WorldWideScience

Sample records for gene encoding plastid

  1. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2016-06-27

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  4. Opposite roles of the Arabidopsis cytokinin receptors AHK2 and AHK3 in the expression of plastid genes and genes for the plastid transcriptional machinery during senescence.

    Science.gov (United States)

    Danilova, Maria N; Kudryakova, Natalia V; Doroshenko, Anastasia S; Zabrodin, Dmitry A; Rakhmankulova, Zulfira F; Oelmüller, Ralf; Kusnetsov, Victor V

    2017-03-01

    Cytokinin membrane receptors of the Arabidopsis thaliana AHK2 and AHK3 play opposite roles in the expression of plastid genes and genes for the plastid transcriptional machinery during leaf senescence Loss-of-function mutants of Arabidopsis thaliana were used to study the role of cytokinin receptors in the expression of chloroplast genes during leaf senescence. Accumulation of transcripts of several plastid-encoded genes is dependent on the АНК2/АНК3 receptor combination. АНК2 is particularly important at the final stage of plant development and, unlike АНК3, a positive regulator of leaf senescence. Cytokinin-dependent up-regulation of the nuclear encoded genes for chloroplast RNA polymerases RPOTp and RPOTmp suggests that the hormone controls plastid gene expression, at least in part, via the expression of nuclear genes for the plastid transcription machinery. This is further supported by cytokinin dependent regulation of genes for the nuclear encoded plastid σ-factors, SIG1-6, which code for components of the transcriptional apparatus in chloroplasts.

  5. Evolution of red algal plastid genomes: ancient architectures, introns, horizontal gene transfer, and taxonomic utility of plastid markers.

    Directory of Open Access Journals (Sweden)

    Jan Janouškovec

    Full Text Available Red algae have the most gene-rich plastid genomes known, but despite their evolutionary importance these genomes remain poorly sampled. Here we characterize three complete and one partial plastid genome from a diverse range of florideophytes. By unifying annotations across all available red algal plastid genomes we show they all share a highly compact and slowly-evolving architecture and uniquely rich gene complements. Both chromosome structure and gene content have changed very little during red algal diversification, and suggest that plastid-to nucleus gene transfers have been rare. Despite their ancient character, however, the red algal plastids also contain several unprecedented features, including a group II intron in a tRNA-Met gene that encodes the first example of red algal plastid intron maturase - a feature uniquely shared among florideophytes. We also identify a rare case of a horizontally-acquired proteobacterial operon, and propose this operon may have been recruited for plastid function and potentially replaced a nucleus-encoded plastid-targeted paralogue. Plastid genome phylogenies yield a fully resolved tree and suggest that plastid DNA is a useful tool for resolving red algal relationships. Lastly, we estimate the evolutionary rates among more than 200 plastid genes, and assess their usefulness for species and subspecies taxonomy by comparison to well-established barcoding markers such as cox1 and rbcL. Overall, these data demonstrates that red algal plastid genomes are easily obtainable using high-throughput sequencing of total genomic DNA, interesting from evolutionary perspectives, and promising in resolving red algal relationships at evolutionarily-deep and species/subspecies levels.

  6. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.

    2016-01-01

    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  7. Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

    Science.gov (United States)

    Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

    2015-01-01

    In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

  8. Nuclear-cytoplasmic conflict in pea (Pisum sativum L. is associated with nuclear and plastidic candidate genes encoding acetyl-CoA carboxylase subunits.

    Directory of Open Access Journals (Sweden)

    Vera S Bogdanova

    Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.

  9. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  10. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  11. Coordinated rates of evolution between interacting plastid and nuclear genes in Geraniaceae.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal; Blazier, J Chris; Jansen, Robert K

    2015-03-01

    Although gene coevolution has been widely observed within individuals and between different organisms, rarely has this phenomenon been investigated within a phylogenetic framework. The Geraniaceae is an attractive system in which to study plastid-nuclear genome coevolution due to the highly elevated evolutionary rates in plastid genomes. In plants, the plastid-encoded RNA polymerase (PEP) is a protein complex composed of subunits encoded by both plastid (rpoA, rpoB, rpoC1, and rpoC2) and nuclear genes (sig1-6). We used transcriptome and genomic data for 27 species of Geraniales in a systematic evaluation of coevolution between genes encoding subunits of the PEP holoenzyme. We detected strong correlations of dN (nonsynonymous substitutions) but not dS (synonymous substitutions) within rpoB/sig1 and rpoC2/sig2, but not for other plastid/nuclear gene pairs, and identified the correlation of dN/dS ratio between rpoB/C1/C2 and sig1/5/6, rpoC1/C2 and sig2, and rpoB/C2 and sig3 genes. Correlated rates between interacting plastid and nuclear sequences across the Geraniales could result from plastid-nuclear genome coevolution. Analyses of coevolved amino acid positions suggest that structurally mediated coevolution is not the major driver of plastid-nuclear coevolution. The detection of strong correlation of evolutionary rates between SIG and RNAP genes suggests a plausible explanation for plastome-genome incompatibility in Geraniaceae. © 2015 American Society of Plant Biologists. All rights reserved.

  12. Regulatory Shifts in Plastid Transcription Play a Key Role in Morphological Conversions of Plastids during Plant Development.

    Science.gov (United States)

    Liebers, Monique; Grübler, Björn; Chevalier, Fabien; Lerbs-Mache, Silva; Merendino, Livia; Blanvillain, Robert; Pfannschmidt, Thomas

    2017-01-01

    Plastids display a high morphological and functional diversity. Starting from an undifferentiated small proplastid, these plant cell organelles can develop into four major forms: etioplasts in the dark, chloroplasts in green tissues, chromoplasts in colored flowers and fruits and amyloplasts in roots. The various forms are interconvertible into each other depending on tissue context and respective environmental condition. Research of the last two decades uncovered that each plastid type contains its own specific proteome that can be highly different from that of the other types. Composition of these proteomes largely defines the enzymatic functionality of the respective plastid. The vast majority of plastid proteins is encoded in the nucleus and must be imported from the cytosol. However, a subset of proteins of the photosynthetic and gene expression machineries are encoded on the plastid genome and are transcribed by a complex transcriptional apparatus consisting of phage-type nuclear-encoded RNA polymerases and a bacterial-type plastid-encoded RNA polymerase. Both types recognize specific sets of promoters and transcribe partly over-lapping as well as specific sets of genes. Here we summarize the current knowledge about the sequential activity of these plastid RNA polymerases and their relative activities in different types of plastids. Based on published plastid gene expression profiles we hypothesize that each conversion from one plastid type into another is either accompanied or even preceded by significant changes in plastid transcription suggesting that these changes represent important determinants of plastid morphology and protein composition and, hence, the plastid type.

  13. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

    Science.gov (United States)

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

    2013-12-01

    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  14. Phylogenetic Analysis of Nucleus-Encoded Acetyl-CoA Carboxylases Targeted at the Cytosol and Plastid of Algae.

    KAUST Repository

    Huerlimann, Roger

    2015-07-01

    The understanding of algal phylogeny is being impeded by an unknown number of events of horizontal gene transfer (HGT), and primary and secondary/tertiary endosymbiosis. Through these events, previously heterotrophic eukaryotes developed photosynthesis and acquired new biochemical pathways. Acetyl-CoA carboxylase (ACCase) is a key enzyme in the fatty acid synthesis and elongation pathways in algae, where ACCase exists in two locations (cytosol and plastid) and in two forms (homomeric and heteromeric). All algae contain nucleus-encoded homomeric ACCase in the cytosol, independent of the origin of the plastid. Nucleus-encoded homomeric ACCase is also found in plastids of algae that arose from a secondary/tertiary endosymbiotic event. In contrast, plastids of algae that arose from a primary endosymbiotic event contain heteromeric ACCase, which consists of three nucleus-encoded and one plastid-encoded subunits. These properties of ACCase provide the potential to inform on the phylogenetic relationships of hosts and their plastids, allowing different hypothesis of endosymbiotic events to be tested. Alveolata (Dinoflagellata and Apicomplexa) and Chromista (Stramenopiles, Haptophyta and Cryptophyta) have traditionally been grouped together as Chromalveolata, forming the red lineage. However, recent genetic evidence groups the Stramenopiles, Alveolata and green plastid containing Rhizaria as SAR, excluding Haptophyta and Cryptophyta. Sequences coding for plastid and cytosol targeted homomeric ACCases were isolated from Isochrysis aff. galbana (TISO), Chromera velia and Nannochloropsis oculata, representing three taxonomic groups for which sequences were lacking. Phylogenetic analyses show that cytosolic ACCase strongly supports the SAR grouping. Conversely, plastidial ACCase groups the SAR with the Haptophyta, Cryptophyta and Prasinophyceae (Chlorophyta). These two ACCase based, phylogenetic relationships suggest that the plastidial homomeric ACCase was acquired by the

  15. Arabidopsis EMB1990 Encoding a Plastid-Targeted YlmG Protein Is Required for Chloroplast Biogenesis and Embryo Development

    Directory of Open Access Journals (Sweden)

    Hongyu Chen

    2018-02-01

    Full Text Available In higher plants, embryo development originated from fertilized egg cell is the first step of the life cycle. The chloroplast participates in many essential metabolic pathways, and its function is highly associated with embryo development. However, the mechanisms and relevant genetic components by which the chloroplast functions in embryogenesis are largely uncharacterized. In this paper, we describe the Arabidopsis EMB1990 gene, encoding a plastid-targeted YlmG protein which is required for chloroplast biogenesis and embryo development. Loss of the EMB1990/YLMG1-1 resulted in albino seeds containing abortive embryos, and the morphological development of homozygous emb1990 embryos was disrupted after the globular stage. Our results showed that EMB1990/YLMG1-1 was expressed in the primordia and adaxial region of cotyledon during embryogenesis, and the encoded protein was targeted to the chloroplast. TEM observation of cellular ultrastructure showed that chloroplast biogenesis was impaired in emb1990 embryo cells. Expression of certain plastid genes was also affected in the loss-of-function mutants, including genes encoding core protein complex subunits located in the thylakoid membrane. Moreover, the tissue-specific genes of embryo development were misexpressed in emb1990 mutant, including genes known to delineate cell fate decisions in the SAM (shoot apical meristem, cotyledon and hypophysis. Taken together, we propose that the nuclear-encoded YLMG1-1 is targeted to the chloroplast and required for normal plastid gene expression. Hence, YLMG1-1 plays a critical role in Arabidopsis embryogenesis through participating in chloroplast biogenesis.

  16. Phytochrome-dependent coordinate control of distinct aspects of nuclear and plastid gene expression during anterograde signalling and photomorphogenesis

    Directory of Open Access Journals (Sweden)

    Sookyung eOh

    2014-04-01

    Full Text Available Light perception by photoreceptors impacts plastid transcription, development, and differentiation. This photoreceptor-dependent activity suggests a mechanism for photoregulation of gene expression in the nucleus and plastid that serves to coordinate expression of critical genes of these two organelles. This coordinate expression is required for proper stoichiometric accumulation of components needed for assembly of plastids, photosynthetic light-harvesting complexes and components such as phytochromes. Chloroplast-targeted sigma factors, which function together with the plastid-encoded RNA polymerase to regulate expression of plastid-encoded genes, and nuclear-encoded plastid development factors, such as GLK1 and GLK2, are targets of phytochrome regulation. Such phytochrome-dependent functions are hypothesized to allow light-dependent regulation, and feasibly tuning, of plastid components and function in response to changes in the external environment, which directly affects photosynthesis and the potential for light-induced damage. When the size and protein composition of the light-harvesting complexes are not tuned to the external environment, imbalances in electron transport can impact the cellular redox state and cause cellular damage. We show that phytochromes specifically regulate the expression of multiple factors that function to modulate plastid transcription and, thus, provide a paradigm for coordinate expression of the nuclear and plastid genomes in response to changes in external light conditions. As phytochromes respond to changes in the prevalent wavelengths of light and light intensity, we propose that specific phytochrome-dependent molecular mechanisms are used during light-dependent signaling between the nucleus and chloroplast during photomorphogenesis to coordinate chloroplast development with plant developmental stage and the external environment.

  17. A plastome mutation affects processing of both chloroplast and nuclear DNA-encoded plastid proteins.

    Science.gov (United States)

    Johnson, E M; Schnabelrauch, L S; Sears, B B

    1991-01-01

    Immunoblotting of a chloroplast mutant (pm7) of Oenothera showed that three proteins, cytochrome f and the 23 kDa and 16 kDa subunits of the oxygen-evolving subcomplex of photosystem II, were larger than the corresponding mature proteins of the wild type and, thus, appear to be improperly processed in pm7. The mutant is also chlorotic and has little or no internal membrane development in the plastids. The improperly processed proteins, and other proteins that are completely missing, represent products of both the plastid and nuclear genomes. To test for linkage of these defects, a green revertant of pm7 was isolated from cultures in which the mutant plastids were maintained in a nuclear background homozygous for the plastome mutator (pm) gene. In this revertant, all proteins analyzed co-reverted to the wild-type condition, indicating that a single mutation in a plastome gene is responsible for the complex phenotype of pm7. These results suggest that the defect in pm7 lies in a gene that affects a processing protease encoded in the chloroplast genome.

  18. Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta.

    Science.gov (United States)

    McNeal, Joel R; Kuehl, Jennifer V; Boore, Jeffrey L; de Pamphilis, Claude W

    2007-10-24

    Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.

  19. Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta

    Directory of Open Access Journals (Sweden)

    Kuehl Jennifer V

    2007-10-01

    Full Text Available Abstract Background Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Results Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Conclusion Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.

  20. Efficient Plastid Transformation in Arabidopsis.

    Science.gov (United States)

    Yu, Qiguo; Lutz, Kerry Ann; Maliga, Pal

    2017-09-01

    Plastid transformation is routine in tobacco ( Nicotiana tabacum ) but 100-fold less frequent in Arabidopsis ( Arabidopsis thaliana ), preventing its use in plastid biology. A recent study revealed that null mutations in ACC2 , encoding a plastid-targeted acetyl-coenzyme A carboxylase, cause hypersensitivity to spectinomycin. We hypothesized that plastid transformation efficiency should increase in the acc2 background, because when ACC2 is absent, fatty acid biosynthesis becomes dependent on translation of the plastid-encoded ACC β-carboxylase subunit. We bombarded ACC2 -defective Arabidopsis leaves with a vector carrying a selectable spectinomycin resistance ( aadA ) gene and gfp , encoding the green fluorescence protein GFP. Spectinomycin-resistant clones were identified as green cell clusters on a spectinomycin medium. Plastid transformation was confirmed by GFP accumulation from the second open reading frame of a polycistronic messenger RNA, which would not be translated in the cytoplasm. We obtained one to two plastid transformation events per bombarded sample in spectinomycin-hypersensitive Slavice and Columbia acc2 knockout backgrounds, an approximately 100-fold enhanced plastid transformation frequency. Slavice and Columbia are accessions in which plant regeneration is uncharacterized or difficult to obtain. A practical system for Arabidopsis plastid transformation will be obtained by creating an ACC2 null background in a regenerable Arabidopsis accession. The recognition that the duplicated ACCase in Arabidopsis is an impediment to plastid transformation provides a rational template to implement plastid transformation in related recalcitrant crops. © 2017 American Society of Plant Biologists. All Rights Reserved.

  1. Divergence of RNA polymerase ? subunits in angiosperm plastid genomes is mediated by genomic rearrangement

    OpenAIRE

    Blazier, J. Chris; Ruhlman, Tracey A.; Weng, Mao-Lun; Rehman, Sumaiyah K.; Sabir, Jamal S. M.; Jansen, Robert K.

    2016-01-01

    Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP ? subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled an...

  2. Hypothesis: Gene-rich plastid genomes in red algae may be an outcome of nuclear genome reduction.

    Science.gov (United States)

    Qiu, Huan; Lee, Jun Mo; Yoon, Hwan Su; Bhattacharya, Debashish

    2017-06-01

    Red algae (Rhodophyta) putatively diverged from the eukaryote tree of life >1.2 billion years ago and are the source of plastids in the ecologically important diatoms, haptophytes, and dinoflagellates. In general, red algae contain the largest plastid gene inventory among all such organelles derived from primary, secondary, or additional rounds of endosymbiosis. In contrast, their nuclear gene inventory is reduced when compared to their putative sister lineage, the Viridiplantae, and other photosynthetic lineages. The latter is thought to have resulted from a phase of genome reduction that occurred in the stem lineage of Rhodophyta. A recent comparative analysis of a taxonomically broad collection of red algal and Viridiplantae plastid genomes demonstrates that the red algal ancestor encoded ~1.5× more plastid genes than Viridiplantae. This difference is primarily explained by more extensive endosymbiotic gene transfer (EGT) in the stem lineage of Viridiplantae, when compared to red algae. We postulate that limited EGT in Rhodophytes resulted from the countervailing force of ancient, and likely recurrent, nuclear genome reduction. In other words, the propensity for nuclear gene loss led to the retention of red algal plastid genes that would otherwise have undergone intracellular gene transfer to the nucleus. This hypothesis recognizes the primacy of nuclear genome evolution over that of plastids, which have no inherent control of their gene inventory and can change dramatically (e.g., secondarily non-photosynthetic eukaryotes, dinoflagellates) in response to selection acting on the host lineage. © 2017 Phycological Society of America.

  3. Paternal inheritance of plastid-encoded transgenes in Petunia hybrida in the greenhouse and under field conditions

    Directory of Open Access Journals (Sweden)

    Patricia Horn

    2017-12-01

    Full Text Available As already demonstrated in greenhouse trials, outcrossing of transgenic plants can be drastically reduced via transgene integration into the plastid. We verified this result in the field with Petunia, for which the highest paternal leakage has been observed. The variety white 115 (W115 served as recipient and Pink Wave (PW and the transplastomic variant PW T16, encoding the uidA reporter gene, as pollen donor. While manual pollination in the greenhouse led to over 90% hybrids for both crossings, the transgenic donor resulted only in 2% hybrids in the field. Nevertheless paternal leakage was detected in one case which proves that paternal inheritance of plastid-located transgenes is possible under artificial conditions. In the greenhouse, paternal leakage occurred in a frequency comparable to published results. As expected natural pollination reduced the hybrid formation in the field from 90 to 7.6% and the transgenic donor did not result in any hybrid. Keywords: Paternal plastid inheritance, Transgene confinement, Greenhouse, Field trial, Pollen mediated gene flow

  4. Citrus plastid-related gene profiling based on expressed sequence tag analyses

    Directory of Open Access Journals (Sweden)

    Tercilio Calsa Jr.

    2007-01-01

    Full Text Available Plastid-related sequences, derived from putative nuclear or plastome genes, were searched in a large collection of expressed sequence tags (ESTs and genomic sequences from the Citrus Biotechnology initiative in Brazil. The identified putative Citrus chloroplast gene sequences were compared to those from Arabidopsis, Eucalyptus and Pinus. Differential expression profiling for plastid-directed nuclear-encoded proteins and photosynthesis-related gene expression variation between Citrus sinensis and Citrus reticulata, when inoculated or not with Xylella fastidiosa, were also analyzed. Presumed Citrus plastome regions were more similar to Eucalyptus. Some putative genes appeared to be preferentially expressed in vegetative tissues (leaves and bark or in reproductive organs (flowers and fruits. Genes preferentially expressed in fruit and flower may be associated with hypothetical physiological functions. Expression pattern clustering analysis suggested that photosynthesis- and carbon fixation-related genes appeared to be up- or down-regulated in a resistant or susceptible Citrus species after Xylella inoculation in comparison to non-infected controls, generating novel information which may be helpful to develop novel genetic manipulation strategies to control Citrus variegated chlorosis (CVC.

  5. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    Directory of Open Access Journals (Sweden)

    Palmer Jeffrey D

    2006-09-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts, where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and

  6. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    Science.gov (United States)

    Rice, Danny W; Palmer, Jeffrey D

    2006-01-01

    Background Horizontal gene transfer (HGT) to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts), where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and cryptophyte plastids to the

  7. Over-expression of Arabidopsis thaliana SFD1/GLY1, the gene encoding plastid localized glycerol-3-phosphate dehydrogenase, increases plastidic lipid content in transgenic rice plants.

    Science.gov (United States)

    Singh, Vijayata; Singh, Praveen Kumar; Siddiqui, Adnan; Singh, Subaran; Banday, Zeeshan Zahoor; Nandi, Ashis Kumar

    2016-03-01

    Lipids are the major constituents of all membranous structures in plants. Plants possess two pathways for lipid biosynthesis: the prokaryotic pathway (i.e., plastidic pathway) and the eukaryotic pathway (i.e., endoplasmic-reticulum (ER) pathway). Whereas some plants synthesize galactolipids from diacylglycerol assembled in the plastid, others, including rice, derive their galactolipids from diacylglycerols assembled by the eukaryotic pathway. Arabidopsis thaliana glycerol-3-phosphate dehydrogenase (G3pDH), coded by SUPPRESSOR OF FATTY ACID DESATURASE 1 (SFD1; alias GLY1) gene, catalyzes the formation of glycerol 3-phosphate (G3p), the backbone of many membrane lipids. Here SFD1 was introduced to rice as a transgene. Arabidopsis SFD1 localizes in rice plastids and its over-expression increases plastidic membrane lipid content in transgenic rice plants without any major impact on ER lipids. The results suggest that over-expression of plastidic G3pDH enhances biosynthesis of plastid-localized lipids in rice. Lipid composition in the transgenic plants is consistent with increased phosphatidylglycerol synthesis in the plastid and increased galactolipid synthesis from diacylglycerol produced via the ER pathway. The transgenic plants show a higher photosynthetic assimilation rate, suggesting a possible application of this finding in crop improvement.

  8. Plastid Transcriptomics and Translatomics of Tomato Fruit Development and Chloroplast-to-Chromoplast Differentiation: Chromoplast Gene Expression Largely Serves the Production of a Single Protein[W][OA

    Science.gov (United States)

    Kahlau, Sabine; Bock, Ralph

    2008-01-01

    Plastid genes are expressed at high levels in photosynthetically active chloroplasts but are generally believed to be drastically downregulated in nongreen plastids. The genome-wide changes in the expression patterns of plastid genes during the development of nongreen plastid types as well as the contributions of transcriptional versus translational regulation are largely unknown. We report here a systematic transcriptomics and translatomics analysis of the tomato (Solanum lycopersicum) plastid genome during fruit development and chloroplast-to-chromoplast conversion. At the level of RNA accumulation, most but not all plastid genes are strongly downregulated in fruits compared with leaves. By contrast, chloroplast-to-chromoplast differentiation during fruit ripening is surprisingly not accompanied by large changes in plastid RNA accumulation. However, most plastid genes are translationally downregulated during chromoplast development. Both transcriptional and translational downregulation are more pronounced for photosynthesis-related genes than for genes involved in gene expression, indicating that some low-level plastid gene expression must be sustained in chromoplasts. High-level expression during chromoplast development identifies accD, the only plastid-encoded gene involved in fatty acid biosynthesis, as the target gene for which gene expression activity in chromoplasts is maintained. In addition, we have determined the developmental patterns of plastid RNA polymerase activities, intron splicing, and RNA editing and report specific developmental changes in the splicing and editing patterns of plastid transcripts. PMID:18441214

  9. Stable plastid transformation in lettuce (Lactuca sativa L.).

    Science.gov (United States)

    Lelivelt, Cilia L C; McCabe, Matthew S; Newell, Christine A; Desnoo, C Bastiaan; van Dun, Kees M P; Birch-Machin, Ian; Gray, John C; Mills, Kingston H G; Nugent, Jacqueline M

    2005-08-01

    Although plastid transformation in higher plants was first demonstrated in the early 1990s it is only recently that the technology is being extended to a broader range of species. To date, the production of fertile transplastomic plants has been reported for tobacco, tomato, petunia, soybean, cotton and Lesquerella fendleri (Brassicaceae). In this study we demonstrate a polyethylene glycol-mediated plastid transformation system for lettuce that generates fertile, homoplasmic, plastid-transformed lines. Transformation was achieved using a vector that targets genes to the trnA/trnI intergenic region of the lettuce plastid genome employing the aadA gene as a selectable marker against spectinomycin. Spectinomycin resistance and heterologous gene transcription were shown in T(1) plants derived from self-pollinated primary regenerants demonstrating transmission of the plastid-encoded transgene to the first seed generation. Crossing with male sterile wild-type lettuce showed that spectinomycin resistance was not transmitted via pollen. Constructs containing the gfp gene showed plastid-based expression of green fluorescent protein. The lettuce plastid could have potential both as a production and a delivery system for edible human therapeutic proteins.

  10. Intragenomic spread of plastid-targeting presequences in the coccolithophore Emiliania huxleyi.

    Science.gov (United States)

    Burki, Fabien; Hirakawa, Yoshihisa; Keeling, Patrick J

    2012-09-01

    Nucleus-encoded plastid-targeted proteins of photosynthetic organisms are generally equipped with an N-terminal presequence required for crossing the plastid membranes. The acquisition of these presequences played a fundamental role in the establishment of plastids. Here, we report a unique case of two non-homologous proteins possessing completely identical presequences consisting of a bipartite plastid-targeting signal in the coccolithophore Emiliania huxleyi. We further show that this presequence is highly conserved in five additional proteins that did not originally function in plastids, representing de novo plastid acquisitions. These are among the most recent cases of presequence spreading from gene to gene and shed light on important evolutionary processes that have been usually erased by the ancient history of plastid evolution. We propose a mechanism of acquisition involving genomic duplications and gene replacement through non-homologous recombination that may have played a more general role for equipping proteins with targeting information.

  11. Paternal inheritance of plastid-encoded transgenes in Petunia hybrida in the greenhouse and under field conditions.

    Science.gov (United States)

    Horn, Patricia; Nausch, Henrik; Baars, Susanne; Schmidtke, Jörg; Schmidt, Kerstin; Schneider, Anja; Leister, Dario; Broer, Inge

    2017-12-01

    As already demonstrated in greenhouse trials, outcrossing of transgenic plants can be drastically reduced via transgene integration into the plastid. We verified this result in the field with Petunia , for which the highest paternal leakage has been observed. The variety white 115 (W115) served as recipient and Pink Wave (PW) and the transplastomic variant PW T16, encoding the uid A reporter gene, as pollen donor. While manual pollination in the greenhouse led to over 90% hybrids for both crossings, the transgenic donor resulted only in 2% hybrids in the field. Nevertheless paternal leakage was detected in one case which proves that paternal inheritance of plastid-located transgenes is possible under artificial conditions. In the greenhouse, paternal leakage occurred in a frequency comparable to published results. As expected natural pollination reduced the hybrid formation in the field from 90 to 7.6% and the transgenic donor did not result in any hybrid.

  12. Plastid-to-Nucleus Retrograde Signals Are Essential for the Expression of Nuclear Starch Biosynthesis Genes during Amyloplast Differentiation in Tobacco BY-2 Cultured Cells1[W][OA

    Science.gov (United States)

    Enami, Kazuhiko; Ozawa, Tomoki; Motohashi, Noriko; Nakamura, Masayuki; Tanaka, Kan; Hanaoka, Mitsumasa

    2011-01-01

    Amyloplasts, a subtype of plastid, are found in nonphotosynthetic tissues responsible for starch synthesis and storage. When tobacco (Nicotiana tabacum) Bright Yellow-2 cells are cultured in the presence of cytokinin instead of auxin, their plastids differentiate from proplastids to amyloplasts. In this program, it is well known that the expression of nucleus-encoded starch biosynthesis genes, such as ADP-Glucose Pyrophosphorylase (AgpS) and Granule-Bound Starch Synthase (GBSS), is specifically induced. In this study, we investigated the roles of plastid gene expression in amyloplast differentiation. Microarray analysis of plastid genes revealed that no specific transcripts were induced in amyloplasts. Nevertheless, amyloplast development accompanied with starch biosynthesis was drastically inhibited in the presence of plastid transcription/translation inhibitors. Surprisingly, the expression of nuclear AgpS and GBSS was significantly repressed by the addition of these inhibitors, suggesting that a plastid-derived signal(s) that reflects normal plastid gene expression was essential for nuclear gene expression. A series of experiments was performed to examine the effects of intermediates and inhibitors of tetrapyrrole biosynthesis, since some of the intermediates have been characterized as candidates for plastid-to-nucleus retrograde signals. Addition of levulinic acid, an inhibitor of tetrapyrrole biosynthesis, resulted in the up-regulation of nuclear AgpS and GBSS gene expression as well as starch accumulation, while the addition of heme showed opposite effects. Thus, these results indicate that plastid transcription and/or translation are required for normal amyloplast differentiation, regulating the expression of specific nuclear genes by unknown signaling mechanisms that can be partly mediated by tetrapyrrole intermediates. PMID:21771917

  13. Divergence of RNA polymerase α subunits in angiosperm plastid genomes is mediated by genomic rearrangement.

    Science.gov (United States)

    Blazier, J Chris; Ruhlman, Tracey A; Weng, Mao-Lun; Rehman, Sumaiyah K; Sabir, Jamal S M; Jansen, Robert K

    2016-04-18

    Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP α subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled and analyzed from each of the three angiosperm families. Multiple lines of evidence indicated that the rpoA sequences are likely functional despite retaining as low as 30% nucleotide sequence identity with rpoA genes from outgroups in the same angiosperm order. The ratio of non-synonymous to synonymous substitutions indicated that these genes are under purifying selection, and bioinformatic prediction of conserved domains indicated that functional domains are preserved. One of the lineages (Pelargonium, Geraniaceae) contains species with multiple rpoA-like ORFs that show evidence of ongoing inter-paralog gene conversion. The plastid genomes containing these divergent rpoA genes have experienced extensive structural rearrangement, including large expansions of the inverted repeat. We propose that illegitimate recombination, not positive selection, has driven the divergence of rpoA.

  14. The complete plastid genomes of the two 'dinotoms' Durinskia baltica and Kryptoperidinium foliaceum.

    Directory of Open Access Journals (Sweden)

    Behzad Imanian

    2010-05-01

    Full Text Available In one small group of dinoflagellates, photosynthesis is carried out by a tertiary endosymbiont derived from a diatom, giving rise to a complex cell that we collectively refer to as a 'dinotom'. The endosymbiont is separated from its host by a single membrane and retains plastids, mitochondria, a large nucleus, and many other eukaryotic organelles and structures, a level of complexity suggesting an early stage of integration. Although the evolution of these endosymbionts has attracted considerable interest, the plastid genome has not been examined in detail, and indeed no tertiary plastid genome has yet been sequenced.Here we describe the complete plastid genomes of two closely related dinotoms, Durinskia baltica and Kryptoperidinium foliaceum. The D. baltica (116470 bp and K. foliaceum (140426 bp plastid genomes map as circular molecules featuring two large inverted repeats that separate distinct single copy regions. The organization and gene content of the D. baltica plastid closely resemble those of the pennate diatom Phaeodactylum tricornutum. The K. foliaceum plastid genome is much larger, has undergone more reorganization, and encodes a putative tyrosine recombinase (tyrC also found in the plastid genome of the heterokont Heterosigma akashiwo, and two putative serine recombinases (serC1 and serC2 homologous to recombinases encoded by plasmids pCf1 and pCf2 in another pennate diatom, Cylindrotheca fusiformis. The K. foliaceum plastid genome also contains an additional copy of serC1, two degenerate copies of another plasmid-encoded ORF, and two non-coding regions whose sequences closely resemble portions of the pCf1 and pCf2 plasmids.These results suggest that while the plastid genomes of two dinotoms share very similar gene content and genome organization with that of the free-living pennate diatom P. tricornutum, the K. folicaeum plastid genome has absorbed two exogenous plasmids. Whether this took place before or after the tertiary

  15. Processes for producing polyhydroxybutyrate and related polyhydroxyalkanoates in the plastids of higher plants

    Science.gov (United States)

    Somerville, C.R.; Nawrath, C.; Poirier, Y.

    1997-03-11

    The present invention relates to a process for producing poly-D-(-)-3-hydroxybutyric acid (PHB) and related polyhydroxyalkanoates (PHA) in the plastids of plants. The production of PHB is accomplished by genetically transforming plants with modified genes from microorganisms. The genes encode the enzymes required to synthesize PHB from acetyl-CoA or related metabolites and are fused with additional plant sequences for targeting the enzymes to the plastid. 37 figs.

  16. Horizontal gene transfer of a plastid gene in the non-photosynthetic flowering plants Orobanche and Phelipanche (Orobanchaceae).

    Science.gov (United States)

    Park, Jeong-Mi; Manen, Jean-François; Schneeweiss, Gerald M

    2007-06-01

    Plastid sequences are among the most widely used in phylogenetic and phylogeographic studies in flowering plants, where they are usually assumed to evolve like non-recombining, uniparentally transmitted, single-copy genes. Among others, this assumption can be violated by intracellular gene transfer (IGT) within cells or by the exchange of genes across mating barriers (horizontal gene transfer, HGT). We report on HGT of a plastid region including rps2, trnL-F, and rbcL in a group of non-photosynthetic flowering plants. Species of the parasitic broomrape genus Phelipanche harbor two copies of rps2, a plastid ribosomal gene, one corresponding to the phylogenetic position of the respective species, the other being horizontally acquired from the related broomrape genus Orobanche. While the vertically transmitted copies probably reside within the plastid genome, the localization of the horizontally acquired copies is not known. With both donor and recipient being parasitic plants, a possible pathway for the exchange of genetic material is via a commonly attacked host.

  17. Non-functional plastid ndh gene fragments are present in the nuclear genome of Norway spruce (Picea abies L. Karsch): insights from in silico analysis of nuclear and organellar genomes.

    Science.gov (United States)

    Ranade, Sonali Sachin; García-Gil, María Rosario; Rosselló, Josep A

    2016-04-01

    Many genes have been lost from the prokaryote plastidial genome during the early events of endosymbiosis in eukaryotes. Some of them were definitively lost, but others were relocated and functionally integrated to the host nuclear genomes through serial events of gene transfer during plant evolution. In gymnosperms, plastid genome sequencing has revealed the loss of ndh genes from several species of Gnetales and Pinaceae, including Norway spruce (Picea abies). This study aims to trace the ndh genes in the nuclear and organellar Norway spruce genomes. The plastid genomes of higher plants contain 11 ndh genes which are homologues of mitochondrial genes encoding subunits of the proton-pumping NADH-dehydrogenase (nicotinamide adenine dinucleotide dehydrogenase) or complex I (electron transport chain). Ndh genes encode 11 NDH polypeptides forming the Ndh complex (analogous to complex I) which seems to be primarily involved in chloro-respiration processes. We considered ndh genes from the plastidial genome of four gymnosperms (Cryptomeria japonica, Cycas revoluta, Ginkgo biloba, Podocarpus totara) and a single angiosperm species (Arabidopsis thaliana) to trace putative homologs in the nuclear and organellar Norway spruce genomes using tBLASTn to assess the evolutionary fate of ndh genes in Norway spruce and to address their genomic location(s), structure, integrity and functionality. The results obtained from tBLASTn were subsequently analyzed by performing homology search for finding ndh specific conserved domains using conserved domain search. We report the presence of non-functional plastid ndh gene fragments, excepting ndhE and ndhG genes, in the nuclear genome of Norway spruce. Regulatory transcriptional elements like promoters, TATA boxes and enhancers were detected in the upstream regions of some ndh fragments. We also found transposable elements in the flanking regions of few ndh fragments suggesting nuclear rearrangements in those regions. These evidences

  18. Mediated Plastid RNA Editing in Plant Immunity

    Science.gov (United States)

    García-Andrade, Javier; Ramírez, Vicente; López, Ana; Vera, Pablo

    2013-01-01

    Plant regulatory circuits coordinating nuclear and plastid gene expression have evolved in response to external stimuli. RNA editing is one of such control mechanisms. We determined the Arabidopsis nuclear-encoded homeodomain-containing protein OCP3 is incorporated into the chloroplast, and contributes to control over the extent of ndhB transcript editing. ndhB encodes the B subunit of the chloroplast NADH dehydrogenase-like complex (NDH) involved in cyclic electron flow (CEF) around photosystem I. In ocp3 mutant strains, ndhB editing efficiency decays, CEF is impaired and disease resistance to fungal pathogens substantially enhanced, a process recapitulated in plants defective in editing plastid RNAs encoding NDH complex subunits due to mutations in previously described nuclear-encoded pentatricopeptide-related proteins (i.e. CRR21, CRR2). Furthermore, we observed that following a pathogenic challenge, wild type plants respond with editing inhibition of ndhB transcript. In parallel, rapid destabilization of the plastidial NDH complex is also observed in the plant following perception of a pathogenic cue. Therefore, NDH complex activity and plant immunity appear as interlinked processes. PMID:24204264

  19. Efficient and stable transformation of Lactuca sativa L. cv. Cisco (lettuce) plastids.

    Science.gov (United States)

    Kanamoto, Hirosuke; Yamashita, Atsushi; Asao, Hiroshi; Okumura, Satoru; Takase, Hisabumi; Hattori, Masahira; Yokota, Akiho; Tomizawa, Ken-Ichi

    2006-04-01

    Transgenic plastids offer unique advantages in plant biotechnology, including high-level foreign protein expression. However, broad application of plastid genome engineering in biotechnology has been largely hampered by the lack of plastid transformation systems for major crops. Here we describe the development of a plastid transformation system for lettuce, Lactuca sativa L. cv. Cisco. The transforming DNA carries a spectinomycin-resistance gene (aadA) under the control of lettuce chloroplast regulatory expression elements, flanked by two adjacent lettuce plastid genome sequences allowing its targeted insertion between the rbcL and accD genes. On average, we obtained 1 transplastomic lettuce plant per bombardment. We show that lettuce leaf chloroplasts can express transgene-encoded GFP to approximately 36% of the total soluble protein. All transplastomic T0 plants were fertile and the T1 progeny uniformly showed stability of the transgene in the chloroplast genome. This system will open up new possibilities for the efficient production of edible vaccines, pharmaceuticals, and antibodies in plants.

  20. Are algal genes in nonphotosynthetic protists evidence of historical plastid endosymbioses?

    Directory of Open Access Journals (Sweden)

    Tian Jing

    2009-10-01

    Full Text Available Abstract Background How photosynthetic organelles, or plastids, were acquired by diverse eukaryotes is among the most hotly debated topics in broad scale eukaryotic evolution. The history of plastid endosymbioses commonly is interpreted under the "chromalveolate" hypothesis, which requires numerous plastid losses from certain heterotrophic groups that now are entirely aplastidic. In this context, discoveries of putatively algal genes in plastid-lacking protists have been cited as evidence of gene transfer from a photosynthetic endosymbiont that subsequently was lost completely. Here we examine this evidence, as it pertains to the chromalveolate hypothesis, through genome-level statistical analyses of similarity scores from queries with two diatoms, Phaeodactylum tricornutum and Thalassiosira pseudonana, and two aplastidic sister taxa, Phytophthora ramorum and P. sojae. Results Contingency tests of specific predictions of the chromalveolate model find no evidence for an unusual red algal contribution to Phytophthora genomes, nor that putative cyanobacterial sequences that are present entered these genomes through a red algal endosymbiosis. Examination of genes unrelated to plastid function provide extraordinarily significant support for both of these predictions in diatoms, the control group where a red endosymbiosis is known to have occurred, but none of that support is present in genes specifically conserved between diatoms and oomycetes. In addition, we uncovered a strong association between overall sequence similarities among taxa and relative sizes of genomic data sets in numbers of genes. Conclusion Signal from "algal" genes in oomycete genomes is inconsistent with the chromalveolate hypothesis, and better explained by alternative models of sequence and genome evolution. Combined with the numerous sources of intragenomic phylogenetic conflict characterized previously, our results underscore the potential to be mislead by a posteriori

  1. Complete Plastid Genome Sequencing of Four Tilia Species (Malvaceae: A Comparative Analysis and Phylogenetic Implications.

    Directory of Open Access Journals (Sweden)

    Jie Cai

    Full Text Available Tilia is an ecologically and economically important genus in the family Malvaceae. However, there is no complete plastid genome of Tilia sequenced to date, and the taxonomy of Tilia is difficult owing to frequent hybridization and polyploidization. A well-supported interspecific relationships of this genus is not available due to limited informative sites from the commonly used molecular markers. We report here the complete plastid genome sequences of four Tilia species determined by the Illumina technology. The Tilia plastid genome is 162,653 bp to 162,796 bp in length, encoding 113 unique genes and a total number of 130 genes. The gene order and organization of the Tilia plastid genome exhibits the general structure of angiosperms and is very similar to other published plastid genomes of Malvaceae. As other long-lived tree genera, the sequence divergence among the four Tilia plastid genomes is very low. And we analyzed the nucleotide substitution patterns and the evolution of insertions and deletions in the Tilia plastid genomes. Finally, we build a phylogeny of the four sampled Tilia species with high supports using plastid phylogenomics, suggesting that it is an efficient way to resolve the phylogenetic relationships of this genus.

