6-Desaturase-Like Encoding Gene Introduction in Catfish (Clarias gariepinus

Directory of Open Access Journals (Sweden)

Anny Hary Ayu

2017-11-01

Full Text Available African catfish (Clarias gariepinus is one of the economically valuable aquaculture fish species in Indonesia. This research was aimed to produce F0 transgenic catfish carrying masou salmon Δ6-desaturase-like (OmΔ6FAD gene. The Δ6-desaturase enzyme is involved in highly unsaturated fatty acid biosynthesis. Transgenic catfish was produced by sperm-mediated gene transfer using electroporation method. In this study, as the first step, sperms were electroporated with three different OmΔ6FAD concentration (25, 50, and 100 µg mL-1 to have the highest sperm viability after electroporation (125 V/cm, pulse frequency 5 times, pulse length 30 millisecond, pulse interval 0.1 second. The highest sperm viability and sperm carrying OmΔ6FAD were obtain at 100 µg mL-1. This concentration was then used to produce F0 transgenic catfish in the second step. Sperm motility, sperm viability, fertilization rate, hatching rate, and larval survival at 14 days after hatching were the same as the controls (p>0.05. Genomic DNA was extracted from caudal fin and then used as template to identify transgenic F0 by PCR method using specific primer for OmΔ6FAD gene. The PCR result showed that 53.84% of F0 carried OmΔ6FAD gene. The result of fatty acid analysis showed that EPA and DHA contents of F0 transgenic fish and non-transgenic fish were similar.   Keywords: catfish, Δ6-desaturase-like gene, fatty acids, electroporation

Isolation and characterization of the human parathyroid hormone-like peptide gene

International Nuclear Information System (INIS)

Mangin, M.; Ikeda, K.; Dreyer, B.E.; Broadus, A.E.

1989-01-01

A parathyroid hormone-like peptide (PTH-LP) has recently been identified in human tumors associated with the syndrome of humoral hypercalcemia of malignancy. The peptide appears to be encoded by a single-copy gene that gives rise to multiple mRNAs that are heterogeneous at both their 5' and their 3' ends. Alternative RNA splicing is responsible for the 3' heterogeneity and results in mRNAs encoding three different peptides, each with a unique C terminus. The authors have isolated and characterized the human PTHLP gene. The gene is a complex transcriptional unit spanning more than 12 kilobases of DNA and containing six exons. Two 5' exons encode distinct 5' untranslated regions and are separated by a putative promoter element, indicating that the gene either has two promoters or is alternatively spliced from a single promoter upstream of the first exon. The middle portion of the PTHLP gene, comprising exons 2-4, has an organizational pattern of introns and exons identical to that of the parathyroid hormone gene, consistent with a common ancestral origin of these two genes. Exon 4 of the PTHLP gene encodes the region common to all three peptides and the C terminus of the shortest peptide, and exons 5 and 6 encode the unique C termini of the other two peptides. Northern analysis of mRNAs from four human tumors of different histological types reveals the preferential use of 3' splicing patterns of individual tumors

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Molecular cloning and characterization of recA-like gene from Schizosaccharomyces pombe

International Nuclear Information System (INIS)

Lee, J.S.; Kang, J.K.; Yoon, S.M.; Park, Y.; Yang, Y.K.; Kim, S.W.; Park, J.K.; Park, J.G.; Hong, S.H.; Park, S.D.

1996-01-01

We have previously purified and characterized a RecA-like protein from Schizosaccharomyces pombe (S. pombe). In the present study, we have cloned a gene encoding the RecA-like protein. The S. pombe recA-like gene was isolated by immunological screening of the expression library of S. pombe using anti-Escherichia coli (E. coli) RecA antibody as a probe. From 10(6) plaques screened, 6 putative clones were finally isolated. Five of the clones screened contained the same kinds of DNA inserts, as determined by crosshybridization analysis. Among the clones, TC-2 was selected for further studies. The pGEM3Zf(-)Delta 17 vector harboring the 4.3 kb DNA insert of TC-2 clone was capable of producing abeta-gal/RecA-like fusion protein, suggesting that the cloned gene encodes the RecA-like protein of S. pombe. It was also revealed by Southern hybridization analysis that the same DNA sequence as the cloned recA-like gene is located within the S. pombe chromosomal DNA. In addition, the cloned recA-like gene was transcribed into a 3.0 kb RNA transcript, as judged by Northern blot analysis. The level of the RNA transcript of recA-like gene was increased approximately 1.6 to 2.4-fold upon treatment with DNA damaging agents such as ultraviolet (UV)-light, methyl methanesulfonate (MMS), and mitomycin-C (MMC). This data suggests that the cloned S. pombe recA-like gene is slightly inducible to DNAdamage as in E. coli recA gene. These results suggest that an inducible repair mechanism analogous to that of E. coli may exist in fission yeast S. pombe

