency-associated genes, integrates external signals and exerts control over the decision between self-renewal and differentiation at the transcriptional, post-transcriptional and epigenetic levels. Recent evidence of alternative pluripotency states indicates the regulatory flexibility of this network. Insights into the underlying principles of the pluripotency network may provide unprecedented opportunities for studying development and for regenerative medicine.
Ground rules of the pluripotency gene regulatory network.
Li, Mo; Belmonte, Juan Carlos Izpisua
2017-01-01
Pluripotency is a state that exists transiently in the early embryo and, remarkably, can be recapitulated in vitro by deriving embryonic stem cells or by reprogramming somatic cells to become induced pluripotent stem cells. The state of pluripotency, which is stabilized by an interconnected network of pluripotency-associated genes, integrates external signals and exerts control over the decision between self-renewal and differentiation at the transcriptional, post-transcriptional and epigenetic levels. Recent evidence of alternative pluripotency states indicates the regulatory flexibility of this network. Insights into the underlying principles of the pluripotency network may provide unprecedented opportunities for studying development and for regenerative medicine.
The expression of antibiotic resistance genes in antibiotic-producing bacteria.
Mak, Stefanie; Xu, Ye; Nodwell, Justin R
2014-08-01
Antibiotic-producing bacteria encode antibiotic resistance genes that protect them from the biologically active molecules that they produce. The expression of these genes needs to occur in a timely manner: either in advance of or concomitantly with biosynthesis. It appears that there have been at least two general solutions to this problem. In many cases, the expression of resistance genes is tightly linked to that of antibiotic biosynthetic genes. In others, the resistance genes can be induced by their cognate antibiotics or by intermediate molecules from their biosynthetic pathways. The regulatory mechanisms that couple resistance to antibiotic biosynthesis are mechanistically diverse and potentially relevant to the origins of clinical antibiotic resistance. © 2014 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
Shanks, John; Burtnick, Mary N; Brett, Paul J; Waag, David M; Spurgers, Kevin B; Ribot, Wilson J; Schell, Mark A; Panchal, Rekha G; Gherardini, Frank C; Wilkinson, Keith D; Deshazer, David
2009-04-01
Burkholderia mallei, a category B biothreat agent, is a facultative intracellular pathogen that causes the zoonotic disease glanders. The B. mallei VirAG two-component regulatory system activates the transcription of approximately 60 genes, including a large virulence gene cluster encoding a type VI secretion system (T6SS). The B. mallei tssM gene encodes a putative ubiquitin-specific protease that is physically linked to, and transcriptionally coregulated with, the T6SS gene cluster. Mass spectrometry and immunoblot analysis demonstrated that TssM was secreted in a virAG-dependent manner in vitro. Surprisingly, the T6SS was found to be dispensable for the secretion of TssM. The C-terminal half of TssM, which contains Cys and His box motifs conserved in eukaryotic deubiquitinases, was purified and biochemically characterized. Recombinant TssM hydrolyzed multiple ubiquitinated substrates and the cysteine at position 102 was critical for enzymatic activity. The tssM gene was expressed within 1 h after uptake of B. mallei into RAW 264.7 murine macrophages, suggesting that the TssM deubiquitinase is produced in this intracellular niche. Although the physiological substrate(s) is currently unknown, the TssM deubiquitinase may provide B. mallei a selective advantage in the intracellular environment during infection.
Kristie, T M; Roizman, B
1986-01-01
Herpes simplex virus type 1 genes form at least five groups (alpha, beta 1, beta 2, gamma 1, and gamma 2) whose expression is coordinately regulated and sequentially ordered in a cascade fashion. Previous studies have shown that functional alpha 4 gene product is essential for the transition from alpha to beta protein synthesis and have suggested that alpha 4 gene expression is autoregulatory. We have previously reported that labeled DNA fragments containing promoter-regulatory domains of thr...
Protein phosphatase 2A (PP2A) is an enzyme consisting of three subunits: a scaffolding A subunit, a regulatory B subunit and a catalytic C subunit. PP2As were shown to play diverse roles in eukaryotes. In this study, the function of the Arabidopsis PP2A-C5 gene that encodes the catalytic subunit 5 o...