  2. The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

    Science.gov (United States)

    Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

    2017-03-01

    The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  3. Perturbations of carotenoid and tetrapyrrole biosynthetic pathways result in differential alterations in chloroplast function and plastid signaling

    International Nuclear Information System (INIS)

    Park, Joon-Heum; Jung, Sunyo

    2017-01-01

    In this study, we used the biosynthetic inhibitors of carotenoid and tetrapyrrole biosynthetic pathways, norflurazon (NF) and oxyfluorfen (OF), as tools to gain insight into mechanisms of photooxidation in rice plants. NF resulted in bleaching symptom on leaves of the treated plants, whereas OF treatment developed a fast symptom of an apparent necrotic phenotype. Both plants exhibited decreases in photosynthetic efficiency, as indicated by F v /F m . NF caused severe disruption in thylakoid membranes, whereas OF-treated plants exhibited disruption of chloroplast envelope and plasma membrane. Levels of Lhca and Lhcb proteins in photosystem I (PSI) and PSII were reduced by photooxidative stress in NF- and OF-treated plants, with a greater decrease in NF plants. The down-regulation of nuclear-encoded photosynthesis genes Lhcb and rbcS was also found in both NF- and OF-treated plants, whereas plastid-encoded photosynthetic genes including RbcL, PsaC, and PsbD accumulated normally in NF plants but decreased drastically in OF plants. This proposes that the plastids in NF plants retain their potential to develop thylakoid membranes and that photobleaching is mainly controlled by nuclear genes. Distinct photooxidation patterns between NF- and OF-treated plants developed differential signaling, which might enable the plant to coordinate the expression of photosynthetic genes from the nuclear and plastidic genomes. - Highlights: • Two modes of photooxidation by carotenoid and tetrapyrrole biosynthetic inhibitors. • We examine differential alterations in chloroplast function and plastid signaling. • NF and OF cause differential alterations in chloroplast ultrastructure and function. • Photooxidation coordinates photosynthetic gene expression from nucleus and plastid.

  4. Evolution of plastid gene rps2 in a lineage of hemiparasitic and holoparasitic plants: Many losses of photosynthesis and complex patterns of rate variation

    Science.gov (United States)

    dePamphilis, Claude W.; Young, Nelson D.; Wolfe, Andrea D.

    1997-01-01

    The plastid genomes of some nonphotosynthetic parasitic plants have experienced an extreme reduction in gene content and an increase in evolutionary rate of remaining genes. Nothing is known of the dynamics of these events or whether either is a direct outcome of the loss of photosynthesis. The parasitic Scrophulariaceae and Orobanchaceae, representing a continuum of heterotrophic ability ranging from photosynthetic hemiparasites to nonphotosynthetic holoparasites, are used to investigate these issues. We present a phylogenetic hypothesis for parasitic Scrophulariaceae and Orobanchaceae based on sequences of the plastid gene rps2, encoding the S2 subunit of the plastid ribosome. Parasitic Scrophulariaceae and Orobanchaceae form a monophyletic group in which parasitism can be inferred to have evolved once. Holoparasitism has evolved independently at least five times, with certain holoparasitic lineages representing single species, genera, and collections of nonphotosynthetic genera. Evolutionary loss of the photosynthetic gene rbcL is limited to a subset of holoparasitic lineages, with several holoparasites retaining a full length rbcL sequence. In contrast, the translational gene rps2 is retained in all plants investigated but has experienced rate accelerations in several hemi- as well as holoparasitic lineages, suggesting that there may be substantial molecular evolutionary changes to the plastid genome of parasites before the loss of photosynthesis. Independent patterns of synonymous and nonsynonymous rate acceleration in rps2 point to distinct mechanisms underlying rate variation in different lineages. Parasitic Scrophulariaceae (including the traditional Orobanchaceae) provide a rich platform for the investigation of molecular evolutionary process, gene function, and the evolution of parasitism. PMID:9207097

  5. A phylogenetic analysis of the genus Psathyrostachys (Poaceae) based on one nuclear gene, three plastid genes, and morphology

    DEFF Research Database (Denmark)

    Petersen, Gitte; Seberg, Ole; Baden, Claus

    2004-01-01

    A phylogenetic analysis of the small, Central Asian genus Psathyrostachys Nevski is presented. The analysis is based on morphological characters and nucleotide sequence data from one nuclear gene, DMC1, and three plastid genes, rbcL, rpoA, and rpoC2. Separate analyses of the three data partitions...... (morphology, nuclear sequences, and plastid sequences) result in mostly congruent trees. The plastid and nuclear sequences produce completely congruent trees, and only the trees based on plastid sequences and morphological characters are incongruent. Combined analysis of all data results in a fairly well......-resolved strict consensus tree: Ps. rupestris is the sister to the remaining species, which are divided into two clades: one including Ps. fragilis and Ps. caduca, the other including Ps. juncea, Ps. huashanica, Ps. lanuginosa, Ps. stoloniformis, and Ps. kronenburgii. Pubescent culms and more than 20 mm long...

  6. Plastid genome evolution across the genus Cuscuta (Convolvulaceae): two clades within subgenus Grammica exhibit extensive gene loss.

    Science.gov (United States)

    Braukmann, Thomas; Kuzmina, Maria; Stefanovic, Sasa

    2013-02-01

    The genus Cuscuta (Convolvulaceae, the morning glory family) is one of the most intensely studied lineages of parasitic plants. Whole plastome sequencing of four Cuscuta species has demonstrated changes to both plastid gene content and structure. The presence of photosynthetic genes under purifying selection indicates that Cuscuta is cryptically photosynthetic. However, the tempo and mode of plastid genome evolution across the diversity of this group (~200 species) remain largely unknown. A comparative investigation of plastid genome content, grounded within a phylogenetic framework, was conducted using a slot-blot Southern hybridization approach. Cuscuta was extensively sampled (~56% of species), including groups previously suggested to possess more altered plastomes compared with other members of this genus. A total of 56 probes derived from all categories of protein-coding genes, typically found within the plastomes of flowering plants, were used. The results indicate that two clades within subgenus Grammica (clades 'O' and 'K') exhibit substantially more plastid gene loss relative to other members of Cuscuta. All surveyed members of the 'O' clade show extensive losses of plastid genes from every category of genes typically found in the plastome, including otherwise highly conserved small and large ribosomal subunits. The extent of plastid gene losses within this clade is similar in magnitude to that observed previously in some non-asterid holoparasites, in which the very presence of a plastome has been questioned. The 'K' clade also exhibits considerable loss of plastid genes. Unlike in the 'O' clade, in which all species seem to be affected, the losses in clade 'K' progress phylogenetically, following a pattern consistent with the Evolutionary Transition Series hypothesis. This clade presents an ideal opportunity to study the reduction of the plastome of parasites 'in action'. The widespread plastid gene loss in these two clades is hypothesized to be a

  7. Horizontal transfer of a eukaryotic plastid-targeted protein gene to cyanobacteria

    Directory of Open Access Journals (Sweden)

    Keeling Patrick J

    2007-06-01

    Full Text Available Abstract Background Horizontal or lateral transfer of genetic material between distantly related prokaryotes has been shown to play a major role in the evolution of bacterial and archaeal genomes, but exchange of genes between prokaryotes and eukaryotes is not as well understood. In particular, gene flow from eukaryotes to prokaryotes is rarely documented with strong support, which is unusual since prokaryotic genomes appear to readily accept foreign genes. Results Here, we show that abundant marine cyanobacteria in the related genera Synechococcus and Prochlorococcus acquired a key Calvin cycle/glycolytic enzyme from a eukaryote. Two non-homologous forms of fructose bisphosphate aldolase (FBA are characteristic of eukaryotes and prokaryotes respectively. However, a eukaryotic gene has been inserted immediately upstream of the ancestral prokaryotic gene in several strains (ecotypes of Synechococcus and Prochlorococcus. In one lineage this new gene has replaced the ancestral gene altogether. The eukaryotic gene is most closely related to the plastid-targeted FBA from red algae. This eukaryotic-type FBA once replaced the plastid/cyanobacterial type in photosynthetic eukaryotes, hinting at a possible functional advantage in Calvin cycle reactions. The strains that now possess this eukaryotic FBA are scattered across the tree of Synechococcus and Prochlorococcus, perhaps because the gene has been transferred multiple times among cyanobacteria, or more likely because it has been selectively retained only in certain lineages. Conclusion A gene for plastid-targeted FBA has been transferred from red algae to cyanobacteria, where it has inserted itself beside its non-homologous, functional analogue. Its current distribution in Prochlorococcus and Synechococcus is punctate, suggesting a complex history since its introduction to this group.

  8. Codon adaptation and synonymous substitution rate in diatom plastid genes.

    Science.gov (United States)

    Morton, Brian R; Sorhannus, Ulf; Fox, Martin

    2002-07-01

    Diatom plastid genes are examined with respect to codon adaptation and rates of silent substitution (Ks). It is shown that diatom genes follow the same pattern of codon usage as other plastid genes studied previously. Highly expressed diatom genes display codon adaptation, or a bias toward specific major codons, and these major codons are the same as those in red algae, green algae, and land plants. It is also found that there is a strong correlation between Ks and variation in codon adaptation across diatom genes, providing the first evidence for such a relationship in the algae. It is argued that this finding supports the notion that the correlation arises from selective constraints, not from variation in mutation rate among genes. Finally, the diatom genes are examined with respect to variation in Ks among different synonymous groups. Diatom genes with strong codon adaptation do not show the same variation in synonymous substitution rate among codon groups as the flowering plant psbA gene which, previous studies have shown, has strong codon adaptation but unusually high rates of silent change in certain synonymous groups. The lack of a similar finding in diatoms supports the suggestion that the feature is unique to the flowering plant psbA due to recent relaxations in selective pressure in that lineage.

  9. Plastid genomes of two brown algae, Ectocarpus siliculosus and Fucus vesiculosus: further insights on the evolution of red-algal derived plastids

    Directory of Open Access Journals (Sweden)

    Corre Erwan

    2009-10-01

    Full Text Available Abstract Background Heterokont algae, together with cryptophytes, haptophytes and some alveolates, possess red-algal derived plastids. The chromalveolate hypothesis proposes that the red-algal derived plastids of all four groups have a monophyletic origin resulting from a single secondary endosymbiotic event. However, due to incongruence between nuclear and plastid phylogenies, this controversial hypothesis remains under debate. Large-scale genomic analyses have shown to be a powerful tool for phylogenetic reconstruction but insufficient sequence data have been available for red-algal derived plastid genomes. Results The chloroplast genomes of two brown algae, Ectocarpus siliculosus and Fucus vesiculosus, have been fully sequenced. These species represent two distinct orders of the Phaeophyceae, which is a major group within the heterokont lineage. The sizes of the circular plastid genomes are 139,954 and 124,986 base pairs, respectively, the size difference being due principally to the presence of longer inverted repeat and intergenic regions in E. siliculosus. Gene contents of the two plastids are similar with 139-148 protein-coding genes, 28-31 tRNA genes, and 3 ribosomal RNA genes. The two genomes also exhibit very similar rearrangements compared to other sequenced plastid genomes. The tRNA-Leu gene of E. siliculosus lacks an intron, in contrast to the F. vesiculosus and other heterokont plastid homologues, suggesting its recent loss in the Ectocarpales. Most of the brown algal plastid genes are shared with other red-algal derived plastid genomes, but a few are absent from raphidophyte or diatom plastid genomes. One of these regions is most similar to an apicomplexan nuclear sequence. The phylogenetic relationship between heterokonts, cryptophytes and haptophytes (collectively referred to as chromists plastids was investigated using several datasets of concatenated proteins from two cyanobacterial genomes and 18 plastid genomes, including

  10. Mutations in a plastid-localized elongation factor G alter early stages of plastid development in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Hangarter Roger P

    2007-07-01

    Full Text Available Abstract Background Proper development of plastids in embryo and seedling tissues is critical for plant development. During germination, plastids develop to perform many critical functions that are necessary to establish the seedling for further growth. A growing body of work has demonstrated that components of the plastid transcription and translation machinery must be present and functional to establish the organelle upon germination. Results We have identified Arabidopsis thaliana mutants in a gene that encodes a plastid-targeted elongation factor G (SCO1 that is essential for plastid development during embryogenesis since two T-DNA insertion mutations in the coding sequence (sco1-2 and sco1-3 result in an embryo-lethal phenotype. In addition, a point mutation allele (sco1-1 and an allele with a T-DNA insertion in the promoter (sco1-4 of SCO1 display conditional seedling-lethal phenotypes. Seedlings of these alleles exhibit cotyledon and hypocotyl albinism due to improper chloroplast development, and normally die shortly after germination. However, when germinated on media supplemented with sucrose, the mutant plants can produce photosynthetically-active green leaves from the apical meristem. Conclusion The developmental stage-specific phenotype of the conditional-lethal sco1 alleles reveals differences in chloroplast formation during seedling germination compared to chloroplast differentiation in cells derived from the shoot apical meristem. Our identification of embryo-lethal mutant alleles in the Arabidopsis elongation factor G indicates that SCO1 is essential for plant growth, consistent with its predicted role in chloroplast protein translation.

  11. The plastid genome of Eutreptiella provides a window into the process of secondary endosymbiosis of plastid in euglenids.

    Directory of Open Access Journals (Sweden)

    Štěpánka Hrdá

    Full Text Available Euglenids are a group of protists that comprises species with diverse feeding modes. One distinct and diversified clade of euglenids is photoautotrophic, and its members bear green secondary plastids. In this paper we present the plastid genome of the euglenid Eutreptiella, which we assembled from 454 sequencing of Eutreptiella gDNA. Comparison of this genome and the only other available plastid genomes of photosynthetic euglenid, Euglena gracilis, revealed that they contain a virtually identical set of 57 protein coding genes, 24 genes fewer than the genome of Pyramimonas parkeae, the closest extant algal relative of the euglenid plastid. Searching within the transcriptomes of Euglena and Eutreptiella showed that 6 of the missing genes were transferred to the nucleus of the euglenid host while 18 have been probably lost completely. Euglena and Eutreptiella represent the deepest bifurcation in the photosynthetic clade, and therefore all these gene transfers and losses must have happened before the last common ancestor of all known photosynthetic euglenids. After the split of Euglena and Eutreptiella only one additional gene loss took place. The conservation of gene content in the two lineages of euglenids is in contrast to the variability of gene order and intron counts, which diversified dramatically. Our results show that the early secondary plastid of euglenids was much more susceptible to gene losses and endosymbiotic gene transfers than the established plastid, which is surprisingly resistant to changes in gene content.

  12. ATP-dependent molecular chaperones in plastids--More complex than expected.

    Science.gov (United States)

    Trösch, Raphael; Mühlhaus, Timo; Schroda, Michael; Willmund, Felix

    2015-09-01

    Plastids are a class of essential plant cell organelles comprising photosynthetic chloroplasts of green tissues, starch-storing amyloplasts of roots and tubers or the colorful pigment-storing chromoplasts of petals and fruits. They express a few genes encoded on their organellar genome, called plastome, but import most of their proteins from the cytosol. The import into plastids, the folding of freshly-translated or imported proteins, the degradation or renaturation of denatured and entangled proteins, and the quality-control of newly folded proteins all require the action of molecular chaperones. Members of all four major families of ATP-dependent molecular chaperones (chaperonin/Cpn60, Hsp70, Hsp90 and Hsp100 families) have been identified in plastids from unicellular algae to higher plants. This review aims not only at giving an overview of the most current insights into the general and conserved functions of these plastid chaperones, but also into their specific plastid functions. Given that chloroplasts harbor an extreme environment that cycles between reduced and oxidized states, that has to deal with reactive oxygen species and is highly reactive to environmental and developmental signals, it can be presumed that plastid chaperones have evolved a plethora of specific functions some of which are just about to be discovered. Here, the most urgent questions that remain unsolved are discussed, and guidance for future research on plastid chaperones is given. This article is part of a Special Issue entitled: Chloroplast Biogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

    Science.gov (United States)

    Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

    2000-01-01

    The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

  14. Perturbations of carotenoid and tetrapyrrole biosynthetic pathways result in differential alterations in chloroplast function and plastid signaling.

    Science.gov (United States)

    Park, Joon-Heum; Jung, Sunyo

    2017-01-22

    In this study, we used the biosynthetic inhibitors of carotenoid and tetrapyrrole biosynthetic pathways, norflurazon (NF) and oxyfluorfen (OF), as tools to gain insight into mechanisms of photooxidation in rice plants. NF resulted in bleaching symptom on leaves of the treated plants, whereas OF treatment developed a fast symptom of an apparent necrotic phenotype. Both plants exhibited decreases in photosynthetic efficiency, as indicated by F v /F m . NF caused severe disruption in thylakoid membranes, whereas OF-treated plants exhibited disruption of chloroplast envelope and plasma membrane. Levels of Lhca and Lhcb proteins in photosystem I (PSI) and PSII were reduced by photooxidative stress in NF- and OF-treated plants, with a greater decrease in NF plants. The down-regulation of nuclear-encoded photosynthesis genes Lhcb and rbcS was also found in both NF- and OF-treated plants, whereas plastid-encoded photosynthetic genes including RbcL, PsaC, and PsbD accumulated normally in NF plants but decreased drastically in OF plants. This proposes that the plastids in NF plants retain their potential to develop thylakoid membranes and that photobleaching is mainly controlled by nuclear genes. Distinct photooxidation patterns between NF- and OF-treated plants developed differential signaling, which might enable the plant to coordinate the expression of photosynthetic genes from the nuclear and plastidic genomes. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Parallel loss of plastid introns and their maturase in the genus Cuscuta.

    Science.gov (United States)

    McNeal, Joel R; Kuehl, Jennifer V; Boore, Jeffrey L; Leebens-Mack, Jim; dePamphilis, Claude W

    2009-06-19

    Plastid genome content and arrangement are highly conserved across most land plants and their closest relatives, streptophyte algae, with nearly all plastid introns having invaded the genome in their common ancestor at least 450 million years ago. One such intron, within the transfer RNA trnK-UUU, contains a large open reading frame that encodes a presumed intron maturase, matK. This gene is missing from the plastid genomes of two species in the parasitic plant genus Cuscuta but is found in all other published land plant and streptophyte algal plastid genomes, including that of the nonphotosynthetic angiosperm Epifagus virginiana and two other species of Cuscuta. By examining matK and plastid intron distribution in Cuscuta, we add support to the hypothesis that its normal role is in splicing seven of the eight group IIA introns in the genome. We also analyze matK nucleotide sequences from Cuscuta species and relatives that retain matK to test whether changes in selective pressure in the maturase are associated with intron deletion. Stepwise loss of most group IIA introns from the plastid genome results in substantial change in selective pressure within the hypothetical RNA-binding domain of matK in both Cuscuta and Epifagus, either through evolution from a generalist to a specialist intron splicer or due to loss of a particular intron responsible for most of the constraint on the binding region. The possibility of intron-specific specialization in the X-domain is implicated by evidence of positive selection on the lineage leading to C. nitida in association with the loss of six of seven introns putatively spliced by matK. Moreover, transfer RNA gene deletion facilitated by parasitism combined with an unusually high rate of intron loss from remaining functional plastid genes created a unique circumstance on the lineage leading to Cuscuta subgenus Grammica that allowed elimination of matK in the most species-rich lineage of Cuscuta.

  16. Parallel loss of plastid introns and their maturase in the genus Cuscuta.

    Directory of Open Access Journals (Sweden)

    Joel R McNeal

    2009-06-01

    Full Text Available Plastid genome content and arrangement are highly conserved across most land plants and their closest relatives, streptophyte algae, with nearly all plastid introns having invaded the genome in their common ancestor at least 450 million years ago. One such intron, within the transfer RNA trnK-UUU, contains a large open reading frame that encodes a presumed intron maturase, matK. This gene is missing from the plastid genomes of two species in the parasitic plant genus Cuscuta but is found in all other published land plant and streptophyte algal plastid genomes, including that of the nonphotosynthetic angiosperm Epifagus virginiana and two other species of Cuscuta. By examining matK and plastid intron distribution in Cuscuta, we add support to the hypothesis that its normal role is in splicing seven of the eight group IIA introns in the genome. We also analyze matK nucleotide sequences from Cuscuta species and relatives that retain matK to test whether changes in selective pressure in the maturase are associated with intron deletion. Stepwise loss of most group IIA introns from the plastid genome results in substantial change in selective pressure within the hypothetical RNA-binding domain of matK in both Cuscuta and Epifagus, either through evolution from a generalist to a specialist intron splicer or due to loss of a particular intron responsible for most of the constraint on the binding region. The possibility of intron-specific specialization in the X-domain is implicated by evidence of positive selection on the lineage leading to C. nitida in association with the loss of six of seven introns putatively spliced by matK. Moreover, transfer RNA gene deletion facilitated by parasitism combined with an unusually high rate of intron loss from remaining functional plastid genes created a unique circumstance on the lineage leading to Cuscuta subgenus Grammica that allowed elimination of matK in the most species-rich lineage of Cuscuta.

  17. The plastid genome of the red macroalga Grateloupia taiwanensis (Halymeniaceae.

    Directory of Open Access Journals (Sweden)

    Michael S DePriest

    Full Text Available The complete plastid genome sequence of the red macroalga Grateloupia taiwanensis S.-M.Lin & H.-Y.Liang (Halymeniaceae, Rhodophyta is presented here. Comprising 191,270 bp, the circular DNA contains 233 protein-coding genes and 29 tRNA sequences. In addition, several genes previously unknown to red algal plastids are present in the genome of G. taiwanensis. The plastid genomes from G. taiwanensis and another florideophyte, Gracilaria tenuistipitata var. liui, are very similar in sequence and share significant synteny. In contrast, less synteny is shared between G. taiwanensis and the plastid genome representatives of Bangiophyceae and Cyanidiophyceae. Nevertheless, the gene content of all six red algal plastid genomes here studied is highly conserved, and a large core repertoire of plastid genes can be discerned in Rhodophyta.

  18. The Plastid Genome of the Red Macroalga Grateloupia taiwanensis (Halymeniaceae)

    Science.gov (United States)

    DePriest, Michael S.; Bhattacharya, Debashish; López-Bautista, Juan M.

    2013-01-01

    The complete plastid genome sequence of the red macroalga Grateloupia taiwanensis S.-M.Lin & H.-Y.Liang (Halymeniaceae, Rhodophyta) is presented here. Comprising 191,270 bp, the circular DNA contains 233 protein-coding genes and 29 tRNA sequences. In addition, several genes previously unknown to red algal plastids are present in the genome of G. taiwanensis. The plastid genomes from G. taiwanensis and another florideophyte, Gracilaria tenuistipitata var. liui, are very similar in sequence and share significant synteny. In contrast, less synteny is shared between G. taiwanensis and the plastid genome representatives of Bangiophyceae and Cyanidiophyceae. Nevertheless, the gene content of all six red algal plastid genomes here studied is highly conserved, and a large core repertoire of plastid genes can be discerned in Rhodophyta. PMID:23894297

  19. Plastid Phylogenomic Analyses Resolve Tofieldiaceae as the Root of the Early Diverging Monocot Order Alismatales.

    Science.gov (United States)

    Luo, Yang; Ma, Peng-Fei; Li, Hong-Tao; Yang, Jun-Bo; Wang, Hong; Li, De-Zhu

    2016-04-06

    The predominantly aquatic order Alismatales, which includes approximately 4,500 species within Araceae, Tofieldiaceae, and the core alismatid families, is a key group in investigating the origin and early diversification of monocots. Despite their importance, phylogenetic ambiguity regarding the root of the Alismatales tree precludes answering questions about the early evolution of the order. Here, we sequenced the first complete plastid genomes from three key families in this order:Potamogeton perfoliatus(Potamogetonaceae),Sagittaria lichuanensis(Alismataceae), andTofieldia thibetica(Tofieldiaceae). Each family possesses the typical quadripartite structure, with plastid genome sizes of 156,226, 179,007, and 155,512 bp, respectively. Among them, the plastid genome ofS. lichuanensisis the largest in monocots and the second largest in angiosperms. Like other sequenced Alismatales plastid genomes, all three families generally encode the same 113 genes with similar structure and arrangement. However, we detected 2.4 and 6 kb inversions in the plastid genomes ofSagittariaandPotamogeton, respectively. Further, we assembled a 79 plastid protein-coding gene sequence data matrix of 22 taxa that included the three newly generated plastid genomes plus 19 previously reported ones, which together represent all primary lineages of monocots and outgroups. In plastid phylogenomic analyses using maximum likelihood and Bayesian inference, we show both strong support for Acorales as sister to the remaining monocots and monophyly of Alismatales. More importantly, Tofieldiaceae was resolved as the most basal lineage within Alismatales. These results provide new insights into the evolution of Alismatales as well as the early-diverging monocots as a whole. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Selective Gene Delivery for Integrating Exogenous DNA into Plastid and Mitochondrial Genomes Using Peptide-DNA Complexes.

    Science.gov (United States)

    Yoshizumi, Takeshi; Oikawa, Kazusato; Chuah, Jo-Ann; Kodama, Yutaka; Numata, Keiji

    2018-05-14

    Selective gene delivery into organellar genomes (mitochondrial and plastid genomes) has been limited because of a lack of appropriate platform technology, even though these organelles are essential for metabolite and energy production. Techniques for selective organellar modification are needed to functionally improve organelles and produce transplastomic/transmitochondrial plants. However, no method for mitochondrial genome modification has yet been established for multicellular organisms including plants. Likewise, modification of plastid genomes has been limited to a few plant species and algae. In the present study, we developed ionic complexes of fusion peptides containing organellar targeting signal and plasmid DNA for selective delivery of exogenous DNA into the plastid and mitochondrial genomes of intact plants. This is the first report of exogenous DNA being integrated into the mitochondrial genomes of not only plants, but also multicellular organisms in general. This fusion peptide-mediated gene delivery system is a breakthrough platform for both plant organellar biotechnology and gene therapy for mitochondrial diseases in animals.

  1. Novel nuclear-encoded proteins interacting with a plastid sigma factor, Sig1, in Arabidopsis thaliana.

    Science.gov (United States)

    Morikawa, Kazuya; Shiina, Takashi; Murakami, Shinya; Toyoshima, Yoshinori

    2002-03-13

    Sigma factor binding proteins are involved in modifying the promoter preferences of the RNA polymerase in bacteria. We found the nuclear encoded protein (SibI) that is transported into chloroplasts and interacts specifically with the region 4 of Sig1 in Arabidopsis. SibI and its homologue, T3K9.5 are novel proteins, which are not homologous to any protein of known function. The expression of sibI was tissue specific, light dependent, and developmentally timed. We suggest the transcriptional regulation by sigma factor binding proteins to function in the plastids of higher plant.

  2. Complete DNA sequences of the plastid genomes of two parasitic flowering plant species, Cuscuta reflexa and Cuscuta gronovii.

    Science.gov (United States)

    Funk, Helena T; Berg, Sabine; Krupinska, Karin; Maier, Uwe G; Krause, Kirsten

    2007-08-22

    The holoparasitic plant genus Cuscuta comprises species with photosynthetic capacity and functional chloroplasts as well as achlorophyllous and intermediate forms with restricted photosynthetic activity and degenerated chloroplasts. Previous data indicated significant differences with respect to the plastid genome coding capacity in different Cuscuta species that could correlate with their photosynthetic activity. In order to shed light on the molecular changes accompanying the parasitic lifestyle, we sequenced the plastid chromosomes of the two species Cuscuta reflexa and Cuscuta gronovii. Both species are capable of performing photosynthesis, albeit with varying efficiencies. Together with the plastid genome of Epifagus virginiana, an achlorophyllous parasitic plant whose plastid genome has been sequenced, these species represent a series of progression towards total dependency on the host plant, ranging from reduced levels of photosynthesis in C. reflexa to a restricted photosynthetic activity and degenerated chloroplasts in C. gronovii to an achlorophyllous state in E. virginiana. The newly sequenced plastid genomes of C. reflexa and C. gronovii reveal that the chromosome structures are generally very similar to that of non-parasitic plants, although a number of species-specific insertions, deletions (indels) and sequence inversions were identified. However, we observed a gradual adaptation of the plastid genome to the different degrees of parasitism. The changes are particularly evident in C. gronovii and include (a) the parallel losses of genes for the subunits of the plastid-encoded RNA polymerase and the corresponding promoters from the plastid genome, (b) the first documented loss of the gene for a putative splicing factor, MatK, from the plastid genome and (c) a significant reduction of RNA editing. Overall, the comparative genomic analysis of plastid DNA from parasitic plants indicates a bias towards a simplification of the plastid gene expression

  3. Complete DNA sequences of the plastid genomes of two parasitic flowering plant species, Cuscuta reflexa and Cuscuta gronovii

    Directory of Open Access Journals (Sweden)

    Maier Uwe G

    2007-08-01

    Full Text Available Abstract Background The holoparasitic plant genus Cuscuta comprises species with photosynthetic capacity and functional chloroplasts as well as achlorophyllous and intermediate forms with restricted photosynthetic activity and degenerated chloroplasts. Previous data indicated significant differences with respect to the plastid genome coding capacity in different Cuscuta species that could correlate with their photosynthetic activity. In order to shed light on the molecular changes accompanying the parasitic lifestyle, we sequenced the plastid chromosomes of the two species Cuscuta reflexa and Cuscuta gronovii. Both species are capable of performing photosynthesis, albeit with varying efficiencies. Together with the plastid genome of Epifagus virginiana, an achlorophyllous parasitic plant whose plastid genome has been sequenced, these species represent a series of progression towards total dependency on the host plant, ranging from reduced levels of photosynthesis in C. reflexa to a restricted photosynthetic activity and degenerated chloroplasts in C. gronovii to an achlorophyllous state in E. virginiana. Results The newly sequenced plastid genomes of C. reflexa and C. gronovii reveal that the chromosome structures are generally very similar to that of non-parasitic plants, although a number of species-specific insertions, deletions (indels and sequence inversions were identified. However, we observed a gradual adaptation of the plastid genome to the different degrees of parasitism. The changes are particularly evident in C. gronovii and include (a the parallel losses of genes for the subunits of the plastid-encoded RNA polymerase and the corresponding promoters from the plastid genome, (b the first documented loss of the gene for a putative splicing factor, MatK, from the plastid genome and (c a significant reduction of RNA editing. Conclusion Overall, the comparative genomic analysis of plastid DNA from parasitic plants indicates a bias towards

  4. Proteomic amino-termini profiling reveals targeting information for protein import into complex plastids.

    Directory of Open Access Journals (Sweden)

    Pitter F Huesgen

    Full Text Available In organisms with complex plastids acquired by secondary endosymbiosis from a photosynthetic eukaryote, the majority of plastid proteins are nuclear-encoded, translated on cytoplasmic ribosomes, and guided across four membranes by a bipartite targeting sequence. In-depth understanding of this vital import process has been impeded by a lack of information about the transit peptide part of this sequence, which mediates transport across the inner three membranes. We determined the mature N-termini of hundreds of proteins from the model diatom Thalassiosira pseudonana, revealing extensive N-terminal modification by acetylation and proteolytic processing in both cytosol and plastid. We identified 63 mature N-termini of nucleus-encoded plastid proteins, deduced their complete transit peptide sequences, determined a consensus motif for their cleavage by the stromal processing peptidase, and found evidence for subsequent processing by a plastid methionine aminopeptidase. The cleavage motif differs from that of higher plants, but is shared with other eukaryotes with complex plastids.

  5. Evolution of RLSB, a nuclear-encoded S1 domain RNA binding protein associated with post-transcriptional regulation of plastid-encoded rbcL mRNA in vascular plants.

    Science.gov (United States)

    Yerramsetty, Pradeep; Stata, Matt; Siford, Rebecca; Sage, Tammy L; Sage, Rowan F; Wong, Gane Ka-Shu; Albert, Victor A; Berry, James O

    2016-06-29

    grasses, highlighting the possible importance of maintaining this gene and its surrounding genomic regions. Findings presented here indicate that the RLSB family originated as a unique gene in land plant evolution, perhaps in the common ancestor of charophytes and higher plants. Purifying selection has maintained this as a highly conserved single- or two-copy gene across most extant species, with several conserved gene duplications. Together with previous findings, this study suggests that RLSB has been sustained as an important regulatory protein throughout the course of land plant evolution. While only RLSB-a has been directly implicated in rbcL regulation in maize, RLSB-b could have an overlapping function in the co-regulation of rbcL, or may have diverged as a regulator of one or more other plastid-encoded mRNAs. This analysis confirms that RLSB is an important and unique photosynthetic regulatory protein that has been continuously expressed in land plants as they emerged and diversified from their ancient common ancestor.

  6. The plastid-localized pfkB-type carbohydrate kinases FRUCTOKINASE-LIKE 1 and 2 are essential for growth and development of Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Gilkerson Jonathan

    2012-07-01

    Full Text Available Abstract Background Transcription of plastid-encoded genes requires two different DNA-dependent RNA polymerases, a nuclear-encoded polymerase (NEP and plastid-encoded polymerase (PEP. Recent studies identified two related pfkB-type carbohydrate kinases, named FRUCTOKINASE-LIKE PROTEIN (FLN1 and FLN2, as components of the thylakoid bound PEP complex in both Arabidopsis thaliana and Sinapis alba (mustard. Additional work demonstrated that RNAi-mediated reduction in FLN expression specifically diminished transcription of PEP-dependent genes. Results Here, we report the characterization of Arabidopsis FLN knockout alleles to examine the contribution of each gene in plant growth, chloroplast development, and in mediating PEP-dependent transcription. We show that fln plants have severe phenotypes with fln1 resulting in an albino phenotype that is seedling lethal without a source of exogenous carbon. In contrast, fln2 plants display chlorosis prior to leaf expansion, but exhibit slow greening, remain autotrophic, can grow to maturity, and set viable seed. fln1 fln2 double mutant analysis reveals haplo-insufficiency, and fln1 fln2 plants have a similar, but more severe phenotype than either single mutant. Normal plastid development in both light and dark requires the FLNs, but surprisingly skotomorphogenesis is unaffected in fln seedlings. Seedlings genetically fln1-1 with dexamethasone-inducible FLN1-HA expression at germination are phenotypically indistinguishable from wild-type. Induction of FLN-HA after 24 hours of germination cannot rescue the mutant phenotype, indicating that the effects of loss of FLN are not always reversible. Examination of chloroplast gene expression in fln1-1 and fln2-1 by qRT-PCR reveals that transcripts of PEP-dependent genes were specifically reduced compared to NEP-dependent genes in both single mutants. Conclusions Our results demonstrate that each FLN protein contributes to wild type growth, and acting additively are

  7. Assembled Plastid and Mitochondrial Genomes, as well as Nuclear Genes, Place the Parasite Family Cynomoriaceae in the Saxifragales.

    Science.gov (United States)

    Bellot, Sidonie; Cusimano, Natalie; Luo, Shixiao; Sun, Guiling; Zarre, Shahin; Gröger, Andreas; Temsch, Eva; Renner, Susanne S

    2016-08-03

    Cynomoriaceae, one of the last unplaced families of flowering plants, comprise one or two species or subspecies of root parasites that occur from the Mediterranean to the Gobi Desert. Using Illumina sequencing, we assembled the mitochondrial and plastid genomes as well as some nuclear genes of a Cynomorium specimen from Italy. Selected genes were also obtained by Sanger sequencing from individuals collected in China and Iran, resulting in matrices of 33 mitochondrial, 6 nuclear, and 14 plastid genes and rDNAs enlarged to include a representative angiosperm taxon sampling based on data available in GenBank. We also compiled a new geographic map to discern possible discontinuities in the parasites' occurrence. Cynomorium has large genomes of 13.70-13.61 (Italy) to 13.95-13.76 pg (China). Its mitochondrial genome consists of up to 49 circular subgenomes and has an overall gene content similar to that of photosynthetic angiosperms, while its plastome retains only 27 of the normally 116 genes. Nuclear, plastid and mitochondrial phylogenies place Cynomoriaceae in Saxifragales, and we found evidence for several horizontal gene transfers from different hosts, as well as intracellular gene transfers. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Plastid and mitochondrion genomic sequences from Arctic Chlorella sp. ArM0029B

    Science.gov (United States)

    2014-01-01

    Background Chorella is the representative taxon of Chlorellales in Trebouxiophyceae, and its chloroplast (cp) genomic information has been thought to depend only on studies concerning Chlorella vulgaris and GenBank information of C. variablis. Mitochondrial (mt) genomic information regarding Chlorella is currently unavailable. To elucidate the evolution of organelle genomes and genetic information of Chlorella, we have sequenced and characterized the cp and mt genomes of Arctic Chlorella sp. ArM0029B. Results The 119,989-bp cp genome lacking inverted repeats and 65,049-bp mt genome were sequenced. The ArM0029B cp genome contains 114 conserved genes, including 32 tRNA genes, 3 rRNA genes, and 79 genes encoding proteins. Chlorella cp genomes are highly rearranged except for a Chlorella-specific six-gene cluster, and the ArM0029B plastid resembles that of Chlorella variabilis except for a 15-kb gene cluster inversion. In the mt genome, 62 conserved genes, including 27 tRNA genes, 3 rRNA genes, and 32 genes encoding proteins were determined. The mt genome of ArM0029B is similar to that of the non-photosynthetic species Prototheca and Heicosporidium. The ArM0029B mt genome contains a group I intron, with an ORF containing two LAGLIDADG motifs, in cox1. The intronic ORF is shared by C. vulgaris and Prototheca. The phylogeny of the plastid genome reveals that ArM0029B showed a close relationship of Chlorella to Parachlorella and Oocystis within Chlorellales. The distribution of the cox1 intron at 721 support membership in the order Chlorellales. Mitochondrial phylogenomic analyses, however, indicated that ArM0029B shows a greater affinity to MX-AZ01 and Coccomyxa than to the Helicosporidium-Prototheca clade, although the detailed phylogenetic relationships among the three taxa remain to be resolved. Conclusions The plastid genome of ArM0029B is similar to that of C. variabilis. The mt sequence of ArM0029B is the first genome to be reported for Chlorella. Chloroplast

  9. Arabidopsis plastid AMOS1/EGY1 integrates abscisic acid signaling to regulate global gene expression response to ammonium stress

    KAUST Repository

    Li, Baohai

    2012-10-12

    Ammonium (NH4 +) is a ubiquitous intermediate of nitrogen metabolism but is notorious for its toxic effects on most organisms. Extensive studies of the underlying mechanisms of NH4 + toxicity have been reported in plants, but it is poorly understood how plants acclimate to high levels of NH4 +. Here, we identified an Arabidopsis (Arabidopsis thaliana) mutant, ammonium overly sensitive1 (amos1), that displays severe chlorosis under NH4 + stress. Map-based cloning shows amos1 to carry a mutation in EGY1 (for ethylene-dependent, gravitropism-deficient, and yellow-green-like protein1), which encodes a plastid metalloprotease. Transcriptomic analysis reveals that among the genes activated in response to NH4 +, 90% are regulated dependent on AMOS1/ EGY1. Furthermore, 63% of AMOS1/EGY1-dependent NH4 +-activated genes contain an ACGTG motif in their promoter region, a core motif of abscisic acid (ABA)-responsive elements. Consistent with this, our physiological, pharmacological, transcriptomic, and genetic data show that ABA signaling is a critical, but not the sole, downstream component of the AMOS1/EGY1-dependent pathway that regulates the expression of NH4 +-responsive genes and maintains chloroplast functionality under NH4 + stress. Importantly, abi4 mutants defective in ABA-dependent and retrograde signaling, but not ABA-deficient mutants, mimic leaf NH4 + hypersensitivity of amos1. In summary, our findings suggest that an NH4 +-responsive plastid retrograde pathway, which depends on AMOS1/EGY1 function and integrates with ABA signaling, is required for the regulation of expression of the presence of high NH4 + levels. © 2012 American Society of Plant Biologists. All Rights Reserved.

  10. Arabidopsis plastid AMOS1/EGY1 integrates abscisic acid signaling to regulate global gene expression response to ammonium stress

    KAUST Repository

    Li, Baohai; Li, Qing; Xiong, Liming; Kronzucker, Herbert J.; Krä mer, Ute; Shi, Weiming

    2012-01-01

    Ammonium (NH4 +) is a ubiquitous intermediate of nitrogen metabolism but is notorious for its toxic effects on most organisms. Extensive studies of the underlying mechanisms of NH4 + toxicity have been reported in plants, but it is poorly understood how plants acclimate to high levels of NH4 +. Here, we identified an Arabidopsis (Arabidopsis thaliana) mutant, ammonium overly sensitive1 (amos1), that displays severe chlorosis under NH4 + stress. Map-based cloning shows amos1 to carry a mutation in EGY1 (for ethylene-dependent, gravitropism-deficient, and yellow-green-like protein1), which encodes a plastid metalloprotease. Transcriptomic analysis reveals that among the genes activated in response to NH4 +, 90% are regulated dependent on AMOS1/ EGY1. Furthermore, 63% of AMOS1/EGY1-dependent NH4 +-activated genes contain an ACGTG motif in their promoter region, a core motif of abscisic acid (ABA)-responsive elements. Consistent with this, our physiological, pharmacological, transcriptomic, and genetic data show that ABA signaling is a critical, but not the sole, downstream component of the AMOS1/EGY1-dependent pathway that regulates the expression of NH4 +-responsive genes and maintains chloroplast functionality under NH4 + stress. Importantly, abi4 mutants defective in ABA-dependent and retrograde signaling, but not ABA-deficient mutants, mimic leaf NH4 + hypersensitivity of amos1. In summary, our findings suggest that an NH4 +-responsive plastid retrograde pathway, which depends on AMOS1/EGY1 function and integrates with ABA signaling, is required for the regulation of expression of the presence of high NH4 + levels. © 2012 American Society of Plant Biologists. All Rights Reserved.