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

DEFF Research Database (Denmark)

Durkin, M E; Jäger, A C; Khurana, T S

1999-01-01

The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

A deep auto-encoder model for gene expression prediction.

Science.gov (United States)

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

Kruppel-like factor 2 inhibit the angiogenesis of cultured human liver sinusoidal endothelial cells through the ERK1/2 signaling pathway

Energy Technology Data Exchange (ETDEWEB)

Zeng, Xiao-Qing, E-mail: zeng.xiaoqing@zs-hospital.sh.cn [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Li, Na, E-mail: Linala.2009@163.com [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Pan, Du-Yi, E-mail: lasikesmi@hotmail.com [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Miao, Qing, E-mail: sadsadvenus@163.com [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Ma, Gui-Fen, E-mail: ma.guifen@zs-hospital.sh.cn [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Liu, Yi-Mei, E-mail: liuyimei1988@163.com [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Tseng, Yu-Jen, E-mail: dianatseng14@gmail.com [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Li, Feng, E-mail: li.feng2@zs-hospital.sh.cn [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Xu, Li-Li, E-mail: xu.lili3@zs-hospital.sh.cn [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Chen, Shi-Yao, E-mail: chen.shiyao@zs-hospital.sh.cn [Department of Gastroenterology of Zhongshan Hospital, Fudan University, Shanghai (China); Institute of Endoscopic Research of Zhongshan Hospital, Fudan University, Shanghai (China)

2015-09-04

Kruppel-like factor 2 (KLF2) is a crucial anti-angiogenic factor. However, its precise role in hepatic angiogenesis induced by liver sinusoidal endothelial cells (LSECs) remain unclear. This study was aimed to evaluate the effect of KLF2 on angiogenesis of LSECs and to explore the corresponding mechanism. Cultured human LSECs were infected with different lentiviruses to overexpress or suppress KLF2 expression. The CCK-8 assay, transwell migration assay and tube formation test, were used to investigate the roles of KLF2 in the proliferation, migration and vessel tube formation of LSECs, respectively. The expression and phosphorylation of ERK1/2 were detected by western blot. We discovered that the up-regulation of KLF2 expression dramatically inhibited proliferation, migration and tube formation in treated LSECs. Correspondingly, down-regulation of KLF2 expression significantly promoted proliferation, migration and tube formation in treated LSECs. Additionally, KLF2 inhibited the phosphorylation of ERK1/2 pathway, followed by the function of KLF2 in the angiogenesis of LSECs disrupted. In conclusion, KLF2 suppressed the angiogenesis of LSECs through inhibition of cell proliferation, migration, and vessel tube formation. These functions of KLF2 may be mediated through the ERK1/2 signaling pathway. - Highlights: • Overexpression of KLF2 inhibits the proliferation and migration of LSECs. • Overexpression of KLF2 inhibits the angiogenesis of LSECs. • ERK1/2 signaling pathway involved in the anti-angiogenic process of KLF2 on LSECs.

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

Investigation of genes encoding calcineurin B-like protein family in legumes and their expression analyses in chickpea (Cicer arietinum L.).