Directory of Open Access Journals (Sweden)
Ruth Li
Full Text Available A majority of the studies examining the molecular regulation of human labor have been conducted using single gene approaches. While the technology to produce multi-dimensional datasets is readily available, the means for facile analysis of such data are limited. The objective of this study was to develop a systems approach to infer regulatory mechanisms governing global gene expression in cytokine-challenged cells in vitro, and to apply these methods to predict gene regulatory networks (GRNs in intrauterine tissues during term parturition. To this end, microarray analysis was applied to human amnion mesenchymal cells (AMCs stimulated with interleukin-1β, and differentially expressed transcripts were subjected to hierarchical clustering, temporal expression profiling, and motif enrichment analysis, from which a GRN was constructed. These methods were then applied to fetal membrane specimens collected in the absence or presence of spontaneous term labor. Analysis of cytokine-responsive genes in AMCs revealed a sterile immune response signature, with promoters enriched in response elements for several inflammation-associated transcription factors. In comparison to the fetal membrane dataset, there were 34 genes commonly upregulated, many of which were part of an acute inflammation gene expression signature. Binding motifs for nuclear factor-κB were prominent in the gene interaction and regulatory networks for both datasets; however, we found little evidence to support the utilization of pathogen-associated molecular pattern (PAMP signaling. The tissue specimens were also enriched for transcripts governed by hypoxia-inducible factor. The approach presented here provides an uncomplicated means to infer global relationships among gene clusters involved in cellular responses to labor-associated signals.
DEFF Research Database (Denmark)
Pundhir, Sachin; Bagger, Frederik Otzen; Lauridsen, Felicia Kathrine Bratt
2016-01-01
Formation of nucleosome free region (NFR) accompanied by specific histone modifications at flanking nucleosomes is an important prerequisite for enhancer and promoter activity. Due to this process, active regulatory elements often exhibit a distinct shape of histone signal in the form of a peak......-valley-peak (PVP) pattern. However, different features of PVP patterns and their robustness in predicting active regulatory elements have never been systematically analyzed. Here, we present PARE, a novel computational method that systematically analyzes the H3K4me1 or H3K4me3 PVP patterns to predict NFRs. We show...... four ENCODE cell lines and four hematopoietic differentiation stages, we identified several enhancers whose regulatory activity is stage specific and correlates positively with the expression of proximal genes in a particular stage. In conclusion, our results demonstrate that PVP patterns delineate...
Toxin-antitoxin systems and regulatory mechanisms in Mycobacterium tuberculosis.
Slayden, Richard A; Dawson, Clinton C; Cummings, Jason E
2018-06-01
There has been a significant reduction in annual tuberculosis incidence since the World Health Organization declared tuberculosis a global health threat. However, treatment of M. tuberculosis infections requires lengthy multidrug therapeutic regimens to achieve a durable cure. The development of new drugs that are active against resistant strains and phenotypically diverse organisms continues to present the greatest challenge in the future. Numerous phylogenomic analyses have revealed that the Mtb genome encodes a significantly expanded repertoire of toxin-antitoxin (TA) loci that makes up the Mtb TA system. A TA loci is a two-gene operon encoding a 'toxin' protein that inhibits bacterial growth and an interacting 'antitoxin' partner that neutralizes the inhibitory activity of the toxin. The presence of multiple chromosomally encoded TA loci in Mtb raises important questions in regard to expansion, regulation and function. Thus, the functional roles of TA loci in Mtb pathogenesis have received considerable attention over the last decade. The cumulative results indicate that they are involved in regulating adaptive responses to stresses associated with the host environment and drug treatment. Here we review the TA families encoded in Mtb, discuss the duplication of TA loci in Mtb, regulatory mechanism of TA loci, and phenotypic heterogeneity and pathogenesis.
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
A comparative study of covariance selection models for the inference of gene regulatory networks.
Stifanelli, Patrizia F; Creanza, Teresa M; Anglani, Roberto; Liuzzi, Vania C; Mukherjee, Sayan; Schena, Francesco P; Ancona, Nicola
2013-10-01
The inference, or 'reverse-engineering', of gene regulatory networks from expression data and the description of the complex dependency structures among genes are open issues in modern molecular biology. In this paper we compared three regularized methods of covariance selection for the inference of gene regulatory networks, developed to circumvent the problems raising when the number of observations n is smaller than the number of genes p. The examined approaches provided three alternative estimates of the inverse covariance matrix: (a) the 'PINV' method is based on the Moore-Penrose pseudoinverse, (b) the 'RCM' method performs correlation between regression residuals and (c) 'ℓ(2C)' method maximizes a properly regularized log-likelihood function. Our extensive simulation studies showed that ℓ(2C) outperformed the other two methods having the most predictive partial correlation estimates and the highest values of sensitivity to infer conditional dependencies between genes even when a few number of observations was available. The application of this method for inferring gene networks of the isoprenoid biosynthesis pathways in Arabidopsis thaliana allowed to enlighten a negative partial correlation coefficient between the two hubs in the two isoprenoid pathways and, more importantly, provided an evidence of cross-talk between genes in the plastidial and the cytosolic pathways. When applied to gene expression data relative to a signature of HRAS oncogene in human cell cultures, the method revealed 9 genes (p-value<0.0005) directly interacting with HRAS, sharing the same Ras-responsive binding site for the transcription factor RREB1. This result suggests that the transcriptional activation of these genes is mediated by a common transcription factor downstream of Ras signaling. Software implementing the methods in the form of Matlab scripts are available at: http://users.ba.cnr.it/issia/iesina18/CovSelModelsCodes.zip. Copyright © 2013 The Authors. Published by
Conditional expression of the vesicular stomatitis virus glycoprotein gene in Escherichia coli.