  11. Constitutive Transcription and Stable RNA Accumulation in Plastids during the Conversion of Chloroplasts to Chromoplasts in Ripening Tomato Fruits 1

    Science.gov (United States)

    Marano, María Rosa; Carrillo, Néstor

    1992-01-01

    The size distribution of plastid transcripts during chromoplast differentiation in ripening tomato (Lycopersicon esculentum L.) fruits was determined using northern blot analysis. Hybridization of total cellular RNA from leaves and fruits with several tobacco chloroplast DNA probes showed distinct transcript patterns in chloroplasts and chromoplasts. We also compared transcriptional rates by probing immobilized DNA fragments of small size (representing about 85% of the plastid genome) with run-on transcripts from tomato plastids. The relative rates of transcription of the various DNA regions were very similar in chloro- and chromoplasts. Parallel determination of the steady-state levels of plastid RNA showed no strict correlation between synthesis rate and RNA accumulation. Differences in the relative abundance of transcripts between chloro- and chromoplasts were not very pronounced and were limited to a small number of genes. The results indicate that the conversion of chloroplasts to chromoplasts at the onset of tomato fruit ripening proceeds with no important variations in the relative transcription rates and with only moderate changes in the relative stability of plastid-encoded transcripts. Images Figure 1 Figure 4 PMID:16653091

  12. Split photosystem protein, linear-mapping topology, and growth of structural complexity in the plastid genome of chromera velia

    KAUST Repository

    Janouškovec, Jan

    2013-08-22

    The canonical photosynthetic plastid genomes consist of a single circular-mapping chromosome that encodes a highly conserved protein core, involved in photosynthesis and ATP generation. Here, we demonstrate that the plastid genome of the photosynthetic relative of apicomplexans, Chromera velia, departs from this view in several unique ways. Core photosynthesis proteins PsaA and AtpB have been broken into two fragments, which we show are independently transcribed, oligoU-tailed, translated, and assembled into functional photosystem I and ATP synthase complexes. Genome-wide transcription profiles support expression of many other highly modified proteins, including several that contain extensions amounting to hundreds of amino acids in length. Canonical gene clusters and operons have been fragmented and reshuffled into novel putative transcriptional units. Massive genomic coverage by paired-end reads, coupled with pulsed-field gel electrophoresis and polymerase chain reaction, consistently indicate that the C. velia plastid genome is linear-mapping, a unique state among all plastids. Abundant intragenomic duplication probably mediated by recombination can explain protein splits, extensions, and genome linearization and is perhaps the key driving force behind the many features that defy the conventional ways of plastid genome architecture and function. © The Author 2013.

  13. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  14. Rate variation in parasitic plants: correlated and uncorrelated patterns among plastid genes of different function

    Directory of Open Access Journals (Sweden)

    dePamphilis Claude W

    2005-02-01

    Full Text Available Abstract Background The analysis of synonymous and nonsynonymous rates of DNA change can help in the choice among competing explanations for rate variation, such as differences in constraint, mutation rate, or the strength of genetic drift. Nonphotosynthetic plants of the Orobanchaceae have increased rates of DNA change. In this study 38 taxa of Orobanchaceae and relatives were used and 3 plastid genes were sequenced for each taxon. Results Phylogenetic reconstructions of relative rates of sequence evolution for three plastid genes (rbcL, matK and rps2 show significant rate heterogeneity among lineages and among genes. Many of the non-photosynthetic plants have increases in both synonymous and nonsynonymous rates, indicating that both (1 selection is relaxed, and (2 there has been a change in the rate at which mutations are entering the population in these species. However, rate increases are not always immediate upon loss of photosynthesis. Overall there is a poor correlation of synonymous and nonsynonymous rates. There is, however, a strong correlation of synonymous rates across the 3 genes studied and the lineage-speccific pattern for each gene is strikingly similar. This indicates that the causes of synonymous rate variation are affecting the whole plastid genome in a similar way. There is a weaker correlation across genes for nonsynonymous rates. Here the picture is more complex, as could be expected if there are many causes of variation, differing from taxon to taxon and gene to gene. Conclusions The distinctive pattern of rate increases in Orobanchaceae has at least two causes. It is clear that there is a relaxation of constraint in many (though not all non-photosynthetic lineages. However, there is also some force affecting synonymous sites as well. At this point, it is not possible to tell whether it is generation time, speciation rate, mutation rate, DNA repair efficiency or some combination of these factors.

  15. Cytosolic monoterpene biosynthesis is supported by plastid-generated geranyl diphosphate substrate in transgenic tomato fruits.

    Science.gov (United States)

    Gutensohn, Michael; Orlova, Irina; Nguyen, Thuong T H; Davidovich-Rikanati, Rachel; Ferruzzi, Mario G; Sitrit, Yaron; Lewinsohn, Efraim; Pichersky, Eran; Dudareva, Natalia

    2013-08-01

    Geranyl diphosphate (GPP), the precursor of most monoterpenes, is synthesized in plastids from dimethylallyl diphosphate and isopentenyl diphosphate by GPP synthases (GPPSs). In heterodimeric GPPSs, a non-catalytic small subunit (GPPS-SSU) interacts with a catalytic large subunit, such as geranylgeranyl diphosphate synthase, and determines its product specificity. Here, snapdragon (Antirrhinum majus) GPPS-SSU was over-expressed in tomato fruits under the control of the fruit ripening-specific polygalacturonase promoter to divert the metabolic flux from carotenoid formation towards GPP and monoterpene biosynthesis. Transgenic tomato fruits produced monoterpenes, including geraniol, geranial, neral, citronellol and citronellal, while exhibiting reduced carotenoid content. Co-expression of the Ocimum basilicum geraniol synthase (GES) gene with snapdragon GPPS-SSU led to a more than threefold increase in monoterpene formation in tomato fruits relative to the parental GES line, indicating that the produced GPP can be used by plastidic monoterpene synthases. Co-expression of snapdragon GPPS-SSU with the O. basilicum α-zingiberene synthase (ZIS) gene encoding a cytosolic terpene synthase that has been shown to possess both sesqui- and monoterpene synthase activities resulted in increased levels of ZIS-derived monoterpene products compared to fruits expressing ZIS alone. These results suggest that re-direction of the metabolic flux towards GPP in plastids also increases the cytosolic pool of GPP available for monoterpene synthesis in this compartment via GPP export from plastids. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  16. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  17. The complete plastome of macaw palm [Acrocomia aculeata (Jacq.) Lodd. ex Mart.] and extensive molecular analyses of the evolution of plastid genes in Arecaceae.

    Science.gov (United States)

    de Santana Lopes, Amanda; Gomes Pacheco, Túlio; Nimz, Tabea; do Nascimento Vieira, Leila; Guerra, Miguel P; Nodari, Rubens O; de Souza, Emanuel Maltempi; de Oliveira Pedrosa, Fábio; Rogalski, Marcelo

    2018-04-01

    The plastome of macaw palm was sequenced allowing analyses of evolution and molecular markers. Additionally, we demonstrated that more than half of plastid protein-coding genes in Arecaceae underwent positive selection. Macaw palm is a native species from tropical and subtropical Americas. It shows high production of oil per hectare reaching up to 70% of oil content in fruits and an interesting plasticity to grow in different ecosystems. Its domestication and breeding are still in the beginning, which makes the development of molecular markers essential to assess natural populations and germplasm collections. Therefore, we sequenced and characterized in detail the plastome of macaw palm. A total of 221 SSR loci were identified in the plastome of macaw palm. Additionally, eight polymorphism hotspots were characterized at level of subfamily and tribe. Moreover, several events of gain and loss of RNA editing sites were found within the subfamily Arecoideae. Aiming to uncover evolutionary events in Arecaceae, we also analyzed extensively the evolution of plastid genes. The analyses show that highly divergent genes seem to evolve in a species-specific manner, suggesting that gene degeneration events may be occurring within Arecaceae at the level of genus or species. Unexpectedly, we found that more than half of plastid protein-coding genes are under positive selection, including genes for photosynthesis, gene expression machinery and other essential plastid functions. Furthermore, we performed a phylogenomic analysis using whole plastomes of 40 taxa, representing all subfamilies of Arecaceae, which placed the macaw palm within the tribe Cocoseae. Finally, the data showed here are important for genetic studies in macaw palm and provide new insights into the evolution of plastid genes and environmental adaptation in Arecaceae.

  18. The plastid genome of Najas flexilis: adaptation to submersed environments is accompanied by the complete loss of the NDH complex in an aquatic angiosperm.

    Directory of Open Access Journals (Sweden)

    Elena L Peredo

    Full Text Available The re-colonization of aquatic habitats by angiosperms has presented a difficult challenge to plants whose long evolutionary history primarily reflects adaptations to terrestrial conditions. Many aquatics must complete vital stages of their life cycle on the water surface by means of floating or emergent leaves and flowers. Only a few species, mainly within the order Alismatales, are able to complete all aspects of their life cycle including pollination, entirely underwater. Water-pollinated Alismatales include seagrasses and water nymphs (Najas, the latter being the only freshwater genus in the family Hydrocharitaceae with subsurface water-pollination. We have determined the complete nucleotide sequence of the plastid genome of Najas flexilis. The plastid genome of N. flexilis is a circular AT-rich DNA molecule of 156 kb, which displays a quadripartite structure with two inverted repeats (IR separating the large single copy (LSC from the small single copy (SSC regions. In N. flexilis, as in other Alismatales, the rps19 and trnH genes are localized in the LSC region instead of within the IR regions as in other monocots. However, the N. flexilis plastid genome presents some anomalous modifications. The size of the SSC region is only one third of that reported for closely related species. The number of genes in the plastid is considerably less. Both features are due to loss of the eleven ndh genes in the Najas flexilis plastid. In angiosperms, the absence of ndh genes has been related mainly to the loss of photosynthetic function in parasitic plants. The ndh genes encode the NAD(PH dehydrogenase complex, believed essential in terrestrial environments, where it increases photosynthetic efficiency in variable light intensities. The modified structure of the N. flexilis plastid genome suggests that adaptation to submersed environments, where light is scarce, has involved the loss of the NDH complex in at least some photosynthetic angiosperms.

  19. Stable plastid transformation in Scoparia dulcis L.

    Science.gov (United States)

    Muralikrishna, Narra; Srinivas, Kota; Kumar, Kalva Bharath; Sadanandam, Abbagani

    2016-10-01

    In the present investigation we report stable plastid transformation in Scoparia dulcis L., a versatile medicinal herb via particle gun method. The vector KNTc, harbouring aadA as a selectable marker and egfp as a reporter gene which were under the control of synthetic promoter pNG1014a, targets inverted repeats, trnR / t rnN of the plastid genome. By use of this heterologous vector, recovery of transplastomic lines with suitable selection protocol have been successfully established with overall efficiency of two transgenic lines for 25 bombarded leaf explants. PCR and Southern blot analysis demonstrated stable integration of foreign gene into the target sequences. The results represent a significant advancement of the plastid transformation technology in medicinal plants, which relevantly implements a change over in enhancing and regulating of certain metabolic pathways.

  20. Transcriptional regulation and DNA methylation in plastids during transitional conversion of chloroplasts to chromoplasts.

    OpenAIRE

    Kobayashi, H; Ngernprasirtsiri, J; Akazawa, T

    1990-01-01

    During transitional conversion of chloroplasts to chromoplasts in ripening tomato (Lycopersicon esculentum) fruits, transcripts for several plastid genes for photosynthesis decreased to undetectable levels. Run-on transcription of plastids indicated that transcriptional regulation operated as a predominant factor. We found that most of the genes in chloroplasts were actively transcribed in vitro by Escherichia coli and soluble plastid RNA polymerases, but some genes in chromoplasts seemed to ...

  1. Production Of Cellulase In Plastids Of Transgenic Plants

    Science.gov (United States)

    Lamppa, Gayle

    2002-08-06

    A genetic construct encoding a fusion protein including endogluconase E1 and a transit peptide is used to transform plants. The plants produce cellulase by expressing the genetic construct. The cellulase is targeted to plastids and can be collected and purified.

  2. Rapid and accurate pyrosequencing of angiosperm plastid genomes

    Science.gov (United States)

    Moore, Michael J; Dhingra, Amit; Soltis, Pamela S; Shaw, Regina; Farmerie, William G; Folta, Kevin M; Soltis, Douglas E

    2006-01-01

    Background Plastid genome sequence information is vital to several disciplines in plant biology, including phylogenetics and molecular biology. The past five years have witnessed a dramatic increase in the number of completely sequenced plastid genomes, fuelled largely by advances in conventional Sanger sequencing technology. Here we report a further significant reduction in time and cost for plastid genome sequencing through the successful use of a newly available pyrosequencing platform, the Genome Sequencer 20 (GS 20) System (454 Life Sciences Corporation), to rapidly and accurately sequence the whole plastid genomes of the basal eudicot angiosperms Nandina domestica (Berberidaceae) and Platanus occidentalis (Platanaceae). Results More than 99.75% of each plastid genome was simultaneously obtained during two GS 20 sequence runs, to an average depth of coverage of 24.6× in Nandina and 17.3× in Platanus. The Nandina and Platanus plastid genomes shared essentially identical gene complements and possessed the typical angiosperm plastid structure and gene arrangement. To assess the accuracy of the GS 20 sequence, over 45 kilobases of sequence were generated for each genome using conventional sequencing. Overall error rates of 0.043% and 0.031% were observed in GS 20 sequence for Nandina and Platanus, respectively. More than 97% of all observed errors were associated with homopolymer runs, with ~60% of all errors associated with homopolymer runs of 5 or more nucleotides and ~50% of all errors associated with regions of extensive homopolymer runs. No substitution errors were present in either genome. Error rates were generally higher in the single-copy and noncoding regions of both plastid genomes relative to the inverted repeat and coding regions. Conclusion Highly accurate and essentially complete sequence information was obtained for the Nandina and Platanus plastid genomes using the GS 20 System. More importantly, the high accuracy observed in the GS 20 plastid

  3. Rapid and accurate pyrosequencing of angiosperm plastid genomes

    Directory of Open Access Journals (Sweden)

    Farmerie William G

    2006-08-01

    Full Text Available Abstract Background Plastid genome sequence information is vital to several disciplines in plant biology, including phylogenetics and molecular biology. The past five years have witnessed a dramatic increase in the number of completely sequenced plastid genomes, fuelled largely by advances in conventional Sanger sequencing technology. Here we report a further significant reduction in time and cost for plastid genome sequencing through the successful use of a newly available pyrosequencing platform, the Genome Sequencer 20 (GS 20 System (454 Life Sciences Corporation, to rapidly and accurately sequence the whole plastid genomes of the basal eudicot angiosperms Nandina domestica (Berberidaceae and Platanus occidentalis (Platanaceae. Results More than 99.75% of each plastid genome was simultaneously obtained during two GS 20 sequence runs, to an average depth of coverage of 24.6× in Nandina and 17.3× in Platanus. The Nandina and Platanus plastid genomes shared essentially identical gene complements and possessed the typical angiosperm plastid structure and gene arrangement. To assess the accuracy of the GS 20 sequence, over 45 kilobases of sequence were generated for each genome using conventional sequencing. Overall error rates of 0.043% and 0.031% were observed in GS 20 sequence for Nandina and Platanus, respectively. More than 97% of all observed errors were associated with homopolymer runs, with ~60% of all errors associated with homopolymer runs of 5 or more nucleotides and ~50% of all errors associated with regions of extensive homopolymer runs. No substitution errors were present in either genome. Error rates were generally higher in the single-copy and noncoding regions of both plastid genomes relative to the inverted repeat and coding regions. Conclusion Highly accurate and essentially complete sequence information was obtained for the Nandina and Platanus plastid genomes using the GS 20 System. More importantly, the high accuracy

  4. Complete sequence and analysis of plastid genomes of two economically important red algae: Pyropia haitanensis and Pyropia yezoensis.

    Directory of Open Access Journals (Sweden)

    Li Wang

    Full Text Available Pyropia haitanensis and P. yezoensis are two economically important marine crops that are also considered to be research models to study the physiological ecology of intertidal seaweed communities, evolutionary biology of plastids, and the origins of sexual reproduction. This plastid genome information will facilitate study of breeding, population genetics and phylogenetics.We have fully sequenced using next-generation sequencing the circular plastid genomes of P. hatanensis (195,597 bp and P. yezoensis (191,975 bp, the largest of all the plastid genomes of the red lineage sequenced to date. Organization and gene contents of the two plastids were similar, with 211-213 protein-coding genes (including 29-31 unknown-function ORFs, 37 tRNA genes, and 6 ribosomal RNA genes, suggesting a largest coding capacity in the red lineage. In each genome, 14 protein genes overlapped and no interrupted genes were found, indicating a high degree of genomic condensation. Pyropia maintain an ancient gene content and conserved gene clusters in their plastid genomes, containing nearly complete repertoires of the plastid genes known in photosynthetic eukaryotes. Similarity analysis based on the whole plastid genome sequences showed the distance between P. haitanensis and P. yezoensis (0.146 was much smaller than that of Porphyra purpurea and P. haitanensis (0.250, and P. yezoensis (0.251; this supports re-grouping the two species in a resurrected genus Pyropia while maintaining P. purpurea in genus Porphyra. Phylogenetic analysis supports a sister relationship between Bangiophyceae and Florideophyceae, though precise phylogenetic relationships between multicellular red alage and chromists were not fully resolved.These results indicate that Pyropia have compact plastid genomes. Large coding capacity and long intergenic regions contribute to the size of the largest plastid genomes reported for the red lineage. Possessing the largest coding capacity and ancient gene

  5. [Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

    Science.gov (United States)

    Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

    2008-01-01

    The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

  6. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  7. RNase P RNA from the Recently Evolved Plastid of Paulinella and from Algae

    Directory of Open Access Journals (Sweden)

    Pilar Bernal-Bayard

    2014-11-01

    Full Text Available The RNase P RNA catalytic subunit (RPR encoded in some plastids has been found to be functionally defective. The amoeba Paulinella chromatophora contains an organelle (chromatophore that is derived from the recent endosymbiotic acquisition of a cyanobacterium, and therefore represents a model of the early steps in the acquisition of plastids. In contrast with plastid RPRs the chromatophore RPR retains functionality similar to the cyanobacterial enzyme. The chromatophore RPR sequence deviates from consensus at some positions but those changes allow optimal activity compared with mutated chromatophore RPR with the consensus sequence. We have analyzed additional RPR sequences identifiable in plastids and have found that it is present in all red algae and in several prasinophyte green algae. We have assayed in vitro a subset of the plastid RPRs not previously analyzed and confirm that these organelle RPRs lack RNase P activity in vitro.

  8. Phylogenetic Analysis of Nucleus-Encoded Acetyl-CoA Carboxylases Targeted at the Cytosol and Plastid of Algae.

    KAUST Repository

    Huerlimann, Roger; Zenger, Kyall R; Jerry, Dean R; Heimann, Kirsten

    2015-01-01

    as Chromalveolata, forming the red lineage. However, recent genetic evidence groups the Stramenopiles, Alveolata and green plastid containing Rhizaria as SAR, excluding Haptophyta and Cryptophyta. Sequences coding for plastid and cytosol targeted homomeric ACCases

  9. Instability of plastid DNA in the nuclear genome.

    Directory of Open Access Journals (Sweden)

    Anna E Sheppard

    2009-01-01

    Full Text Available Functional gene transfer from the plastid (chloroplast and mitochondrial genomes to the nucleus has been an important driving force in eukaryotic evolution. Non-functional DNA transfer is far more frequent, and the frequency of such transfers from the plastid to the nucleus has been determined experimentally in tobacco using transplastomic lines containing, in their plastid genome, a kanamycin resistance gene (neo readymade for nuclear expression. Contrary to expectations, non-Mendelian segregation of the kanamycin resistance phenotype is seen in progeny of some lines in which neo has been transferred to the nuclear genome. Here, we provide a detailed analysis of the instability of kanamycin resistance in nine of these lines, and we show that it is due to deletion of neo. Four lines showed instability with variation between progeny derived from different areas of the same plant, suggesting a loss of neo during somatic cell division. One line showed a consistent reduction in the proportion of kanamycin-resistant progeny, suggesting a loss of neo during meiosis, and the remaining four lines were relatively stable. To avoid genomic enlargement, the high frequency of plastid DNA integration into the nuclear genome necessitates a counterbalancing removal process. This is the first demonstration of such loss involving a high proportion of recent nuclear integrants. We propose that insertion, deletion, and rearrangement of plastid sequences in the nuclear genome are important evolutionary processes in the generation of novel nuclear genes. This work is also relevant in the context of transgenic plant research and crop production, because similar processes to those described here may be involved in the loss of plant transgenes.

  10. PEP activity and expression of photosynthesis genes required for embryo and seed development in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Dmitry eKremnev

    2014-08-01

    Full Text Available Chloroplast biogenesis and function is essential for proper plant embryo and seed development but the molecular mechanisms underlying the role of plastids during embryogenesis are poorly understood. Expression of plastid encoded genes is dependent on two different transcription machineries; a plastid-encoded bacterial-type RNA polymerase (PEP and a nuclear-encoded phage-type RNA polymerase (NEP, which recognize distinct types of promoters. However, the division of labor between PEP and NEP during plastid development and in mature chloroplasts is unclear. We show here that PRIN2 and CSP41b, two proteins identified in plastid nucleoid preparations, are essential for proper plant embryo development. Using Co-IP assays and native PAGE we have shown a direct physical interaction between PRIN2 and CSP41b. Moreover, PRIN2 and CSP41b form a distinct protein complex in vitro that binds DNA. The prin2.2 and csp41b-2 single mutants displayed pale phenotypes, abnormal chloroplasts with reduced transcript levels of photosynthesis genes and defects in embryo development. The respective csp41b-2prin2.2 homo/heterozygote double mutants produced abnormal white colored ovules and shrunken seeds. Thus, the csp41b-2prin2.2 double mutant is embryo lethal. In silico analysis of available array data showed that a large number of genes traditionally classified as PEP dependent genes are transcribed during early embryo development from the pre-globular stage to the mature-green-stage. Taken together, our results suggest that PEP activity and consequently the switch from NEP to PEP activity, is essential during embryo development and that the PRIN2-CSP41b DNA binding protein complex possibly is important for full PEP activity during this process.

  11. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  12. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Directory of Open Access Journals (Sweden)

    Xiao Li Shi

    Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  13. Plastid and mitochondrial genomes of Coccophora langsdorfii (Fucales, Phaeophyceae and the utility of molecular markers.

    Directory of Open Access Journals (Sweden)

    Louis Graf

    Full Text Available Coccophora langsdorfii (Turner Greville (Fucales is an intertidal brown alga that is endemic to Northeast Asia and increasingly endangered by habitat loss and climate change. We sequenced the complete circular plastid and mitochondrial genomes of C. langsdorfii. The circular plastid genome is 124,450 bp and contains 139 protein-coding, 28 tRNA and 6 rRNA genes. The circular mitochondrial genome is 35,660 bp and contains 38 protein-coding, 25 tRNA and 3 rRNA genes. The structure and gene content of the C. langsdorfii plastid genome is similar to those of other species in the Fucales. The plastid genomes of brown algae in other orders share similar gene content but exhibit large structural recombination. The large in-frame insert in the cox2 gene in the mitochondrial genome of C. langsdorfii is typical of other brown algae. We explored the effect of this insertion on the structure and function of the cox2 protein. We estimated the usefulness of 135 plastid genes and 35 mitochondrial genes for developing molecular markers. This study shows that 29 organellar genes will prove efficient for resolving brown algal phylogeny. In addition, we propose a new molecular marker suitable for the study of intraspecific genetic diversity that should be tested in a large survey of populations of C. langsdorfii.

  14. Plastids and Carotenoid Accumulation.

    Science.gov (United States)

    Li, Li; Yuan, Hui; Zeng, Yunliu; Xu, Qiang

    Plastids are ubiquitously present in plants and are the organelles for carotenoid biosynthesis and storage. Based on their morphology and function, plastids are classified into various types, i.e. proplastids, etioplasts, chloroplasts, amyloplasts, and chromoplasts. All plastids, except proplastids, can synthesize carotenoids. However, plastid types have a profound effect on carotenoid accumulation and stability. In this chapter, we discuss carotenoid biosynthesis and regulation in various plastids with a focus on carotenoids in chromoplasts. Plastid transition related to carotenoid biosynthesis and the different capacity of various plastids to sequester carotenoids and the associated effect on carotenoid stability are described in light of carotenoid accumulation in plants.

  15. Transcriptional regulation and DNA methylation in plastids during transitional conversion of chloroplasts to chromoplasts.

    Science.gov (United States)

    Kobayashi, H; Ngernprasirtsiri, J; Akazawa, T

    1990-01-01

    During transitional conversion of chloroplasts to chromoplasts in ripening tomato (Lycopersicon esculentum) fruits, transcripts for several plastid genes for photosynthesis decreased to undetectable levels. Run-on transcription of plastids indicated that transcriptional regulation operated as a predominant factor. We found that most of the genes in chloroplasts were actively transcribed in vitro by Escherichia coli and soluble plastid RNA polymerases, but some genes in chromoplasts seemed to be silent when assayed by the in vitro systems. The regulatory step, therefore, was ascribed to DNA templates. The analysis of modified base composition revealed the presence of methylated bases in chromoplast DNA, in which 5-methylcytosine was most abundant. The presence of 5-methylcytosine detected by isoschizomeric endonucleases and Southern hybridization was correlated with the undetectable transcription activity of each gene in the run-on assay and in vitro transcription experiments. It is thus concluded that the suppression of transcription mediated by DNA methylation is one of the mechanisms governing gene expression in plastids converting from chloroplasts to chromoplasts. Images Fig. 1 Fig. 2 Fig. 3. Fig. 4. Fig. 5. PMID:2303026

  16. Plastid transformation in the monocotyledonous cereal crop, rice (Oryza sativa) and transmission of transgenes to their progeny.

    Science.gov (United States)

    Lee, Sa Mi; Kang, Kyungsu; Chung, Hyungsup; Yoo, Soon Hee; Xu, Xiang Ming; Lee, Seung-Bum; Cheong, Jong-Joo; Daniell, Henry; Kim, Minkyun

    2006-06-30

    The plastid transformation approach offers a number of unique advantages, including high-level transgene expression, multi-gene engineering, transgene containment, and a lack of gene silencing and position effects. The extension of plastid transformation technology to monocotyledonous cereal crops, including rice, bears great promise for the improvement of agronomic traits, and the efficient production of pharmaceutical or nutritional enhancement. Here, we report a promising step towards stable plastid transformation in rice. We produced fertile transplastomic rice plants and demonstrated transmission of the plastid-expressed green fluorescent protein (GFP) and aminoglycoside 3'-adenylyltransferase genes to the progeny of these plants. Transgenic chloroplasts were determined to have stably expressed the GFP, which was confirmed by both confocal microscopy and Western blot analyses. Although the produced rice plastid transformants were found to be heteroplastomic, and the transformation efficiency requires further improvement, this study has established a variety of parameters for the use of plastid transformation technology in cereal crops.

  17. Trans-splicing of plastid rps12 transcripts, mediated by AtPPR4, is essential for embryo patterning in Arabidopsis thaliana.

    Science.gov (United States)

    Tadini, Luca; Ferrari, Roberto; Lehniger, Marie-Kristin; Mizzotti, Chiara; Moratti, Fabio; Resentini, Francesca; Colombo, Monica; Costa, Alex; Masiero, Simona; Pesaresi, Paolo

    2018-04-23

    AtPPR4-mediated trans-splicing of plastid rps12 transcripts is essential for key embryo morphogenetic events such as development of cotyledons, determination of provascular tissue, and organization of the shoot apical meristem (SAM), but not for the formation of the protodermal layer. Members of the pentatricopeptide repeat (PPR) containing protein family have emerged as key regulators of the organelle post-transcriptional processing and to be essential for proper plant embryo development. In this study, we report the functional characterization of the AtPPR4 (At5g04810) gene encoding a plastid nucleoid PPR protein. In-situ hybridization analysis reveals the presence of AtPPR4 transcripts already at the transition stage of embryo development. As a consequence, embryos lacking the AtPPR4 protein arrest their development at the transition/early-heart stages and show defects in the determination of the provascular tissue and organization of SAM. This complex phenotype is due to the specific role of AtPPR4 in the trans-splicing of the plastid rps12 transcripts, as shown by northern and slot-blot hybridizations, and the consequent defect in 70S ribosome accumulation and plastid protein synthesis, in agreement with the role proposed for the maize orthologue, ZmPPR4.

  18. A plastid gene phylogeny of the non-photosynthetic parasitic Orobanche (Orobanchaceae) and related genera.

    Science.gov (United States)

    Park, Jeong-Mi; Manen, Jean-François; Colwell, Alison E; Schneeweiss, Gerald M

    2008-07-01

    The phylogenetic relationships of the non-photosynthetic Orobanche sensu lato (Orobanchaceae), which includes some of the economically most important parasitic weeds, remain insufficiently understood and controversial. This concerns both the phylogenetic relationships within the genus, in particular its monophyly or lack thereof, and the relationships to other holoparasitic genera such as Cistanche or Conopholis. Here we present the first comprehensive phylogenetic study of this group based on a region from the plastid genome (rps2 gene). Although substitution rates appear to be elevated compared to the photosynthetic members of Orobanchaceae, relationships among the major lineages Cistanche, Conopholis plus Epifagus, Boschniakia rossica (Cham. & Schltdl.) B. Fedtsch., B. himalaica Hook. f. & Thomson, B. hookeri Walp. plus B. strobilacea A. Gray, and Orobanche s. l. remain unresolved. Resolution within Orobanche, however, is much better. In agreement with morphological, cytological and other molecular phylogenetic evidence, five lineages, corresponding to the four traditionally recognised sections (Gymnocaulis, Myzorrhiza, Orobanche, Trionychon) and O. latisquama Reut. ex Boiss. (of sect. Orobanche), can be distinguished. A combined analysis of plastid rps2 and nuclear ITS sequences of the holoparasitic genera results in more resolved and better supported trees, although the relationships among Orobanche s. l., Cistanche, and the clade including the remaining genera is unresolved. Therefore, rps2 is a marker from the plastid genome that is well-suited to be used in combination with other already established nuclear markers for resolving generic relationships of Orobanche and related genera.

  19. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  20. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  1. Complete plastid genome sequence of Daucus carota: implications for biotechnology and phylogeny of angiosperms.

    Science.gov (United States)

    Ruhlman, Tracey; Lee, Seung-Bum; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry

    2006-08-31

    Carrot (Daucus carota) is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats > or = 30 bp with a sequence identity > or = 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP) and maximum likelihood (ML) were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap) for the sister relationship of Daucus with Panax in the euasterid II clade. These

  2. Complete plastid genome sequence of Daucus carota: Implications for biotechnology and phylogeny of angiosperms

    Directory of Open Access Journals (Sweden)

    Ruhlman Tracey

    2006-08-01

    Full Text Available Abstract Background Carrot (Daucus carota is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. Results The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats ≥ 30 bp with a sequence identity ≥ 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP and maximum likelihood (ML were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. Conclusion The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap for the sister relationship of

  3. A plastid gene phylogeny of the non-photosynthetic parasitic Orobanche (Orobanchaceae) and related genera

    Science.gov (United States)

    Park, J.-M.; Manen, J.-F.; Colwell, A.E.; Schneeweiss, G.M.

    2008-01-01

    The phylogenetic relationships of the non-photosynthetic Orobanche sensu lato (Orobanchaceae), which includes some of the economically most important parasitic weeds, remain insufficiently understood and controversial. This concerns both the phylogenetic relationships within the genus, in particular its monophyly or lack thereof, and the relationships to other holoparasitic genera such as Cistanche or Conopholis. Here we present the first comprehensive phylogenetic study of this group based on a region from the plastid genome (rps2 gene). Although substitution rates appear to be elevated compared to the photosynthetic members of Orobanchaceae, relationships among the major lineages Cistanche, Conopholis plus Epifagus, Boschniakia rossica (Cham. & Schltdl.) B. Fedtsch., B. himalaica Hook. f. & Thomson, B. hookeri Walp. plus B. strobilacea A. Gray, and Orobanche s. l. remain unresolved. Resolution within Orobanche, however, is much better. In agreement with morphological, cytological and other molecular phylogenetic evidence, five lineages, corresponding to the four traditionally recognised sections (Gymnocaulis, Myzorrhiza, Orobanche, Trionychon) and O. latisquama Reut. ex Boiss. (of sect. Orobanche), can be distinguished. A combined analysis of plastid rps2 and nuclear ITS sequences of the holoparasitic genera results in more resolved and better supported trees, although the relationships among Orobanche s. l., Cistanche, and the clade including the remaining genera is unresolved. Therefore, rps2 is a marker from the plastid genome that is well-suited to be used in combination with other already established nuclear markers for resolving generic relationships of Orobanche and related genera. ?? 2008 The Botanical Society of Japan and Springer.

  4. Does the mode of plastid inheritance influence plastid genome architecture?

    Directory of Open Access Journals (Sweden)

    Kate Crosby

    Full Text Available Plastid genomes show an impressive array of sizes and compactnesses, but the forces responsible for this variation are unknown. It has been argued that species with small effective genetic population sizes are less efficient at purging excess DNA from their genomes than those with large effective population sizes. If true, one may expect the primary mode of plastid inheritance to influence plastid DNA (ptDNA architecture. All else being equal, biparentally inherited ptDNAs should have a two-fold greater effective population size than those that are uniparentally inherited, and thus should also be more compact. Here, we explore the relationship between plastid inheritance pattern and ptDNA architecture, and consider the role of phylogeny in shaping our observations. Contrary to our expectations, we found no significant difference in plastid genome size or compactness between ptDNAs that are biparentally inherited relative to those that are uniparentally inherited. However, we also found that there was significant phylogenetic signal for the trait of mode of plastid inheritance. We also found that paternally inherited ptDNAs are significantly smaller (n = 19, p = 0.000001 than those that are maternally, uniparentally (when isogamous, or biparentally inherited. Potential explanations for this observation are discussed.

  5. Chloroplast genes are expressed during intracellular symbiotic association of Vaucheria litorea plastids with the sea slug Elysia chlorotica.

    Science.gov (United States)

    Mujer, C V; Andrews, D L; Manhart, J R; Pierce, S K; Rumpho, M E

    1996-10-29

    The marine slug Elysia chlorotica (Gould) forms an intracellular symbiosis with photosynthetically active chloroplasts from the chromophytic alga Vaucheria litorea (C. Agardh). This symbiotic association was characterized over a period of 8 months during which E. chlorotica was deprived of V. litorea but provided with light and CO2. The fine structure of the symbiotic chloroplasts remained intact in E. chlorotica even after 8 months of starvation as revealed by electron microscopy. Southern blot analysis of total DNA from E. chlorotica indicated that algal genes, i.e., rbcL, rbcS, psaB, psbA, and 16S rRNA are present in the animal. These genes are typically localized to the plastid genome in higher plants and algae except rbcS, which is nuclear-encoded in higher plants and green (chlorophyll a/b) algae. Our analysis suggests, however, that similar to the few other chromophytes (chlorophyll a/c) examined, rbcS is chloroplast encoded in V. litorea. Levels of psbA transcripts remained constant in E. chlorotica starved for 2 and 3 months and then gradually declined over the next 5 months corresponding with senescence of the animal in culture and in nature. The RNA synthesis inhibitor 6-methylpurine reduced the accumulation of psbA transcripts confirming active transcription. In contrast to psbA, levels of 16S rRNA transcripts remained constant throughout the starvation period. The levels of the photosystem II proteins, D1 and CP43, were high at 2 and 4 months of starvation and remained constant at a lower steady-state level after 6 months. In contrast, D2 protein levels, although high at 2 and 4 months, were very low at all other periods of starvation. At 8 months, de novo synthesis of several thylakoid membrane-enriched proteins, including D1, still occurred. To our knowledge, these results represent the first molecular evidence for active transcription and translation of algal chloroplast genes in an animal host and are discussed in relation to the endosymbiotic

  6. High Expression of Cry1Ac Protein in Cotton (Gossypium hirsutum by Combining Independent Transgenic Events that Target the Protein to Cytoplasm and Plastids.

    Directory of Open Access Journals (Sweden)

    Amarjeet Kumar Singh

    Full Text Available Transgenic cotton was developed using two constructs containing a truncated and codon-modified cry1Ac gene (1,848 bp, which was originally characterized from Bacillus thuringiensis subspecies kurstaki strain HD73 that encodes a toxin highly effective against many lepidopteran pests. In Construct I, the cry1Ac gene was cloned under FMVde, a strong constitutively expressing promoter, to express the encoded protein in the cytoplasm. In Construct II, the encoded protein was directed to the plastids using a transit peptide taken from the cotton rbcSIb gene. Genetic transformation experiments with Construct I resulted in a single copy insertion event in which the Cry1Ac protein expression level was 2-2.5 times greater than in the Bacillus thuringiensis cotton event Mon 531, which is currently used in varieties and hybrids grown extensively in India and elsewhere. Another high expression event was selected from transgenics developed with Construct II. The Cry protein expression resulting from this event was observed only in the green plant parts. No transgenic protein expression was observed in the non-green parts, including roots, seeds and non-green floral tissues. Thus, leucoplasts may lack the mechanism to allow entry of a protein tagged with the transit peptide from a protein that is only synthesized in tissues containing mature plastids. Combining the two events through sexual crossing led to near additive levels of the toxin at 4-5 times the level currently used in the field. The two high expression events and their combination will allow for effective resistance management against lepidopteran insect pests, particularly Helicoverpa armigera, using a high dosage strategy.

  7. Contradiction between plastid gene transcription and function due to complex posttranscriptional splicing: an exemplary study of ycf15 function and evolution in angiosperms.

    Directory of Open Access Journals (Sweden)

    Chao Shi

    Full Text Available Plant chloroplast genes are usually co-transcribed while its posttranscriptional splicing is fairly complex and remains largely unsolved. On basis of sequencing the three complete Camellia (Theaceae chloroplast genomes for the first time, we comprehensively analyzed the evolutionary patterns of ycf15, a plastid gene quite paradoxical in terms of its function and evolution, along the inferred angiosperm phylogeny. Although many species in separate lineages including the three species reported here contained an intact ycf15 gene in their chloroplast genomes, the phylogenetic mixture of both intact and obviously disabled ycf15 genes imply that they are all non-functional. Both intracellular gene transfer (IGT and horizontal gene transfer (HGT failed to explain such distributional anomalies. While, transcriptome analyses revealed that ycf15 was transcribed as precursor polycistronic transcript which contained ycf2, ycf15 and antisense trnL-CAA. The transcriptome assembly was surprisingly found to cover near the complete Camellia chloroplast genome. Many non-coding regions including pseudogenes were mapped by multiple transcripts, indicating the generality of pseudogene transcriptions. Our results suggest that plastid DNA posttranscriptional splicing may involve complex cleavage of non-functional genes.

  8. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  9. A complete plastid phylogeny of Daucus – concordance to nuclear results, and markers necessary for phylogenetic resolution

    Science.gov (United States)

    Premise of study: Our purposes were to (1) obtain a well-resolved plastid counterpart to the 94 gene nuclear ortholog gene phylogeny of Arbizu et al. (2014, Amer. J. Bot. 101:1666-1685; and Syst. Bot., in press), and (2) to investigate various classes and numbers of plastid markers necessary for a c...

  10. The chloroplast min system functions differentially in two specific nongreen plastids in Arabidopsis thaliana.

    Science.gov (United States)

    Wang, Peng; Zhang, Jie; Su, Jianbin; Wang, Peng; Liu, Jun; Liu, Bing; Feng, Dongru; Wang, Jinfa; Wang, Hongbin

    2013-01-01

    The nongreen plastids, such as etioplasts, chromoplasts, etc., as well as chloroplasts, are all derived from proplastids in the meristem. To date, the Min system members in plants have been identified as regulators of FtsZ-ring placement, which are essential for the symmetrical division of chloroplasts. However, the regulation of FtsZ-ring placement in nongreen plastids is poorly understood. In this study, we investigated the division site placement of nongreen plastids by examining the etioplasts as representative in Arabidopsis Min system mutants. Surprisingly, the shape and number of etioplasts in cotyledons of arc3, arc11 and mcd1 mutants were similar to that observed in wild-type plants, whereas arc12 and parc6 mutants exhibited enlarged etioplasts that were reduced in number. In order to examine nongreen plastids in true leaves, we silenced the ALB3 gene in these Min system mutant backgrounds to produce immature chloroplasts without the thylakoidal network using virus induced gene silencing (VIGS). Interestingly, consistent with our observations in etioplasts, enlarged and fewer nongreen plastids were only detected in leaves of parc6 (VIGS-ALB3) and arc12 (VIGS-ALB3) plants. Further, the FtsZ-ring assembled properly at the midpoint in nongreen plastids of arc3, arc11 and mcd1 (VIGS-ALB3) plants, but organized into multiple rings in parc6 (VIGS-ALB3) and presented fragmented filaments in arc12 (VIGS-ALB3) plants, suggesting that division site placement in nongreen plastids requires fewer components of the plant Min system. Taken together, these results suggest that division site placement in nongreen plastids is different from that in chloroplasts.

  11. The chloroplast min system functions differentially in two specific nongreen plastids in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Peng Wang

    Full Text Available The nongreen plastids, such as etioplasts, chromoplasts, etc., as well as chloroplasts, are all derived from proplastids in the meristem. To date, the Min system members in plants have been identified as regulators of FtsZ-ring placement, which are essential for the symmetrical division of chloroplasts. However, the regulation of FtsZ-ring placement in nongreen plastids is poorly understood. In this study, we investigated the division site placement of nongreen plastids by examining the etioplasts as representative in Arabidopsis Min system mutants. Surprisingly, the shape and number of etioplasts in cotyledons of arc3, arc11 and mcd1 mutants were similar to that observed in wild-type plants, whereas arc12 and parc6 mutants exhibited enlarged etioplasts that were reduced in number. In order to examine nongreen plastids in true leaves, we silenced the ALB3 gene in these Min system mutant backgrounds to produce immature chloroplasts without the thylakoidal network using virus induced gene silencing (VIGS. Interestingly, consistent with our observations in etioplasts, enlarged and fewer nongreen plastids were only detected in leaves of parc6 (VIGS-ALB3 and arc12 (VIGS-ALB3 plants. Further, the FtsZ-ring assembled properly at the midpoint in nongreen plastids of arc3, arc11 and mcd1 (VIGS-ALB3 plants, but organized into multiple rings in parc6 (VIGS-ALB3 and presented fragmented filaments in arc12 (VIGS-ALB3 plants, suggesting that division site placement in nongreen plastids requires fewer components of the plant Min system. Taken together, these results suggest that division site placement in nongreen plastids is different from that in chloroplasts.