Science.gov (United States)

Meena, Mukesh Kumar; Ghawana, Sanjay; Sardar, Atish; Dwivedi, Vikas; Khandal, Hitaishi; Roy, Riti; Chattopadhyay, Debasis

2015-01-01

Calcium ion (Ca2+) is a ubiquitous second messenger that transmits various internal and external signals including stresses and, therefore, is important for plants' response process. Calcineurin B-like proteins (CBLs) are one of the plant calcium sensors, which sense and convey the changes in cytosolic Ca2+-concentration for response process. A search in four leguminous plant (soybean, Medicago truncatula, common bean and chickpea) genomes identified 9 to 15 genes in each species that encode CBL proteins. Sequence analyses of CBL peptides and coding sequences (CDS) suggested that there are nine original CBL genes in these legumes and some of them were multiplied during whole genome or local gene duplication. Coding sequences of chickpea CBL genes (CaCBL) were cloned from their cDNAs and sequenced, and their annotations in the genome assemblies were corrected accordingly. Analyses of protein sequences and gene structures of CBL family in plant kingdom indicated its diverse origin but showed a remarkable conservation in overall protein structure with appearance of complex gene structure in the course of evolution. Expression of CaCBL genes in different tissues and in response to different stress and hormone treatment were studied. Most of the CaCBL genes exhibited high expression in flowers. Expression profile of CaCBL genes in response to different abiotic stresses and hormones related to development and stresses (ABA, auxin, cytokinin, SA and JA) at different time intervals suggests their diverse roles in development and plant defence in addition to abiotic stress tolerance. These data not only contribute to a better understanding of the complex regulation of chickpea CBL gene family, but also provide valuable information for further research in chickpea functional genomics.

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

Investigation of genes encoding calcineurin B-like protein family in legumes and their expression analyses in chickpea (Cicer arietinum L..

Directory of Open Access Journals (Sweden)

Mukesh Kumar Meena

Full Text Available Calcium ion (Ca2+ is a ubiquitous second messenger that transmits various internal and external signals including stresses and, therefore, is important for plants' response process. Calcineurin B-like proteins (CBLs are one of the plant calcium sensors, which sense and convey the changes in cytosolic Ca2+-concentration for response process. A search in four leguminous plant (soybean, Medicago truncatula, common bean and chickpea genomes identified 9 to 15 genes in each species that encode CBL proteins. Sequence analyses of CBL peptides and coding sequences (CDS suggested that there are nine original CBL genes in these legumes and some of them were multiplied during whole genome or local gene duplication. Coding sequences of chickpea CBL genes (CaCBL were cloned from their cDNAs and sequenced, and their annotations in the genome assemblies were corrected accordingly. Analyses of protein sequences and gene structures of CBL family in plant kingdom indicated its diverse origin but showed a remarkable conservation in overall protein structure with appearance of complex gene structure in the course of evolution. Expression of CaCBL genes in different tissues and in response to different stress and hormone treatment were studied. Most of the CaCBL genes exhibited high expression in flowers. Expression profile of CaCBL genes in response to different abiotic stresses and hormones related to development and stresses (ABA, auxin, cytokinin, SA and JA at different time intervals suggests their diverse roles in development and plant defence in addition to abiotic stress tolerance. These data not only contribute to a better understanding of the complex regulation of chickpea CBL gene family, but also provide valuable information for further research in chickpea functional genomics.

Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

2017-01-01

The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

DOG1-like genes in cereals: investigation of their function by means of ectopic expression in Arabidopsis.

Science.gov (United States)

Ashikawa, Ikuo; Abe, Fumitaka; Nakamura, Shingo

2013-07-01

The Arabidopsis gene DOG1 (AtDOG1) functions in seed dormancy and in sugar signaling. Little is known about the structural and functional features of plant genes homologous to AtDOG1, except for one type (clade 1) of Triticeae AtDOG1-like genes, which was previously demonstrated to be functionally orthologous to AtDOG1. Here, through phylogenetic, structural, and functional analyses of cereal AtDOG1-like genes, we characterized their features: these genes exist as a gene family that can be classified into five distinct clades (1-5). Of these, AtDOG1-like genes in clades 1-4 have a similar architecture to AtDOG1: they encode proteins with three conserved regions. In contrast, the clade 5 genes are distinct; their encoded proteins lack these conserved regions, but harbor domains that interact with DNA. Ectopic expression of the cereal AtDOG1-like genes of clades 2-4 in Arabidopsis demonstrated that like the clade 1 genes, they performed the same function as AtDOG1. The correlation between the depth of seed dormancy and the efficiency of sugar signaling in transgenic Arabidopsis conferred by genes in clades 1-4 suggests a close link in the underlying mechanisms between the seed dormancy and sugar signaling functions of AtDOG1. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

[Cloning and expression analysis of a zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein encoding gene in Dendrobium officinale].