Rose, J K; Shafferman, A
1981-01-01
Bacterial plasmids that directed expression of the vesicular stomatitis virus glycoprotein (G-protein) gene under control of the tryptophan operon regulatory region were constructed. A plasmid directing the synthesis of a G-protein-like protein (containing the NH2-terminal segment of seven amino acids encoded by the trpE gene fused to the complete G-protein sequence lacking only its NH2-terminal methionine) could be transformed into trpR+ (repressed) but not into trpR- (derepressed) cells. Th...
Exploring the bZIP transcription factor regulatory network in Neurospora crassa.
Tian, Chaoguang; Li, Jingyi; Glass, N Louise
2011-03-01
Transcription factors (TFs) are key nodes of regulatory networks in eukaryotic organisms, including filamentous fungi such as Neurospora crassa. The 178 predicted DNA-binding TFs in N. crassa are distributed primarily among six gene families, which represent an ancient expansion in filamentous ascomycete genomes; 98 TF genes show detectable expression levels during vegetative growth of N. crassa, including 35 that show a significant difference in expression level between hyphae at the periphery versus hyphae in the interior of a colony. Regulatory networks within a species genome include paralogous TFs and their respective target genes (TF regulon). To investigate TF network evolution in N. crassa, we focused on the basic leucine zipper (bZIP) TF family, which contains nine members. We performed baseline transcriptional profiling during vegetative growth of the wild-type and seven isogenic, viable bZIP deletion mutants. We further characterized the regulatory network of one member of the bZIP family, NCU03905. NCU03905 encodes an Ap1-like protein (NcAp-1), which is involved in resistance to multiple stress responses, including oxidative and heavy metal stress. Relocalization of NcAp-1 from the cytoplasm to the nucleus was associated with exposure to stress. A comparison of the NcAp-1 regulon with Ap1-like regulons in Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida albicans and Aspergillus fumigatus showed both conservation and divergence. These data indicate how N. crassa responds to stress and provide information on pathway evolution.
Christenson, L K; Johnson, P F; McAllister, J M; Strauss, J F
1999-09-10
Two putative CCAAT/enhancer-binding protein (C/EBP) response elements were identified in the proximal promoter of the human steroidogenic acute regulatory protein (StAR) gene, which encodes a key protein-regulating steroid hormone synthesis. Expression of C/EBPalpha and -beta increased StAR promoter activity in COS-1 and HepG2 cells. Cotransfection of C/EBPalpha or -beta and steroidogenic factor 1, a transcription factor required for cAMP regulation of StAR expression, into COS-1 augmented 8-bromoadenosine 3':5'-cyclic monophosphate (8-Br-cAMP)-stimulated promoter activity. When the putative C/EBP response elements were mutated, individually or together, a pronounced decline in basal StAR promoter activity in human granulosa-lutein cells resulted, but the fold stimulation of promoter activity by 8-Br-cAMP was unaffected. Recombinant C/EBPalpha and -beta bound to the two identified sequences but not the mutated elements. Human granulosa-lutein cell nuclear extracts also bound these elements but not the mutated sequences. An antibody to C/EBPbeta, but not C/EBPalpha, supershifted the nuclear protein complex associated with the more distal element. The complex formed by nuclear extracts with the proximal element was not supershifted by either antibody. Western blot analysis revealed the presence of C/EBPalpha and C/EBPbeta in human granulosa-lutein cell nuclear extracts. C/EBPbeta levels were up-regulated 3-fold by 8-Br-cAMP treatment. Our studies demonstrate a role for C/EBPbeta as well as yet to be identified proteins, which can bind to C/EBP response elements, in the regulation of StAR gene expression and suggest a mechanism by which C/EBPbeta participates in the cAMP regulation of StAR gene transcription.
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
Characterization of the hepcidin gene in eight species of bats.