  12. Plastid Located WHIRLY1 Enhances the Responsiveness of Arabidopsis Seedlings Toward Abscisic Acid

    Science.gov (United States)

    Isemer, Rena; Krause, Kirsten; Grabe, Nils; Kitahata, Nobutaka; Asami, Tadao; Krupinska, Karin

    2012-01-01

    WHIRLY1 is a protein that can be translocated from the plastids to the nucleus, making it an ideal candidate for communicating information between these two compartments. Mutants of Arabidopsis thaliana lacking WHIRLY1 (why1) were shown to have a reduced sensitivity toward salicylic acid (SA) and abscisic acid (ABA) during germination. Germination assays in the presence of abamine, an inhibitor of ABA biosynthesis, revealed that the effect of SA on germination was in fact caused by a concomitant stimulation of ABA biosynthesis. In order to distinguish whether the plastid or the nuclear isoform of WHIRLY1 is adjusting the responsiveness toward ABA, sequences encoding either the complete WHIRLY1 protein or a truncated form lacking the plastid transit peptide were overexpressed in the why1 mutant background. In plants overexpressing the full-length sequence, WHIRLY1 accumulated in both plastids and the nucleus, whereas in plants overexpressing the truncated sequence, WHIRLY1 accumulated exclusively in the nucleus. Seedlings containing recombinant WHIRLY1 in both compartments were hypersensitive toward ABA. In contrast, seedlings possessing only the nuclear form of WHIRLY1 were as insensitive toward ABA as the why1 mutants. ABA was furthermore shown to lower the rate of germination of wildtype seeds even in the presence of abamine which is known to inhibit the formation of xanthoxin, the plastid located precursor of ABA. From this we conclude that plastid located WHIRLY1 enhances the responsiveness of seeds toward ABA even when ABA is supplied exogenously. PMID:23269926

  13. Plastid genome structure and loss of photosynthetic ability in the parasitic genus Cuscuta.

    Science.gov (United States)

    Revill, Meredith J W; Stanley, Susan; Hibberd, Julian M

    2005-09-01

    The genus Cuscuta (dodder) is composed of parasitic plants, some species of which appear to be losing the ability to photosynthesize. A molecular phylogeny was constructed using 15 species of Cuscuta in order to assess whether changes in photosynthetic ability and alterations in structure of the plastid genome relate to phylogenetic position within the genus. The molecular phylogeny provides evidence for four major clades within Cuscuta. Although DNA blot analysis showed that Cuscuta species have smaller plastid genomes than tobacco, and that plastome size varied significantly even within one Cuscuta clade, dot blot analysis indicated that the dodders possess homologous sequence to 101 genes from the tobacco plastome. Evidence is provided for significant rates of DNA transfer from plastid to nucleus in Cuscuta. Size and structure of Cuscuta plastid genomes, as well as photosynthetic ability, appear to vary independently of position within the phylogeny, thus supporting the hypothesis that within Cuscuta photosynthetic ability and organization of the plastid genome are changing in an unco-ordinated manner.

  14. Plastid Transformation in the Monocotyledonous Cereal Crop, Rice (Oryza sativa) and Transmission of Transgenes to Their Progeny

    OpenAIRE

    Lee, Sa Mi; Kang, Kyungsu; Chung, Hyunsup; Yoo, Soon Hee; Xu, Xiang Ming; Lee, Seung-Bum; Cheong, Jong-Joo; Daniell, Henry; Kim, Minkyun

    2006-01-01

    The plastid transformation approach offers a number of unique advantages, including high-level transgene expression, multi-gene engineering, transgene containment, and a lack of gene silencing and position effects. The extension of plastid transformation technology to monocotyledonous cereal crops, including rice, bears great promise for the improvement of agronomic traits, and the efficient production of pharmaceutical or nutritional enhancement. Here, we report a promising step towards stab...

  15. Comparative analyses of plastid genomes from fourteen Cornales species: inferences for phylogenetic relationships and genome evolution.

    Science.gov (United States)

    Fu, Chao-Nan; Li, Hong-Tao; Milne, Richard; Zhang, Ting; Ma, Peng-Fei; Yang, Jing; Li, De-Zhu; Gao, Lian-Ming

    2017-12-08

    The Cornales is the basal lineage of the asterids, the largest angiosperm clade. Phylogenetic relationships within the order were previously not fully resolved. Fifteen plastid genomes representing 14 species, ten genera and seven families of Cornales were newly sequenced for comparative analyses of genome features, evolution, and phylogenomics based on different partitioning schemes and filtering strategies. All plastomes of the 14 Cornales species had the typical quadripartite structure with a genome size ranging from 156,567 bp to 158,715 bp, which included two inverted repeats (25,859-26,451 bp) separated by a large single-copy region (86,089-87,835 bp) and a small single-copy region (18,250-18,856 bp) region. These plastomes encoded the same set of 114 unique genes including 31 transfer RNA, 4 ribosomal RNA and 79 coding genes, with an identical gene order across all examined Cornales species. Two genes (rpl22 and ycf15) contained premature stop codons in seven and five species respectively. The phylogenetic relationships among all sampled species were fully resolved with maximum support. Different filtering strategies (none, light and strict) of sequence alignment did not have an effect on these relationships. The topology recovered from coding and noncoding data sets was the same as for the whole plastome, regardless of filtering strategy. Moreover, mutational hotspots and highly informative regions were identified. Phylogenetic relationships among families and intergeneric relationships within family of Cornales were well resolved. Different filtering strategies and partitioning schemes do not influence the relationships. Plastid genomes have great potential to resolve deep phylogenetic relationships of plants.

  16. Enzymological evidence for the function of a plastid-located pyruvate carboxylase in the Haptophyte alga Emiliania huxleyi: a novel pathway for the production of C4 compounds.

    Science.gov (United States)

    Tsuji, Yoshinori; Suzuki, Iwane; Shiraiwa, Yoshihiro

    2012-06-01

    Pyruvate carboxylase (PYC) catalyzes the β-carboxylation of pyruvate to yield oxaloacetate (OAA). We previously isolated a cDNA encoding a putative PYC (EhPYC1) from the haptophyte alga Emiliania huxleyi and then proposed that EhPYC1 contributes to active anaplerotic β-carboxylation during photosynthesis although PYC activity was not detected in the cell extracts. Involvement of PYC in photosynthetic carbon metabolism is unique, since PYC generally functions in non-photosynthetic organisms. In the present study, we demonstrate that EhPYC1 is highly sensitive to endogenous proteases and therefore is easily degraded in cell extracts. By avoiding proteolytic degradation, PYC activity can be detected in the cell extracts of E. huxleyi. The activity of a recombinant His-tagged EhPYC1 expressed in Streptomyces lividans was inhibited by l-malate in a mixed non-competitive manner. Immunofluorescence labeling showed that EhPYC1 is located in the plastid. This result agrees with the prediction that a bipartite plastid-targeting signal is present that functions to deliver proteins into the four-membrane plastid of haptophyte algae. This is the first finding of a plastid-located PYC. These results indicate that E. huxleyi possesses a unique pathway to produce OAA catalyzed by PYC, and the pathway may provide carbon skeletons for amino acid biosynthesis in the plastid. A database search indicates that PYC genes are widespread in green algae, diatoms and brown algae, suggesting the crucial role of PYC in various aquatic phototrophs.

  17. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  18. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  19. Production of high levels of poly-3-hydroxybutyrate in plastids of Camelina sativa seeds.

    Science.gov (United States)

    Malik, Meghna R; Yang, Wenyu; Patterson, Nii; Tang, Jihong; Wellinghoff, Rachel L; Preuss, Mary L; Burkitt, Claire; Sharma, Nirmala; Ji, Yuanyuan; Jez, Joseph M; Peoples, Oliver P; Jaworski, Jan G; Cahoon, Edgar B; Snell, Kristi D

    2015-06-01

    Poly-3-hydroxybutyrate (PHB) production in plastids of Camelina sativa seeds was investigated by comparing levels of polymer produced upon transformation of plants with five different binary vectors containing combinations of five seed-specific promoters for expression of transgenes. Genes encoding PHB biosynthetic enzymes were modified at the N-terminus to encode a plastid targeting signal. PHB levels of up to 15% of the mature seed weight were measured in single sacrificed T1 seeds with a genetic construct containing the oleosin and glycinin promoters. A more detailed analysis of the PHB production potential of two of the best performing binary vectors in a Camelina line bred for larger seed size yielded lines containing up to 15% polymer in mature T2 seeds. Transmission electron microscopy showed the presence of distinct granules of PHB in the seeds. PHB production had varying effects on germination, emergence and survival of seedlings. Once true leaves formed, plants grew normally and were able to set seeds. PHB synthesis lowered the total oil but not the protein content of engineered seeds. A change in the oil fatty acid profile was also observed. High molecular weight polymer was produced with weight-averaged molecular weights varying between 600 000 and 1 500 000, depending on the line. Select lines were advanced to later generations yielding a line with 13.7% PHB in T4 seeds. The levels of polymer produced in this study are the highest reported to date in a seed and are an important step forward for commercializing an oilseed-based platform for PHB production. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Quantitative proteomic analysis of intact plastids.

    Science.gov (United States)

    Shiraya, Takeshi; Kaneko, Kentaro; Mitsui, Toshiaki

    2014-01-01

    Plastids are specialized cell organelles in plant cells that are differentiated into various forms including chloroplasts, chromoplasts, and amyloplasts, and fulfill important functions in maintaining the overall cell metabolism and sensing environmental factors such as sunlight. It is therefore important to grasp the mechanisms of differentiation and functional changes of plastids in order to enhance the understanding of vegetality. In this chapter, details of a method for the extraction of intact plastids that makes analysis possible while maintaining the plastid functions are provided; in addition, a quantitative shotgun method for analyzing the composition and changes in the content of proteins in plastids as a result of environmental impacts is described.

  1. In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering

    Directory of Open Access Journals (Sweden)

    Yuyong Wu

    2017-08-01

    Full Text Available Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5′ untranslated region (UTR from gene10 of bacteriophage T7 and the transcript-stabilizing 3′UTR from the E. coli ribosomal RNA operon rrnB. Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids.

  2. Plastome-Genome Interactions Affect Plastid Transmission in Oenothera

    Science.gov (United States)

    Chiu, W. L.; Sears, B. B.

    1993-01-01

    Plastids of Oenothera, the evening primrose, can be transmitted to the progeny from both parents. In a constant nuclear background, the frequency of biparental plastid transmission is determined by the types of plastid genomes (plastomes) involved in the crosses. In this study, the impact of nuclear genomes on plastid inheritance was analyzed. In general, the transmission efficiency of each plastome correlated strongly with its compatibility with the nuclear genome of the progeny, suggesting that plastome-genome interactions can influence plastid transmission by affecting the efficiency of plastid multiplication after fertilization. Lower frequencies of plastid transmission from the paternal side were observed when the pollen had poor vigor due to an incompatible plastome-genome combination, indicating that plastome-genome interactions may also affect the input of plastids at fertilization. Parental traits that affect the process of fertilization can also have an impact on plastid transmission. Crosses using maternal parents with long styles or pollen with relatively low growth capacity resulted in reduced frequencies of paternal plastid transmission. These observations suggest that degeneration of pollen plastids may occur as the time interval between pollination and fertilization is lengthened. PMID:8462856

  3. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  4. Horizontal Transfer of DNA from the Mitochondrial to the Plastid Genome and Its Subsequent Evolution in Milkweeds (Apocynaceae)

    Science.gov (United States)

    Straub, Shannon C.K.; Cronn, Richard C.; Edwards, Christopher; Fishbein, Mark; Liston, Aaron

    2013-01-01

    Horizontal gene transfer (HGT) of DNA from the plastid to the nuclear and mitochondrial genomes of higher plants is a common phenomenon; however, plastid genomes (plastomes) are highly conserved and have generally been regarded as impervious to HGT. We sequenced the 158 kb plastome and the 690 kb mitochondrial genome of common milkweed (Asclepias syriaca [Apocynaceae]) and found evidence of intracellular HGT for a 2.4-kb segment of mitochondrial DNA to the rps2–rpoC2 intergenic spacer of the plastome. The transferred region contains an rpl2 pseudogene and is flanked by plastid sequence in the mitochondrial genome, including an rpoC2 pseudogene, which likely provided the mechanism for HGT back to the plastome through double-strand break repair involving homologous recombination. The plastome insertion is restricted to tribe Asclepiadeae of subfamily Asclepiadoideae, whereas the mitochondrial rpoC2 pseudogene is present throughout the subfamily, which confirms that the plastid to mitochondrial HGT event preceded the HGT to the plastome. Although the plastome insertion has been maintained in all lineages of Asclepiadoideae, it shows minimal evidence of transcription in A. syriaca and is likely nonfunctional. Furthermore, we found recent gene conversion of the mitochondrial rpoC2 pseudogene in Asclepias by the plastid gene, which reflects continued interaction of these genomes. PMID:24029811

  5. Ties that bind: the integration of plastid signalling pathways in plant cell metabolism.

    Science.gov (United States)

    Brunkard, Jacob O; Burch-Smith, Tessa M

    2018-04-13

    Plastids are critical organelles in plant cells that perform diverse functions and are central to many metabolic pathways. Beyond their major roles in primary metabolism, of which their role in photosynthesis is perhaps best known, plastids contribute to the biosynthesis of phytohormones and other secondary metabolites, store critical biomolecules, and sense a range of environmental stresses. Accordingly, plastid-derived signals coordinate a host of physiological and developmental processes, often by emitting signalling molecules that regulate the expression of nuclear genes. Several excellent recent reviews have provided broad perspectives on plastid signalling pathways. In this review, we will highlight recent advances in our understanding of chloroplast signalling pathways. Our discussion focuses on new discoveries illuminating how chloroplasts determine life and death decisions in cells and on studies elucidating tetrapyrrole biosynthesis signal transduction networks. We will also examine the role of a plastid RNA helicase, ISE2, in chloroplast signalling, and scrutinize intriguing results investigating the potential role of stromules in conducting signals from the chloroplast to other cellular locations. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  6. Gene expression in isolated plastids from fruits of capsicum annum

    International Nuclear Information System (INIS)

    Powell, D.S.; Pryke, J.A.

    1987-01-01

    Plastids were obtained from the ripening fruits of Capsicum annum, and incubated in vitro in the presence of [ 35 S]methionine(Met). There was polypeptide synthesis at all stages of pepper tissue studied in both chloroplasts and chromoplasts, dependent on the addition of nuclioside triphosphates and phosphoenolpyruvate and inhibited by D-threo-chloramphenicol. l8. refs. (author)

  7. Plastid structure and carotenogenic gene expression in red- and white-fleshed loquat (Eriobotrya japonica) fruits

    Science.gov (United States)

    Fu, Xiumin; Kong, Wenbin; Peng, Gang; Zhou, Jingyi; Azam, Muhammad; Xu, Changjie; Grierson, Don; Chen, Kunsong

    2012-01-01

    Loquat (Eriobotrya japonica Lindl.) can be sorted into red- and white-fleshed cultivars. The flesh of Luoyangqing (LYQ, red-fleshed) appears red-orange because of a high content of carotenoids while the flesh of Baisha (BS, white-fleshed) appears ivory white due to a lack of carotenoid accumulation. The carotenoid content in the peel and flesh of LYQ was approximately 68 μg g−1 and 13 μg g−1 fresh weight (FW), respectively, and for BS 19 μg g−1 and 0.27 μg g−1 FW. The mRNA levels of 15 carotenogenesis-related genes were analysed during fruit development and ripening. After the breaker stage (S4), the mRNA levels of phytoene synthase 1 (PSY1) and chromoplast-specific lycopene β-cyclase (CYCB) were higher in the peel, and CYCB and β-carotene hydroxylase (BCH) mRNAs were higher in the flesh of LYQ, compared with BS. Plastid morphogenesis during fruit ripening was also studied. The ultrastructure of plastids in the peel of BS changed less than in LYQ during fruit development. Two different chromoplast shapes were observed in the cells of LYQ peel and flesh at the fully ripe stage. Carotenoids were incorporated in the globules in chromoplasts of LYQ and BS peel but were in a crystalline form in the chromoplasts of LYQ flesh. However, no chromoplast structure was found in the cells of fully ripe BS fruit flesh. The mRNA level of plastid lipid-associated protein (PAP) in the peel and flesh of LYQ was over five times higher than in BS peel and flesh. In conclusion, the lower carotenoid content in BS fruit was associated with the lower mRNA levels of PSY1, CYCB, and BCH; however, the failure to develop normal chromoplasts in BS flesh is the most convincing explanation for the lack of carotenoid accumulation. The expression of PAP was well correlated with chromoplast numbers and carotenoid accumulation, suggesting its possible role in chromoplast biogenesis or interconversion of loquat fruit. PMID:21994170

  8. The myth of interconnected plastids and related phenomena.

    Science.gov (United States)

    Schattat, Martin H; Barton, Kiah A; Mathur, Jaideep

    2015-01-01

    Studies spread over nearly two and a half centuries have identified the primary plastid in autotrophic algae and plants as a pleomorphic, multifunctional organelle comprising of a double-membrane envelope enclosing an organization of internal membranes submerged in a watery stroma. All plastid units have been observed extending and retracting thin stroma-filled tubules named stromules sporadically. Observations on living plant cells often convey the impression that stromules connect two or more independent plastids with each other. When photo-bleaching techniques were used to suggest that macromolecules such as the green fluorescent protein could flow between already interconnected plastids, for many people this impression changed to conviction. However, it was noticed only recently that the concept of protein flow between plastids rests solely on the words "interconnected plastids" for which details have never been provided. We have critically reviewed botanical literature dating back to the 1880s for understanding this term and the phenomena that have become associated with it. We find that while meticulously detailed ontogenic studies spanning nearly 150 years have established the plastid as a singular unit organelle, there is no experimental support for the idea that interconnected plastids exist under normal conditions of growth and development. In this review, while we consider several possibilities that might allow a single elongated plastid to be misinterpreted as two or more interconnected plastids, our final conclusion is that the concept of direct protein flow between plastids is based on an unfounded assumption.

  9. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  10. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  11. Re-evaluating the green versus red signal in eukaryotes with secondary plastid of red algal origin

    KAUST Repository

    Burki, Fabien

    2012-05-16

    The transition from endosymbiont to organelle in eukaryotic cells involves the transfer of significant numbers of genes to the host genomes, a process known as endosymbiotic gene transfer (EGT). In the case of plastid organelles, EGTs have been shown to leave a footprint in the nuclear genome that can be indicative of ancient photosynthetic activity in present-day plastid-lacking organisms, or even hint at the existence of cryptic plastids. Here,we evaluated the impact of EGTon eukaryote genomes by reanalyzing the recently published EST dataset for Chromera velia, an interesting test case of a photosynthetic alga closely related to apicomplexan parasites. Previously, 513 genes were reported to originate from red and green algae in a 1:1 ratio. In contrast, by manually inspecting newly generated trees indicating putative algal ancestry, we recovered only 51 genes congruent with EGT, of which 23 and 9 were of red and green algal origin, respectively,whereas 19 were ambiguous regarding the algal provenance.Our approach also uncovered 109 genes that branched within a monocot angiosperm clade, most likely representing a contamination. We emphasize the lack of congruence and the subjectivity resulting from independent phylogenomic screens for EGT, which appear to call for extreme caution when drawing conclusions for major evolutionary events. 2012 The Author(s).

  12. Organization of plastid genomes in the freshwater red algal order Batrachospermales (Rhodophyta).

    Science.gov (United States)

    Paiano, Monica Orlandi; Del Cortona, Andrea; Costa, Joana F; Liu, Shao-Lun; Verbruggen, Heroen; De Clerck, Olivier; Necchi, Orlando

    2018-02-01

    Little is known about genome organization in members of the order Batrachospermales, and the infra-ordinal relationship remains unresolved. Plastid (cp) genomes of seven members of the freshwater red algal order Batrachospermales were sequenced, with the following aims: (i) to describe the characteristics of cp genomes and compare these with other red algal groups; (ii) to infer the phylogenetic relationships among these members to better understand the infra-ordinal classification. Cp genomes of Batrachospermales are large, with several cases of gene loss, they are gene-dense (high gene content for the genome size and short intergenic regions) and have highly conserved gene order. Phylogenetic analyses based on concatenated nucleotide genome data roughly supports the current taxonomic system for the order. Comparative analyses confirm data for members of the class Florideophyceae that cp genomes in Batrachospermales is highly conserved, with little variation in gene composition. However, relevant new features were revealed in our study: genome sizes in members of Batrachospermales are close to the lowest values reported for Florideophyceae; differences in cp genome size within the order are large in comparison with other orders (Ceramiales, Gelidiales, Gracilariales, Hildenbrandiales, and Nemaliales); and members of Batrachospermales have the lowest number of protein-coding genes among the Florideophyceae. In terms of gene loss, apcF, which encodes the allophycocyanin beta subunit, is absent in all sequenced taxa of Batrachospermales. We reinforce that the interordinal relationships between the freshwater orders Batrachospermales and Thoreales within the Nemaliophycidae is not well resolved due to limited taxon sampling. © 2017 Phycological Society of America.

  13. Environmental control of plant nuclear gene expression by chloroplast redox signals

    Directory of Open Access Journals (Sweden)

    Jeannette ePfalz

    2012-11-01

    Full Text Available Plant photosynthesis takes place in specialised cell organelles, the chloroplasts, which perform all essential steps of this process. The proteins involved in photosynthesis are encoded by genes located on the plastid and nuclear genomes. Proper function and regulation of light harvesting and energy fixation thus requires a tight coordination of the gene expression machineries in the two genetic compartments. This is achieved by a bi-directional exchange of information between nucleus and plastids. Signals emerging from plastids report the functional and developmental state of the organelle to the nucleus and initiate distinct nuclear gene expression profiles, which trigger responses that support or improve plastid functions. Recent research indicated that this signalling is absolutely essential for plant growth and development. Reduction/oxidation (redox signals from photosynthesis are key players in this information network since they do report functional disturbances in photosynthesis, the primary energy source of plants. Such disturbances are caused by environmental fluctuations for instance in illumination, temperature or water availability. These environmental changes affect the linear electron flow of photosynthesis and result in changes of the redox state of the components involved (e.g. the plastoquinone pool or coupled to it (e.g. the thioredoxin pool. Thus, the changes in redox state directly reflect the environmental impact and serve as immediate plastidial signals to the nucleus. The triggered responses range from counterbalancing reactions within the physiological range up to severe stress responses including cell death. This review focuses on physiological redox signals from photosynthetic electron transport, their relation to the environment, potential transduction pathways to the nucleus and their impact on nuclear gene expression.

  14. Why does biparental plastid inheritance revive in angiosperms?

    Science.gov (United States)

    Zhang, Quan; Sodmergen

    2010-03-01

    It is widely believed that plastid and mitochondrial genomes are inherited through the maternal parent. In plants, however, paternal transmission of these genomes is frequently observed, especially for the plastid genome. A male gametic trait, called potential biparental plastid inheritance (PBPI), occurs in up to 20% of angiosperm genera, implying a strong tendency for plastid transmission from the male lineage. Why do plants receive organelles from the male parents? Are there clues in plastids that will help to elucidate the evolution of plants? Reconstruction of the ancestral state of plastid inheritance patterns in a phylogenetic context provides insights into these questions. In particular, a recent report demonstrated the unilateral occurrence of PBPI in angiosperms. This result implies that nuclear cytoplasmic conflicts, a basic driving force for altering the mode of organelle inheritance, might have arisen specifically in angiosperms. Based on existing evidence, it is likely that biparental inheritance may have occurred to rescue angiosperm species with defective plastids.

  15. Horizontal transfer of DNA from the mitochondrial to the plastid genome and its subsequent evolution in milkweeds (Apocynaceae)

    Science.gov (United States)

    Shannon C.K. Straub; Richard C. Cronn; Christopher Edwards; Mark Fishbein; Aaron. Liston

    2013-01-01

    Horizontal gene transfer (HGT) of DNA from the plastid to the nuclear and mitochondrial genomes of higher plants is a common phenomenon; however, plastid genomes (plastomes) are highly conserved and have generally been regarded as impervious to HGT. We sequenced the 158 kb plastome and the 690 kb mitochondrial genome of common milkweed (Asclepias syriaca [Apocynaceae...

  16. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  17. Plastid Genome Evolution in the Early-Diverging Legume Subfamily Cercidoideae (Fabaceae

    Directory of Open Access Journals (Sweden)

    Yin-Huan Wang

    2018-02-01

    Full Text Available The subfamily Cercidoideae is an early-branching legume lineage, which consists of 13 genera distributed in the tropical and warm temperate Northern Hemisphere. A previous study detected two plastid genomic variations in this subfamily, but the limited taxon sampling left the overall plastid genome (plastome diversification across the subfamily unaddressed, and phylogenetic relationships within this clade remained unresolved. Here, we assembled eight plastomes from seven Cercidoideae genera and conducted phylogenomic-comparative analyses in a broad evolutionary framework across legumes. The plastomes of Cercidoideae all exhibited a typical quadripartite structure with a conserved gene content typical of most angiosperm plastomes. Plastome size ranged from 151,705 to 165,416 bp, mainly due to the expansion and contraction of inverted repeat (IR regions. The order of genes varied due to the occurrence of several inversions. In Tylosema species, a plastome with a 29-bp IR-mediated inversion was found to coexist with a canonical-type plastome, and the abundance of the two arrangements of isomeric molecules differed between individuals. Complete plastome data were much more efficient at resolving intergeneric relationships of Cercidoideae than the previously used selection of only a few plastid or nuclear loci. In sum, our study revealed novel insights into the structural diversification of plastomes in an early-branching legume lineage, and, thus, into the evolutionary trajectories of legume plastomes in general.

  18. Plastid and Stromule Morphogenesis in Tomato

    Science.gov (United States)

    PYKE, KEVIN A.; HOWELLS, CAROLINE A.

    2002-01-01

    By using green fluorescent protein targeted to the plastid organelle in tomato (Lycopersicon esculentum Mill.), the morphology of plastids and their associated stromules in epidermal cells and trichomes from stems and petioles and in the chromoplasts of pericarp cells in the tomato fruit has been revealed. A novel characteristic of tomato stromules is the presence of extensive bead‐like structures along the stromules that are often observed as free vesicles, distinct from and apparently unconnected to the plastid body. Interconnections between the red pigmented chromoplast bodies are common in fruit pericarp cells suggesting that chromoplasts could form a complex network in this cell type. The potential implications for carotenoid biosynthesis in tomato fruit and for vesicles originating from beaded stromules as a secretory mechanism for plastids in glandular trichomes of tomato is discussed. PMID:12466096

  19. The Plant Immunity Regulating F-Box Protein CPR1 Supports Plastid Function in Absence of Pathogens

    Directory of Open Access Journals (Sweden)

    Christiane Hedtmann

    2017-09-01

    Full Text Available The redox imbalanced 6 mutant (rimb6 of Arabidopsis thaliana was isolated in a genetic screening approach for mutants with defects in chloroplast-to-nucleus redox signaling. It has an atypically low activation status of the 2-Cys peroxiredoxin-A promoter in the seedling stage. rimb6 shows wildtype-like germination, seedling development and greening, but slower growth and reduced biomass in the rosette stage. Mapping of the casual mutation revealed that rimb6 carries a single nucleotide polymorphism in the gene encoding CONSTITUTIVE EXPRESSER OF PATHOGENESIS RELATED (PR GENES 1, CPR1 (At4g12560, leading to a premature stop codon. CPR1 is known as a repressor of pathogen signaling and regulator of microtubule organization. Allelism of rimb6 and cpr1 revealed a function of CPR1 in chloroplast stress protection. Expression studies in pathogen signaling mutants demonstrated that CPR1-mediated activation of genes for photosynthesis and chloroplast antioxidant protection is, in contrast to activation of pathogen responses, regulated independently from PAD4-controlled salicylic acid (SA accumulation. We conclude that the support of plastid function is a basic, SA-independent function of CPR1.

  20. The plastid genome of some eustigmatophyte algae harbours a bacteria-derived six-gene cluster for biosynthesis of a novel secondary metabolite

    Czech Academy of Sciences Publication Activity Database

    Yurchenko, T.; Ševčíková, T.; Strnad, Hynek; Butenko, A.; Eliáš, M.

    2016-01-01

    Roč. 6, č. 11 (2016), č. článku 160249. ISSN 2046-2441 R&D Projects: GA ČR GA13-33039S; GA MŠk(CZ) ED2.1.00/19.0388; GA MŠk(CZ) LO1208 EU Projects: European Commission 642575 Institutional support: RVO:68378050 Keywords : Eustigmatophyceae * horizontal gene transfer * plastid genome * secondary metabolism * sugar phosphate cyclase superfamily * UbiA superfamily Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016

  1. Carotenoid Metabolism in Plants: The Role of Plastids.

    Science.gov (United States)

    Sun, Tianhu; Yuan, Hui; Cao, Hongbo; Yazdani, Mohammad; Tadmor, Yaakov; Li, Li

    2018-01-08

    Carotenoids are indispensable to plants and critical in human diets. Plastids are the organelles for carotenoid biosynthesis and storage in plant cells. They exist in various types, which include proplastids, etioplasts, chloroplasts, amyloplasts, and chromoplasts. These plastids have dramatic differences in their capacity to synthesize and sequester carotenoids. Clearly, plastids play a central role in governing carotenogenic activity, carotenoid stability, and pigment diversity. Understanding of carotenoid metabolism and accumulation in various plastids expands our view on the multifaceted regulation of carotenogenesis and facilitates our efforts toward developing nutrient-enriched food crops. In this review, we provide a comprehensive overview of the impact of various types of plastids on carotenoid biosynthesis and accumulation, and discuss recent advances in our understanding of the regulatory control of carotenogenesis and metabolic engineering of carotenoids in light of plastid types in plants. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.

  2. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  3. Contrasting Patterns of Nucleotide Substitution Rates Provide Insight into Dynamic Evolution of Plastid and Mitochondrial Genomes of Geranium

    OpenAIRE

    Park, Seongjun; Ruhlman, Tracey A.; Weng, Mao-Lun; Hajrah, Nahid H.; Sabir, Jamal S.M.; Jansen, Robert K.

    2017-01-01

    Abstract Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have i...

  4. Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae): Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid.

    Science.gov (United States)

    Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp

    2017-02-01

    We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).

  5. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  6. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  7. Plastids: the Green Frontiers for Vaccine Production

    Directory of Open Access Journals (Sweden)

    Mohammad Tahir eWaheed

    2015-11-01

    Full Text Available Infectious diseases pose an increasing risk to health, especially in developing countries. Vaccines are available to either cure or prevent many of these diseases. However, there are certain limitations related to these vaccines, mainly the costs, which make these vaccines mostly unaffordable for people in resource poor countries. These costs are mainly related to production and purification of the products manufactured from fermenter-based systems. Plastid biotechnology has become an attractive platform to produce biopharmaceuticals in large amounts and cost-effectively. This is mainly due to high copy number of plastids DNA in mature chloroplasts, a characteristic particularly important for vaccine production in large amounts. An additional advantage lies in the maternal inheritance of plastids in most plant species, which addresses the regulatory concerns related to transgenic plants. These and many other aspects of plastids will be discussed in the present review, especially those that particularly make these green biofactories an attractive platform for vaccine production. A summary of recent vaccine antigens against different human diseases expressed in plastids will also be presented.

  8. A gene phylogeny of the red algae (Rhodophyta) based on plastid rbcL.

    Science.gov (United States)

    Freshwater, D W; Fredericq, S; Butler, B S; Hommersand, M H; Chase, M W

    1994-01-01

    A phylogeny for the Rhodophyta has been inferred by parsimony analysis of plastid rbcL sequences representing 81 species, 68 genera, 38 families, and 17 orders of red algae; rbcL encodes the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase. Levels of sequence divergence among species, genera, and families are high in red algae, typically much greater than those reported for flowering plants. The Rhodophyta traditionally consists of one class, Rhodophyceae, and two subclasses, Bangiophycidae and Florideophycidae. The Bangiophycidae with three orders (Porphyridiales, Compsopogonales, and Bangiales) appears to be polyphyletic, and the Florideophycidae with 17 orders is monophyletic in this study. The current classification of the Florideophycidae based on ultrastructure of pit connections is supported. With the exception of the Rhodogorgonales, which appears to be misplaced, orders with one or two pit-plug cap layers (Hildenbrandiales, Corallinales, Acrochaetiales, Palmanales, Batrachospermales, and Nemaliales) terminate long branches of basal position within Florideophycidae in the most parsimonious rbcL tree. Orders that lack typical cap layers but possess a cap membrane are resolved as a monophyletic clade sister to the Ahnfeltiales. The large order Gigartinales, which is distributed among five rbcL clades, is polyphyletic. Families that possess typical carrageenan in their cell walls are resolved as a terminal clade containing two family complexes centered around the Solieriaceae and Gigartinaceae. PMID:8041781

  9. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  10. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  11. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  12. Investigations about the in vitro import of nucleus encoded cyanellar ploypeptides

    International Nuclear Information System (INIS)

    Brandtner, M.

    1991-05-01

    Cyanelles are the plastids of the eukaryotic alga Cyanophora paradoxa. They share several features with cyanobacteria: a cell wall made of peptidoglycan, concentric thylakoid membranes and phycobilisomes as light harvesting complexes. Therefore cyanelles were regarded as 'missing link' between the chloroplasts and the prokaryotic ancestor according to the endosymbiotic hypothesis. The genome of the cyanelles resembles that of plastids concerning size and organization. So cyanelles have to import 90% of their proteins. In order to study the import of proteins into cyanelles, it was necessary to isolate a nucleus-encoded gene from a cDNA library. The gene could be expressed in vitro in a suitable plasmid. The radioactive labelled precursor will be incubated with isolated cyanelles. After their lysis their proteins will be run on a gel and the fate of the precursor -whether it was imported and processed respectively or not - will be detected. A method for mRNA isolation was adapted with respect to Cyanophora paradoxa. Based on the mRNA cDNA libraries were established. In parallel the mRNA was in vitro translated. Import experiments with the translation products were performed into cyanelles and pea chloroplasts. Additionally it was tried to import four precursors of higher plants into cyanelles. The isolated cyanelles were not competent for protein uptake. The gene for ferredoxin-NADP-reductase was found in a lambda ZAP cDNA library by screening with homologous antibodies. The transit peptide for the import into cyanelles shows the same general features as chloroplast transit peptides do, but differs from the three known transit peptides of ferredoxin-NADP-reductase from higher plants. (author)

  13. Abscisic acid affects transcription of chloroplast genes via protein phosphatase 2C-dependent activation of nuclear genes: repression by guanosine-3'-5'-bisdiphosphate and activation by sigma factor 5.

    Science.gov (United States)

    Yamburenko, Maria V; Zubo, Yan O; Börner, Thomas

    2015-06-01

    Abscisic acid (ABA) represses the transcriptional activity of chloroplast genes (determined by run-on assays), with the exception of psbD and a few other genes in wild-type Arabidopsis seedlings and mature rosette leaves. Abscisic acid does not influence chloroplast transcription in the mutant lines abi1-1 and abi2-1 with constitutive protein phosphatase 2C (PP2C) activity, suggesting that ABA affects chloroplast gene activity by binding to the pyrabactin resistance (PYR)/PYR1-like or regulatory component of ABA receptor protein family (PYR/PYL/RCAR) and signaling via PP2Cs and sucrose non-fermenting protein-related kinases 2 (SnRK2s). Further we show by quantitative PCR that ABA enhances the transcript levels of RSH2, RSH3, PTF1 and SIG5. RelA/SpoT homolog 2 (RSH2) and RSH3 are known to synthesize guanosine-3'-5'-bisdiphosphate (ppGpp), an inhibitor of the plastid-gene-encoded chloroplast RNA polymerase. We propose, therefore, that ABA leads to an inhibition of chloroplast gene expression via stimulation of ppGpp synthesis. On the other hand, sigma factor 5 (SIG5) and plastid transcription factor 1 (PTF1) are known to be necessary for the transcription of psbD from a specific light- and stress-induced promoter (the blue light responsive promoter, BLRP). We demonstrate that ABA activates the psbD gene by stimulation of transcription initiation at BLRP. Taken together, our data suggest that ABA affects the transcription of chloroplast genes by a PP2C-dependent activation of nuclear genes encoding proteins involved in chloroplast transcription. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  14. The plastid genomes of flowering plants.

    Science.gov (United States)

    Ruhlman, Tracey A; Jansen, Robert K

    2014-01-01

    The plastid genome (plastome) has proved a valuable source of data for evaluating evolutionary relationships among angiosperms. Through basic and applied approaches, plastid transformation technology offers the potential to understand and improve plant productivity, providing food, fiber, energy and medicines to meet the needs of a burgeoning global population. The growing genomic resources available to both phylogenetic and biotechnological investigations are allowing novel insights and expanding the scope of plastome research to encompass new species. In this chapter we present an overview of some of the seminal and contemporary research that has contributed to our current understanding of plastome evolution and attempt to highlight the relationship between evolutionary mechanisms and tools of plastid genetic engineering.

  15. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  16. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  17. Evolutionary and biotechnology implications of plastid genome variation in the inverted-repeat-lacking clade of legumes.

    Science.gov (United States)

    Sabir, Jamal; Schwarz, Erika; Ellison, Nicholas; Zhang, Jin; Baeshen, Nabih A; Mutwakil, Muhammed; Jansen, Robert; Ruhlman, Tracey

    2014-08-01

    Land plant plastid genomes (plastomes) provide a tractable model for evolutionary study in that they are relatively compact and gene dense. Among the groups that display an appropriate level of variation for structural features, the inverted-repeat-lacking clade (IRLC) of papilionoid legumes presents the potential to advance general understanding of the mechanisms of genomic evolution. Here, are presented six complete plastome sequences from economically important species of the IRLC, a lineage previously represented by only five completed plastomes. A number of characters are compared across the IRLC including gene retention and divergence, synteny, repeat structure and functional gene transfer to the nucleus. The loss of clpP intron 2 was identified in one newly sequenced member of IRLC, Glycyrrhiza glabra. Using deeply sequenced nuclear transcriptomes from two species helped clarify the nature of the functional transfer of accD to the nucleus in Trifolium, which likely occurred in the lineage leading to subgenus Trifolium. Legumes are second only to cereal crops in agricultural importance based on area harvested and total production. Genetic improvement via plastid transformation of IRLC crop species is an appealing proposition. Comparative analyses of intergenic spacer regions emphasize the need for complete genome sequences for developing transformation vectors for plastid genetic engineering of legume crops. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Contrasting Patterns of Nucleotide Substitution Rates Provide Insight into Dynamic Evolution of Plastid and Mitochondrial Genomes of Geranium.

    Science.gov (United States)

    Park, Seongjun; Ruhlman, Tracey A; Weng, Mao-Lun; Hajrah, Nahid H; Sabir, Jamal S M; Jansen, Robert K

    2017-06-01

    Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have included limited sampling of Geranium, the largest genus in the family with over 400 species. This study reports on rates and patterns of nucleotide substitutions in plastomes and mitogenomes of 17 species of Geranium and representatives of other Geraniaceae. As detected across other angiosperms, substitution rates in the plastome are 3.5 times higher than the mitogenome in most Geranium. However, in the branch leading to Geranium brycei/Geranium incanum mitochondrial genes experienced significantly higher dN and dS than plastid genes, a pattern that has only been detected in one other angiosperm. Furthermore, rate accelerations differ in the two organelle genomes with plastomes having increased dN and mitogenomes with increased dS. In the Geranium phaeum/Geranium reflexum clade, duplicate copies of clpP and rpoA genes that experienced asymmetric rate divergence were detected in the single copy region of the plastome. In the case of rpoA, the branch leading to G. phaeum/G. reflexum experienced positive selection or relaxation of purifying selection. Finally, the evolution of acetyl-CoA carboxylase is unusual in Geraniaceae because it is only the second angiosperm family where both prokaryotic and eukaryotic ACCases functionally coexist in the plastid. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  20. Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2017-04-01

    For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  1. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  2. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  3. Complete plastid genome of Astragalus mongholicus var. nakaianus (Fabaceae).

    Science.gov (United States)

    Choi, In-Su; Kim, Joo-Hwan; Choi, Byoung-Hee

    2016-07-01

    The first complete plastid genome (plastome) of the largest angiosperm genus, Astragalus, was sequenced for the Korean endangered endemic species A. mongholicus var. nakaianus. Its genome is relatively short (123,633 bp) because it lacks an Inverted Repeat (IR) region. It comprises 110 genes, including four unique rRNAs, 30 tRNAs, and 76 protein-coding genes. Similar to other closely related plastomes, rpl22 and rps16 are absent. The putative pseudogene with abnormal stop codons is atpE. This plastome has no additional inversions when compared with highly variable plastomes from IRLC tribes Fabeae and Trifolieae. Our phylogenetic analysis confirms the non-monophyly of Galegeae.