Science.gov (United States)

Zhang, Gang; Li, Yi-Min; Li, Biao; Zhang, Da-Wei; Guo, Shun-Xing

2015-01-01

The zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein (ZIP) plays an important role in the growth and development of plant. In this study, a full length cDNA of ZIP encoding gene, designed as DoZIP1 (GenBank accession KJ946203), was identified from Dendrobium officinale using RT-PCR and RACE. Bioinformatics analysis showed that DoZIP1 consisted of a 1,056 bp open reading frame (ORF) encoded a 351-aa protein with a molecular weight of 37.57 kDa and an isoelectric point (pI) of 6.09. The deduced DoZIP1 protein contained the conserved ZIP domain, and its secondary structure was composed of 50.71% alpha helix, 11.11% extended strand, 36.18% random coil, and beta turn 1.99%. DoZIP1 protein exhibited a signal peptide and eight transmembrane domains, presumably locating in cell membrane. The amino acid sequence had high homology with ZIP proteins from Arabidopsis, alfalfa and rice. A phylogenetic tree analysis demonstrated that DoZIP1 was closely related to AtZIP10 and OsZIP3, and they were clustered into one clade. Real time quantitative PCR analysis demonstrated that the transcription level of DoZIP1 in D. officinale roots was the highest (4.19 fold higher than that of stems), followed by that of leaves (1.12 fold). Molecular characters of DoZIP1 will be useful for further functional determination of the gene involving in the growth and development of D. officinale.

Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative

Energy Technology Data Exchange (ETDEWEB)

Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka; Pigli, Ying Z.; Boyle-Vavra, Susan; Rice , Phoebe A. (UC)

2016-08-29

Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-family replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

You Wanhui

2012-04-01

Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

DEFF Research Database (Denmark)

Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

2004-01-01

Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

A Root-Preferential DFR-Like Gene Encoding Dihydrokaempferol Reductase Involved in Anthocyanin Biosynthesis of Purple-Fleshed Sweet Potato.

Science.gov (United States)

Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua

2017-01-01

Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.

Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

International Nuclear Information System (INIS)

Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

2005-01-01

Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

Science.gov (United States)

Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

2012-07-15

Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

Structural analysis of the RH-like blood group gene products in nonhuman primates

Energy Technology Data Exchange (ETDEWEB)

Salvignol, I. [Centre Regional de Transfusion Sanguine, Toulouse (France); Calvas, P.; Blancher, A. [Universitaire d`Immunogenetique moleculaire, Toulouse (France); Socha, W.W. [University Medical Center, New York, NY (United States); Colin, Y.; Le Van Kim, C.; Bailly, P.; Cartron, J.P. [Institut National de la Transfusion Sanguine, Paris (France); Ruffie, J.; Blancher, A. [College de France, Paris (France)

1995-03-01

Rh-related transcripts present in bone marrow samples from several species of nonhuman primates (chimpanzee, gorilla, gibbon, crab-eating macaque) have been amplified by RT-polymerase chain reaction using primers deduced from the sequence of human RH genes. Nucleotide sequence analysis of the nonhuman transcripts revealed a high degree of similarity to human blood group Rh sequences, suggesting a great conservation of the RH genes throughout evolution. Full-length transcripts, potentially encoding 417 amino acid long proteins homologous to Rh polypeptides, were characterized, as well as mRNA isoforms which harbored nucleotide deletions or insertions and potentially encode truncated proteins. Proteins of 30-40,000 M{sub r}, immunologically related to human Rh proteins, were detected by western blot analysis with antipeptide antibodies, indicating that Rh-like transcripts are translated into membrane proteins. Comparison of human and nonhuman protein sequences was pivotal in clarifying the molecular basis of the blood group C/c polymorphism, showing that only the Pro103Ser substitution was correlated with C/c polymorphism. In addition, it was shown that a proline residue at position 102 was critical in the expression of C and c epitopes, most likely by providing an appropriate conformation of Rh polypeptides. From these data a phylogenetic reconstruction of the RH locus evolution has been calculated from which an unrooted phylogenetic tree could be proposed, indicating that African ape Rh-like genes would be closer to the human RhD gene than to the human RhCE gene. 55 refs., 4 figs., 1 tab.