Stasiak, Iga M; Smith, Dale A; Crawshaw, Graham J; Hammermueller, Jutta D; Bienzle, Dorothee; Lillie, Brandon N
2014-02-01
Hemochromatosis, or iron storage disease, has been associated with significant liver disease and mortality in captive Egyptian fruit bats (Rousettus aegyptiacus). The physiologic basis for this susceptibility has not been established. In humans, a deficiency or resistance to the iron regulatory hormone, hepcidin has been implicated in the development of hereditary hemochromatosis. In the present study, we compared the coding sequence of the hepcidin gene in eight species of bats representing three distinct taxonomic families with diverse life histories and dietary preferences. Bat hepcidin mRNA encoded a 23 amino acid signal peptide, a 34 or 35 amino acid pro-region, and a 25 amino acid mature peptide, similar to other mammalian species. Differences in the sequence of the portion of the hepcidin gene that encodes the mature peptide that might account for the increased susceptibility of the Egyptian fruit bat to iron storage disease were not identified. Variability in gene sequence corresponded to the taxonomic relationship amongst species. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Sun, Mengyang; Cheng, Xianrui; Socolar, Joshua E S
2013-06-01
A common approach to the modeling of gene regulatory networks is to represent activating or repressing interactions using ordinary differential equations for target gene concentrations that include Hill function dependences on regulator gene concentrations. An alternative formulation represents the same interactions using Boolean logic with time delays associated with each network link. We consider the attractors that emerge from the two types of models in the case of a simple but nontrivial network: a figure-8 network with one positive and one negative feedback loop. We show that the different modeling approaches give rise to the same qualitative set of attractors with the exception of a possible fixed point in the ordinary differential equation model in which concentrations sit at intermediate values. The properties of the attractors are most easily understood from the Boolean perspective, suggesting that time-delay Boolean modeling is a useful tool for understanding the logic of regulatory networks.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
Koh, Kyunghee; Bernstein, Yelena; Sundaram, Meera V
2004-03-01
egl-18 and elt-6 are partially redundant, adjacent genes encoding GATA factors essential for viability, seam cell development, and vulval development in Caenorhabditis elegans. The nT1 reciprocal translocation causes a strong Vulvaless phenotype, and an nT1 breakpoint was previously mapped to the left arm of LGIV, where egl-18/elt-6 are located. Here we present evidence that the nT1 vulval phenotype is due to a disruption of egl-18/elt-6 function specifically in the vulva. egl-18 mutations do not complement nT1 for vulval defects, and the nT1 breakpoint on LGIV is located within approximately 800 bp upstream of a potential transcriptional start site of egl-18. In addition, we have identified a approximately 350-bp cis-regulatory region sufficient for vulval expression just upstream of the nT1 breakpoint. By examining the fusion state and division patterns of the cells in the developing vulva of nT1 mutants, we demonstrate that egl-18/elt-6 prevent fusion and promote cell proliferation at multiple steps of vulval development.
Shanks, John; Burtnick, Mary N.; Brett, Paul J.; Waag, David M.; Spurgers, Kevin B.; Ribot, Wilson J.; Schell, Mark A.; Panchal, Rekha G.; Gherardini, Frank C.; Wilkinson, Keith D.; DeShazer, David
2009-01-01
Burkholderia mallei, a category B biothreat agent, is a facultative intracellular pathogen that causes the zoonotic disease glanders. The B. mallei VirAG two-component regulatory system activates the transcription of ∼60 genes, including a large virulence gene cluster encoding a type VI secretion system (T6SS). The B. mallei tssM gene encodes a putative ubiquitin-specific protease that is physically linked to, and transcriptionally coregulated with, the T6SS gene cluster. Mass spectrometry and immunoblot analysis demonstrated that TssM was secreted in a virAG-dependent manner in vitro. Surprisingly, the T6SS was found to be dispensable for the secretion of TssM. The C-terminal half of TssM, which contains Cys and His box motifs conserved in eukaryotic deubiquitinases, was purified and biochemically characterized. Recombinant TssM hydrolyzed multiple ubiquitinated substrates and the cysteine at position 102 was critical for enzymatic activity. The tssM gene was expressed within 1 h after uptake of B. mallei into RAW 264.7 murine macrophages, suggesting that the TssM deubiquitinase is produced in this intracellular niche. Although the physiological substrate(s) is currently unknown, the TssM deubiquitinase may provide B. mallei a selective advantage in the intracellular environment during infection. PMID:19168747
Regulation of expression of pectate lyase genes pelA, pelD, and pelE in Erwinia chrysanthemi.