  4. Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

    Science.gov (United States)

    Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

    2017-04-01

    There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

  5. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  6. Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

    Science.gov (United States)

    Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

    2001-01-24

    We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

  7. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  8. Non-photosynthetic plastids as hosts for metabolic engineering.

    Science.gov (United States)

    Mellor, Silas Busck; Behrendorff, James B Y H; Nielsen, Agnieszka Zygadlo; Jensen, Poul Erik; Pribil, Mathias

    2018-04-13

    Using plants as hosts for production of complex, high-value compounds and therapeutic proteins has gained increasing momentum over the past decade. Recent advances in metabolic engineering techniques using synthetic biology have set the stage for production yields to become economically attractive, but more refined design strategies are required to increase product yields without compromising development and growth of the host system. The ability of plant cells to differentiate into various tissues in combination with a high level of cellular compartmentalization represents so far the most unexploited plant-specific resource. Plant cells contain organelles called plastids that retain their own genome, harbour unique biosynthetic pathways and differentiate into distinct plastid types upon environmental and developmental cues. Chloroplasts, the plastid type hosting the photosynthetic processes in green tissues, have proven to be suitable for high yield protein and bio-compound production. Unfortunately, chloroplast manipulation often affects photosynthetic efficiency and therefore plant fitness. In this respect, plastids of non-photosynthetic tissues, which have focused metabolisms for synthesis and storage of particular classes of compounds, might prove more suitable for engineering the production and storage of non-native metabolites without affecting plant fitness. This review provides the current state of knowledge on the molecular mechanisms involved in plastid differentiation and focuses on non-photosynthetic plastids as alternative biotechnological platforms for metabolic engineering. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  9. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  10. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  11. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  12. Plant cells without detectable plastids are generated in the crumpled leaf mutant of Arabidopsis thaliana.

    Science.gov (United States)

    Chen, Yuling; Asano, Tomoya; Fujiwara, Makoto T; Yoshida, Shigeo; Machida, Yasunori; Yoshioka, Yasushi

    2009-05-01

    Plastids are maintained in cells by proliferating prior to cell division and being partitioned to each daughter cell during cell division. It is unclear, however, whether cells without plastids are generated when plastid division is suppressed. The crumpled leaf (crl) mutant of Arabidopsis thaliana is a plastid division mutant that displays severe abnormalities in plastid division and plant development. We show that the crl mutant contains cells lacking detectable plastids; this situation probably results from an unequal partitioning of plastids to each daughter cell. Our results suggest that crl has a partial defect in plastid expansion, which is suggested to be important in the partitioning of plastids to daughter cells when plastid division is suppressed. The absence of cells without detectable plastids in the accumulation and replication of chloroplasts 6 (arc6) mutant, another plastid division mutant of A. thaliana having no significant defects in plant morphology, suggests that the generation of cells without detectable plastids is one of the causes of the developmental abnormalities seen in crl plants. We also demonstrate that plastids with trace or undetectable amounts of chlorophyll are generated from enlarged plastids by a non-binary fission mode of plastid replication in both crl and arc6.

  13. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  14. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  15. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  16. Engineering plastid fatty acid biosynthesis to improve food quality and biofuel production in higher plants.

    Science.gov (United States)

    Rogalski, Marcelo; Carrer, Helaine

    2011-06-01

    The ability to manipulate plant fatty acid biosynthesis by using new biotechnological approaches has allowed the production of transgenic plants with unusual fatty acid profile and increased oil content. This review focuses on the production of very long chain polyunsaturated fatty acids (VLCPUFAs) and the increase in oil content in plants using molecular biology tools. Evidences suggest that regular consumption of food rich in VLCPUFAs has multiple positive health benefits. Alternative sources of these nutritional fatty acids are found in cold-water fishes. However, fish stocks are in severe decline because of decades of overfishing, and also fish oils can be contaminated by the accumulation of toxic compounds. Recently, there is also an increase in oilseed use for the production of biofuels. This tendency is partly associated with the rapidly rising costs of petroleum, increased concern about the environmental impact of fossil oil and the attractive need to develop renewable sources of fuel. In contrast to this scenario, oil derived from crop plants is normally contaminant free and less environmentally aggressive. Genetic engineering of the plastid genome (plastome) offers a number of attractive advantages, including high-level foreign protein expression, marker-gene excision and transgene containment because of maternal inheritance of plastid genome in most crops. Here, we describe the possibility to improve fatty acid biosynthesis in plastids, production of new fatty acids and increase their content in plants by genetic engineering of plastid fatty acid biosynthesis via plastid transformation. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  17. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  18. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  19. Complete plastid genome sequence of Primula sinensis (Primulaceae: structure comparison, sequence variation and evidence for accD transfer to nucleus

    Directory of Open Access Journals (Sweden)

    Tong-Jian Liu

    2016-06-01

    Full Text Available Species-rich genus Primula L. is a typical plant group with which to understand genetic variance between species in different levels of relationships. Chloroplast genome sequences are used to be the information resource for quantifying this difference and reconstructing evolutionary history. In this study, we reported the complete chloroplast genome sequence of Primula sinensis and compared it with other related species. This genome of chloroplast showed a typical circular quadripartite structure with 150,859 bp in sequence length consisting of 37.2% GC base. Two inverted repeated regions (25,535 bp were separated by a large single-copy region (82,064 bp and a small single-copy region (17,725 bp. The genome consists of 112 genes, including 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Among them, seven coding genes, seven tRNA genes and four rRNA genes have two copies due to their locations in the IR regions. The accD and infA genes lacking intact open reading frames (ORF were identified as pseudogenes. SSR and sequence variation analyses were also performed on the plastome of Primula sinensis, comparing with another available plastome of P. poissonii. The four most variable regions, rpl36–rps8, rps16–trnQ, trnH–psbA and ndhC–trnV, were identified. Phylogenetic relationship estimates using three sub-datasets extracted from a matrix of 57 protein-coding gene sequences showed the identical result that was consistent with previous studies. A transcript found from P. sinensis transcriptome showed a high similarity to plastid accD functional region and was identified as a putative plastid transit peptide at the N-terminal region. The result strongly suggested that plastid accD has been functionally transferred to the nucleus in P. sinensis.

  20. Respiratory processes in non-photosynthetic plastids

    Science.gov (United States)

    Renato, Marta; Boronat, Albert; Azcón-Bieto, Joaquín

    2015-01-01

    Chlororespiration is a respiratory process located in chloroplast thylakoids which consists in an electron transport chain from NAD(P)H to oxygen. This respiratory chain involves the NAD(P)H dehydrogenase complex, the plastoquinone pool and the plastid terminal oxidase (PTOX), and it probably acts as a safety valve to prevent the over-reduction of the photosynthetic machinery in stress conditions. The existence of a similar respiratory activity in non-photosynthetic plastids has been less studied. Recently, it has been reported that tomato fruit chromoplasts present an oxygen consumption activity linked to ATP synthesis. Etioplasts and amyloplasts contain several electron carriers and some subunits of the ATP synthase, so they could harbor a similar respiratory process. This review provides an update on the study about respiratory processes in chromoplasts, identifying the major gaps that need to be addressed in future research. It also reviews the proteomic data of etioplasts and amyloplasts, which suggest the presence of a respiratory electron transport chain in these plastids. PMID:26236317

  1. Respiratory processes in non-photosynthetic plastids

    Directory of Open Access Journals (Sweden)

    Marta eRenato

    2015-07-01

    Full Text Available Chlororespiration is a respiratory process located in chloroplast thylakoids which consists in an electron transport chain from NAD(PH to oxygen. This respiratory chain involves the NAD(PH dehydrogenase complex, the plastoquinone pool and the plastid terminal oxidase (PTOX, and it probably acts as a safety valve to prevent the over-reduction of the photosynthetic machinery in stress conditions. The existence of a similar respiratory activity in non-photosynthetic plastids has been less studied. Recently, it has been reported that tomato fruit chromoplasts present an oxygen consumption activity linked to ATP synthesis. Etioplasts and amyloplasts contain several electron carriers and some subunits of the ATP synthase, so they could harbor a similar respiratory process. This review provides an update on the study about respiratory processes in chromoplasts, identifying the major gaps that need to be addressed in future research. It also reviews the proteomic data of etioplasts and amyloplasts, which suggest the presence of a respiratory electron transport chain in these plastids.

  2. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  3. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae) based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments.

    Science.gov (United States)

    Wang, Zhaoshan; Du, Shuhui; Dayanandan, Selvadurai; Wang, Dongsheng; Zeng, Yanfei; Zhang, Jianguo

    2014-01-01

    Populus (Salicaceae) is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1) the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2) three advanced sections (Populus, Aigeiros and Tacamahaca) are of hybrid origin; (3) species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4) many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  4. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments.

    Directory of Open Access Journals (Sweden)

    Zhaoshan Wang

    Full Text Available Populus (Salicaceae is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1 the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2 three advanced sections (Populus, Aigeiros and Tacamahaca are of hybrid origin; (3 species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4 many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  5. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  6. Genes Sufficient for Synthesizing Peptidoglycan are Retained in Gymnosperm Genomes, and MurE from Larix gmelinii can Rescue the Albino Phenotype of Arabidopsis MurE Mutation.

    Science.gov (United States)

    Lin, Xiaofei; Li, Ningning; Kudo, Hiromi; Zhang, Zhe; Li, Jinyu; Wang, Li; Zhang, Wenbo; Takechi, Katsuaki; Takano, Hiroyoshi

    2017-03-01

    The endosymbiotic theory states that plastids are derived from a single cyanobacterial ancestor that possessed a cell wall. Peptidoglycan (PG), the main component of the bacteria cell wall, gradually degraded during plastid evolution. PG-synthesizing Mur genes have been found to be retained in the genomes of basal streptophyte plants, although many of them have been lost from the genomes of angiosperms. The enzyme encoded by bacterial MurE genes catalyzes the formation of the UDP-N-acetylmuramic acid (UDP-MurNAc) tripeptide in bacterial PG biosynthesis. Knockout of the MurE gene in the moss Physcomitrella patens resulted in defects of chloroplast division, whereas T-DNA-tagged mutants of Arabidopsis thaliana for MurE revealed inhibition of chloroplast development but not of plastid division, suggesting that AtMurE is functionally divergent from the bacterial and moss MurE proteins. Here, we could identify 10 homologs of bacterial Mur genes, including MurE, in the recently sequenced genomes of Picea abies and Pinus taeda, suggesting the retention of the plastid PG system in gymnosperms. To investigate the function of gymnosperm MurE, we isolated an ortholog of MurE from the larch, Larix gmelinii (LgMurE) and confirmed its presence as a single copy per genome, as well as its abundant expression in the leaves of larch seedlings. Analysis with a fusion protein combining green fluorescent protein and LgMurE suggested that it localizes in chloroplasts. Cross-species complementation assay with MurE mutants of A. thaliana and P. patens showed that the expression of LgMurE cDNA completely rescued the albefaction defects in A. thaliana but did not rescue the macrochloroplast phenotype in P. patens. The evolution of plastid PG and the mechanism behind the functional divergence of MurE genes are discussed in the context of information about plant genomes at different evolutionary stages. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of

  7. Dynamical behavior of psb gene transcripts in greening wheat seedlings. I. Time course of accumulation of the pshA through psbN gene transcripts during light-induced greening.

    Science.gov (United States)

    Kawaguchi, H; Fukuda, I; Shiina, T; Toyoshima, Y

    1992-11-01

    The time course of the accumulation of the transcripts from 13 psb genes encoding a major part of the proteins composing photosystem II during light-induced greening of dark-grown wheat seedlings was examined focusing on early stages of plastid development (0.5 h through 72 h). The 13 genes can be divided into three groups. (1) The psbA gene is transcribed as a single transcript of 1.3 kb in the dark-grown seedlings, but its level increases 5- to 7-fold in response to light due to selective increase in RNA stability as well as in transcription activity. (2) The psbE-F-L-J operon, psbM and psbN genes are transcribed as a single transcript of 1.1 kb, two transcripts of 0.5 and 0.7 kb and a single transcript of 0.3 kb, respectively, in the dark-grown seedlings. The levels of accumulation of every transcript remain unchanged or rather decrease during plastid development under illumination. (3) The psbK-I-D-C gene cluster and psbB-H operon exhibit fairly complicated northern hybridization patterns during the greening process. When a psbC or psbD gene probe was used for northern hybridization, five transcripts differing in length were detected in the etioplasts from 5-day old dark-grown seedlings. After 2 h illumination, two new transcripts of different length appeared. Light induction of new transcripts was also observed in the psbB-H operon.

  8. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  9. Plastid Proteomic Analysis in Tomato Fruit Development.

    Directory of Open Access Journals (Sweden)

    Miho Suzuki

    Full Text Available To better understand the mechanism of plastid differentiation from chloroplast to chromoplast, we examined proteome and plastid changes over four distinct developmental stages of 'Micro-Tom' fruit. Additionally, to discover more about the relationship between fruit color and plastid differentiation, we also analyzed and compared 'Micro-Tom' results with those from two other varieties, 'Black' and 'White Beauty'. We confirmed that proteins related to photosynthesis remain through the orange maturity stage of 'Micro-Tom', and also learned that thylakoids no longer exist at this stage. These results suggest that at a minimum there are changes in plastid morphology occurring before all related proteins change. We also compared 'Micro-Tom' fruits with 'Black' and 'White Beauty' using two-dimensional gel electrophoresis. We found a decrease of CHRC (plastid-lipid-associated protein and HrBP1 (harpin binding protein-1 in the 'Black' and 'White Beauty' varieties. CHRC is involved in carotenoid accumulation and stabilization. HrBP1 in Arabidopsis has a sequence similar to proteins in the PAP/fibrillin family. These proteins have characteristics and functions similar to lipocalin, an example of which is the transport of hydrophobic molecules. We detected spots of TIL (temperature-induced lipocalin in 2D-PAGE results, however the number of spots and their isoelectric points differed between 'Micro-Tom' and 'Black'/'White Beauty'. Lipocalin has various functions including those related to environmental stress response, apoptosis induction, membrane formation and fixation, regulation of immune response, cell growth, and metabolism adjustment. Lipocalin related proteins such as TIL and HrBP1 could be related to the accumulation of carotenoids, fruit color and the differentiation of chromoplast.

  10. Genome, Functional Gene Annotation, and Nuclear Transformation of the Heterokont Oleaginous Alga Nannochloropsis oceanica CCMP1779

    Science.gov (United States)

    2012-11-15

    development of such an algal model system for basic discovery, we sequenced the genome and two sets of transcriptomes of N. oceanica CCMP1779, assembled...CCMP1779 has a gene encoding a highly conserved violax- anthin de-epoxidase ( VDE ) protein like that found in plants (Table S9). In Arabidopsis, VDE is...HLA3 or LCI1 were present. This result suggests that CCMP1779 might have a plastid Ci transport system similar to that of Chlamydomonas, but a distinct

  11. Endosymbiosis undone by stepwise elimination of the plastid in a parasitic dinoflagellate

    KAUST Repository

    Gornik, Sebastian G.; Febrimarsa,; Cassin, Andrew M.; MacRae, James I.; Ramaprasad, Abhinay; Rchiad, ‍ Zineb; McConville, Malcolm J.; Bacic, Antony; McFadden, Geoffrey I.; Pain, Arnab; Waller, Ross F.

    2015-01-01

    Organelle gain through endosymbiosis has been integral to the origin and diversification of eukaryotes, and, once gained, plastids and mitochondria seem seldom lost. Indeed, discovery of nonphotosynthetic plastids in many eukaryotes - notably, the apicoplast in apicomplexan parasites such as the malaria pathogen Plasmodium - highlights the essential metabolic functions performed by plastids beyond photosynthesis. Once a cell becomes reliant on these ancillary functions, organelle dependence is apparently difficult to overcome. Previous examples of endosymbiotic organelle loss (either mitochondria or plastids), which have been invoked to explain the origin of eukaryotic diversity, have subsequently been recognized as organelle reduction to cryptic forms, such as mitosomes and apicoplasts. Integration of these ancient symbionts with their hosts has been too well developed to reverse. Here, we provide evidence that the dinoflagellate Hematodinium sp., a marine parasite of crustaceans, represents a rare case of endosymbiotic organelle loss by the elimination of the plastid. Extensive RNA and genomic sequencing data provide no evidence for a plastid organelle, but, rather, reveal a metabolic decoupling from known plastid functions that typically impede organelle loss. This independence has been achieved through retention of ancestral anabolic pathways, enzyme relocation from the plastid to the cytosol, and metabolic scavenging from the parasite's host. Hematodinium sp. thus represents a further dimension of endosymbiosis-life after the organelle. © 2015, National Academy of Sciences. All rights reserved.

  12. Endosymbiosis undone by stepwise elimination of the plastid in a parasitic dinoflagellate

    KAUST Repository

    Gornik, Sebastian G.

    2015-04-20

    Organelle gain through endosymbiosis has been integral to the origin and diversification of eukaryotes, and, once gained, plastids and mitochondria seem seldom lost. Indeed, discovery of nonphotosynthetic plastids in many eukaryotes - notably, the apicoplast in apicomplexan parasites such as the malaria pathogen Plasmodium - highlights the essential metabolic functions performed by plastids beyond photosynthesis. Once a cell becomes reliant on these ancillary functions, organelle dependence is apparently difficult to overcome. Previous examples of endosymbiotic organelle loss (either mitochondria or plastids), which have been invoked to explain the origin of eukaryotic diversity, have subsequently been recognized as organelle reduction to cryptic forms, such as mitosomes and apicoplasts. Integration of these ancient symbionts with their hosts has been too well developed to reverse. Here, we provide evidence that the dinoflagellate Hematodinium sp., a marine parasite of crustaceans, represents a rare case of endosymbiotic organelle loss by the elimination of the plastid. Extensive RNA and genomic sequencing data provide no evidence for a plastid organelle, but, rather, reveal a metabolic decoupling from known plastid functions that typically impede organelle loss. This independence has been achieved through retention of ancestral anabolic pathways, enzyme relocation from the plastid to the cytosol, and metabolic scavenging from the parasite\\'s host. Hematodinium sp. thus represents a further dimension of endosymbiosis-life after the organelle. © 2015, National Academy of Sciences. All rights reserved.

  13. YCF45 protein, usually associated with plastids, is targeted into the mitochondrion of Trypanosoma brucei

    Czech Academy of Sciences Publication Activity Database

    Týč, Jiří; Long, Shaojun; Jirků, Milan; Lukeš, Julius

    2010-01-01

    Roč. 173, č. 1 (2010), s. 43-47 ISSN 0166-6851 R&D Projects: GA ČR GA204/09/1667 Institutional research plan: CEZ:AV0Z60220518 Keywords : Trypanosoma * Plastid * Mitochondrion * Targeting * YCF45 * Horizontal gene transfer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.875, year: 2010

  14. Design of chimeric expression elements that confer high-level gene activity in chromoplasts.

    Science.gov (United States)

    Caroca, Rodrigo; Howell, Katharine A; Hasse, Claudia; Ruf, Stephanie; Bock, Ralph

    2013-02-01

    Non-green plastids, such as chromoplasts, generally have much lower activity of gene expression than chloroplasts in photosynthetically active tissues. Suppression of plastid genes in non-green tissues occurs through a complex interplay of transcriptional and translational control, with the contribution of regulation of transcript abundance versus translational activity being highly variable between genes. Here, we have investigated whether the low expression of the plastid genome in chromoplasts results from inherent limitations in gene expression capacity, or can be overcome by designing appropriate combinations of promoters and translation initiation signals in the 5' untranslated region (5'-UTR). We constructed chimeric expression elements that combine promoters and 5'-UTRs from plastid genes, which are suppressed during chloroplast-to-chromoplast conversion in Solanum lycopersicum (tomato) fruit ripening, either just at the translational level or just at the level of mRNA accumulation. These chimeric expression elements were introduced into the tomato plastid genome by stable chloroplast transformation. We report the identification of promoter-UTR combinations that confer high-level gene expression in chromoplasts of ripe tomato fruits, resulting in the accumulation of reporter protein GFP to up to 1% of total cellular protein. Our work demonstrates that non-green plastids are capable of expressing genes to high levels. Moreover, the chimeric cis-elements for chromoplasts developed here are widely applicable in basic and applied research using transplastomic methods. © 2012 The Authors The Plant Journal © 2012 Blackwell Publishing Ltd.

  15. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  16. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  17. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  18. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  19. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  20. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  1. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  2. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  3. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  4. A functional TOC complex contributes to gravity signal transduction in Arabidopsis.

    Science.gov (United States)

    Strohm, Allison K; Barrett-Wilt, Greg A; Masson, Patrick H

    2014-01-01

    Although plastid sedimentation has long been recognized as important for a plant's perception of gravity, it was recently shown that plastids play an additional function in gravitropism. The Translocon at the Outer envelope membrane of Chloroplasts (TOC) complex transports nuclear-encoded proteins into plastids, and a receptor of this complex, Toc132, was previously hypothesized to contribute to gravitropism either by directly functioning as a gravity signal transducer or by indirectly mediating the plastid localization of a gravity signal transducer. Here we show that mutations in multiple genes encoding TOC complex components affect gravitropism in a genetically sensitized background and that the cytoplasmic acidic domain of Toc132 is not required for its involvement in this process. Furthermore, mutations in TOC132 enhance the gravitropic defect of a mutant whose amyloplasts lack starch. Finally, we show that the levels of several nuclear-encoded root proteins are altered in toc132 mutants. These data suggest that the TOC complex indirectly mediates gravity signal transduction in Arabidopsis and support the idea that plastids are involved in gravitropism not only through their ability to sediment but also as part of the signal transduction mechanism.

  5. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  6. Still acting green: continued expression of photosynthetic genes in the heterotrophic Dinoflagellate Pfiesteria piscicida (Peridiniales, Alveolata.

    Directory of Open Access Journals (Sweden)

    Gwang Hoon Kim

    Full Text Available The loss of photosynthetic function should lead to the cessation of expression and finally loss of photosynthetic genes in the new heterotroph. Dinoflagellates are known to have lost their photosynthetic ability several times. Dinoflagellates have also acquired photosynthesis from other organisms, either on a long-term basis or as "kleptoplastids" multiple times. The fate of photosynthetic gene expression in heterotrophs can be informative into evolution of gene expression patterns after functional loss, and the dinoflagellates ability to acquire new photosynthetic function through additional endosymbiosis. To explore this we analyzed a large-scale EST database consisting of 151,091 unique sequences (29,170 contigs, 120,921 singletons obtained from 454 pyrosequencing of the heterotrophic dinoflagellate Pfiesteria piscicida. About 597 contigs from P. piscicida showed significant homology (E-value plastid and photosynthetic function. Most of the genes involved in the Calvin-Benson cycle were found, genes of the light-dependent reaction were also identified. Also genes of associated pathways including the chorismate pathway and genes involved in starch metabolism were discovered. BLAST searches and phylogenetic analysis suggest that these plastid-associated genes originated from several different photosynthetic ancestors. The Calvin-Benson cycle genes are mostly associated with genes derived from the secondary plastids of peridinin-containing dinoflagellates, while the light-harvesting genes are derived from diatoms, or diatoms that are tertiary plastids in other dinoflagellates. The continued expression of many genes involved in photosynthetic pathways indicates that the loss of transcriptional regulation may occur well after plastid loss and could explain the organism's ability to "capture" new plastids (i.e. different secondary endosymbiosis or tertiary symbioses to renew photosynthetic function.

  7. Still acting green: continued expression of photosynthetic genes in the heterotrophic Dinoflagellate Pfiesteria piscicida (Peridiniales, Alveolata).

    Science.gov (United States)

    Kim, Gwang Hoon; Jeong, Hae Jin; Yoo, Yeong Du; Kim, Sunju; Han, Ji Hee; Han, Jong Won; Zuccarello, Giuseppe C

    2013-01-01

    The loss of photosynthetic function should lead to the cessation of expression and finally loss of photosynthetic genes in the new heterotroph. Dinoflagellates are known to have lost their photosynthetic ability several times. Dinoflagellates have also acquired photosynthesis from other organisms, either on a long-term basis or as "kleptoplastids" multiple times. The fate of photosynthetic gene expression in heterotrophs can be informative into evolution of gene expression patterns after functional loss, and the dinoflagellates ability to acquire new photosynthetic function through additional endosymbiosis. To explore this we analyzed a large-scale EST database consisting of 151,091 unique sequences (29,170 contigs, 120,921 singletons) obtained from 454 pyrosequencing of the heterotrophic dinoflagellate Pfiesteria piscicida. About 597 contigs from P. piscicida showed significant homology (E-value plastid and photosynthetic function. Most of the genes involved in the Calvin-Benson cycle were found, genes of the light-dependent reaction were also identified. Also genes of associated pathways including the chorismate pathway and genes involved in starch metabolism were discovered. BLAST searches and phylogenetic analysis suggest that these plastid-associated genes originated from several different photosynthetic ancestors. The Calvin-Benson cycle genes are mostly associated with genes derived from the secondary plastids of peridinin-containing dinoflagellates, while the light-harvesting genes are derived from diatoms, or diatoms that are tertiary plastids in other dinoflagellates. The continued expression of many genes involved in photosynthetic pathways indicates that the loss of transcriptional regulation may occur well after plastid loss and could explain the organism's ability to "capture" new plastids (i.e. different secondary endosymbiosis or tertiary symbioses) to renew photosynthetic function.

  8. Re-evaluating the green versus red signal in eukaryotes with secondary plastid of red algal origin

    Czech Academy of Sciences Publication Activity Database

    Burki, F.; Flegontov, Pavel; Oborník, Miroslav; Cihlář, Jaromír; Pain, A.; Lukeš, Julius; Keeling, P. J.

    2012-01-01

    Roč. 4, č. 6 (2012), s. 738-747 ISSN 1759-6653 R&D Projects: GA ČR GAP506/12/1522; GA ČR GBP501/12/G055 Institutional support: RVO:60077344 Keywords : Endosymbiotic gene transfer * plastid evolution * protist * algae * chromera Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.759, year: 2012

  9. Identification and characterization of plastid-type proteins from sequence-attributed features using machine learning

    Science.gov (United States)

    2013-01-01

    Background Plastids are an important component of plant cells, being the site of manufacture and storage of chemical compounds used by the cell, and contain pigments such as those used in photosynthesis, starch synthesis/storage, cell color etc. They are essential organelles of the plant cell, also present in algae. Recent advances in genomic technology and sequencing efforts is generating a huge amount of DNA sequence data every day. The predicted proteome of these genomes needs annotation at a faster pace. In view of this, one such annotation need is to develop an automated system that can distinguish between plastid and non-plastid proteins accurately, and further classify plastid-types based on their functionality. We compared the amino acid compositions of plastid proteins with those of non-plastid ones and found significant differences, which were used as a basis to develop various feature-based prediction models using similarity-search and machine learning. Results In this study, we developed separate Support Vector Machine (SVM) trained classifiers for characterizing the plastids in two steps: first distinguishing the plastid vs. non-plastid proteins, and then classifying the identified plastids into their various types based on their function (chloroplast, chromoplast, etioplast, and amyloplast). Five diverse protein features: amino acid composition, dipeptide composition, the pseudo amino acid composition, Nterminal-Center-Cterminal composition and the protein physicochemical properties are used to develop SVM models. Overall, the dipeptide composition-based module shows the best performance with an accuracy of 86.80% and Matthews Correlation Coefficient (MCC) of 0.74 in phase-I and 78.60% with a MCC of 0.44 in phase-II. On independent test data, this model also performs better with an overall accuracy of 76.58% and 74.97% in phase-I and phase-II, respectively. The similarity-based PSI-BLAST module shows very low performance with about 50% prediction

  10. Systematics and plastid genome evolution of the cryptically photosynthetic parasitic plant genus Cuscuta (Convolvulaceae

    Directory of Open Access Journals (Sweden)

    Kuehl Jennifer V

    2007-12-01

    Full Text Available Abstract Background The genus Cuscuta L. (Convolvulaceae, commonly known as dodders, are epiphytic vines that invade the stems of their host with haustorial feeding structures at the points of contact. Although they lack expanded leaves, some species are noticeably chlorophyllous, especially as seedlings and in maturing fruits. Some species are reported as crop pests of worldwide distribution, whereas others are extremely rare and have local distributions and apparent niche specificity. A strong phylogenetic framework for this large genus is essential to understand the interesting ecological, morphological and molecular phenomena that occur within these parasites in an evolutionary context. Results Here we present a well-supported phylogeny of Cuscuta using sequences of the nuclear ribosomal internal transcribed spacer and plastid rps2, rbcL and matK from representatives across most of the taxonomic diversity of the genus. We use the phylogeny to interpret morphological and plastid genome evolution within the genus. At least three currently recognized taxonomic sections are not monophyletic and subgenus Cuscuta is unequivocally paraphyletic. Plastid genes are extremely variable with regards to evolutionary constraint, with rbcL exhibiting even higher levels of purifying selection in Cuscuta than photosynthetic relatives. Nuclear genome size is highly variable within Cuscuta, particularly within subgenus Grammica, and in some cases may indicate the existence of cryptic species in this large clade of morphologically similar species. Conclusion Some morphological characters traditionally used to define major taxonomic splits within Cuscuta are homoplastic and are of limited use in defining true evolutionary groups. Chloroplast genome evolution seems to have evolved in a punctuated fashion, with episodes of loss involving suites of genes or tRNAs followed by stabilization of gene content in major clades. Nearly all species of Cuscuta retain some

  11. Systematics and plastid genome evolution of the cryptically photosynthetic parasitic plant genus Cuscuta (Convolvulaceae).

    Science.gov (United States)

    McNeal, Joel R; Arumugunathan, Kathiravetpilla; Kuehl, Jennifer V; Boore, Jeffrey L; Depamphilis, Claude W

    2007-12-13

    The genus Cuscuta L. (Convolvulaceae), commonly known as dodders, are epiphytic vines that invade the stems of their host with haustorial feeding structures at the points of contact. Although they lack expanded leaves, some species are noticeably chlorophyllous, especially as seedlings and in maturing fruits. Some species are reported as crop pests of worldwide distribution, whereas others are extremely rare and have local distributions and apparent niche specificity. A strong phylogenetic framework for this large genus is essential to understand the interesting ecological, morphological and molecular phenomena that occur within these parasites in an evolutionary context. Here we present a well-supported phylogeny of Cuscuta using sequences of the nuclear ribosomal internal transcribed spacer and plastid rps2, rbcL and matK from representatives across most of the taxonomic diversity of the genus. We use the phylogeny to interpret morphological and plastid genome evolution within the genus. At least three currently recognized taxonomic sections are not monophyletic and subgenus Cuscuta is unequivocally paraphyletic. Plastid genes are extremely variable with regards to evolutionary constraint, with rbcL exhibiting even higher levels of purifying selection in Cuscuta than photosynthetic relatives. Nuclear genome size is highly variable within Cuscuta, particularly within subgenus Grammica, and in some cases may indicate the existence of cryptic species in this large clade of morphologically similar species. Some morphological characters traditionally used to define major taxonomic splits within Cuscuta are homoplastic and are of limited use in defining true evolutionary groups. Chloroplast genome evolution seems to have evolved in a punctuated fashion, with episodes of loss involving suites of genes or tRNAs followed by stabilization of gene content in major clades. Nearly all species of Cuscuta retain some photosynthetic ability, most likely for nutrient

  12. Plant hormone cytokinins control cell cycle progression and plastid replication in apicomplexan parasites.

    Science.gov (United States)

    Andrabi, Syed Bilal Ahmad; Tahara, Michiru; Matsubara, Ryuma; Toyama, Tomoko; Aonuma, Hiroka; Sakakibara, Hitoshi; Suematsu, Makoto; Tanabe, Kazuyuki; Nozaki, Tomoyoshi; Nagamune, Kisaburo

    2018-02-01

    Cytokinins are plant hormones that are involved in regulation of cell proliferation, cell cycle progression, and cell and plastid development. Here, we show that the apicomplexan parasites Toxoplasma gondii and Plasmodium berghei, an opportunistic human pathogen and a rodent malaria agent, respectively, produce cytokinins via a biosynthetic pathway similar to that in plants. Cytokinins regulate the growth and cell cycle progression of T. gondii by mediating expression of the cyclin gene TgCYC4. A natural form of cytokinin, trans-zeatin (t-zeatin), upregulated expression of this cyclin, while a synthetic cytokinin, thidiazuron, downregulated its expression. Immunofluorescence microscopy and quantitative PCR analysis showed that t-zeatin increased the genome-copy number of apicoplast, which are non-photosynthetic plastid, in the parasite, while thidiazuron led to their disappearance. Thidiazuron inhibited growth of T. gondii and Plasmodium falciparum, a human malaria parasite, suggesting that thidiazuron has therapeutic potential as an inhibitor of apicomplexan parasites. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  14. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  15. On being the right size as an animal with plastids

    NARCIS (Netherlands)

    C. Rauch (Cessa); P. Jahns (Peter); A.G.M. Tielens (Aloysius); D.B. Gould (Douglas ); W.F. Martin (William F.)

    2017-01-01

    textabstractPlastids typically reside in plant or algal cells—with one notable exception. There is one group of multicellular animals, sea slugs in the order Sacoglossa, members of which feed on siphonaceous algae. The slugs sequester the ingested plastids in the cytosol of cells in their digestive

  16. On Being the Right Size as an Animal with Plastids

    NARCIS (Netherlands)

    Rauch, Cessa; Jahns, Peter; Tielens, Aloysius G M; Gould, Sven B; Martin, William F

    2017-01-01

    Plastids typically reside in plant or algal cells-with one notable exception. There is one group of multicellular animals, sea slugs in the order Sacoglossa, members of which feed on siphonaceous algae. The slugs sequester the ingested plastids in the cytosol of cells in their digestive gland,

  17. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  18. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  19. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  20. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  1. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  2. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  3. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  4. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  5. Reference: 304 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available genous carbon sources. Expression patterns of the plastid-encoded genes in the corr...teins (pTACs), have not yet been described. T-DNA insertions in three corresponding genes, ptac2, -6, and -12, are lethal without exo

  6. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  7. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  8. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  9. A contemplation on the secondary origin of green algal and plant plastids

    Directory of Open Access Journals (Sweden)

    Eunsoo Kim

    2014-12-01

    Full Text Available A single origin of plastids and the monophyly of three “primary” plastid-containing groups – the Chloroplastida (or Viridiplantae; green algae+land plants, Rhodophyta, and Glaucophyta – are widely accepted, mainstream hypotheses that form the basis for many comparative evolutionary studies. This “Archaeplastida” hypothesis, however, thus far has not been unambiguously confirmed by phylogenetic studies based on nucleocytoplasmic markers. In view of this as well as other lines of evidence, we suggest the testing of an alternate hypothesis that plastids of the Chloroplastida are of secondary origin. The new hypothesis is in agreement with, or perhaps better explains, existing data, including both the plastidal and nucleocytoplasmic characteristics of the Chloroplastida in comparison to those of other groups.

  10. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  11. Photosynthetic and Heterotrophic Ferredoxin Isoproteins Are Colocalized in Fruit Plastids of Tomato1

    Science.gov (United States)

    Aoki, Koh; Yamamoto, Miyuki; Wada, Keishiro

    1998-01-01

    Fruit tissues of tomato (Lycopersicon esculentum Mill.) contain both photosynthetic and heterotrophic ferredoxin (FdA and FdE, respectively) isoproteins, irrespective of their photosynthetic competence, but we did not previously determine whether these proteins were colocalized in the same plastids. In isolated fruit chloroplasts and chromoplasts, both FdA and FdE were detected by immunoblotting. Colocalization of FdA and FdE in the same plastids was demonstrated using double-staining immunofluorescence microscopy. We also found that FdA and FdE were colocalized in fruit chloroplasts and chloroamyloplasts irrespective of sink status of the plastid. Immunoelectron microscopy demonstrated that FdA and FdE were randomly distributed within the plastid stroma. To investigate the significance of the heterotrophic Fd in fruit plastids, Glucose 6-phosphate dehydrogenase (G6PDH) activity was measured in isolated fruit and leaf plastids. Fruit chloroplasts and chromoplasts showed much higher G6PDH activity than did leaf chloroplasts, suggesting that high G6PDH activity is linked with FdE to maintain nonphotosynthetic production of reducing power. This result suggested that, despite their morphological resemblance, fruit chloroplasts are functionally different from their leaf counterparts. PMID:9765529

  12. Interdependency of formation and localisation of the Min complex controls symmetric plastid division.

    Science.gov (United States)

    Maple, Jodi; Møller, Simon G

    2007-10-01

    Plastid division represents a fundamental biological process essential for plant development; however, the molecular basis of symmetric plastid division is unclear. AtMinE1 plays a pivotal role in selection of the plastid division site in concert with AtMinD1. AtMinE1 localises to discrete foci in chloroplasts and interacts with AtMinD1, which shows a similar localisation pattern. Here, we investigate the importance of Min protein complex formation during the chloroplast division process. Dissection of the assembly of the Min protein complex and determination of the interdependency of complex assembly and localisation in planta allow us to present a model of the molecular basis of selection of the division site in plastids. Moreover, functional analysis of AtMinE1 in bacteria demonstrates the level of functional conservation and divergence of the plastidic MinE proteins.

  13. NDH expression marks major transitions in plant evolution and reveals coordinate intracellular gene loss.

    Science.gov (United States)

    Ruhlman, Tracey A; Chang, Wan-Jung; Chen, Jeremy J W; Huang, Yao-Ting; Chan, Ming-Tsair; Zhang, Jin; Liao, De-Chih; Blazier, John C; Jin, Xiaohua; Shih, Ming-Che; Jansen, Robert K; Lin, Choun-Sea

    2015-04-11

    Key innovations have facilitated novel niche utilization, such as the movement of the algal predecessors of land plants into terrestrial habitats where drastic fluctuations in light intensity, ultraviolet radiation and water limitation required a number of adaptations. The NDH (NADH dehydrogenase-like) complex of Viridiplantae plastids participates in adapting the photosynthetic response to environmental stress, suggesting its involvement in the transition to terrestrial habitats. Although relatively rare, the loss or pseudogenization of plastid NDH genes is widely distributed across diverse lineages of photoautotrophic seed plants and mutants/transgenics lacking NDH function demonstrate little difference from wild type under non-stressed conditions. This study analyzes large transcriptomic and genomic datasets to evaluate the persistence and loss of NDH expression across plants. Nuclear expression profiles showed accretion of the NDH gene complement at key transitions in land plant evolution, such as the transition to land and at the base of the angiosperm lineage. While detection of transcripts for a selection of non-NDH, photosynthesis related proteins was independent of the state of NDH, coordinate, lineage-specific loss of plastid NDH genes and expression of nuclear-encoded NDH subunits was documented in Pinaceae, gnetophytes, Orchidaceae and Geraniales confirming the independent and complete loss of NDH in these diverse seed plant taxa. The broad phylogenetic distribution of NDH loss and the subtle phenotypes of mutants suggest that the NDH complex is of limited biological significance in contemporary plants. While NDH activity appears dispensable under favorable conditions, there were likely sufficiently frequent episodes of abiotic stress affecting terrestrial habitats to allow the retention of NDH activity. These findings reveal genetic factors influencing plant/environment interactions in a changing climate through 450 million years of land plant

  14. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  15. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  16. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  17. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  18. Complete plastid genome sequencing of Trochodendraceae reveals a significant expansion of the inverted repeat and suggests a Paleogene divergence between the two extant species.

    Directory of Open Access Journals (Sweden)

    Yan-xia Sun

    Full Text Available The early-diverging eudicot order Trochodendrales contains only two monospecific genera, Tetracentron and Trochodendron. Although an extensive fossil record indicates that the clade is perhaps 100 million years old and was widespread throughout the Northern Hemisphere during the Paleogene and Neogene, the two extant genera are both narrowly distributed in eastern Asia. Recent phylogenetic analyses strongly support a clade of Trochodendrales, Buxales, and Gunneridae (core eudicots, but complete plastome analyses do not resolve the relationships among these groups with strong support. However, plastid phylogenomic analyses have not included data for Tetracentron. To better resolve basal eudicot relationships and to clarify when the two extant genera of Trochodendrales diverged, we sequenced the complete plastid genome of Tetracentron sinense using Illumina technology. The Tetracentron and Trochodendron plastomes possess the typical gene content and arrangement that characterize most angiosperm plastid genomes, but both genomes have the same unusual ∼4 kb expansion of the inverted repeat region to include five genes (rpl22, rps3, rpl16, rpl14, and rps8 that are normally found in the large single-copy region. Maximum likelihood analyses of an 83-gene, 88 taxon angiosperm data set yield an identical tree topology as previous plastid-based trees, and moderately support the sister relationship between Buxaceae and Gunneridae. Molecular dating analyses suggest that Tetracentron and Trochodendron diverged between 44-30 million years ago, which is congruent with the fossil record of Trochodendrales and with previous estimates of the divergence time of these two taxa. We also characterize 154 simple sequence repeat loci from the Tetracentron sinense and Trochodendron aralioides plastomes that will be useful in future studies of population genetic structure for these relict species, both of which are of conservation concern.