Variation in the gene encoding Krüppel-like factor 7 influences body fat: studies of 14 818 Danes

DEFF Research Database (Denmark)

Zobel, Dorit P; Andreasen, Camilla H; Burgdorf, Kristoffer S

2009-01-01

OBJECTIVE: KLF7 encodes Krüppel-like factor (KLF) 7, a member of the KLF family of transcription factors, initially shown to play important roles in cellular development and differentiation, and reported to be specifically involved in adipogenesis. Several single nucleotide polymorphisms (SNPs...

Are Toll-like receptor gene polymorphisms associated with prostate cancer?

International Nuclear Information System (INIS)

Kutikhin, Anton G; Yuzhalin, Arseniy E

2012-01-01

The suggestion that there is a connection between chronic intraprostatic inflammation and prostate cancer was declared some years ago. As Toll-like receptors (TLRs) are the key players in the processes of chronic intraprostatic inflammation, there is a hypothesis that TLR gene polymorphisms may be associated with prostate cancer risk. Although a number of comprehensive studies have been conducted on large samples in various countries, reliable connections between these single nucleotide polymorphisms and prostate cancer risk, stage, grade, aggressiveness, ability to metastasize, and mortality have not been detected. Results have also varied slightly in different populations. The data obtained regarding the absence of connection between the polymorphisms of the genes encoding interleukin-1 receptor-associated kinases (IRAK1 and IRAK4) and prostate cancer risk might indicate a lack of association between inherited variation in the TLR signaling pathway and prostate cancer risk. It is possible to consider that polymorphisms of genes encoding TLRs and proteins of the TLR pathway also do not play a major role in the etiology and pathogenesis of prostate cancer. Feasibly, it would be better to focus research on associations between TLR single nucleotide polymorphisms and cancer risk in other infection-related cancer types

Bioinformatic analysis reveals high diversity of bacterial genes for laccase-like enzymes.

Directory of Open Access Journals (Sweden)

Luka Ausec

Full Text Available Fungal laccases have been used in various fields ranging from processes in wood and paper industries to environmental applications. Although a few bacterial laccases have been characterized in recent years, prokaryotes have largely been neglected as a source of novel enzymes, in part due to the lack of knowledge about the diversity and distribution of laccases within Bacteria. In this work genes for laccase-like enzymes were searched for in over 2,200 complete and draft bacterial genomes and four metagenomic datasets, using the custom profile Hidden Markov Models for two- and three-domain laccases. More than 1,200 putative genes for laccase-like enzymes were retrieved from chromosomes and plasmids of diverse bacteria. In 76% of the genes, signal peptides were predicted, indicating that these bacterial laccases may be exported from the cytoplasm, which contrasts with the current belief. Moreover, several examples of putatively horizontally transferred bacterial laccase genes were described. Many metagenomic sequences encoding fragments of laccase-like enzymes could not be phylogenetically assigned, indicating considerable novelty. Laccase-like genes were also found in anaerobic bacteria, autotrophs and alkaliphiles, thus opening new hypotheses regarding their ecological functions. Bacteria identified as carrying laccase genes represent potential sources for future biotechnological applications.

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes

Science.gov (United States)

Jarvi, S.I.; Goto, R.M.; Gee, G.F.; Briles, W.E.; Miller, M.M.

1999-01-01

We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbgl and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of '-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.

Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes.

Science.gov (United States)

Jarvi, S I; Goto, R M; Gee, G F; Briles, W E; Miller, M M

1999-01-01

We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbg1 and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of alpha-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase

Science.gov (United States)

Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Molecular characterisation of two novel maize LRR receptor-like kinases, which belong to the SERK gene family

NARCIS (Netherlands)

Baudino, S.; Hansen, S.; Brettschneider, R.; Hecht, V.F.G.; Dresselhaus, T.; Lörz, H.; Dumas, C.; Rogowsky, P.M.