Reverchon, S; Robert-Baudouy, J
1987-06-01
The regulation of pelA, pelD, and pelE genes encoding three of the five major pectate lyase isoenzymes (PLa, PLd, and PLe) in Erwinia chrysanthemi B374 was analyzed by using genetic fusions to lacZ. These three genes are clustered on a 5-kilobase DNA fragment in the order pelD-pelE-pelA and constitute three independent transcriptional units. We localized the pelDEA cluster near the pro-1 marker on the genetic map of B374 by chromosomal mobilization with RP4::mini-Mu plasmid pULB110. Three classes of regulatory mutations responsible for constitutive pectate lyase synthesis have been described (kdgR, gpiR, and cri). We studied the effects of each mutation on pelE, pelD, and pelA expression independently. The mutations kdgR and gpiR mainly affect the expression of pelE and pelD, although PLa synthesis is slightly increased. The cri mutation results in a low level of constitutive expression of the three pel genes, but it is a pleiotropic mutation since other genes not involved in pectinolysis are also affected. In addition, we demonstrated that exuR, a negative regulatory gene governing the catabolism of hexuronates, does not modify the expression of pel genes. The frequency of gpiR or cri mutations (about 10(-8)) and the resulting constitutivity of pectate lyase synthesis suggest that these genes act as negative regulatory genes in addition to kdgR, which is already known to encode a repressor. Moreover, we found that expression of pel-lac fusions carried on pBR322 derivatives was higher in E. chrysanthemi than in Escherichia coli; this fact suggests the existence of positive regulation of pectate lyase synthesis in E. chrysanthemi.
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Recurrent neural network based hybrid model for reconstructing gene regulatory network.
Raza, Khalid; Alam, Mansaf
2016-10-01
One of the exciting problems in systems biology research is to decipher how genome controls the development of complex biological system. The gene regulatory networks (GRNs) help in the identification of regulatory interactions between genes and offer fruitful information related to functional role of individual gene in a cellular system. Discovering GRNs lead to a wide range of applications, including identification of disease related pathways providing novel tentative drug targets, helps to predict disease response, and also assists in diagnosing various diseases including cancer. Reconstruction of GRNs from available biological data is still an open problem. This paper proposes a recurrent neural network (RNN) based model of GRN, hybridized with generalized extended Kalman filter for weight update in backpropagation through time training algorithm. The RNN is a complex neural network that gives a better settlement between biological closeness and mathematical flexibility to model GRN; and is also able to capture complex, non-linear and dynamic relationships among variables. Gene expression data are inherently noisy and Kalman filter performs well for estimation problem even in noisy data. Hence, we applied non-linear version of Kalman filter, known as generalized extended Kalman filter, for weight update during RNN training. The developed model has been tested on four benchmark networks such as DNA SOS repair network, IRMA network, and two synthetic networks from DREAM Challenge. We performed a comparison of our results with other state-of-the-art techniques which shows superiority of our proposed model. Further, 5% Gaussian noise has been induced in the dataset and result of the proposed model shows negligible effect of noise on results, demonstrating the noise tolerance capability of the model. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
Identification of regulatory targets for the bacterial Nus factor complex.
Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T
2017-12-11
Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.
Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.
2016-01-01
SUMMARY Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5′ untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5′ ends of mRNA molecules. These can include 5′ secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. PMID:27784798
Mars, Ruben A T; Nicolas, Pierre; Denham, Emma L; van Dijl, Jan Maarten
2016-12-01
Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5' untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5' ends of mRNA molecules. These can include 5' secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Directory of Open Access Journals (Sweden)
Je-Hyuk Lee
2009-11-01
Full Text Available Normal variation in gene expression due to regulatory polymorphisms is often masked by biological and experimental noise. In addition, some regulatory polymorphisms may become apparent only in specific tissues. We derived human induced pluripotent stem (iPS cells from adult skin primary fibroblasts and attempted to detect tissue-specific cis-regulatory variants using in vitro cell differentiation. We used padlock probes and high-throughput sequencing for digital RNA allelotyping and measured allele-specific gene expression in primary fibroblasts, lymphoblastoid cells, iPS cells, and their differentiated derivatives. We show that allele-specific expression is both cell type and genotype-dependent, but the majority of detectable allele-specific expression loci remains consistent despite large changes in the cell type or the experimental condition following iPS reprogramming, except on the X-chromosome. We show that our approach to mapping cis-regulatory variants reduces in vitro experimental noise and reveals additional tissue-specific variants using skin-derived human iPS cells.
Kumar, V; Wong, D T; Pasion, S G; Biswas, D K
1987-12-08
The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Directory of Open Access Journals (Sweden)
Huang Hsien-Da
2008-11-01
Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.