  19. Comparative ultrastructure of fruit plastids in three genetically diverse genotypes of apple (Malus × domestica Borkh.) during development

    Science.gov (United States)

    Schaeffer, Scott M.; Christian, Ryan; Castro-Velasquez, Nohely; Hyden, Brennan; Lynch-Holm, Valerie

    2017-01-01

    Plastids are the defining organelle for a plant cell and are critical for myriad metabolic functions. The role of leaf plastid, chloroplast, is extensively documented; however, fruit plastids—chromoplasts—are poorly understood, especially in the context of the diverse metabolic processes operating in these diverse plant organs. Recently, in a comparative study of the predicted plastid-targeted proteomes across seven plant species, we reported that each plant species is predicted to harbor a unique set of plastid-targeted proteins. However, the temporal and developmental context of these processes remains unknown. In this study, an ultrastructural analysis approach was used to characterize fruit plastids in the epidermal and collenchymal cell layers at 11 developmental timepoints in three genotypes of apple (Malus × domestica Borkh.): chlorophyll-predominant ‘Granny Smith’, carotenoid-predominant ‘Golden Delicious’, and anthocyanin-predominant ‘Top Red Delicious’. Plastids transitioned from a proplastid-like plastid to a chromoplast-like plastid in epidermis cells, while in the collenchyma cells, they transitioned from a chloroplast-like plastid to a chloro-chromo-amyloplast plastid. Plastids in the collenchyma cells of the three genotypes demonstrated a diverse array of structures and features. This study enabled the identification of discrete developmental stages during which specific functions are most likely being performed by the plastids as indicated by accumulation of plastoglobuli, starch granules, and other sub-organeller structures. Information regarding the metabolically active developmental stages is expected to facilitate biologically relevant omics studies to unravel the complex biochemistry of plastids in perennial non-model systems. PMID:28698906

  20. A Cytosolic Arabidopsis d-Xylulose Kinase Catalyzes the Phosphorylation of 1-Deoxy-d-Xylulose into a Precursor of the Plastidial Isoprenoid Pathway1

    Science.gov (United States)

    Hemmerlin, Andréa; Tritsch, Denis; Hartmann, Michael; Pacaud, Karine; Hoeffler, Jean-François; van Dorsselaer, Alain; Rohmer, Michel; Bach, Thomas J.

    2006-01-01

    Plants are able to integrate exogenous 1-deoxy-d-xylulose (DX) into the 2C-methyl-d-erythritol 4-phosphate pathway, implicated in the biosynthesis of plastidial isoprenoids. Thus, the carbohydrate needs to be phosphorylated into 1-deoxy-d-xylulose 5-phosphate and translocated into plastids, or vice versa. An enzyme capable of phosphorylating DX was partially purified from a cell-free Arabidopsis (Arabidopsis thaliana) protein extract. It was identified by mass spectrometry as a cytosolic protein bearing d-xylulose kinase (XK) signatures, already suggesting that DX is phosphorylated within the cytosol prior to translocation into the plastids. The corresponding cDNA was isolated and enzymatic properties of a recombinant protein were determined. In Arabidopsis, xylulose kinases are encoded by a small gene family, in which only two genes are putatively annotated. The additional gene is coding for a protein targeted to plastids, as was proved by colocalization experiments using green fluorescent protein fusion constructs. Functional complementation assays in an Escherichia coli strain deleted in xk revealed that the cytosolic enzyme could exclusively phosphorylate xylulose in vivo, not the enzyme that is targeted to plastids. xk activities could not be detected in chloroplast protein extracts or in proteins isolated from its ancestral relative Synechocystis sp. PCC 6803. The gene encoding the plastidic protein annotated as “xylulose kinase” might in fact yield an enzyme having different phosphorylation specificities. The biochemical characterization and complementation experiments with DX of specific Arabidopsis knockout mutants seedlings treated with oxo-clomazone, an inhibitor of 1-deoxy-d-xylulose 5-phosphate synthase, further confirmed that the cytosolic protein is responsible for the phosphorylation of DX in planta. PMID:16920870

  1. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  2. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  3. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  4. Vesicles Are Persistent Features of Different Plastids.

    Science.gov (United States)

    Lindquist, Emelie; Solymosi, Katalin; Aronsson, Henrik

    2016-10-01

    Peripheral vesicles in plastids have been observed repeatedly, primarily in proplastids and developing chloroplasts, in which they are suggested to function in thylakoid biogenesis. Previous observations of vesicles in mature chloroplasts have mainly concerned low temperature pretreated plants occasionally treated with inhibitors blocking vesicle fusion. Here, we show that such vesicle-like structures occur not only in chloroplasts and proplastids, but also in etioplasts, etio-chloroplasts, leucoplasts, chromoplasts and even transforming desiccoplasts without any specific pretreatment. Observations are made both in C3 and C4 species, in different cell types (meristematic, epidermis, mesophyll, bundle sheath and secretory cells) and different organs (roots, stems, leaves, floral parts and fruits). Until recently not much focus has been given to the idea that vesicle transport in chloroplasts could be mediated by proteins, but recent data suggest that the vesicle system of chloroplasts has similarities with the cytosolic coat protein complex II system. All current data taken together support the idea of an ongoing, active and protein-mediated vesicle transport not only in chloroplasts but also in other plastids, obviously occurring regardless of chemical modifications, temperature and plastid developmental stage. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  6. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  7. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  8. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  9. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  10. Comparative ultrastructure of fruit plastids in three genetically diverse genotypes of apple (Malus × domestica Borkh.) during development.

    Science.gov (United States)

    Schaeffer, Scott M; Christian, Ryan; Castro-Velasquez, Nohely; Hyden, Brennan; Lynch-Holm, Valerie; Dhingra, Amit

    2017-10-01

    Comparative ultrastructural developmental time-course analysis has identified discrete stages at which the fruit plastids undergo structural and consequently functional transitions to facilitate subsequent development-guided understanding of the complex plastid biology. Plastids are the defining organelle for a plant cell and are critical for myriad metabolic functions. The role of leaf plastid, chloroplast, is extensively documented; however, fruit plastids-chromoplasts-are poorly understood, especially in the context of the diverse metabolic processes operating in these diverse plant organs. Recently, in a comparative study of the predicted plastid-targeted proteomes across seven plant species, we reported that each plant species is predicted to harbor a unique set of plastid-targeted proteins. However, the temporal and developmental context of these processes remains unknown. In this study, an ultrastructural analysis approach was used to characterize fruit plastids in the epidermal and collenchymal cell layers at 11 developmental timepoints in three genotypes of apple (Malus × domestica Borkh.): chlorophyll-predominant 'Granny Smith', carotenoid-predominant 'Golden Delicious', and anthocyanin-predominant 'Top Red Delicious'. Plastids transitioned from a proplastid-like plastid to a chromoplast-like plastid in epidermis cells, while in the collenchyma cells, they transitioned from a chloroplast-like plastid to a chloro-chromo-amyloplast plastid. Plastids in the collenchyma cells of the three genotypes demonstrated a diverse array of structures and features. This study enabled the identification of discrete developmental stages during which specific functions are most likely being performed by the plastids as indicated by accumulation of plastoglobuli, starch granules, and other sub-organeller structures. Information regarding the metabolically active developmental stages is expected to facilitate biologically relevant omics studies to unravel the complex

  11. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    Science.gov (United States)

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  12. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  13. Genomic Resources of Three Pulsatilla Species Reveal Evolutionary Hotspots, Species-Specific Sites and Variable Plastid Structure in the Family Ranunculaceae.

    Science.gov (United States)

    Szczecińska, Monika; Sawicki, Jakub

    2015-09-15

    The European continent is presently colonized by nine species of the genus Pulsatilla, five of which are encountered only in mountainous regions of southwest and south-central Europe. The remaining four species inhabit lowlands in the north-central and eastern parts of the continent. Most plants of the genus Pulsatilla are rare and endangered, which is why most research efforts focused on their biology, ecology and hybridization. The objective of this study was to develop genomic resources, including complete plastid genomes and nuclear rRNA clusters, for three sympatric Pulsatilla species that are most commonly found in Central Europe. The results will supply valuable information about genetic variation, which can be used in the process of designing primers for population studies and conservation genetics research. The complete plastid genomes together with the nuclear rRNA cluster can serve as a useful tool in hybridization studies. Six complete plastid genomes and nuclear rRNA clusters were sequenced from three species of Pulsatilla using the Illumina sequencing technology. Four junctions between single copy regions and inverted repeats and junctions between the identified locally-collinear blocks (LCB) were confirmed by Sanger sequencing. Pulsatilla genomes of 120 unique genes had a total length of approximately 161-162 kb, and 21 were duplicated in the inverted repeats (IR) region. Comparative plastid genomes of newly-sequenced Pulsatilla and the previously-identified plastomes of Aconitum and Ranunculus species belonging to the family Ranunculaceae revealed several variations in the structure of the genome, but the gene content remained constant. The nuclear rRNA cluster (18S-ITS1-5.8S-ITS2-26S) of studied Pulsatilla species is 5795 bp long. Among five analyzed regions of the rRNA cluster, only Internal Transcribed Spacer 2 (ITS2) enabled the molecular delimitation of closely-related Pulsatilla patens and Pulsatilla vernalis. The determination of complete

  14. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  15. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  16. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  17. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  18. Expression of chloroperoxidase from Pseudomonas pyrrocinia in tobacco plastids for fungal resistance.

    Science.gov (United States)

    Ruhlman, Tracey A; Rajasekaran, Kanniah; Cary, Jeffrey W

    2014-11-01

    The chloroperoxidase (cpo) gene from Pseudomonas pyrrocinia was transformed into the plastid genome (plastome) of Nicotiana tabacum var. Petit Havana and transplastomic lines were compared with a nuclear transformant for the same gene. Southern analysis confirmed integration in the plastome and western blotting confirmed the presence of the chloroperoxidase protein (CPO) in higher abundance in transplastomic plants than in cpo nuclear transformants. Northern analysis of primary plastome transformants for cpo showed 15-fold higher transcript abundance than in the nuclear transformant, yet this extent of enhancement was not observed in western blot, enzyme or bioassay, indicating a bottleneck at the post-transcriptional level. Representative plants from the two transplastomic lines showed resistance to fungal pathogens in vitro (Aspergillus flavus, Fusarium verticillioides, and Verticillium dahliae) and in planta (Alternaria alternata). Published by Elsevier Ireland Ltd.

  19. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  20. Heterologous expression of a plastid EF-Tu reduces protein thermal aggregation and enhances CO2 fixation in wheat (Triticum aestivum) following heat stress.

    Science.gov (United States)

    Fu, Jianming; Momcilović, Ivana; Clemente, Thomas E; Nersesian, Natalya; Trick, Harold N; Ristic, Zoran

    2008-10-01

    Heat stress is a major constraint to wheat production and negatively impacts grain quality, causing tremendous economic losses, and may become a more troublesome factor due to global warming. At the cellular level, heat stress causes denaturation and aggregation of proteins and injury to membranes leading to alterations in metabolic fluxes. Protein aggregation is irreversible, and protection of proteins from thermal aggregation is a strategy a cell uses to tolerate heat stress. Here we report on the development of transgenic wheat (Triticum aestivum) events, expressing a maize gene coding for plastidal protein synthesis elongation factor (EF-Tu), which, compared to non-transgenic plants, display reduced thermal aggregation of leaf proteins, reduced heat injury to photosynthetic membranes (thylakoids), and enhanced rate of CO(2) fixation after exposure to heat stress. The results support the concept that EF-Tu ameliorates negative effects of heat stress by acting as a molecular chaperone. This is the first demonstration of the introduction of a plastidal EF-Tu in plants that leads to protection against heat injury and enhanced photosynthesis after heat stress. This is also the first demonstration that a gene other than HSP gene can be used for improvement of heat tolerance and that the improvement is possible in a species that has a complex genome, hexaploid wheat. The results strongly suggest that heat tolerance of wheat, and possibly other crop plants, can be improved by modulating expression of plastidal EF-Tu and/or by selection of genotypes with increased endogenous levels of this protein.

  1. Plastid-bearing sea slugs fix CO2 in the light but do not require photosynthesis to survive

    NARCIS (Netherlands)

    Christa, Gregor; Zimorski, Verena; Woehle, Christian; Tielens, Aloysius G M; Wägele, Heike; Martin, William F; Gould, Sven B

    2014-01-01

    Several sacoglossan sea slugs (Plakobranchoidea) feed upon plastids of large unicellular algae. Four species--called long-term retention (LtR) species--are known to sequester ingested plastids within specialized cells of the digestive gland. There, the stolen plastids (kleptoplasts) remain

  2. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  3. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  4. Phylogeny of Celastraceae tribe Euonymeae inferred from morphological characters and nuclear and plastid genes.

    Science.gov (United States)

    Simmons, Mark P; McKenna, Miles J; Bacon, Christine D; Yakobson, Kendra; Cappa, Jennifer J; Archer, Robert H; Ford, Andrew J

    2012-01-01

    The phylogeny of Celastraceae tribe Euonymeae (≈ 230 species in eight genera in both the Old and New Worlds) was inferred using morphological characters together with plastid (matK, trnL-F) and nuclear (ITS and 26S rDNA) genes. Tribe Euonymeae has been defined as those genera of Celastraceae with generally opposite leaves, isomerous carpels, loculicidally dehiscent capsules, and arillate seeds (except Microtropis). Euonymus is the most diverse (129 species) and widely cultivated genus in the tribe. We infer that tribe Euonymeae consists of at least six separate lineages within Celastraceae and that a revised natural classification of the family is needed. Microtropis and Quetzalia are inferred to be distinct sister groups that together are sister to Zinowiewia. The endangered Monimopetalum chinense is an isolated and early derived lineage of Celastraceae that represents an important component of phylogenetic diversity within the family. Hedraianthera is sister to Brassiantha, and we describe a second species (Brassiantha hedraiantheroides A.J. Ford) that represents the first reported occurrence of this genus in Australia. Euonymus globularis, from eastern Australia, is sister to Menepetalum, which is endemic to New Caledonia, and we erect a new genus (Dinghoua R.H. Archer) for it. The Madagascan species of Euonymus are sister to Pleurostylia and recognized as a distinct genus (Astrocassine ined.). Glyptopetalum, Torralbasia, and Xylonymus are all closely related to Euonymus sensu stricto and are questionably distinct from it. Current intrageneric classifications of Euonymus are not completely natural and require revision. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  6. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  7. Plastome Evolution in the Sole Hemiparasitic Genus Laurel Dodder (Cassytha) and Insights into the Plastid Phylogenomics of Lauraceae.

    Science.gov (United States)

    Wu, Chung-Shien; Wang, Ting-Jen; Wu, Chia-Wen; Wang, Ya-Nan; Chaw, Shu-Miaw

    2017-10-01

    To date, little is known about the evolution of plastid genomes (plastomes) in Lauraceae. As one of the top five largest families in tropical forests, the Lauraceae contain many species that are important ecologically and economically. Lauraceous species also provide wonderful materials to study the evolutionary trajectory in response to parasitism because they contain both nonparasitic and parasitic species. This study compared the plastomes of nine Lauraceous species, including the sole hemiparasitic and herbaceous genus Cassytha (laurel dodder; here represented by Cassytha filiformis). We found differential contractions of the canonical inverted repeat (IR), resulting in two IR types present in Lauraceae. These two IR types reinforce Cryptocaryeae and Neocinnamomum-Perseeae-Laureae as two separate clades. Our data reveal several traits unique to Cas. filiformis, including loss of IRs, loss or pseudogenization of 11 ndh and rpl23 genes, richness of repeats, and accelerated rates of nucleotide substitutions in protein-coding genes. Although Cas. filiformis is low in chlorophyll content, our analysis based on dN/dS ratios suggests that both its plastid house-keeping and photosynthetic genes are under strong selective constraints. Hence, we propose that short generation time and herbaceous lifestyle rather than reduced photosynthetic ability drive the accelerated rates of nucleotide substitutions in Cas. filiformis. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Plastid transformation in potato: Solanum tuberosum.

    Science.gov (United States)

    Valkov, Vladimir T; Gargano, Daniela; Scotti, Nunzia; Cardi, Teodoro

    2014-01-01

    Although plastid transformation has attractive advantages and potential applications in plant biotechnology, for long time it has been highly efficient only in tobacco. The lack of efficient selection and regeneration protocols and, for some species, the inefficient recombination using heterologous flanking regions in transformation vectors prevented the extension of the technology to major crops. However, the availability of this technology for species other than tobacco could offer new possibilities in plant breeding, such as resistance management or improvement of nutritional value, with no or limited environmental concerns. Herein we describe an efficient plastid transformation protocol for potato (Solanum tuberosum subsp. tuberosum). By optimizing the tissue culture system and using transformation vectors carrying homologous potato flanking sequences, we obtained up to one transplastomic shoot per bombardment. Such efficiency is comparable to that usually achieved in tobacco. The method described in this chapter can be used to regenerate potato transplastomic plants expressing recombinant proteins in chloroplasts as well as in amyloplasts.

  9. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  10. The Arabidopsis arc5 and arc6 mutations differentially affect plastid morphology in pavement and guard cells in the leaf epidermis.

    Science.gov (United States)

    Fujiwara, Makoto T; Yasuzawa, Mana; Kojo, Kei H; Niwa, Yasuo; Abe, Tomoko; Yoshida, Shigeo; Nakano, Takeshi; Itoh, Ryuuichi D

    2018-01-01

    Chloroplasts, or photosynthetic plastids, multiply by binary fission, forming a homogeneous population in plant cells. In Arabidopsis thaliana, the division apparatus (or division ring) of mesophyll chloroplasts includes an inner envelope transmembrane protein ARC6, a cytoplasmic dynamin-related protein ARC5 (DRP5B), and members of the FtsZ1 and FtsZ2 families of proteins, which co-assemble in the stromal mid-plastid division ring (FtsZ ring). FtsZ ring placement is controlled by several proteins, including a stromal factor MinE (AtMinE1). During leaf mesophyll development, ARC6 and AtMinE1 are necessary for FtsZ ring formation and thus plastid division initiation, while ARC5 is essential for a later stage of plastid division. Here, we examined plastid morphology in leaf epidermal pavement cells (PCs) and stomatal guard cells (GCs) in the arc5 and arc6 mutants using stroma-targeted fluorescent proteins. The arc5 PC plastids were generally a bit larger than those of the wild type, but most had normal shapes and were division-competent, unlike mutant mesophyll chloroplasts. The arc6 PC plastids were heterogeneous in size and shape, including the formation of giant and mini-plastids, plastids with highly developed stromules, and grape-like plastid clusters, which varied on a cell-by-cell basis. Moreover, unique plastid phenotypes for stomatal GCs were observed in both mutants. The arc5 GCs rarely lacked chlorophyll-bearing plastids (chloroplasts), while they accumulated minute chlorophyll-less plastids, whereas most GCs developed wild type-like chloroplasts. The arc6 GCs produced large chloroplasts and/or chlorophyll-less plastids, as previously observed, but unexpectedly, their chloroplasts/plastids exhibited marked morphological variations. We quantitatively analyzed plastid morphology and partitioning in paired GCs from wild-type, arc5, arc6, and atminE1 plants. Collectively, our results support the notion that ARC5 is dispensable in the process of equal division

  11. Stable Plastid Transformation for High-Level Recombinant Protein Expression: Promises and Challenges

    Directory of Open Access Journals (Sweden)

    Meili Gao

    2012-01-01

    Full Text Available Plants are a promising expression system for the production of recombinant proteins. However, low protein productivity remains a major obstacle that limits extensive commercialization of whole plant and plant cell bioproduction platform. Plastid genetic engineering offers several advantages, including high levels of transgenic expression, transgenic containment via maternal inheritance, and multigene expression in a single transformation event. In recent years, the development of optimized expression strategies has given a huge boost to the exploitation of plastids in molecular farming. The driving forces behind the high expression level of plastid bioreactors include codon optimization, promoters and UTRs, genotypic modifications, endogenous enhancer and regulatory elements, posttranslational modification, and proteolysis. Exciting progress of the high expression level has been made with the plastid-based production of two particularly important classes of pharmaceuticals: vaccine antigens, therapeutic proteins, and antibiotics and enzymes. Approaches to overcome and solve the associated challenges of this culture system that include low transformation frequencies, the formation of inclusion bodies, and purification of recombinant proteins will also be discussed.

  12. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  13. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  14. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  15. Metabolic and Molecular Events Occurring during Chromoplast Biogenesis

    Directory of Open Access Journals (Sweden)

    Wanping Bian

    2011-01-01

    Full Text Available Chromoplasts are nonphotosynthetic plastids that accumulate carotenoids. They derive from other plastid forms, mostly chloroplasts. The biochemical events responsible for the interconversion of one plastid form into another are poorly documented. However, thanks to transcriptomics and proteomics approaches, novel information is now available. Data of proteomic and biochemical analysis revealed the importance of lipid metabolism and carotenoids biosynthetic activities. The loss of photosynthetic activity was associated with the absence of the chlorophyll biosynthesis branch and the presence of proteins involved in chlorophyll degradation. Surprisingly, the entire set of Calvin cycle and of the oxidative pentose phosphate pathway persisted after the transition from chloroplast to chromoplast. The role of plastoglobules in the formation and organisation of carotenoid-containing structures and that of the Or gene in the control of chromoplastogenesis are reviewed. Finally, using transcriptomic data, an overview is given the expression pattern of a number of genes encoding plastid-located proteins during tomato fruit ripening.

  16. A Targeted Enrichment Strategy for Massively Parallel Sequencing of Angiosperm Plastid Genomes

    Directory of Open Access Journals (Sweden)

    Gregory W. Stull

    2013-02-01

    Full Text Available Premise of the study: We explored a targeted enrichment strategy to facilitate rapid and low-cost next-generation sequencing (NGS of numerous complete plastid genomes from across the phylogenetic breadth of angiosperms. Methods and Results: A custom RNA probe set including the complete sequences of 22 previously sequenced eudicot plastomes was designed to facilitate hybridization-based targeted enrichment of eudicot plastid genomes. Using this probe set and an Agilent SureSelect targeted enrichment kit, we conducted an enrichment experiment including 24 angiosperms (22 eudicots, two monocots, which were subsequently sequenced on a single lane of the Illumina GAIIx with single-end, 100-bp reads. This approach yielded nearly complete to complete plastid genomes with exceptionally high coverage (mean coverage: 717×, even for the two monocots. Conclusions: Our enrichment experiment was highly successful even though many aspects of the capture process employed were suboptimal. Hence, significant improvements to this methodology are feasible. With this general approach and probe set, it should be possible to sequence more than 300 essentially complete plastid genomes in a single Illumina GAIIx lane (achieving 50× mean coverage. However, given the complications of pooling numerous samples for multiplex sequencing and the limited number of barcodes (e.g., 96 available in commercial kits, we recommend 96 samples as a current practical maximum for multiplex plastome sequencing. This high-throughput approach should facilitate large-scale plastid genome sequencing at any level of phylogenetic diversity in angiosperms.

  17. Genomic Resources of Three Pulsatilla Species Reveal Evolutionary Hotspots, Species-Specific Sites and Variable Plastid Structure in the Family Ranunculaceae

    Directory of Open Access Journals (Sweden)

    Monika Szczecińska

    2015-09-01

    Full Text Available Background: The European continent is presently colonized by nine species of the genus Pulsatilla, five of which are encountered only in mountainous regions of southwest and south-central Europe. The remaining four species inhabit lowlands in the north-central and eastern parts of the continent. Most plants of the genus Pulsatilla are rare and endangered, which is why most research efforts focused on their biology, ecology and hybridization. The objective of this study was to develop genomic resources, including complete plastid genomes and nuclear rRNA clusters, for three sympatric Pulsatilla species that are most commonly found in Central Europe. The results will supply valuable information about genetic variation, which can be used in the process of designing primers for population studies and conservation genetics research. The complete plastid genomes together with the nuclear rRNA cluster can serve as a useful tool in hybridization studies. Methodology/principal findings: Six complete plastid genomes and nuclear rRNA clusters were sequenced from three species of Pulsatilla using the Illumina sequencing technology. Four junctions between single copy regions and inverted repeats and junctions between the identified locally-collinear blocks (LCB were confirmed by Sanger sequencing. Pulsatilla genomes of 120 unique genes had a total length of approximately 161–162 kb, and 21 were duplicated in the inverted repeats (IR region. Comparative plastid genomes of newly-sequenced Pulsatilla and the previously-identified plastomes of Aconitum and Ranunculus species belonging to the family Ranunculaceae revealed several variations in the structure of the genome, but the gene content remained constant. The nuclear rRNA cluster (18S-ITS1-5.8S-ITS2-26S of studied Pulsatilla species is 5795 bp long. Among five analyzed regions of the rRNA cluster, only Internal Transcribed Spacer 2 (ITS2 enabled the molecular delimitation of closely-related Pulsatilla

  18. The (in)complete organelle genome: exploring the use and nonuse of available technologies for characterizing mitochondrial and plastid chromosomes.

    Science.gov (United States)

    Sanitá Lima, Matheus; Woods, Laura C; Cartwright, Matthew W; Smith, David Roy

    2016-11-01

    Not long ago, scientists paid dearly in time, money and skill for every nucleotide that they sequenced. Today, DNA sequencing technologies epitomize the slogan 'faster, easier, cheaper and more', and in many ways, sequencing an entire genome has become routine, even for the smallest laboratory groups. This is especially true for mitochondrial and plastid genomes. Given their relatively small sizes and high copy numbers per cell, organelle DNAs are currently among the most highly sequenced kind of chromosome. But accurately characterizing an organelle genome and the information it encodes can require much more than DNA sequencing and bioinformatics analyses. Organelle genomes can be surprisingly complex and can exhibit convoluted and unconventional modes of gene expression. Unravelling this complexity can demand a wide assortment of experiments, from pulsed-field gel electrophoresis to Southern and Northern blots to RNA analyses. Here, we show that it is exactly these types of 'complementary' analyses that are often lacking from contemporary organelle genome papers, particularly short 'genome announcement' articles. Consequently, crucial and interesting features of organelle chromosomes are going undescribed, which could ultimately lead to a poor understanding and even a misrepresentation of these genomes and the genes they express. High-throughput sequencing and bioinformatics have made it easy to sequence and assemble entire chromosomes, but they should not be used as a substitute for or at the expense of other types of genomic characterization methods. © 2016 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  19. Plastid-like Seq in mt Genome - RMG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available deletions in the plastid DNA sequence (Number of deletion sites is shown in parentheses) Insertion Number o...f nucleotide insertions in the plastid DNA sequence (Number of insertion sites is shown in parentheses) Homo

  20. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  1. FtsZ-less prokaryotic cell division as well as FtsZ- and dynamin-less chloroplast and non-photosynthetic plastid division

    Directory of Open Access Journals (Sweden)

    Shin-Ya eMiyagishima

    2014-09-01

    Full Text Available The chloroplast division machinery is a mixture of a stromal FtsZ-based complex descended from a cyanobacterial ancestor of chloroplasts and a cytosolic dynamin-related protein (DRP 5B-based complex derived from the eukaryotic host. Molecular genetic studies have shown that each component of the division machinery is normally essential for normal chloroplast division. However, several exceptions have been found. In the absence of the FtsZ ring, nonphotosynthetic plastids are able to proliferate, likely by elongation and budding. Depletion of DRP5B impairs, but does not stop chloroplast division. Chloroplasts in glaucophytes, which possesses a peptidoglycan (PG layer, divide without DRP5B. Certain parasitic eukaryotes possess nonphotosynthetic plastids of secondary endosymbiotic origin, but neither FtsZ nor DRP5B is encoded in their genomes. Elucidation of the FtsZ- and/or DRP5B-less chloroplast division mechanism will lead to a better understanding of the function and evolution of the chloroplast division machinery and the finding of the as-yet-unknown mechanism that is likely involved in chloroplast division. Recent studies have shown that FtsZ was lost from a variety of prokaryotes, many of which lost PG by regressive evolution. In addition, even some of the FtsZ-bearing bacteria are able to divide when FtsZ and PG are depleted experimentally. In some cases, alternative mechanisms for cell division, such as budding by an increase of the cell surface-to-volume ratio, are proposed. Although PG is believed to have been lost from chloroplasts other than in glaucophytes, there is some indirect evidence for the existence of PG in chloroplasts. Such information is also useful for understanding how nonphotosynthetic plastids are able to divide in FtsZ-depleted cells and the reason for the retention of FtsZ in chloroplast division. Here we summarize information to facilitate analyses of FtsZ- and/or DRP5B-less chloroplast and nonphotosynthetic plastid

  2. Visualisation of plastid outgrowths in potato (Solanum tuberosum L.) tubers by carboxyfluorescein diacetate staining.

    Science.gov (United States)

    Borucki, Wojciech; Bederska, Magdalena; Sujkowska-Rybkowska, Marzena

    2015-05-01

    We describe two types of plastid outgrowths visualised in potato tubers after carboxyfluorescein diacetate staining. Probable esterase activity of the outgrowths has been demonstrated for the first time ever. Plastid outgrowths were observed in the phelloderm and storage parenchyma cells of red potato (S. tuberosum L. cv. Rosalinde) tubers after administration of carboxyfluorescein diacetate stain. Endogenous esterases cleaved off acetic groups to release membrane-unpermeable green fluorescing carboxyfluorescein which accumulated differentially in particular cell compartments. The intensive green fluorescence of carboxyfluorescein exhibited highly branched stromules (stroma-filled plastid tubular projections of the plastid envelope) and allowed distinguishing them within cytoplasmic strands of the phelloderm cells. Stromules (1) were directed towards the nucleus or (2) penetrated the whole cells through the cytoplasmic bands of highly vacuolated phelloderm cells. Those directed towards the nucleus were flattened and adhered to the nuclear envelope. Stromule-like interconnections between two parts of the same plastids (isthmuses) were also observed. We also documented the formation of another type of the stroma-filled plastid outgrowths, referred to here as protrusions, which differed from previously defined stromules in both morphology and esterase activity. Unlike stromules, the protrusions were found to be associated with developmental processes leading to starch accumulation in the storage parenchyma cells. These results strongly suggest that stromules and protrusions exhibit esterase activity. This has been demonstrated for the first time. Morphological and biochemical features as well as possible functions of stromules and protrusions are discussed below.

  3. The Populus superoxide dismutase gene family and its responses to drought stress in transgenic poplar overexpressing a pine cytosolic glutamine synthetase (GS1a.

    Directory of Open Access Journals (Sweden)

    Juan Jesús Molina-Rueda

    Full Text Available BACKGROUND: Glutamine synthetase (GS plays a central role in plant nitrogen assimilation, a process intimately linked to soil water availability. We previously showed that hybrid poplar (Populus tremula X alba, INRA 717-1B4 expressing ectopically a pine cytosolic glutamine synthetase gene (GS1a display enhanced tolerance to drought. Preliminary transcriptome profiling revealed that during drought, members of the superoxide dismutase (SOD family were reciprocally regulated in GS poplar when compared with the wild-type control, in all tissues examined. SOD was the only gene family found to exhibit such patterns. RESULTS: In silico analysis of the Populus genome identified 12 SOD genes and two genes encoding copper chaperones for SOD (CCSs. The poplar SODs form three phylogenetic clusters in accordance with their distinct metal co-factor requirements and gene structure. Nearly all poplar SODs and CCSs are present in duplicate derived from whole genome duplication, in sharp contrast to their predominantly single-copy Arabidopsis orthologs. Drought stress triggered plant-wide down-regulation of the plastidic copper SODs (CSDs, with concomitant up-regulation of plastidic iron SODs (FSDs in GS poplar relative to the wild type; this was confirmed at the activity level. We also found evidence for coordinated down-regulation of other copper proteins, including plastidic CCSs and polyphenol oxidases, in GS poplar under drought conditions. CONCLUSIONS: Both gene duplication and expression divergence have contributed to the expansion and transcriptional diversity of the Populus SOD/CCS families. Coordinated down-regulation of major copper proteins in drought-tolerant GS poplars supports the copper cofactor economy model where copper supply is preferentially allocated for plastocyanins to sustain photosynthesis during drought. Our results also extend previous findings on the compensatory regulation between chloroplastic CSDs and FSDs, and suggest that this

  4. Control of sulfate concentration by miR395-targeted APS genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Qin Ai

    2016-04-01

    Full Text Available Sulfur nutrition is crucial for plant growth and development, as well as crop yield and quality. Inorganic sulfate in the soil is the major sulfur source for plants. After uptake, sulfate is activated by ATP sulfurylase, and then gets assimilated into sulfur-containing metabolites. However, the mechanism of regulation of sulfate levels by ATP sulfurylase is unclear. Here, we investigated the control of sulfate levels by miR395-mediated regulation of APS1/3/4. Sulfate was over-accumulated in the shoots of miR395 over-expression plants in which the expression of the APS1, APS3, and APS4 genes was suppressed. Accordingly, reduced expression of miR395 caused a decline of sulfate concentration. In agreement with these results, over-expression of the APS1, APS3, and APS4 genes led to the reduction of sulfate levels. Differential expression of these three APS genes in response to sulfate starvation implied that they have different functions. Further investigation revealed that the regulation of sulfate levels mediated by miR395 depends on the repression of its APS targets. Unlike the APS1, APS3, and APS4 genes, which encode plastid-localized ATP sulfurylases, the APS2 gene encodes a cytosolic version of ATP sulfurylase. Genetic analysis indicated that APS2 has no significant effect on sulfate levels. Our data suggest that miR395-targeted APS genes are key regulators of sulfate concentration in leaves.

  5. The plastid genome of Eutreptiella provides a window into the process of secondary endosymbiosis of plastid in euglenids

    Czech Academy of Sciences Publication Activity Database

    Hrdá, Š.; Fousek, Jan; Szabová, J.; Vlček, Čestmír; Hampl, V.

    2012-01-01

    Roč. 7, č. 3 (2012), e33746 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GAP506/11/1320 Institutional support: RVO:68378050 Keywords : euglenid plastid * Eutreptiella * phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

  6. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  7. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  8. Membrane composition and physiological activity of plastids from an oenothera plastome mutator-induced chloroplast mutant.

    Science.gov (United States)

    Johnson, E M; Sears, B B

    1990-01-01

    Plastids were isolated from a plastome mutator-induced mutant (pm7) of Oenothera hookeri and were analyzed for various physiological and biochemical attributes. No photosynthetic electron transport activity was detected in the mutant plastids. This is consistent with previous ultrastructural analysis showing the absence of thylakoid membranes in the pm7 plastids and with the observation of aberrant processing and accumulation of chloroplast proteins in the mutant. In comparison to wild type, the mutant tissue lacks chlorophyll, and has significant differences in levels of four fatty acids. The analyses did not reveal any differences in carotenoid levels nor in the synthesis of several chloroplast lipids. The consequences of the altered composition of the chloroplast membrane are discussed in terms of their relation to the aberrant protein processing of the pm7 plastids. The pigment, fatty acid, and lipid measurements were also performed on two distinct nuclear genotypes (A/A and A/C) which differ in their compatibility with the plastid genome (type I) contained in these lines. In these cases, only chlorophyll concentrations differed significantly.

  9. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  10. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  11. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  12. Complete plastid genomes from Ophioglossum californicum, Psilotum nudum, and Equisetum hyemale reveal an ancestral land plant genome structure and resolve the position of Equisetales among monilophytes

    Directory of Open Access Journals (Sweden)

    Grewe Felix

    2013-01-01

    Full Text Available Abstract Background Plastid genome structure and content is remarkably conserved in land plants. This widespread conservation has facilitated taxon-rich phylogenetic analyses that have resolved organismal relationships among many land plant groups. However, the relationships among major fern lineages, especially the placement of Equisetales, remain enigmatic. Results In order to understand the evolution of plastid genomes and to establish phylogenetic relationships among ferns, we sequenced the plastid genomes from three early diverging species: Equisetum hyemale (Equisetales, Ophioglossum californicum (Ophioglossales, and Psilotum nudum (Psilotales. A comparison of fern plastid genomes showed that some lineages have retained inverted repeat (IR boundaries originating from the common ancestor of land plants, while other lineages have experienced multiple IR changes including expansions and inversions. Genome content has remained stable throughout ferns, except for a few lineage-specific losses of genes and introns. Notably, the losses of the rps16 gene and the rps12i346 intron are shared among Psilotales, Ophioglossales, and Equisetales, while the gain of a mitochondrial atp1 intron is shared between Marattiales and Polypodiopsida. These genomic structural changes support the placement of Equisetales as sister to Ophioglossales + Psilotales and Marattiales as sister to Polypodiopsida. This result is augmented by some molecular phylogenetic analyses that recover the same relationships, whereas others suggest a relationship between Equisetales and Polypodiopsida. Conclusions Although molecular analyses were inconsistent with respect to the position of Marattiales and Equisetales, several genomic structural changes have for the first time provided a clear placement of these lineages within the ferns. These results further demonstrate the power of using rare genomic structural changes in cases where molecular data fail to provide strong phylogenetic

  13. Identification and in silico analysis of the Citrus HSP70 molecular chaperone gene family

    Directory of Open Access Journals (Sweden)

    Luciano G. Fietto

    2007-01-01

    Full Text Available The completion of the genome sequencing of the Arabidopsis thaliana model system provided a powerful molecular tool for comparative analysis of gene families present in the genome of economically relevant plant species. In this investigation, we used the sequences of the Arabidopsis Hsp70 gene family to identify and annotate the Citrus Hsp70 genes represented in the CitEST database. Based on sequence comparison analysis, we identified 18 clusters that were further divided into 5 subgroups encoding four mitochondrial mtHsp70s, three plastid csHsp70s, one ER luminal Hsp70 BiP, two HSP110/SSE-related proteins and eight cytosolic Hsp/Hsc70s. We also analyzed the expression profile by digital Northern of each Hsp70 transcript in different organs and in response to stress conditions. The EST database revealed a distinct population distribution of Hsp70 ESTs among isoforms and across the organs surveyed. The Hsp70-5 isoform was highly expressed in seeds, whereas BiP, mitochondrial and plastid HSp70 mRNAs displayed a similar expression profile in the organs analyzed, and were predominantly represented in flowers. Distinct Hsp70 mRNAs were also differentially expressed during Xylella infection and Citrus tristeza viral infection as well as during water deficit. This in silico study sets the groundwork for future investigations to fully characterize functionally the Citrus Hsp70 family and underscores the relevance of Hsp70s in response to abiotic and biotic stresses in Citrus.

  14. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  15. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  16. Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

    Science.gov (United States)

    Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

    2016-01-01

    Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  17. Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

    Directory of Open Access Journals (Sweden)

    Huanqiang Zhao

    2016-08-01

    Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  18. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  19. Distinct pathways mediate the sorting of tail-anchored proteins to the plastid outer envelope.

    Directory of Open Access Journals (Sweden)

    Preetinder K Dhanoa

    Full Text Available BACKGROUND: Tail-anchored (TA proteins are a distinct class of membrane proteins that are sorted post-translationally to various organelles and function in a number of important cellular processes, including redox reactions, vesicular trafficking and protein translocation. While the molecular targeting signals and pathways responsible for sorting TA proteins to their correct intracellular destinations in yeasts and mammals have begun to be characterized, relatively little is known about TA protein biogenesis in plant cells, especially for those sorted to the plastid outer envelope. METHODOLOGY/PRINCIPAL FINDINGS: Here we investigated the biogenesis of three plastid TA proteins, including the 33-kDa and 34-kDa GTPases of the translocon at the outer envelope of chloroplasts (Toc33 and Toc34 and a novel 9-kDa protein of unknown function that we define here as an outer envelope TA protein (OEP9. Using a combination of in vivo and in vitro assays we show that OEP9 utilizes a different sorting pathway than that used by Toc33 and Toc34. For instance, while all three TA proteins interact with the cytosolic OEP chaperone/receptor, AKR2A, the plastid targeting information within OEP9 is distinct from that within Toc33 and Toc34. Toc33 and Toc34 also appear to differ from OEP9 in that their insertion is dependent on themselves and the unique lipid composition of the plastid outer envelope. By contrast, the insertion of OEP9 into the plastid outer envelope occurs in a proteinaceous-dependent, but Toc33/34-independent manner and membrane lipids appear to serve primarily to facilitate normal thermodynamic integration of this TA protein. CONCLUSIONS/SIGNIFICANCE: Collectively, the results provide evidence in support of at least two sorting pathways for plastid TA outer envelope proteins and shed light on not only the complex diversity of pathways involved in the targeting and insertion of proteins into plastids, but also the molecular mechanisms that underlie

  20. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  1. The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

    Science.gov (United States)

    Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

    1994-05-03

    Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. CyanoClust: comparative genome resources of cyanobacteria and plastids.

    Science.gov (United States)

    Sasaki, Naobumi V; Sato, Naoki

    2010-01-01

    Cyanobacteria, which perform oxygen-evolving photosynthesis as do chloroplasts of plants and algae, are one of the best-studied prokaryotic phyla and one from which many representative genomes have been sequenced. Lack of a suitable comparative genomic database has been a problem in cyanobacterial genomics because many proteins involved in physiological functions such as photosynthesis and nitrogen fixation are not catalogued in commonly used databases, such as Clusters of Orthologous Proteins (COG). CyanoClust is a database of homolog groups in cyanobacteria and plastids that are produced by the program Gclust. We have developed a web-server system for the protein homology database featuring cyanobacteria and plastids. Database URL: http://cyanoclust.c.u-tokyo.ac.jp/.

  3. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  4. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  5. Membrane Composition and Physiological Activity of Plastids from an Oenothera Plastome Mutator-Induced Chloroplast Mutant 1

    Science.gov (United States)

    Johnson, Ellen M.; Sears, Barbara B.