2001-01-01

Genes encoding two novel members of the leucine-rich repeat receptor-like kinase (LRR-RLK) superfamily have been isolated from maize (Zea mays L.). These genes have been named ZmSERK1 and ZmSERK2 since features such as a putative leucine zipper (ZIP) and five leucine rich repeats in the

Cloning and expression of three thaumatin-like protein genes from Polyporus umbellatus

Directory of Open Access Journals (Sweden)

Mengmeng Liu

2017-05-01

Full Text Available Genes encoding thaumatin-like protein (TLPs are frequently found in fungal genomes. However, information on TLP genes in Polyporus umbellatus is still limited. In this study, three TLP genes were cloned from P. umbellatus. The full-length coding sequence of PuTLP1, PuTLP2 and PuTLP3 were 768, 759 and 561 bp long, respectively, encoding for 256, 253 and 187 amino acids. Phylogenetic trees showed that P. umbellatus PuTLP1, PuTLP2 and PuTLP3 were clustered with sequences from Gloeophyllum trabeum, Trametes versicolor and Stereum hirsutum, respectively. The expression patterns of the three TLP genes were higher in P. umbellatus with Armillaria mellea infection than in the sclerotia without A. mellea. Furthermore, over-expression of three PuTLPs were carried out in Escherichia coli BL21 (DE3 strain, and high quality proteins were obtained using Ni-NTA resin that can be used for preparation of specific antibodies. These results suggest that PuTLP1, PuTLP2 and PuTLP3 in P. umbellatus may be involved in the defense response to A. mellea infections.

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Influence of EARLI1-like genes on flowering time and lignin synthesis of Arabidopsis thaliana.

Science.gov (United States)

Shi, Y; Zhang, X; Xu, Z-Y; Li, L; Zhang, C; Schläppi, M; Xu, Z-Q

2011-09-01

EARLI1 encodes a 14.7 kDa protein in the cell wall, is a member of the PRP (proline-rich protein) family and has multiple functions, including resistance to low temperature and fungal infection. RNA gel blot analyses in the present work indicated that expression of EARLI1-like genes, EARLI1, At4G12470 and At4G12490, was down-regulated in Col-FRI-Sf2 RNAi plants derived from transformation with Agrobacterium strain ABI, which contains a construct encoding a double-strand RNA targeting 8CM of EARLI1. Phenotype analyses revealed that Col-FRI-Sf2 RNAi plants of EARLI1 flowered earlier than Col-FRI-Sf2 wild-type plants. The average bolting time of Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants was 39.7 and 19.4 days, respectively, under a long-day photoperiod. In addition, there were significant differences in main stem length, internode number and rosette leaf number between Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants. RT-PCR showed that EARLI1-like genes might delay flowering time through the autonomous and long-day photoperiod pathways by maintaining the abundance of FLC transcripts. In Col-FRI-Sf2 RNAi plants, transcription of FLC was repressed, while expression of SOC1 and FT was activated. Microscopy observations showed that EARLI1-like genes were also associated with morphogenesis of leaf cells in Arabidopsis. Using histochemical staining, EARLI1-like genes were found to be involved in regulation of lignin synthesis in inflorescence stems, and Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants had 9.67% and 8.76% dry weight lignin, respectively. Expression analysis revealed that cinnamoyl-CoA reductase, a key enzyme in lignin synthesis, was influenced by EARLI1-like genes. These data all suggest that EARLI1-like genes could control the flowering process and lignin synthesis in Arabidopsis. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Evolution of the C-Type Lectin-Like Receptor Genes of the DECTIN-1 Cluster in the NK Gene Complex

Directory of Open Access Journals (Sweden)