Yerramsetty, Pradeep; Stata, Matt; Siford, Rebecca; Sage, Tammy L; Sage, Rowan F; Wong, Gane Ka-Shu; Albert, Victor A; Berry, James O
2016-06-29
grasses, highlighting the possible importance of maintaining this gene and its surrounding genomic regions. Findings presented here indicate that the RLSB family originated as a unique gene in land plant evolution, perhaps in the common ancestor of charophytes and higher plants. Purifying selection has maintained this as a highly conserved single- or two-copy gene across most extant species, with several conserved gene duplications. Together with previous findings, this study suggests that RLSB has been sustained as an important regulatory protein throughout the course of land plant evolution. While only RLSB-a has been directly implicated in rbcL regulation in maize, RLSB-b could have an overlapping function in the co-regulation of rbcL, or may have diverged as a regulator of one or more other plastid-encoded mRNAs. This analysis confirms that RLSB is an important and unique photosynthetic regulatory protein that has been continuously expressed in land plants as they emerged and diversified from their ancient common ancestor.
Directory of Open Access Journals (Sweden)
Reiss Monika
2008-11-01
Full Text Available Abstract Background Geobacillus stearothermophilus is able to utilize phenol as a sole carbon source. A DNA fragment encoding a phenol hydroxylase catalyzing the first step in the meta-pathway has been isolated previously. Based on these findings a PCR-based DNA walk was performed initially to isolate a catechol 2,3-dioxygenase for biosensoric applications but was continued to elucidate the organisation of the genes encoding the proteins for the metabolization of phenol. Results A 20.2 kb DNA fragment was isolated as a result of the DNA walk. Fifteen open reading frames residing on a low-copy megaplasmid were identified. Eleven genes are co-transcribed in one polycistronic mRNA as shown by reverse transcription-PCR. Ten genes encode proteins, that are directly linked with the meta-cleavage pathway. The deduced amino acid sequences display similarities to a two-component phenol hydroxylase, a catechol 2,3-dioxygenase, a 4-oxalocrotonate tautomerase, a 2-oxopent-4-dienoate hydratase, a 4-oxalocrotonate decarboxylase, a 4-hydroxy-2-oxovalerate aldolase, an acetaldehyde dehydrogenase, a plant-type ferredoxin involved in the reactivation of extradiol dioxygenases and a novel regulatory protein. The only enzymes missing for the complete mineralization of phenol are a 2-hydroxymuconic acid-6-semialdehyde hydrolase and/or 2-hydroxymuconic acid-6-semialdehyde dehydrogenase. Conclusion Research on the bacterial degradation of aromatic compounds on a sub-cellular level has been more intensively studied in gram-negative organisms than in gram-positive bacteria. Especially regulatory mechanisms in gram-positive (thermophilic prokaryotes remain mostly unknown. We isolated the first complete sequence of an operon from a thermophilic bacterium encoding the meta-pathway genes and analyzed the genetic organization. Moreover, the first transcriptional regulator of the phenol metabolism in gram-positive bacteria was identified. This is a first step to elucidate
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Energy Technology Data Exchange (ETDEWEB)
Puntel, Mariana [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Ghulam, Muhammad A.K.M. [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Farrokhi, Catherine [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); VanderVeen, Nathan; Paran, Christopher; Appelhans, Ashley [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Kroeger, Kurt M.; Salem, Alireza [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Lacayo, Liliana [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Pechnick, Robert N. [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Department of Psychiatry and Behavioral Neurosciences, David Geffen School of Medicine, University of California, Los Angeles, CA (United States); Kelson, Kyle R.; Kaur, Sukhpreet; Kennedy, Sean [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Palmer, Donna; Ng, Philip [Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030 (United States); and others
2013-05-01
Adenoviral vectors (Ads) are promising gene delivery vehicles due to their high transduction efficiency; however, their clinical usefulness has been hampered by their immunogenicity and the presence of anti-Ad immunity in humans. We reported the efficacy of a gene therapy approach for glioma consisting of intratumoral injection of Ads encoding conditionally cytotoxic herpes simplex type 1 thymidine kinase (Ad-TK) and the immunostimulatory cytokine fms-like tyrosine kinase ligand 3 (Ad-Flt3L). Herein, we report the biodistribution, efficacy, and neurological and systemic effects of a bicistronic high-capacity Ad, i.e., HC-Ad-TK/TetOn-Flt3L. HC-Ads elicit sustained transgene expression, even in the presence of anti-Ad immunity, and can encode large therapeutic cassettes, including regulatory elements to enable turning gene expression “on” or “off” according to clinical need. The inclusion of two therapeutic transgenes within a single vector enables a reduction of the total vector load without adversely impacting efficacy. Because clinically the vectors will be delivered into the surgical cavity, normal regions of the brain parenchyma