    1990-01-01

    Plastids were isolated from a plastome mutator-induced mutant (pm7) of Oenothera hookeri and were analyzed for various physiological and biochemical attributes. No photosynthetic electron transport activity was detected in the mutant plastids. This is consistent with previous ultrastructural analysis showing the absence of thylakoid membranes in the pm7 plastids and with the observation of aberrant processing and accumulation of chloroplast proteins in the mutant. In comparison to wild type, the mutant tissue lacks chlorophyll, and has significant differences in levels of four fatty acids. The analyses did not reveal any differences in carotenoid levels nor in the synthesis of several chloroplast lipids. The consequences of the altered composition of the chloroplast membrane are discussed in terms of their relation to the aberrant protein processing of the pm7 plastids. The pigment, fatty acid, and lipid measurements were also performed on two distinct nuclear genotypes (A/A and A/C) which differ in their compatibility with the plastid genome (type I) contained in these lines. In these cases, only chlorophyll concentrations differed significantly. PMID:16667256

  6. Sequencing of whole plastid genomes and nuclear ribosomal DNA of Diospyros species (Ebenaceae) endemic to New Caledonia: many species, little divergence.

    Science.gov (United States)

    Turner, Barbara; Paun, Ovidiu; Munzinger, Jérôme; Chase, Mark W; Samuel, Rosabelle

    2016-06-01

    Some plant groups, especially on islands, have been shaped by strong ancestral bottlenecks and rapid, recent radiation of phenotypic characters. Single molecular markers are often not informative enough for phylogenetic reconstruction in such plant groups. Whole plastid genomes and nuclear ribosomal DNA (nrDNA) are viewed by many researchers as sources of information for phylogenetic reconstruction of groups in which expected levels of divergence in standard markers are low. Here we evaluate the usefulness of these data types to resolve phylogenetic relationships among closely related Diospyros species. Twenty-two closely related Diospyros species from New Caledonia were investigated using whole plastid genomes and nrDNA data from low-coverage next-generation sequencing (NGS). Phylogenetic trees were inferred using maximum parsimony, maximum likelihood and Bayesian inference on separate plastid and nrDNA and combined matrices. The plastid and nrDNA sequences were, singly and together, unable to provide well supported phylogenetic relationships among the closely related New Caledonian Diospyros species. In the nrDNA, a 6-fold greater percentage of parsimony-informative characters compared with plastid DNA was found, but the total number of informative sites was greater for the much larger plastid DNA genomes. Combining the plastid and nuclear data improved resolution. Plastid results showed a trend towards geographical clustering of accessions rather than following taxonomic species. In plant groups in which multiple plastid markers are not sufficiently informative, an investigation at the level of the entire plastid genome may also not be sufficient for detailed phylogenetic reconstruction. Sequencing of complete plastid genomes and nrDNA repeats seems to clarify some relationships among the New Caledonian Diospyros species, but the higher percentage of parsimony-informative characters in nrDNA compared with plastid DNA did not help to resolve the phylogenetic tree

  7. Phylogeny of the Celastreae (Celastraceae) and the relationships of Catha edulis (qat) inferred from morphological characters and nuclear and plastid genes.

    Science.gov (United States)

    Simmons, Mark P; Cappa, Jennifer J; Archer, Robert H; Ford, Andrew J; Eichstedt, Dedra; Clevinger, Curtis C

    2008-08-01

    The phylogeny of Celastraceae tribe Celastreae, which includes about 350 species of trees and shrubs in 15 genera, was inferred in a simultaneous analysis of morphological characters together with nuclear (ITS and 26S rDNA) and plastid (matK, trnL-F) genes. A strong correlation was found between the geography of the species sampled and their inferred relationships. Species of Maytenus and Gymnosporia from different regions were resolved as polyphyletic groups. Maytenus was resolved in three lineages (New World, African, and Austral-Pacific), while Gymnosporia was resolved in two lineages (New World and Old World). Putterlickia was resolved as nested within the Old World Gymnosporia. Catha edulis (qat, khat) was resolved as sister to the clade of Allocassine, Cassine, Lauridia, and Maurocenia. Gymnosporia cassinoides, which is reportedly chewed as a stimulant in the Canary Islands, was resolved as a derived member of Gymnosporia and is more closely related to Lydenburgia and Putterlickia than it is to Catha. Therefore, all eight of these genera are candidates for containing cathinone- and/or cathine-related alkaloids.

  8. Chloroplast His-to-Asp signal transduction: a potential mechanism for plastid gene regulation in Heterosigma akashiwo (Raphidophyceae

    Directory of Open Access Journals (Sweden)

    Jacobs Michael A

    2007-05-01

    Full Text Available Abstract Background Maintenance of homeostasis requires that an organism perceive selected physical and chemical signals within an informationally dense environment. Functionally, an organism uses a variety of signal transduction arrays to amplify and convert these perceived signals into appropriate gene transcriptional responses. These changes in gene expression serve to modify selective metabolic processes and thus optimize reproductive success. Here we analyze a chloroplast-encoded His-to-Asp signal transduction circuit in the stramenopile Heterosigma akashiwo (Hada Hada ex Y. Hara et Chihara [syn. H. carterae (Hulburt F.J.R. Taylor]. The presence, structure and putative function of this protein pair are discussed in the context of their evolutionary homologues. Results Bioinformatic analysis of the Heterosigma akashiwo chloroplast genome sequence revealed the presence of a single two-component His-to-Asp (designated Tsg1/Trg1 pair in this stramenopile (golden-brown alga. These data represent the first documentation of a His-to-Asp array in stramenopiles and counter previous reports suggesting that such regulatory proteins are lacking in this taxonomic cluster. Comparison of the 43 kDa H. akashiwo Tsg1 with bacterial sensor kinases showed that the algal protein exhibits a moderately maintained PAS motif in the sensor kinase domain as well as highly conserved H, N, G1 and F motifs within the histidine kinase ATP binding site. Molecular modelling of the 27 kDa H. akashiwo Trg1 regulator protein was consistent with a winged helix-turn-helix identity – a class of proteins that is known to impact gene expression at the level of transcription. The occurrence of Trg1 protein in actively growing H. akashiwo cells was verified by Western analysis. The presence of a PhoB-like RNA polymerase loop in Trg1 and its homologues in the red-algal lineage support the hypothesis that Trg1 and its homologues interact with a sigma 70 (σ70 subunit (encoded by

  9. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2006-05-01

    Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

  10. Metabolic pathway redundancy within the apicomplexan-dinoflagellate radiation argues against an ancient chromalveolate plastid

    KAUST Repository

    Waller, Ross F.

    2015-12-08

    The chromalveolate hypothesis presents an attractively simple explanation for the presence of red algal-derived secondary plastids in 5 major eukaryotic lineages: “chromista” phyla, cryptophytes, haptophytes and ochrophytes; and alveolate phyla, dinoflagellates and apicomplexans. It posits that a single secondary endosymbiotic event occurred in a common ancestor of these diverse groups, and that this ancient plastid has since been maintained by vertical inheritance only. Substantial testing of this hypothesis by molecular phylogenies has, however, consistently failed to provide support for the predicted monophyly of the host organisms that harbour these plastids—the “chromalveolates.” This lack of support does not disprove the chromalveolate hypothesis per se, but rather drives the proposed endosymbiosis deeper into the eukaryotic tree, and requires multiple plastid losses to have occurred within intervening aplastidic lineages. An alternative perspective on plastid evolution is offered by considering the metabolic partnership between the endosymbiont and its host cell. A recent analysis of metabolic pathways in a deep-branching dinoflagellate indicates a high level of pathway redundancy in the common ancestor of apicomplexans and dinoflagellates, and differential losses of these pathways soon after radiation of the major extant lineages. This suggests that vertical inheritance of an ancient plastid in alveolates is highly unlikely as it would necessitate maintenance of redundant pathways over very long evolutionary timescales.

  11. Metabolic pathway redundancy within the apicomplexan-dinoflagellate radiation argues against an ancient chromalveolate plastid

    KAUST Repository

    Waller, Ross F.; Gornik, Sebastian G.; Koreny, Ludek; Pain, Arnab

    2015-01-01

    The chromalveolate hypothesis presents an attractively simple explanation for the presence of red algal-derived secondary plastids in 5 major eukaryotic lineages: “chromista” phyla, cryptophytes, haptophytes and ochrophytes; and alveolate phyla, dinoflagellates and apicomplexans. It posits that a single secondary endosymbiotic event occurred in a common ancestor of these diverse groups, and that this ancient plastid has since been maintained by vertical inheritance only. Substantial testing of this hypothesis by molecular phylogenies has, however, consistently failed to provide support for the predicted monophyly of the host organisms that harbour these plastids—the “chromalveolates.” This lack of support does not disprove the chromalveolate hypothesis per se, but rather drives the proposed endosymbiosis deeper into the eukaryotic tree, and requires multiple plastid losses to have occurred within intervening aplastidic lineages. An alternative perspective on plastid evolution is offered by considering the metabolic partnership between the endosymbiont and its host cell. A recent analysis of metabolic pathways in a deep-branching dinoflagellate indicates a high level of pathway redundancy in the common ancestor of apicomplexans and dinoflagellates, and differential losses of these pathways soon after radiation of the major extant lineages. This suggests that vertical inheritance of an ancient plastid in alveolates is highly unlikely as it would necessitate maintenance of redundant pathways over very long evolutionary timescales.

  12. Cuscuta europaea plastid apparatus in various developmental stages

    Science.gov (United States)

    Švubová, Renáta; Ovečka, Miroslav; Pavlovič, Andrej; Slováková, Ľudmila; Blehová, Alžbeta

    2013-01-01

    It was generally accepted that Cuscuta europaea is mostly adapted to a parasitic lifestyle with no detectable levels of chlorophylls. We found out relatively high level of chlorophylls (Chls a+b) in young developmental stages of dodder. Significant lowering of Chls (a+b) content and increase of carotenoid concentration was typical only for ontogenetically more developed stages. Lower content of photosynthesis-related proteins involved in Chls biosynthesis and in photosystem formation as well as low photochemical activity of PSII indicate that photosynthesis is not the main activity of C. europaea plastids. Previously, it has been shown in other species that the Thylakoid Formation Protein 1 (THF1) is involved in thylakoid membrane differentiation, plant-fungal and plant-bacterial interactions and in sugar signaling with its preferential localization to plastids. Our immunofluorescence localization studies and analyses of haustorial plasma membrane fractions revealed that in addition to plastids, the THF1 protein localizes also to the plasma membrane and plasmodesmata in developing C. europaea haustorium, most abundantly in the digitate cells of the endophyte primordium. These results are supported by western blot analysis, documenting the highest levels of the THF1 protein in “get together” tissues of dodder and tobacco. Based on the fact that photosynthesis is not a typical process in the C. europaea haustorium and on the extra-plastidial localization pattern of the THF1, our data support rather other functions of this protein in the complex relationship between C. europaea and its host. PMID:23438585

  13. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  14. Ferritin gene transcription is regulated by iron in soybean cell cultures.

    Science.gov (United States)

    Lescure, A M; Proudhon, D; Pesey, H; Ragland, M; Theil, E C; Briat, J F

    1991-09-15

    Iron-regulated ferritin synthesis in animals is dominated by translational control of stored mRNA; iron-induced transcription of ferritin genes, when it occurs, changes the subunit composition of ferritin mRNA and protein and is coupled to translational control. Ferritins in plants and animals have evolved from a common progenitor, based on the similarity of protein sequence; however, sequence divergence occurs in the C termini; structure prediction suggests that plant ferritin has the E-helix, which, in horse ferritin, forms a large channel at the tetrameric interface. In contemporary plants, a transit peptide is encoded by ferritin mRNA to target the protein to plastids. Iron-regulated synthesis of ferritin in plants and animals appears to be very different since the 50- to 60-fold increases of ferritin protein, previously observed to be induced by iron in cultured soybean cells, is accompanied by an equivalent accumulation of hybridizable ferritin mRNA and by increased transcription of ferritin genes. Ferritin mRNA from iron-induced cells and the constitutive ferritin mRNA from soybean hypocotyls are identical. The iron-induced protein is translocated normally to plastids. Differences in animal ferritin structure coincide with the various iron storage functions (reserve for iron proteins and detoxification). In contrast, the constancy of structure of soybean ferritin, iron-induced and constitutive, coupled with the potential for vacuolar storage of excess iron in plants suggest that rapid synthesis of ferritin from a stored ferritin mRNA may not be needed in plants for detoxification of iron.

  15. Nuclear and plastid DNAs from the binucleate dinoflagellates Glenodinium (Peridinium) foliaceum and Peridinium balticum.

    Science.gov (United States)

    Kite, G C; Rothschild, L J; Dodge, J D

    1988-01-01

    The binucleate dinoflagellates Glenodinium (Peridinium) foliaceum Stein and Peridinium balticum (Levander) Lemmermann were found to contain two major buoyant density classes of DNA. The heavier peak (1.730 g/cm3) was derived from the "dinokaryotic" nucleus and the lighter peak (1.706 g/cm3) from the "endosymbiont" nucleus and this allowed for the fractionation of G. foliaceum DNA in CsCl/EtBr density gradients. An initial CsCl/Hoechst Dye gradient removed a minor A-T rich satellite species which was identified as plastid DNA with a size of about 100-106 kb. Analysis of the nuclear DNA by agarose gel electrophoresis and renaturation studies showed that the endosymbiont nucleus lacked amplified gene-sized DNA molecules, however, this nucleus did have a comparatively high level of DNA. The total amount of DNA per cell and the relative contributions of the two nuclei appeared to vary between two strains of G. foliaceum (75 pg/cell in CCAP strain and 58 pg in UTEX strain). The only strain of P. balticum examined contained 73 pg cell. These results are discussed in relation to the status and possible functioning of the endosymbiont nucleus and the idea that these dinoflagellates provide model systems with which to study the evolution of plastids.

  16. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  17. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  18. Novel 9-cis/all-trans β-carotene isomerases from plastidic oil bodies in Dunaliella bardawil catalyze the conversion of all-trans to 9-cis β-carotene.

    Science.gov (United States)

    Davidi, Lital; Pick, Uri

    2017-06-01

    We identified and demonstrated the function of 9-cis/all-trans β-carotene isomerases in plastidic globules of Dunaliella bardawil, the species accumulating the highest levels of 9-cis β-carotene that is essential for humans. The halotolerant alga Dunaliella bardawil is unique in that it accumulates under light stress high levels of β-carotene in plastidic lipid globules. The pigment is composed of two major isomers: all-trans β-carotene, the common natural form of this pigment, and 9-cis β-carotene. The biosynthetic pathway of β-carotene is known, but it is not clear how the 9-cis isomer is formed. We identified in plastidic lipid globules that were isolated from D. bardawil two proteins with high sequence homology to the D27 protein-a 9-cis/all-trans β-carotene isomerase from rice (Alder et al. Science 335:1348-1351, 2012). The proteins are enriched in the oil globules by 6- to 17-fold compared to chloroplast proteins. The expression of the corresponding genes, 9-cis-βC-iso1 and 9-cis-βC-iso2, is enhanced under light stress. The synthetic proteins catalyze in vitro conversion of all-trans to 9-cis β-carotene. Expression of the 9-cis-βC-iso1 or of 9-cis-βC-iso2 genes in an E. coli mutant line that harbors β-carotene biosynthesis genes enhanced the conversion of all-trans into 9-cis β-carotene. These results suggest that 9-cis-βC-ISO1 and 9-cis-βC-ISO2 proteins are responsible for the formation of 9-cis β-carotene in D. bardawil under stress conditions.

  19. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  20. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  1. The iojap gene in maize

    Energy Technology Data Exchange (ETDEWEB)

    Martienssen, Robert

    2001-12-01

    The classical maize mutant iojap (Iodent japonica) has variegated green and white leaves. Green sectors have cells with normal chloroplasts whereas white sectors have cells where plastids fail to differentiate. These mutant plastids, when transmitted through the female gametophyte, do not recover in the presence of wild type Iojap. We cloned the Ij locus, and we have investigated the mechanism of epigenetic inheritance and phenotypic expression. More recently, a modifier of this type of variegation, ''Inhibitor of striate'', has also been cloned. Both the iojap and inhibitor of striate proteins have homologs in bacteria and are members of ancient conserved families found in multiple species. These tools can be used to address fundamental questions of inheritance and variegation associated with this classical conundrum of maize genetics. Since the work of Rhoades there has been considerable speculation concerning the nature of the Iojap gene product, the origin of leaf variegation and the mechanism behind the material inheritance of defective plastids. This has made Iojap a textbook paradigm for cytoplasmic inheritance and nuclear-organellar interaction for almost 50 years. Cloning of the Iojap gene in maize, and homologs in other plants and bacteria, provides a new means to address the origin of heteroplastidity, variegation and cytoplasmic inheritance in higher plants.

  2. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

    Science.gov (United States)

    Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

    2016-06-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

  3. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  4. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  5. Nuclear and plastid haplotypes suggest rapid diploid and polyploid speciation in the N Hemisphere Achillea millefolium complex (Asteraceae

    Directory of Open Access Journals (Sweden)

    Guo Yan-Ping

    2012-01-01

    Full Text Available Abstract Background Species complexes or aggregates consist of a set of closely related species often of different ploidy levels, whose relationships are difficult to reconstruct. The N Hemisphere Achillea millefolium aggregate exhibits complex morphological and genetic variation and a broad ecological amplitude. To understand its evolutionary history, we study sequence variation at two nuclear genes and three plastid loci across the natural distribution of this species complex and compare the patterns of such variations to the species tree inferred earlier from AFLP data. Results Among the diploid species of A. millefolium agg., gene trees of the two nuclear loci, ncpGS and SBP, and the combined plastid fragments are incongruent with each other and with the AFLP tree likely due to incomplete lineage sorting or secondary introgression. In spite of the large distributional range, no isolation by distance is found. Furthermore, there is evidence for intragenic recombination in the ncpGS gene. An analysis using a probabilistic model for population demographic history indicates large ancestral effective population sizes and short intervals between speciation events. Such a scenario explains the incongruence of the gene trees and species tree we observe. The relationships are particularly complex in the polyploid members of A. millefolium agg. Conclusions The present study indicates that the diploid members of A. millefolium agg. share a large part of their molecular genetic variation. The findings of little lineage sorting and lack of isolation by distance is likely due to short intervals between speciation events and close proximity of ancestral populations. While previous AFLP data provide species trees congruent with earlier morphological classification and phylogeographic considerations, the present sequence data are not suited to recover the relationships of diploid species in A. millefolium agg. For the polyploid taxa many hybrid links and

  6. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  7. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  8. A new 1-deoxy-D-xylulose 5-phosphate reductoisomerase gene encoding the committed-step enzyme in the MEP pathway from Rauvolfia verticillata.

    Science.gov (United States)

    Liao, Zhihua; Chen, Rong; Chen, Min; Yang, Chunxian; Wang, Qiang; Gong, Yifu

    2007-01-01

    1-Deoxy-D-xylulose 5-phosphate (DXP) reductoisomerase (DXR; EC 1.1.1.267) catalyzes a committed step of the methylerythritol phosphate (MEP) pathway for the biosynthesis of pharmaceutical terpenoid indole alkaloid (TIA) precursors. The full-length cDNA sequence was cloned and characterized from a TIA-producing species, Rauvolfia verticillata, using rapid amplification of cDNA ends (RACE) technique. The new cDNA was named as RvDXR and submitted to GenBank to be assigned with an accession number (DQ779286). The full-length cDNA of RvDXR was 1804 bp containing a 1425 bp open reading frame (ORF) encoding a polypeptide of 474 amino acids with a calculated molecular mass of 51.3 kDa and an isoelectric point of 5.88. Comparative and bioinformatic analyses revealed that RvDXR showed extensive homology with DXRs from other plant species and contained a conserved transit peptide for plastids, an extended Pro-rich region and a highly conserved NADPH-binding motif in its N-terminal region owned by all plant DXRs. The phylogenetic analysis revealed that DXRs had two groups including a plant and bacterial group; RvDXR belonged to angiosperm DXRs that were obtained from Synechocystis through gene transfer according to the phylogenetic analysis. The structural modeling of RvDXR showed that RvDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that RvDXR expressed in all tissues including roots, stems, leaves, fruits and followers but at different levels. The lowest transcription level was observed in followers and the highest transcription was found in fruits of R. verticillata; the transcription level of RvDXR was a little higher in roots and stems than in leaves. The cloning and characterization of RvDXR will be helpful to understand more about the role of DXR involved in R. verticillata TIA biosynthesis at the molecular level and provides a candidate gene for metabolic engineering of the TIAs pathway in R. verticillata.

  9. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  10. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  11. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  12. Plastid-expressed betaine aldehyde dehydrogenase gene in carrot cultured cells, roots, and leaves confers enhanced salt tolerance.

    Science.gov (United States)

    Kumar, Shashi; Dhingra, Amit; Daniell, Henry

    2004-09-01

    Salinity is one of the major factors that limits geographical distribution of plants and adversely affects crop productivity and quality. We report here high-level expression of betaine aldehyde dehydrogenase (BADH) in cultured cells, roots, and leaves of carrot (Daucus carota) via plastid genetic engineering. Homoplasmic transgenic plants exhibiting high levels of salt tolerance were regenerated from bombarded cell cultures via somatic embryogenesis. Transformation efficiency of carrot somatic embryos was very high, with one transgenic event per approximately seven bombarded plates under optimal conditions. In vitro transgenic carrot cells transformed with the badh transgene were visually green in color when compared to untransformed carrot cells, and this offered a visual selection for transgenic lines. BADH enzyme activity was enhanced 8-fold in transgenic carrot cell cultures, grew 7-fold more, and accumulated 50- to 54-fold more betaine (93-101 micromol g(-1) dry weight of beta-Ala betaine and Gly betaine) than untransformed cells grown in liquid medium containing 100 mm NaCl. Transgenic carrot plants expressing BADH grew in the presence of high concentrations of NaCl (up to 400 mm), the highest level of salt tolerance reported so far among genetically modified crop plants. BADH expression was 74.8% in non-green edible parts (carrots) containing chromoplasts, and 53% in proplastids of cultured cells when compared to chloroplasts (100%) in leaves. Demonstration of plastid transformation via somatic embryogenesis utilizing non-green tissues as recipients of foreign DNA for the first time overcomes two of the major obstacles in extending this technology to important crop plants.

  13. RECG maintains plastid and mitochondrial genome stability by suppressing extensive recombination between short dispersed repeats.

    Directory of Open Access Journals (Sweden)

    Masaki Odahara

    2015-03-01

    Full Text Available Maintenance of plastid and mitochondrial genome stability is crucial for photosynthesis and respiration, respectively. Recently, we have reported that RECA1 maintains mitochondrial genome stability by suppressing gross rearrangements induced by aberrant recombination between short dispersed repeats in the moss Physcomitrella patens. In this study, we studied a newly identified P. patens homolog of bacterial RecG helicase, RECG, some of which is localized in both plastid and mitochondrial nucleoids. RECG partially complements recG deficiency in Escherichia coli cells. A knockout (KO mutation of RECG caused characteristic phenotypes including growth delay and developmental and mitochondrial defects, which are similar to those of the RECA1 KO mutant. The RECG KO cells showed heterogeneity in these phenotypes. Analyses of RECG KO plants showed that mitochondrial genome was destabilized due to a recombination between 8-79 bp repeats and the pattern of the recombination partly differed from that observed in the RECA1 KO mutants. The mitochondrial DNA (mtDNA instability was greater in severe phenotypic RECG KO cells than that in mild phenotypic ones. This result suggests that mitochondrial genomic instability is responsible for the defective phenotypes of RECG KO plants. Some of the induced recombination caused efficient genomic rearrangements in RECG KO mitochondria. Such loci were sometimes associated with a decrease in the levels of normal mtDNA and significant decrease in the number of transcripts derived from the loci. In addition, the RECG KO mutation caused remarkable plastid abnormalities and induced recombination between short repeats (12-63 bp in the plastid DNA. These results suggest that RECG plays a role in the maintenance of both plastid and mitochondrial genome stability by suppressing aberrant recombination between dispersed short repeats; this role is crucial for plastid and mitochondrial functions.

  14. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  15. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  16. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  17. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  18. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  19. Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

    DEFF Research Database (Denmark)

    Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

    2018-01-01

    The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

  20. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  1. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  2. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  3. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  4. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  5. Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

    Science.gov (United States)

    Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

    2005-01-01

    Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

  6. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  7. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  8. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

    Science.gov (United States)

    Mei, Yu; Kernodle, Bliss M.; Hill, John H.

    2016-01-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

  9. Paulinella chromatophora – rethinking the transition from endosymbiont to organelle

    Directory of Open Access Journals (Sweden)

    Eva C.M. Nowack

    2014-12-01

    Full Text Available Eukaryotes co-opted photosynthetic carbon fixation from prokaryotes by engulfing a cyanobacterium and stably integrating it as a photosynthetic organelle (plastid in a process known as primary endosymbiosis. The sheer complexity of interactions between a plastid and the surrounding cell that started to evolve over 1 billion years ago, make it challenging to reconstruct intermediate steps in organelle evolution by studying extant plastids. Recently, the photosynthetic amoeba Paulinella chromatophora was identified as a much sought-after intermediate stage in the evolution of a photosynthetic organelle. This article reviews the current knowledge on this unique organism. In particular it describes how the interplay of reductive genome evolution, gene transfers, and trafficking of host-encoded proteins into the cyanobacterial endosymbiont contributed to transform the symbiont into a nascent photosynthetic organelle. Together with recent results from various other endosymbiotic associations a picture emerges that lets the targeting of host-encoded proteins into bacterial endosymbionts appear as an early step in the establishment of an endosymbiotic relationship that enables the host to gain control over the endosymbiont.

  10. Fatty acid biosynthesis in pea root plastids

    International Nuclear Information System (INIS)

    Stahl, R.J.; Sparace, S.A.

    1989-01-01

    Fatty acid biosynthesis from [1- 14 C]acetate was optimized in plastids isolated from primary root tips of 7-day-old germinating pea seeds. Fatty acid synthesis was maximum at approximately 80 nmoles/hr/mg protein in the presence of 200 μM acetate, 0.5 mM each of NADH, NADPH and CoA, 6 mM each of ATP and MgCl 2 , 1 mM each of the MnCl 2 and glycerol-3-phosphate, 15 mM KHCO 3 , and 0.1M Bis-tris-propane, pH 8.0 incubated at 35C. At the standard incubation temperature of 25C, fatty acid synthesis was linear from up to 6 hours with 80 to 100 μg/mL plastid protein. ATP and CoA were absolute requirements, whereas KHCO 3 , divalent cations and reduced nucleotides all improved activity by 80 to 85%. Mg 2+ and NADH were the preferred cation and nucleotide, respectively. Dithiothreitol and detergents were generally inhibitory. The radioactive products of fatty acid biosynthesis were approximately 33% 16:0, 10% 18:0 and 56% 18:1 and generally did not vary with increasing concentrations of each cofactor

  11. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Science.gov (United States)

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  13. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  14. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  15. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  16. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    compartment. We conclude that the palindromic repeats in V. carteri represent a single class of selfish DNA and speculate that the derivation of this element involved the lateral gene transfer of an organelle intron that first appeared in the mitochondrial genome, spreading to the ptDNA through mitochondrion-to-plastid DNA migrations, and eventually arrived in the nucDNA through organelle-to-nucleus DNA transfer events. The overall implications of palindromic repeats on the evolution of chlorophyte organelle genomes are discussed.

  17. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  18. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  19. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  20. A first glimpse into the pattern and scale of gene transfer in the Apicomplexa

    DEFF Research Database (Denmark)

    Huang, J.L.; Mullapudi, N.; Sicheritz-Pontén, Thomas

    2004-01-01

    with a phylogenomic approach to detect potential gene transfers in four apicomplexan genomes. We have detected genes of algal nuclear, chloroplast (cyanobacterial) and proteobacterial origin. Plant-like genes were detected in species not currently harbouring a plastid (e.g. Cryptosporidium parvum) and putatively...

  1. Thylakoid redox signals are integrated into organellar-gene-expression-dependent retrograde signalling in the prors1-1 mutant

    Directory of Open Access Journals (Sweden)

    Luca eTadini

    2012-12-01

    Full Text Available Perturbations in organellar gene expression (OGE and the thylakoid redox state (TRS activate retrograde signalling pathways that adaptively modify nuclear gene expression (NGE, according to developmental and metabolic needs. The prors1-1 mutation in Arabidopsis down-regulates the expression of the nuclear gene Prolyl-tRNA Synthetase1 (PRORS1 which acts in both plastids and mitochondria, thereby impairing protein synthesis in both organelles and triggering OGE-dependent retrograde signalling. Because the mutation also affects thylakoid electron transport, TRS-dependent signals may likewise have an impact on the changes in NGE observed in this genotype. In this study, we have investigated whether signals related to TRS are actually integrated into the OGE-dependent retrograde signalling pathway. To this end, the chaos mutation (for chlorophyll a/b binding protein harvesting-organelle specific, which shows a partial loss of PSII antennae proteins and thus a reduction in PSII light absorption capability, was introduced into the prors1-1 mutant background. The resulting double mutant displayed a prors1-1-like reduction in plastid translation rate and a chaos-like decrease in PSII antenna size, whereas the hyper-reduction of the thylakoid electron transport chain, caused by the prors1-1 mutation, was alleviated, as determined by monitoring chlorophyll (Chl fluorescence and thylakoid phosphorylation. Interestingly, a substantial fraction of the nucleus-encoded photosynthesis genes down-regulated in the prors1-1 mutant are expressed at nearly wild-type rates in prors1-1 chaos leaves, and this recovery is reflected in the steady-state levels of their protein products in the chloroplast. We therefore conclude that signals related to photosynthetic electron transport and TRS, and indirectly to carbohydrate metabolism and energy balance, are indeed fed into the OGE-dependent retrograde pathway to modulate NGE and adjust the abundance of chloroplast proteins.

  2. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  3. Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

    Science.gov (United States)

    Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

    2009-01-01

    There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

  4. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  5. Analysis of plastid number, size, and distribution in Arabidopsis plants by light and fluorescence microscopy.

    Science.gov (United States)

    Pyke, Kevin

    2011-01-01

    Methods are described which allow one to observe chloroplasts in mesophyll cells from leaves of Arabidopsis, determine their number per cell, measure their area, and determine a value for chloroplast coverage inside mesophyll cells. Non-green plastids can also be imaged either by using staining, or by exploiting fluorescent proteins targeted to the plastid in non-green parts of the plant, such as the roots, in transgenic Arabidopsis.

  6. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  7. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  8. Demonstration of paternal inheritance of plastids in Picea (Pinaceae)

    International Nuclear Information System (INIS)

    Stine, M.

    1988-01-01

    Chloroplast DNA (cpDNA) was purified from Picea glauca, P. pungens, P. engelmannii, and P. omorika, and was digested with several restriction endonucleases. Interspecific restriction fragment length polymorphisms (RFLPs) of cpDNA were identified. The RFLPs were identified as cpDNA by the hybridization of cloned, 32 -P labeled, petunia cpDNA to the polymorphic bands, and by the lack of hybridization of a cloned and labeled mtDNA probe from maize. Chloroplast DNA RFLPs that showed no intraspecific variation when examined across the natural range for each species, were used as markers to follow the inheritance of plastids in interspecific hybrids. The inheritance of plastids was determined for F 1 -hybrids from reciprocal crosses of P. glauca and P. pungens, P. glauca and P. omorika, and F 1 -hybrids of P. engelmannii x pungens. All 31 F 1 -hybrids examined showed the cpDNA genotypes of the pollen parent, or the paternal species

  9. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  10. Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

    Science.gov (United States)

    Kim, K S; Farrand, S K

    1996-06-01

    Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

  11. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  12. Allopatric speciation despite historical gene flow: Divergence and hybridization in Carex furva and C. lucennoiberica (Cyperaceae) inferred from plastid and nuclear RAD-seq data.

    Science.gov (United States)

    Maguilla, Enrique; Escudero, Marcial; Hipp, Andrew L; Luceño, Modesto

    2017-10-01

    Gene flow among incipient species can act as a creative or destructive force in the speciation process, generating variation on which natural selection can act while, potentially, undermining population divergence. The flowering plant genus Carex exhibits a rapid and relatively recent radiation with many species limits still unclear. This is the case with the Iberian Peninsula (Spain and Portugal)-endemic C. lucennoiberica, which lay unrecognized within Carex furva until its recent description as a new species. In this study, we test how these species were impacted by interspecific gene flow during speciation. We sampled the full range of distribution of C. furva (15 individuals sampled) and C. lucennoiberica (88 individuals), sequenced two cpDNA regions (atpI-atpH, psbA-trnH) and performed genomic sequencing of 45,100 SNPs using restriction site-associated DNA sequencing (RAD-seq). We utilized a set of partitioned D-statistic tests and demographic analyses to study the degree and direction of introgression. Additionally, we modelled species distributions to reconstruct changes in range distribution during glacial and interglacial periods. Plastid, nuclear and morphological data strongly support divergence between species with subsequent gene flow. Combined with species distribution modelling, these data support a scenario of allopatry leading to species divergence, followed by secondary contact and gene flow due to long-distance dispersal and/or range expansions and contractions in response to Quaternary glacial cycles. We conclude that this is a case of allopatric speciation despite historical secondary contacts, which could have temporally influenced the speciation process, contributing to the knowledge of forces that are driving or counteracting speciation. © 2017 John Wiley & Sons Ltd.

  13. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  14. Ultrastructural study on dynamics of lipid bodies and plastids during ripening of chili pepper fruits.

    Science.gov (United States)

    Liu, Lin

    2013-03-01

    Dynamics of lipid bodies and plastids in chili pepper fruits during ripening were investigated by means of transmission electron microscopy. Mesocarp of chili pepper fruits consists of collenchyma, normal parenchyma, and huge celled parenchyma. In mature green fruits, plastids contain numerous thylakoids that are well organized into grana in collenchyma, a strikingly huge amount of starch and irregularly organized thylakoids in normal parenchyma, and simple tubes rather than thylakoids in huge celled parenchyma. These morphological features suggest that plastids are chloroplasts in collenchyma, chloroamyloplasts in normal parenchyma, proplastids in huge celled parenchyma. As fruits ripen to red, plastids in all cell types convert to chromoplasts and, concomitantly, lipid bodies accumulate in both cytoplasm and chromoplasts. Cytosolic lipid bodies are lined up in a regular layer adjacent to plasma membrane. The cytosolic lipid body consists of a core surrounded by a membrane. The core is comprised of a more electron-dense central part enclosed by a slightly less electron-dense peripheral layer. Plastidial lipid bodies in collenchyma, normal parenchyma, and endodermis initiate as plastoglobuli, which in turn convert to rod-like structures. Therefore, plastidial lipid bodies are more dynamic than cytosolic lipid bodies. Both cytosolic and plastidial lipid bodies contain rich unsaturated lipids. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

    Science.gov (United States)

    Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

    2017-01-01

    Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

  16. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  17. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  18. Pervasive, Genome-Wide Transcription in the Organelle Genomes of Diverse Plastid-Bearing Protists

    Directory of Open Access Journals (Sweden)

    Matheus Sanitá Lima

    2017-11-01

    Full Text Available Organelle genomes are among the most sequenced kinds of chromosome. This is largely because they are small and widely used in molecular studies, but also because next-generation sequencing technologies made sequencing easier, faster, and cheaper. However, studies of organelle RNA have not kept pace with those of DNA, despite huge amounts of freely available eukaryotic RNA-sequencing (RNA-seq data. Little is known about organelle transcription in nonmodel species, and most of the available eukaryotic RNA-seq data have not been mined for organelle transcripts. Here, we use publicly available RNA-seq experiments to investigate organelle transcription in 30 diverse plastid-bearing protists with varying organelle genomic architectures. Mapping RNA-seq data to organelle genomes revealed pervasive, genome-wide transcription, regardless of the taxonomic grouping, gene organization, or noncoding content. For every species analyzed, transcripts covered ≥85% of the mitochondrial and/or plastid genomes (all of which were ≤105 kb, indicating that most of the organelle DNA—coding and noncoding—is transcriptionally active. These results follow earlier studies of model species showing that organellar transcription is coupled and ubiquitous across the genome, requiring significant downstream processing of polycistronic transcripts. Our findings suggest that noncoding organelle DNA can be transcriptionally active, raising questions about the underlying function of these transcripts and underscoring the utility of publicly available RNA-seq data for recovering complete genome sequences. If pervasive transcription is also found in bigger organelle genomes (>105 kb and across a broader range of eukaryotes, this could indicate that noncoding organelle RNAs are regulating fundamental processes within eukaryotic cells.

  19. Hedysarum L. (Fabaceae: Hedysareae) Is Not Monophyletic - Evidence from Phylogenetic Analyses Based on Five Nuclear and Five Plastid Sequences.

    Science.gov (United States)

    Liu, Pei-Liang; Wen, Jun; Duan, Lei; Arslan, Emine; Ertuğrul, Kuddisi; Chang, Zhao-Yang

    2017-01-01

    The legume family (Fabaceae) exhibits a high level of species diversity and evolutionary success worldwide. Previous phylogenetic studies of the genus Hedysarum L. (Fabaceae: Hedysareae) showed that the nuclear and the plastid topologies might be incongruent, and the systematic position of the Hedysarum sect. Stracheya clade was uncertain. In this study, phylogenetic relationships of Hedysarum were investigated based on the nuclear ITS, ETS, PGDH, SQD1, TRPT and the plastid psbA-trnH, trnC-petN, trnL-trnF, trnS-trnG, petN-psbM sequences. Both nuclear and plastid data support two major lineages in Hedysarum: the Hedysarum s.s. clade and the Sartoria clade. In the nuclear tree, Hedysarum is biphyletic with the Hedysarum s.s. clade sister to the Corethrodendron + Eversmannia + Greuteria + Onobrychis clade (the CEGO clade), whereas the Sartoria clade is sister to the genus Taverniera DC. In the plastid tree, Hedysarum is monophyletic and sister to Taverniera. The incongruent position of the Hedysarum s.s. clade between the nuclear and plastid trees may be best explained by a chloroplast capture hypothesis via introgression. The Hedysarum sect. Stracheya clade is resolved as sister to the H. sect. Hedysarum clade in both nuclear and plastid trees, and our analyses support merging Stracheya into Hedysarum. Based on our new evidence from multiple sequences, Hedysarum is not monophyletic, and its generic delimitation needs to be reconsidered.

  20. Ectopic expression of TaOEP16-2-5B, a wheat plastid outer envelope protein gene, enhances heat and drought stress tolerance in transgenic Arabidopsis plants.

    Science.gov (United States)

    Zang, Xinshan; Geng, Xiaoli; Liu, Kelu; Wang, Fei; Liu, Zhenshan; Zhang, Liyuan; Zhao, Yue; Tian, Xuejun; Hu, Zhaorong; Yao, Yingyin; Ni, Zhongfu; Xin, Mingming; Sun, Qixin; Peng, Huiru

    2017-05-01

    Abiotic stresses, such as heat and drought, are major environmental factors restricting crop productivity and quality worldwide. A plastid outer envelope protein gene, TaOEP16-2, was identified from our previous transcriptome analysis [1,2]. In this study, the isolation and functional characterization of the TaOEP16-2 gene was reported. Three homoeologous sequences of TaOEP16-2 were isolated from hexaploid wheat, which were localized on the chromosomes 5A, 5B and 5D, respectively. These three homoeologues exhibited different expression patterns under heat stress conditions, TaOEP16-2-5B was the dominant one, and TaOEP16-2-5B was selected for further analysis. Compared with wild type (WT) plants, transgenic Arabidopsis plants overexpressing the TaOEP16-2-5B gene exhibited enhanced tolerance to heat stress, which was supported by improved survival rate, strengthened cell membrane stability and increased sucrose content. It was also found that TaOEP16-2 was induced by drought stress and involved in drought stress tolerance. TaOEP16-2-5B has the same function in ABA-controlled seed germination as AtOEP16-2. Our results suggest that TaOEP16-2-5B plays an important role in heat and drought stress tolerance, and could be utilized in transgenic breeding of wheat and other crop plants. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. RNA transcription in isolated chloroplasts during senescence and rejuvenation of intact cotyledons of CUCURBITA PEPO L. (ZUCCHINI)

    International Nuclear Information System (INIS)

    Mishev, K.; Ananiev, E.; Denev, L.; Radeva, G.

    2006-01-01

    RNA transcription was studied in intact chloroplasts isolated from cotyledons of Cucurbita pepoL. (zucchini) during their growth and development including natural senescence and rejuvenation. Rejuvenation of cotyledons was studied after decapitation of the epicotyl above the senescing yellow cotyledons. Maximal incorporation of [32P] UTP into overall chloroplast RNA was measured two days after exposure of seedlings to light (day 6 th after the onset of germination), followed by a gradual decrease reaching minimal values at the age of 25-28 days when cotyledons began to yellow and eventually die. Rejuvenation of cotyledons completely restored chloroplast RNA synthesis and fifteen days after decapitation (at the age of 40 days), the values of chloroplast transcription even exceeded that of the maximal transcriptional activity in young cotyledons. Inhibitory analysis with tagetitoxin (a specific inhibitor of plastid encoded chloroplast RNA polymerase (PEP)) showed that in young and rejuvenated cotyledons about 85% of chloroplast RNA polymerase activity was due to PEP and only 15% corresponded to the nuclear encoded plastid RNA polymerase (NEP). Definite regions of two chloroplast encoded genes were amplified by means of PCR technique using specific DNA primers for Rubisco large subunit gene (rbcL) and the housekeeping gene for chloroplast 16S rRNA as well as chloroplast DNA as a template. The appropriate lengths of the amplified DNA fragments were checked by restriction analysis

  2. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  3. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  4. Allotetraploid origin and divergence in Eleusine (Chloridoideae, Poaceae): evidence from low-copy nuclear gene phylogenies and a plastid gene chronogram.

    Science.gov (United States)

    Liu, Qing; Triplett, Jimmy K; Wen, Jun; Peterson, Paul M

    2011-11-01

    Eleusine (Poaceae) is a small genus of the subfamily Chloridoideae exhibiting considerable morphological and ecological diversity in East Africa and the Americas. The interspecific phylogenetic relationships of Eleusine are investigated in order to identify its allotetraploid origin, and a chronogram is estimated to infer temporal relationships between palaeoenvironment changes and divergence of Eleusine in East Africa. Two low-copy nuclear (LCN) markers, Pepc4 and EF-1α, were analysed using parsimony, likelihood and Bayesian approaches. A chronogram of Eleusine was inferred from a combined data set of six plastid DNA markers (ndhA intron, ndhF, rps16-trnK, rps16 intron, rps3, and rpl32-trnL) using the Bayesian dating method. The monophyly of Eleusine is strongly supported by sequence data from two LCN markers. In the cpDNA phylogeny, three tetraploid species (E. africana, E. coracana and E. kigeziensis) share a common ancestor with the E. indica-E. tristachya clade, which is considered a source of maternal parents for allotetraploids. Two homoeologous loci are isolated from three tetraploid species in the Pepc4 phylogeny, and the maternal parents receive further support. The A-type EF-1α sequences possess three characters, i.e. a large number of variations of intron 2; clade E-A distantly diverged from clade E-B and other diploid species; and seven deletions in intron 2, implying a possible derivation through a gene duplication event. The crown age of Eleusine and the allotetraploid lineage are 3·89 million years ago (mya) and 1·40 mya, respectively. The molecular data support independent allotetraploid origins for E. kigeziensis and the E. africana-E. coracana clade. Both events may have involved diploids E. indica and E. tristachya as the maternal parents, but the paternal parents remain unidentified. The habitat-specific hypothesis is proposed to explain the divergence of Eleusine and its allotetraploid lineage.

  5. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  6. Variability among the Most Rapidly Evolving Plastid Genomic Regions is Lineage-Specific: Implications of Pairwise Genome Comparisons in Pyrus (Rosaceae) and Other Angiosperms for Marker Choice

    Science.gov (United States)

    Ter-Voskanyan, Hasmik; Allgaier, Martin; Borsch, Thomas

    2014-01-01

    Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae)—a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC–trnV, trnR–atpA, ndhF–rpl32, psbM–trnD, and trnQ–rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters). Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid), Olea (asterids) and Cymbidium (monocots) showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF–rpl32 and trnK–rps16) were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations

  7. Variability among the most rapidly evolving plastid genomic regions is lineage-specific: implications of pairwise genome comparisons in Pyrus (Rosaceae and other angiosperms for marker choice.

    Directory of Open Access Journals (Sweden)

    Nadja Korotkova

    Full Text Available Plastid genomes exhibit different levels of variability in their sequences, depending on the respective kinds of genomic regions. Genes are usually more conserved while noncoding introns and spacers evolve at a faster pace. While a set of about thirty maximum variable noncoding genomic regions has been suggested to provide universally promising phylogenetic markers throughout angiosperms, applications often require several regions to be sequenced for many individuals. Our project aims to illuminate evolutionary relationships and species-limits in the genus Pyrus (Rosaceae-a typical case with very low genetic distances between taxa. In this study, we have sequenced the plastid genome of Pyrus spinosa and aligned it to the already available P. pyrifolia sequence. The overall p-distance of the two Pyrus genomes was 0.00145. The intergenic spacers between ndhC-trnV, trnR-atpA, ndhF-rpl32, psbM-trnD, and trnQ-rps16 were the most variable regions, also comprising the highest total numbers of substitutions, indels and inversions (potentially informative characters. Our comparative analysis of further plastid genome pairs with similar low p-distances from Oenothera (representing another rosid, Olea (asterids and Cymbidium (monocots showed in each case a different ranking of genomic regions in terms of variability and potentially informative characters. Only two intergenic spacers (ndhF-rpl32 and trnK-rps16 were consistently found among the 30 top-ranked regions. We have mapped the occurrence of substitutions and microstructural mutations in the four genome pairs. High AT content in specific sequence elements seems to foster frequent mutations. We conclude that the variability among the fastest evolving plastid genomic regions is lineage-specific and thus cannot be precisely predicted across angiosperms. The often lineage-specific occurrence of stem-loop elements in the sequences of introns and spacers also governs lineage-specific mutations. Sequencing

  8. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  9. Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

    Directory of Open Access Journals (Sweden)

    Hui-Yeng Y Yap

    Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

  10. The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

    Science.gov (United States)

    Santiago, Margarita; Gardner, Richard C

    2015-07-01

    Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

  11. Plastid ribosomal protein S5 plays a critical role in photosynthesis, plant development, and cold stress tolerance in arabidopsis

    Science.gov (United States)

    Plastid ribosomal proteins (RPs) are essential components for protein synthesis machinery and exert diverse roles in plant growth and development. Mutations in plastid RPs lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood and th...

  12. Structure and expression of cytochrome f in an Oenothera plastome mutant.

    Science.gov (United States)

    Johnson, E M; Sears, B B

    1990-06-01

    The chloroplast mutant pm7 is one of a number of mutants derived from the plastome mutator (pm) line of Oenothera hookeri, strain Johansen. Immunoblotting showed that this mutant accumulates a protein that is cross-antigenic with cytochrome f, but five kilodaltons larger than the mature wild-type protein. Since cytochrome f is known to be translated on plastid ribosomes as a precursor with an amino-terminal extension, it is proposed that the unprocessed cytochrome f precursor accumulates in pm7. In addition to this precursor-sized cytochrome f protein, some mature-sized cytochrome f was also found in the mutant plastids. The pm7 mutation is inherited in a non-Mendelian fashion; but no alterations in chloroplast DNA restriction patterns, or differences in DNA sequence in the region encoding cytochrome f, were found in a comparison of the wild-type and pm7 chloroplast DNAs. Although the mutant was capable of synthesizing heme, no covalently-bound heme, normally found associated with mature, functional, cytochrome f was detected in the mutant at sizes expected for the presumed precursor, or for mature cytochrome f. These results indicate that the aberrant accumulation of a precursor-sized cytochrome f in pm7 is not due to a lesion directly in the plastid gene encoding cytochrome f, petA, or to a deficiency in the ability of the mutant plastids to synthesize or accumulate heme.

  13. Hedysarum L. (Fabaceae: Hedysareae) Is Not Monophyletic – Evidence from Phylogenetic Analyses Based on Five Nuclear and Five Plastid Sequences

    Science.gov (United States)

    Liu, Pei-Liang; Wen, Jun; Duan, Lei; Arslan, Emine; Ertuğrul, Kuddisi; Chang, Zhao-Yang

    2017-01-01

    The legume family (Fabaceae) exhibits a high level of species diversity and evolutionary success worldwide. Previous phylogenetic studies of the genus Hedysarum L. (Fabaceae: Hedysareae) showed that the nuclear and the plastid topologies might be incongruent, and the systematic position of the Hedysarum sect. Stracheya clade was uncertain. In this study, phylogenetic relationships of Hedysarum were investigated based on the nuclear ITS, ETS, PGDH, SQD1, TRPT and the plastid psbA-trnH, trnC-petN, trnL-trnF, trnS-trnG, petN-psbM sequences. Both nuclear and plastid data support two major lineages in Hedysarum: the Hedysarum s.s. clade and the Sartoria clade. In the nuclear tree, Hedysarum is biphyletic with the Hedysarum s.s. clade sister to the Corethrodendron + Eversmannia + Greuteria + Onobrychis clade (the CEGO clade), whereas the Sartoria clade is sister to the genus Taverniera DC. In the plastid tree, Hedysarum is monophyletic and sister to Taverniera. The incongruent position of the Hedysarum s.s. clade between the nuclear and plastid trees may be best explained by a chloroplast capture hypothesis via introgression. The Hedysarum sect. Stracheya clade is resolved as sister to the H. sect. Hedysarum clade in both nuclear and plastid trees, and our analyses support merging Stracheya into Hedysarum. Based on our new evidence from multiple sequences, Hedysarum is not monophyletic, and its generic delimitation needs to be reconsidered. PMID:28122062

  14. Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

    Science.gov (United States)

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

    2009-02-27

    All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  15. An Arabidopsis introgression zone studied at high spatio-temporal resolution: interglacial and multiple genetic contact exemplified using whole nuclear and plastid genomes.

    Science.gov (United States)

    Hohmann, Nora; Koch, Marcus A

    2017-10-23

    Gene flow between species, across ploidal levels, and even between evolutionary lineages is a common phenomenon in the genus Arabidopsis. However, apart from two genetically fully stabilized allotetraploid species that have been investigated in detail, the extent and temporal dynamics of hybridization are not well understood. An introgression zone, with tetraploid A. arenosa introgressing into A. lyrata subsp. petraea in the Eastern Austrian Forealps and subsequent expansion towards pannonical lowlands, was described previously based on morphological observations as well as molecular data using microsatellite and plastid DNA markers. Here we investigate the spatio-temporal context of this suture zone, making use of the potential of next-generation sequencing and whole-genome data. By utilizing a combination of nuclear and plastid genomic data, the extent, direction and temporal dynamics of gene flow are elucidated in detail and Late Pleistocene evolutionary processes are resolved. Analysis of nuclear genomic data significantly recognizes the clinal structure of the introgression zone, but also reveals that hybridization and introgression is more common and substantial than previously thought. Also tetraploid A. lyrata and A. arenosa subsp. borbasii from outside the previously defined suture zone show genomic signals of past introgression. A. lyrata is shown to serve usually as the maternal parent in these hybridizations, but one exception is identified from plastome-based phylogenetic reconstruction. Using plastid phylogenomics with secondary time calibration, the origin of A. lyrata and A. arenosa lineages is pre-dating the last three glaciation complexes (approx. 550,000 years ago). Hybridization and introgression followed during the last two glacial-interglacial periods (since approx. 300,000 years ago) with later secondary contact at the northern and southern border of the introgression zone during the Holocene. Footprints of adaptive introgression in the

  16. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  17. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    OpenAIRE

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  18. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  19. Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

    International Nuclear Information System (INIS)

    Chisholm, G.E.; Summers, W.C.

    1986-01-01

    The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

  20. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

    2002-01-01

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  1. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  2. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  3. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  4. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2004-12-31

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  5. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2006-01-16

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  6. The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

    Science.gov (United States)

    Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

    2017-03-01

    The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

  7. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  8. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  9. A census of nuclear cyanobacterial recruits in the plant kingdom.

    Directory of Open Access Journals (Sweden)

    Szabolcs Makai

    Full Text Available The plastids and mitochondria of the eukaryotic cell are of endosymbiotic origin. These events occurred ~2 billion years ago and produced significant changes in the genomes of the host and the endosymbiont. Previous studies demonstrated that the invasion of land affected plastids and mitochondria differently and that the paths of mitochondrial integration differed between animals and plants. Other studies examined the reasons why a set of proteins remained encoded in the organelles and were not transferred to the nuclear genome. However, our understanding of the functional relations of the transferred genes is insufficient. In this paper, we report a high-throughput phylogenetic analysis to identify genes of cyanobacterial origin for plants of different levels of complexity: Arabidopsis thaliana, Chlamydomonas reinhardtii, Physcomitrella patens, Populus trichocarpa, Selaginella moellendorffii, Sorghum bicolor, Oryza sativa, and Ostreococcus tauri. Thus, a census of cyanobacterial gene recruits and a study of their function are presented to better understand the functional aspects of plastid symbiogenesis. From algae to angiosperms, the GO terms demonstrated a gradual expansion over functionally related genes in the nuclear genome, beginning with genes related to thylakoids and photosynthesis, followed by genes involved in metabolism, and finally with regulation-related genes, primarily in angiosperms. The results demonstrate that DNA is supplied to the nuclear genome on a permanent basis with no regard to function, and only what is needed is kept, which thereby expands on the GO space along the related genes.

  10. Pervasive, Genome-Wide Transcription in the Organelle Genomes of Diverse Plastid-Bearing Protists.

    Science.gov (United States)

    Sanitá Lima, Matheus; Smith, David Roy

    2017-11-06

    Organelle genomes are among the most sequenced kinds of chromosome. This is largely because they are small and widely used in molecular studies, but also because next-generation sequencing technologies made sequencing easier, faster, and cheaper. However, studies of organelle RNA have not kept pace with those of DNA, despite huge amounts of freely available eukaryotic RNA-sequencing (RNA-seq) data. Little is known about organelle transcription in nonmodel species, and most of the available eukaryotic RNA-seq data have not been mined for organelle transcripts. Here, we use publicly available RNA-seq experiments to investigate organelle transcription in 30 diverse plastid-bearing protists with varying organelle genomic architectures. Mapping RNA-seq data to organelle genomes revealed pervasive, genome-wide transcription, regardless of the taxonomic grouping, gene organization, or noncoding content. For every species analyzed, transcripts covered ≥85% of the mitochondrial and/or plastid genomes (all of which were ≤105 kb), indicating that most of the organelle DNA-coding and noncoding-is transcriptionally active. These results follow earlier studies of model species showing that organellar transcription is coupled and ubiquitous across the genome, requiring significant downstream processing of polycistronic transcripts. Our findings suggest that noncoding organelle DNA can be transcriptionally active, raising questions about the underlying function of these transcripts and underscoring the utility of publicly available RNA-seq data for recovering complete genome sequences. If pervasive transcription is also found in bigger organelle genomes (>105 kb) and across a broader range of eukaryotes, this could indicate that noncoding organelle RNAs are regulating fundamental processes within eukaryotic cells. Copyright © 2017 Sanitá Lima and Smith.

  11. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  12. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

    Science.gov (United States)

    Shukla, Avi; Chatterjee, Anirvan

    2018-01-01

    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  13. The Complete Plastid Genome Sequence of Madagascar Periwinkle Catharanthus roseus (L.) G. Don: Plastid Genome Evolution, Molecular Marker Identification, and Phylogenetic Implications in Asterids

    Science.gov (United States)

    Ku, Chuan; Chung, Wan-Chia; Chen, Ling-Ling; Kuo, Chih-Horng

    2013-01-01

    The Madagascar periwinkle ( Catharanthus roseus in the family Apocynaceae) is an important medicinal plant and is the source of several widely marketed chemotherapeutic drugs. It is also commonly grown for its ornamental values and, due to ease of infection and distinctiveness of symptoms, is often used as the host for studies on phytoplasmas, an important group of uncultivated plant pathogens. To gain insights into the characteristics of apocynaceous plastid genomes (plastomes), we used a reference-assisted approach to assemble the complete plastome of C . roseus , which could be applied to other C . roseus -related studies. The C . roseus plastome is the second completely sequenced plastome in the asterid order Gentianales. We performed comparative analyses with two other representative sequences in the same order, including the complete plastome of Coffea arabica (from the basal Gentianales family Rubiaceae) and the nearly complete plastome of Asclepias syriaca (Apocynaceae). The results demonstrated considerable variations in gene content and plastome organization within Apocynaceae, including the presence/absence of three essential genes (i.e., accD, clpP, and ycf1) and large size changes in non-coding regions (e.g., rps2-rpoC2 and IRb-ndhF). To find plastome markers of potential utility for Catharanthus breeding and phylogenetic analyses, we identified 41 C . roseus -specific simple sequence repeats. Furthermore, five intergenic regions with high divergence between C . roseus and three other euasterids I taxa were identified as candidate markers. To resolve the euasterids I interordinal relationships, 82 plastome genes were used for phylogenetic inference. With the addition of representatives from Apocynaceae and sampling of most other asterid orders, a sister relationship between Gentianales and Solanales is supported. PMID:23825699

  14. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  15. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  16. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

    2015-01-01

    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  17. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  18. Of chromoplasts and chaperones.

    Science.gov (United States)

    Giuliano, Giovanni; Diretto, Gianfranco

    2007-12-01

    Chromoplasts are carotenoid-accumulating plastids found in many fruits and flowers. In a new paper, Li and colleagues show that the Or gene of cauliflower induces differentiation of beta-carotene-containing chromoplasts in the (normally non-pigmented) curd tissue. This is the first time that a gene product controlling chromoplast differentiation is described. Or encodes an evolutionarily conserved DnaJ cysteine-rich domain-containing protein that can be used for metabolic engineering in crop plants, such as potato.

  19. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    Science.gov (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  20. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    International Nuclear Information System (INIS)

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

    2005-01-01

    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  1. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  2. Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

    Directory of Open Access Journals (Sweden)

    Moysés Elias-Neto

    2013-06-01

    Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

  3. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  4. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  5. Phylogeny and evolutionary history of Leymus (Triticeae; Poaceae based on a single-copy nuclear gene encoding plastid acetyl-CoA carboxylase

    Directory of Open Access Journals (Sweden)

    Ding Cun-Bang

    2009-10-01

    Full Text Available Abstract Background Single- and low- copy genes are less likely subject to concerted evolution, thus making themselves ideal tools for studying the origin and evolution of polyploid taxa. Leymus is a polyploid genus with a diverse array of morphology, ecology and distribution in Triticeae. The genomic constitution of Leymus was assigned as NsXm, where Ns was presumed to be originated from Psathyrostachys, while Xm represented a genome of unknown origin. In addition, little is known about the evolutionary history of Leymus. Here, we investigate the phylogenetic relationship, genome donor, and evolutionary history of Leymus based on a single-copy nuclear Acc1 gene. Results Two homoeologues of the Acc1 gene were isolated from nearly all the sampled Leymus species using allele-specific primer and were analyzed with those from 35 diploid taxa representing 18 basic genomes in Triticeae. Sequence diversity patterns and genealogical analysis suggested that (1 Leymus is closely related to Psathyrostachys, Agropyron, and Eremopyrum; (2 Psathyrostachys juncea is an ancestral Ns-genome donor of Leymus species; (3 the Xm genome in Leymus may be originated from an ancestral lineage of Agropyron and Eremopyrum triticeum; (4 the Acc1 sequences of Leymus species from the Qinghai-Tibetan plateau are evolutionarily distinct; (5 North America Leymus species might originate from colonization via the Bering land bridge; (6 Leymus originated about 11-12MYA in Eurasia, and adaptive radiation might have occurred in Leymus during the period of 3.7-4.3 MYA and 1.7-2.1 MYA. Conclusion Leymus species have allopolyploid origin. It is hypothesized that the adaptive radiation of Leymus species might have been triggered by the recent upliftings of the Qinghai-Tibetan plateau and subsequent climatic oscillations. Adaptive radiation may have promoted the rapid speciation, as well as the fixation of unique morphological characters in Leymus. Our results shed new light on our

  6. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Science.gov (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  7. Complete nucleotide sequence of the Oenothera elata plastid chromosome, representing plastome I of the five distinguishable euoenothera plastomes.

    Science.gov (United States)

    Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B

    2000-05-01

    We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.

  8. The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

  9. Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

    Directory of Open Access Journals (Sweden)

    DEWI FITRIANI

    2010-06-01

    Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

  10. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  11. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  12. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  13. Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

    OpenAIRE

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-01-01

    Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

  14. Chloroplast to chromoplast transition in tomato fruit: spectral confocal microscopy analyses of carotenoids and chlorophylls in isolated plastids and time-lapse recording on intact live tissue.

    Science.gov (United States)

    Egea, Isabel; Bian, Wanping; Barsan, Cristina; Jauneau, Alain; Pech, Jean-Claude; Latché, Alain; Li, Zhengguo; Chervin, Christian

    2011-08-01

    There are several studies suggesting that tomato (Solanum lycopersicum) chromoplasts arise from chloroplasts, but there is still no report showing the fluorescence of both chlorophylls and carotenoids in an intermediate plastid, and no video showing this transition phase. Pigment fluorescence within individual plastids, isolated from tomato fruit using sucrose gradients, was observed at different ripening stages, and an in situ real-time recording of pigment fluorescence was performed on live tomato fruit slices. At the mature green and red stages, homogenous fractions of chloroplasts and chromoplasts were obtained, respectively. At the breaker stage, spectral confocal microscopy showed that intermediate plastids contained both chlorophylls and carotenoids. Furthermore, an in situ real-time recording (a) showed that the chloroplast to chromoplast transition was synchronous for all plastids of a single cell; and (b) confirmed that all chromoplasts derived from pre-existing chloroplasts. These results give details of the early steps of tomato chromoplast biogenesis from chloroplasts, with the formation of intermediate plastids containing both carotenoids and chlorophylls. They provide information at the sub-cellular level on the synchronism of plastid transition and pigment changes.

  15. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    Science.gov (United States)

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  16. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

    OpenAIRE

    Xu, J; Johnson, R C

    1995-01-01

    Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

  17. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  18. Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

    Science.gov (United States)

    Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

    2017-10-01

    Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

  19. Human granulocyte colony-stimulating factor (hG-CSF) expression in plastids of Lactuca sativa.

    Science.gov (United States)

    Sharifi Tabar, Mehdi; Habashi, Ali Akbar; Rajabi Memari, Hamid

    2013-01-01

    Human granulocyte colony-stimulating factor (hG-CSF) can serve as valuable biopharmaceutical for research and treatment of the human blood cancer. Transplastomic plants have been emerged as a new and high potential candidate for production of recombinant biopharmaceutical proteins in comparison with transgenic plants due to extremely high level expression, biosafety and many other advantages. hG-CSF gene was cloned into pCL vector between prrn16S promoter and TpsbA terminator. The recombinant vector was coated on nanogold particles and transformed to lettuce chloroplasts through biolistic method. Callogenesis and regeneration of cotyledonary explants were obtained by Murashige and Skoog media containing 6-benzylaminopurine and 1-naphthaleneacetic acid hormones. The presence of hG-CSF gene in plastome was studied with four specific PCR primers and expression by Western immunoblotting. hG-CSF gene cloning was confirmed by digestion and sequencing. Transplastomic lettuce lines were regenerated and subjected to molecular analysis. The presence of hG-CSF in plastome was confirmed by PCR using specific primers designed from the plastid genome. Western immunoblotting of extracted protein from transplastomic plants showed a 20-kDa band, which verified the expression of recombinant protein in lettuce chloroplasts. This study is the first report that successfully express hG-CSF gene in lettuce chloroplast. The lettuce plastome can provide a cheap and safe expression platform for producing valuable biopharmaceuticals for research and treatment.

  20. A sea slug’s guide to plastid symbiosis

    Directory of Open Access Journals (Sweden)

    Jan de Vries

    2014-12-01

    Full Text Available Some 140 years ago sea slugs that contained chlorophyll-pigmented granules similar to those of plants were described. While we now understand that these “green granules” are plastids the slugs sequester from siphonaceous algae upon which they feed, surprisingly little is really known about the molecular details that underlie this one of a kind animal-plastid symbiosis. Kleptoplasts are stored in the cytosol of epithelial cells that form the slug’s digestive tubules, and one would guess that the stolen organelles are acquired for their ability to fix carbon, but studies have never really been able to prove that. We also do not know how the organelles are distinguished from the remaining food particles the slugs incorporate with their meal and that include algal mitochondria and nuclei. We know that the ability to store kleptoplasts long-term has evolved only a few times independently among hundreds of sacoglossan species, but we have no idea on what basis. Here we take a closer look at the history of sacoglossan research and discuss recent developments. We argue that, in order to understand what makes this symbiosis work, we will need to focus on the animal’s physiology just as much as we need to commence a detailed analysis of the plastids’ photobiology. Understanding kleptoplasty in sacoglossan slugs requires an unbiased multidisciplinary approach.

  1. Plastid phylogenomics and adaptive evolution of Gaultheria series Trichophyllae (Ericaceae), a clade from sky islands of the Himalaya-Hengduan Mountains.

    Science.gov (United States)

    Zhang, Ming-Ying; Fritsch, Peter W; Ma, Peng-Fei; Wang, Hong; Lu, Lu; Li, De-Zhu

    2017-05-01

    Gaultheria series Trichophyllae Airy Shaw is an angiosperm clade of high-alpine shrublets endemic to the Himalaya-Hengduan Mountains and characterized by recent species divergence and convergent character evolution that has until recently caused much confusion in species circumscription. Although multiple DNA sequence regions have been employed previously, phylogenetic relationships among species in the group have remained largely unresolved. Here we examined the effectiveness of the plastid genome for improving phylogenetic resolution within the G. series Trichophyllae clade. Plastid genomes of 31 samples representing all 19 recognized species of the series and three outgroup species were sequenced with Illumina Sequencing technology. Maximum likelihood (ML), maximum parsimony (MP) and Bayesian inference (BI) phylogenetic analyses were performed with various datasets, i.e., that from the whole plastid genome, coding regions, noncoding regions, large single-copy region (LSC) and inverted-repeat region a (IRa). The partitioned whole plastid genome with inverted-repeat region b (IRb) excluded was also analyzed with ML and BI. Tree topologies based on the whole plastid genome, noncoding regions, and LSC region datasets across all analyses, and that based on the partitioned dataset with ML and BI analyses, are identical and generally strongly supported. Gaultheria series Trichophyllae form a clade with three species and one variety that is sister to a clade of the remaining 16 species; the latter comprises seven main subclades. Interspecific relationships within the series are strongly supported except for those based on the coding-region and IRa-region datasets. Eight divergence hotspot regions, each possessing >5% percent variable sites, were screened across the whole plastid genome of the 28 individuals sampled in the series. Results of morphological character evolution reconstruction diagnose several clades, and a hypothesis of adaptive evolution for plant habit is

  2. Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

    Science.gov (United States)

    Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

    2013-12-01

    The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

  3. Investigation into the Physiological Significance of the Phytohormone Abscisic Acid in Perkinsus marinus, an Oyster Parasite Harboring a Nonphotosynthetic Plastid.

    Science.gov (United States)

    Sakamoto, Hirokazu; Suzuki, Shigeo; Nagamune, Kisaburo; Kita, Kiyoshi; Matsuzaki, Motomichi

    2017-07-01

    Some organisms have retained plastids even after they have lost the ability to photosynthesize. Several studies of nonphotosynthetic plastids in apicomplexan parasites have shown that the isopentenyl pyrophosphate biosynthesis pathway in the organelle is essential for their survival. A phytohormone, abscisic acid, one of several compounds biosynthesized from isopentenyl pyrophosphate, regulates the parasite cell cycle. Thus, it is possible that the phytohormone is universally crucial, even in nonphotosynthetic plastids. Here, we examined this possibility using the oyster parasite Perkinsus marinus, which is a plastid-harboring cousin of apicomplexan parasites and has independently lost photosynthetic ability. Fluridone, an inhibitor of abscisic acid biosynthesis, blocked parasite growth and induced cell clustering. Nevertheless, abscisic acid and its intermediate carotenoids did not affect parasite growth or rescue the parasite from inhibition. Moreover, abscisic acid was not detected from the parasite using liquid chromatography mass spectrometry. Our findings show that abscisic acid does not play any significant roles in P. marinus. © 2016 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  4. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  5. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

    Science.gov (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

    2018-02-01

    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  6. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  7. Comparison of phosphate uptake rates by the smallest plastidic and aplastidic protists in the North Atlantic subtropical gyre.

    Science.gov (United States)

    Hartmann, Manuela; Grob, Carolina; Scanlan, David J; Martin, Adrian P; Burkill, Peter H; Zubkov, Mikhail V

    2011-11-01

    The smallest phototrophic protists (protists meet their inorganic nutrient requirements, we compared the phosphate uptake rates of plastidic and aplastidic protists in the phosphate-depleted subtropical and tropical North Atlantic (4-29°N) using a combination of radiotracers and flow cytometric sorting on two Atlantic Meridional Transect cruises. Plastidic protists were divided into two groups according to their size (protists showed higher phosphate uptake rates per cell than the aplastidic protists. Although the phosphate uptake rates of protist cells were on average seven times (Pprotists were one fourth to one twentieth of an average bacterioplankton cell. The unsustainably low biomass-specific phosphate uptake by both plastidic and aplastidic protists suggests the existence of a common alternative means of phosphorus acquisition - predation on phosphorus-rich bacterioplankton cells. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  8. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  9. Intricate patterns of phylogenetic relationships in the olive family as inferred from multi-locus plastid and nuclear DNA sequence analyses: a close-up on Chionanthus and Noronhia (Oleaceae).

    Science.gov (United States)

    Hong-Wa, Cynthia; Besnard, Guillaume

    2013-05-01

    Noronhia represents the most successful radiation of the olive family (Oleaceae) in Madagascar with more than 40 named endemic species distributed in all ecoregions from sea level to high mountains. Its position within the subtribe Oleinae has, however, been largely unresolved and its evolutionary history has remained unexplored. In this study, we generated a dataset of plastid (trnL-F, trnT-L, trnS-G, trnK-matK) and nuclear (internal transcribed spacer [ITS]) DNA sequences to infer phylogenetic relationships within Oleinae and to examine evolutionary patterns within Noronhia. Our sample included most species of Noronhia and representatives of the ten other extant genera within the subtribe with an emphasis on Chionanthus. Bayesian inferences and maximum likelihood analyses of plastid and nuclear data indicated several instances of paraphyly and polyphyly within Oleinae, with some geographic signal. Both plastid and ITS data showed a polyphyletic Noronhia that included Indian Ocean species of Chionanthus. They also found close relationships between Noronhia and African Chionanthus. However, the plastid data showed little clear differentiation between Noronhia and the African Chionanthus whereas relationships suggested by the nuclear ITS data were more consistent with taxonomy and geography. We used molecular dating to discriminate between hybridization and lineage sorting/gene duplication as alternative explanations for these topological discordances and to infer the biogeographic history of Noronhia. Hybridization between African Chionanthus and Noronhia could not be ruled out. However, Noronhia has long been established in Madagascar after a likely Cenozoic dispersal from Africa, suggesting any hybridization between representatives of African and Malagasy taxa was ancient. In any case, the African and Indian Ocean Chionanthus and Noronhia together formed a strongly supported monophyletic clade distinct and distant from other Chionanthus, which calls for a revised

  10. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  11. Ferritin gene organization: differences between plants and animals suggest possible kingdom-specific selective constraints.

    Science.gov (United States)

    Proudhon, D; Wei, J; Briat, J; Theil, E C

    1996-03-01

    Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may

  12. Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

    Science.gov (United States)

    Hempel, Niels; Görisch, Helmut; Mern, Demissew S

    2013-09-01

    Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

  13. Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

    Directory of Open Access Journals (Sweden)

    Tiane Martin de Moura

    2012-10-01

    Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

  14. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-03-05

    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  15. Existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot

    Science.gov (United States)

    Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza

    2016-01-01

    Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570

  16. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Science.gov (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  17. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  18. Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

    Directory of Open Access Journals (Sweden)

    Beatriz Moreno

    2016-07-01

    Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

  19. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  20. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  1. Spreading of genes encoding enterotoxins, haemolysins, adhesin and biofilm among methicillin resistant Staphylococcus aureus strains with staphylococcal cassette chromosome mec type IIIA isolated from burn patients.

    Science.gov (United States)

    Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad

    2016-08-01

    The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  3. Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Dunham Stephen

    2009-11-01

    Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.

  4. Comparative analyses of two Geraniaceae transcriptomes using next-generation sequencing.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Mower, Jeffrey P; Jansen, Robert K

    2013-12-29

    Organelle genomes of Geraniaceae exhibit several unusual evolutionary phenomena compared to other angiosperm families including accelerated nucleotide substitution rates, widespread gene loss, reduced RNA editing, and extensive genomic rearrangements. Since most organelle-encoded proteins function in multi-subunit complexes that also contain nuclear-encoded proteins, it is likely that the atypical organellar phenomena affect the evolution of nuclear genes encoding organellar proteins. To begin to unravel the complex co-evolutionary interplay between organellar and nuclear genomes in this family, we sequenced nuclear transcriptomes of two species, Geranium maderense and Pelargonium x hortorum. Normalized cDNA libraries of G. maderense and P. x hortorum were used for transcriptome sequencing. Five assemblers (MIRA, Newbler, SOAPdenovo, SOAPdenovo-trans [SOAPtrans], Trinity) and two next-generation technologies (454 and Illumina) were compared to determine the optimal transcriptome sequencing approach. Trinity provided the highest quality assembly of Illumina data with the deepest transcriptome coverage. An analysis to determine the amount of sequencing needed for de novo assembly revealed diminishing returns of coverage and quality with data sets larger than sixty million Illumina paired end reads for both species. The G. maderense and P. x hortorum transcriptomes contained fewer transcripts encoding the PLS subclass of PPR proteins relative to other angiosperms, consistent with reduced mitochondrial RNA editing activity in Geraniaceae. In addition, transcripts for all six plastid targeted sigma factors were identified in both transcriptomes, suggesting that one of the highly divergent rpoA-like ORFs in the P. x hortorum plastid genome is functional. The findings support the use of the Illumina platform and assemblers optimized for transcriptome assembly, such as Trinity or SOAPtrans, to generate high-quality de novo transcriptomes with broad coverage. In addition

  5. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  6. The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

    Science.gov (United States)

    Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

    2005-05-15

    Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

  7. Extensive diversification of IgD-, IgY-, and truncated IgY(δFc)-encoding genes in the red-eared turtle (Trachemys scripta elegans).

    Science.gov (United States)

    Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng

    2012-10-15

    IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.

  8. Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures.

    Directory of Open Access Journals (Sweden)

    Senta Heiss-Blanquet

    Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.

  9. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  10. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  11. Expression of Xanthophyll Biosynthetic Genes during Light-Dependent Chloroplast Differentiation1

    Science.gov (United States)

    Woitsch, Sonja; Römer, Susanne

    2003-01-01

    In higher plants, etioplast to chloroplast differentiation is characterized by dramatic ultrastructural changes of the plastid and a concomitant increase in chlorophylls and carotenoids. Whereas the formation and function of carotenes and their oxygenated derivatives, the xanthophylls, have been well studied, little is known about the regulation of the genes involved in xanthophyll biosynthesis. Here, we analyze the expression of three xanthophyll biosynthetic genes (i.e. β-carotene hydroxylase [bhy], zeaxanthin epoxidase [zep], and violaxanthin de-epoxidase [vde]) during de-etiolation of seedlings of tobacco (Nicotiana tabacum L. cv Samsun) under different light conditions. White-light illumination caused an increase in the amount of all corresponding mRNAs. The expression profiles of bhy and zep not only resembled each other but were also similar to the pattern of a gene encoding a major light-harvesting protein of photosystem II. This finding indicates a coordinated synthesis during formation of the antenna complex. In contrast, the expression pattern of vde was clearly different. Furthermore, the gene expression of bhy was shown to be modulated after illumination with different white-light intensities. The expression of all xanthophyll biosynthetic genes under examination was up-regulated upon exposure to red, blue, and white light. Gene expression of bhy and vde but not of zep was more pronounced under red-light illumination, pointing at an involvement of the phytochrome system. Expression analysis in the presence of the photosynthetic electron transport inhibitors 3-(3,4-dichlorophenyl)-1,1-dimethyl-urea and 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone indicated a redox control of transcription of two of the xanthophyll biosynthetic genes (bhy and zep). PMID:12857831

  12. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Science.gov (United States)

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  13. Intersectional gene flow between insular endemics of Ilex (Aquifoliaceae) on the Bonin Islands and the Ryukyu Islands.

    Science.gov (United States)

    Setoguchi, H; Watanabe, I

    2000-06-01

    Hybridization and introgression play important roles in plant evolution, and their occurrence on the oceanic islands provides good examples of plant speciation and diversification. Restriction fragment length polymorphisms (RFLPs) and trnL (UAA) 3'exon-trnF (GAA) intergenic spacer (IGS) sequences of chloroplast DNA (cpDNA), and the sequences of internal transcribed spacer (ITS) of nuclear ribosomal DNA were examined to investigate the occurrence of gene transfer in Ilex species on the Bonin Islands and the Ryukyu Islands in Japan. A gene phylogeny for the plastid genome is in agreement with the morphologically based taxonomy, whereas the nuclear genome phylogeny clusters putatively unrelated endemics both on the Bonin and the Ryukyu Islands. Intersectional hybridization and nuclear gene flow were independently observed in insular endemics of Ilex on both sets of islands without evidence of plastid introgression. Gene flow observed in these island systems can be explained by ecological features of insular endemics, i.e., limits of distribution range or sympatric distribution in a small land area.

  14. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Science.gov (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  15. Cuscuta europaea plastid apparatus in various developmental stages: localization of THF1 protein.

    Science.gov (United States)

    Švubová, Renáta; Ovečka, Miroslav; Pavlovič, Andrej; Slováková, L'udmila; Blehová, Alžbeta

    2013-05-01

    It was generally accepted that Cuscuta europaea is mostly adapted to a parasitic lifestyle with no detectable levels of chlorophylls. We found out relatively high level of chlorophylls (Chls a+b) in young developmental stages of dodder. Significant lowering of Chls (a+b) content and increase of carotenoid concentration was typical only for ontogenetically more developed stages. Lower content of photosynthesis-related proteins involved in Chls biosynthesis and in photosystem formation as well as low photochemical activity of PSII indicate that photosynthesis is not the main activity of C. europaea plastids. Previously, it has been shown in other species that the Thylakoid Formation Protein 1 (THF1) is involved in thylakoid membrane differentiation, plant-fungal and plant-bacterial interactions and in sugar signaling with its preferential localization to plastids. Our immunofluorescence localization studies and analyses of haustorial plasma membrane fractions revealed that in addition to plastids, the THF1 protein localizes also to the plasma membrane and plasmodesmata in developing C. europaea haustorium, most abundantly in the digitate cells of the endophyte primordium. These results are supported by western blot analysis, documenting the highest levels of the THF1 protein in "get together" tissues of dodder and tobacco. Based on the fact that photosynthesis is not a typical process in the C. europaea haustorium and on the extra-plastidial localization pattern of the THF1, our data support rather other functions of this protein in the complex relationship between C. europaea and its host.

  16. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds.

    Science.gov (United States)

    de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap

    2002-04-15

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.

  17. Riboflavin accumulation and characterization of cDNAs encoding lumazine synthase and riboflavin synthase in bitter melon (Momordica charantia).

    Science.gov (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un

    2012-12-05

    Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.

  18. Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

    2015-12-01

    In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  19. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi

    2013-12-01

    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  20. The gene encoding the melanin-concentrating hormone receptor 1 is associated with schizophrenia in a Danish case-control sample

    DEFF Research Database (Denmark)

    Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H

    2012-01-01

    OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...

  1. Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

    Science.gov (United States)

    Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

    2010-07-04

    Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

  2. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  4. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  6. Comparison of Six DNA Extraction Procedures and the Application of Plastid DNA Enrichment Methods in Selected Non-photosynthetic Plants

    Directory of Open Access Journals (Sweden)

    Shin-Yi Shyu

    2013-12-01

    Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.

  7. CLE peptide-encoding gene families in Medicago truncatula and Lotus japonicus, compared with those of soybean, common bean and Arabidopsis

    DEFF Research Database (Denmark)

    Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M

    2017-01-01

    these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...

  8. Geographical variation in the presence of genes encoding superantigenic exotoxins and beta-hemolysin among Staphylococcus aureus isolated from bovine mastitis in Europe and USA

    DEFF Research Database (Denmark)

    Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.

    2002-01-01

    The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...

  9. Trichoderma genes

    Science.gov (United States)

    Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  10. A common red algal origin of the apicomplexan, dinoflagellate, and heterokont plastids

    Czech Academy of Sciences Publication Activity Database

    Janouškovec, J.; Horák, A.; Oborník, Miroslav; Lukeš, Julius; Keeling, P. J.

    2010-01-01

    Roč. 107, č. 24 (2010), s. 10949-10954 ISSN 0027-8424 R&D Projects: GA AV ČR IAA601410907 Institutional research plan: CEZ:AV0Z60220518 Keywords : Apicomplexa * Chromera velia * CCMP3155 * plastid evolution * chloroplast genome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.771, year: 2010

  11. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    Science.gov (United States)

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

  12. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-01-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

  13. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  14. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  15. A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

    Science.gov (United States)

    Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

    2002-07-01

    Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

  16. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

    Science.gov (United States)

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

    2011-01-01

    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  18. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  19. REDUCED CHLOROPLAST COVERAGE genes from Arabidopsis thaliana help to establish the size of the chloroplast compartment.

    Science.gov (United States)

    Larkin, Robert M; Stefano, Giovanni; Ruckle, Michael E; Stavoe, Andrea K; Sinkler, Christopher A; Brandizzi, Federica; Malmstrom, Carolyn M; Osteryoung, Katherine W

    2016-02-23

    Eukaryotic cells require mechanisms to establish the proportion of cellular volume devoted to particular organelles. These mechanisms are poorly understood. From a screen for plastid-to-nucleus signaling mutants in Arabidopsis thaliana, we cloned a mutant allele of a gene that encodes a protein of unknown function that is homologous to two other Arabidopsis genes of unknown function and to FRIENDLY, which was previously shown to promote the normal distribution of mitochondria in Arabidopsis. In contrast to FRIENDLY, these three homologs of FRIENDLY are found only in photosynthetic organisms. Based on these data, we proposed that FRIENDLY expanded into a small gene family to help regulate the energy metabolism of cells that contain both mitochondria and chloroplasts. Indeed, we found that knocking out these genes caused a number of chloroplast phenotypes, including a reduction in the proportion of cellular volume devoted to chloroplasts to 50% of wild type. Thus, we refer to these genes as REDUCED CHLOROPLAST COVERAGE (REC). The size of the chloroplast compartment was reduced most in rec1 mutants. The REC1 protein accumulated in the cytosol and the nucleus. REC1 was excluded from the nucleus when plants were treated with amitrole, which inhibits cell expansion and chloroplast function. We conclude that REC1 is an extraplastidic protein that helps to establish the size of the chloroplast compartment, and that signals derived from cell expansion or chloroplasts may regulate REC1.

  20. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...