are likely to be transduced. Thus, we assessed any potential toxicities elicited by escalating doses of HC-Ad-TK/TetOn-Flt3L (1 × 10{sup 8}, 1 × 10{sup 9}, or 1 × 10{sup 10} viral particles [vp]) delivered into the rat brain parenchyma. We assessed neuropathology, biodistribution, transgene expression, systemic toxicity, and behavioral impact at acute and chronic time points. The results indicate that doses up to 1 × 10{sup 9} vp of HC-Ad-TK/TetOn-Flt3L can be safely delivered into the normal rat brain and underpin further developments for its implementation in a phase I clinical trial for glioma. - Highlights: ► High capacity Ad vectors elicit sustained therapeutic gene expression in the brain. ► HC-Ad-TK/TetOn-Flt3L encodes two therapeutic genes and a transcriptional switch. ► We performed a dose escalation study at
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Schrader, Alexandra; Meyer, Katharina; Walther, Neele; Stolz, Ailine; Feist, Maren; Hand, Elisabeth; von Bonin, Frederike; Evers, Maurits; Kohler, Christian; Shirneshan, Katayoon; Vockerodt, Martina; Klapper, Wolfram; Szczepanowski, Monika; Murray, Paul G.; Bastians, Holger; Trümper, Lorenz; Spang, Rainer; Kube, Dieter
2016-01-01
To discover new regulatory pathways in B lymphoma cells, we performed a combined analysis of experimental, clinical and global gene expression data. We identified a specific cluster of genes that was coherently expressed in primary lymphoma samples and suppressed by activation of the B cell receptor (BCR) through αIgM treatment of lymphoma cells in vitro. This gene cluster, which we called BCR.1, includes numerous cell cycle regulators. A reduced expression of BCR.1 genes after BCR activation was observed in different cell lines and also in CD10+ germinal center B cells. We found that BCR activation led to a delayed entry to and progression of mitosis and defects in metaphase. Cytogenetic changes were detected upon long-term αIgM treatment. Furthermore, an inverse correlation of BCR.1 genes with c-Myc co-regulated genes in distinct groups of lymphoma patients was observed. Finally, we showed that the BCR.1 index discriminates activated B cell-like and germinal centre B cell-like diffuse large B cell lymphoma supporting the functional relevance of this new regulatory circuit and the power of guided clustering for biomarker discovery. PMID:27166259
Parker, Hugo J; Bronner, Marianne E; Krumlauf, Robb
2016-06-01
Hindbrain development is orchestrated by a vertebrate gene regulatory network that generates segmental patterning along the anterior-posterior axis via Hox genes. Here, we review analyses of vertebrate and invertebrate chordate models that inform upon the evolutionary origin and diversification of this network. Evidence from the sea lamprey reveals that the hindbrain regulatory network generates rhombomeric compartments with segmental Hox expression and an underlying Hox code. We infer that this basal feature was present in ancestral vertebrates and, as an evolutionarily constrained developmental state, is fundamentally important for patterning of the vertebrate hindbrain across diverse lineages. Despite the common ground plan, vertebrates exhibit neuroanatomical diversity in lineage-specific patterns, with different vertebrates revealing variations of Hox expression in the hindbrain that could underlie this diversification. Invertebrate chordates lack hindbrain segmentation but exhibit some conserved aspects of this network, with retinoic acid signaling playing a role in establishing nested domains of Hox expression. © 2016 WILEY Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Joshi NV
2009-01-01
Full Text Available Abstract Background Regulation of gene expression in Plasmodium falciparum (Pf remains poorly understood. While over half the genes are estimated to be regulated at the transcriptional level, few regulatory motifs and transcription regulators have been found. Results The study seeks to identify putative regulatory motifs in the upstream regions of 13 functional groups of genes expressed in the intraerythrocytic developmental cycle of Pf. Three motif-discovery programs were used for the purpose, and motifs were searched for only on the gene coding strand. Four motifs – the 'G-rich', the 'C-rich', the 'TGTG' and the 'CACA' motifs – were identified, and zero to all four of these occur in the 13 sets of upstream regions. The 'CACA motif' was absent in functional groups expressed during the ring to early trophozoite transition. For functional groups expressed in each transition, the motifs tended to be similar. Upstream motifs in some functional groups showed 'positional conservation' by occurring at similar positions relative to the translational start site (TLS; this increases their significance as regulatory motifs. In the ribonucleotide synthesis, mitochondrial, proteasome and organellar translation machinery genes, G-rich, C-rich, CACA and TGTG motifs, respectively, occur with striking positional conservation. In the organellar translation machinery group, G-rich motifs occur close to the TLS. The same motifs were sometimes identified for multiple functional groups; differences in location and abundance of the motifs appear to ensure different modes of action. Conclusion The identification of positionally conserved over-represented upstream motifs throws light on putative regulatory elements for transcription in Pf.
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Quantitative inference of dynamic regulatory pathways via microarray data
Directory of Open Access Journals (Sweden)
Chen Bor-Sen
2005-03-01
Full Text Available Abstract Background The cellular signaling pathway (network is one of the main topics of organismic investigations. The intracellular interactions between genes in a signaling pathway are considered as the foundation of functional genomics. Thus, what genes and how much they influence each other through transcriptional binding or physical interactions are essential problems. Under the synchronous measures of gene expression via a microarray chip, an amount of dynamic information is embedded and remains to be discovered. Using a systematically dynamic modeling approach, we explore the causal relationship among genes in cellular signaling pathways from the system biology approach. Results In this study, a second-order dynamic model is developed to describe the regulatory mechanism of a target gene from the upstream causality point of view. From the expression profile and dynamic model of a target gene, we can estimate its upstream regulatory function. According to this upstream regulatory function, we would deduce the upstream regulatory genes with their regulatory abilities and activation delays, and then link up a regulatory pathway. Iteratively, these regulatory genes are considered as target genes to trace back their upstream regulatory genes. Then we could construct the regulatory pathway (or network to the genome wide. In short, we can infer the genetic regulatory pathways from gene-expression profiles quantitatively, which can confirm some doubted paths or seek some unknown paths in a regulatory pathway (network. Finally, the proposed approach is validated by randomly reshuffling the time order of microarray data. Conclusion We focus our algorithm on the inference of regulatory abilities of the identified causal genes, and how much delay before they regulate the downstream genes. With this information, a regulatory pathway would be built up using microarray data. In the present study, two signaling pathways, i.e. circadian regulatory
Directory of Open Access Journals (Sweden)
Dilley Robert
2009-01-01
Full Text Available Abstract Background Adeno-associated virus (AAV vectors are promising tools for gene therapy. Currently, their potential is limited by difficulties in producing high vector yields with which to generate transgene protein product. AAV vector production depends in part upon the replication (Rep proteins required for viral replication. We tested the hypothesis that mutations in the start codon and upstream regulatory elements of Rep78/68 in AAV helper plasmids can regulate recombinant AAV (rAAV vector production. We further tested whether the resulting rAAV vector preparation augments the production of the potentially therapeutic transgene, insulin-like growth factor I (IGF-I. Results We constructed a series of AAV helper plasmids containing different Rep78/68 start codon in combination with different gene regulatory sequences. rAAV vectors carrying the human IGF-I gene were prepared with these vectors and the vector preparations used to transduce HT1080 target cells. We found that the substitution of ATG by ACG in the Rep78/68 start codon in an AAV helper plasmid (pAAV-RC eliminated Rep78/68 translation, rAAV and IGF-I production. Replacement of the heterologous sequence upstream of Rep78/68 in pAAV-RC with the AAV2 endogenous p5 promoter restored translational activity to the ACG mutant, and restored rAAV and IGF-I production. Insertion of the AAV2 p19 promoter sequence into pAAV-RC in front of the heterologous sequence also enabled ACG to function as a start codon for Rep78/68 translation. The data further indicate that the function of the AAV helper construct (pAAV-RC, that is in current widespread use for rAAV production, may be improved by replacement of its AAV2 unrelated heterologous sequence with the native AAV2 p5 promoter. Conclusion Taken together, the data demonstrate an interplay between the start codon and upstream regulatory sequences in the regulation of Rep78/68 and indicate that selective mutations in Rep78/68 regulatory elements
Memory functions reveal structural properties of gene regulatory networks
Perez-Carrasco, Ruben
2018-01-01
Gene regulatory networks (GRNs) control cellular function and decision making during tissue development and homeostasis. Mathematical tools based on dynamical systems theory are often used to model these networks, but the size and complexity of these models mean that their behaviour is not always intuitive and the underlying mechanisms can be difficult to decipher. For this reason, methods that simplify and aid exploration of complex networks are necessary. To this end we develop a broadly applicable form of the Zwanzig-Mori projection. By first converting a thermodynamic state ensemble model of gene regulation into mass action reactions we derive a general method that produces a set of time evolution equations for a subset of components of a network. The influence of the rest of the network, the bulk, is captured by memory functions that describe how the subnetwork reacts to its own past state via components in the bulk. These memory functions provide probes of near-steady state dynamics, revealing information not easily accessible otherwise. We illustrate the method on a simple cross-repressive transcriptional motif to show that memory functions not only simplify the analysis of the subnetwork but also have a natural interpretation. We then apply the approach to a GRN from the vertebrate neural tube, a well characterised developmental transcriptional network composed of four interacting transcription factors. The memory functions reveal the function of specific links within the neural tube network and identify features of the regulatory structure that specifically increase the robustness of the network to initial conditions. Taken together, the study provides evidence that Zwanzig-Mori projections offer powerful and effective tools for simplifying and exploring the behaviour of GRNs. PMID:29470492