Susanne Sattler

2012-01-01

Full Text Available Pattern recognition receptors are crucial in initiating and shaping innate and adaptive immune responses and often belong to families of structurally and evolutionarily related proteins. The human C-type lectin-like receptors encoded in the DECTIN-1 cluster within the NK gene complex contain prominent receptors with pattern recognition function, such as DECTIN-1 and LOX-1. All members of this cluster share significant homology and are considered to have arisen from subsequent gene duplications. Recent developments in sequencing and the availability of comprehensive sequence data comprising many species showed that the receptors of the DECTIN-1 cluster are not only homologous to each other but also highly conserved between species. Even in Caenorhabditis elegans, genes displaying homology to the mammalian C-type lectin-like receptors have been detected. In this paper, we conduct a comprehensive phylogenetic survey and give an up-to-date overview of the currently available data on the evolutionary emergence of the DECTIN-1 cluster genes.

The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

Directory of Open Access Journals (Sweden)

Ying Wang

Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

The Drosophila melanogaster DmCK2beta transcription unit encodes for functionally non-redundant protein isoforms.

Science.gov (United States)

Jauch, Eike; Wecklein, Heike; Stark, Felix; Jauch, Mandy; Raabe, Thomas

2006-06-07

Genes encoding for the two evolutionary highly conserved subunits of a heterotetrameric protein kinase CK2 holoenzyme are present in all examined eukaryotic genomes. Depending on the organism, multiple transcription units encoding for a catalytically active CK2alpha subunit and/or a regulatory CK2beta subunit may exist. The phosphotransferase activity of members of the protein kinase CK2alpha family is thought to be independent of second messengers but is modulated by interaction with CK2beta-like proteins. In the genome of Drosophila melanogaster, one gene encoding for a CK2alpha subunit and three genes encoding for CK2beta-like proteins are present. The X-linked DmCK2beta transcription unit encodes for several CK2beta protein isoforms due to alternative splicing of its primary transcript. We addressed the question whether CK2beta-like proteins are redundant in function. Our in vivo experiments show that variations of the very C-terminal tail of CK2beta isoforms encoded by the X-linked DmCK2beta transcription unit influence their functional properties. In addition, we find that CK2beta-like proteins encoded by the autosomal D. melanogaster genes CK2betates and CK2beta' cannot fully substitute for a loss of CK2beta isoforms encoded by DmCK2beta.

Characterization of the product of a nonribosomal peptide synthetase-like (NRPS-like) gene using the doxycycline dependent Tet-on system in Aspergillus terreus.

Science.gov (United States)

Sun, Wei-Wen; Guo, Chun-Jun; Wang, Clay C C

2016-04-01

Genome sequencing of the fungus Aspergillus terreus uncovered a number of silent core structural biosynthetic genes encoding enzymes presumed to be involved in the production of cryptic secondary metabolites. There are five nonribosomal peptide synthetase (NRPS)-like genes with the predicted A-T-TE domain architecture within the A. terreus genome. Among the five genes, only the product of pgnA remains unknown. The Tet-on system is an inducible, tunable and metabolism-independent expression system originally developed for Aspergillus niger. Here we report the adoption of the Tet-on system as an effective gene activation tool in A. terreus. Application of this system in A. terreus allowed us to uncover the product of the cryptic NRPS-like gene, pgnA. Furthermore expression of pgnA in the heterologous Aspergillus nidulans host suggested that the pgnA gene alone is necessary for phenguignardic acid (1) biosynthesis. Copyright © 2016 Elsevier Inc. All rights reserved.

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

CLAVATA3-like genes are differentially expressed in grape vine (Vitis vinifera) tissues.

Science.gov (United States)

Tominaga-Wada, Rumi; Nukumizu, Yuka; Wada, Takuji; Sawa, Shinichiro; Tetsumura, Takuya

2013-10-15

The CLAVATA3 (CLV3)/endosperm surrounding region [(ESR) CLE] peptides function as intercellular signaling molecules that regulate various physiological and developmental processes in diverse plant species. We identified five CLV3-like genes from grape vine (Vitis vinifera var. Pinot Noir): VvCLE 6, VvCLE 25-1, VvCLE 25-2, VvCLE 43 and VvCLE TDIF. These CLV3-like genes encode short proteins containing 43-128 amino acids. Except VvCLE TDIF, grape vine CLV3-like proteins possess a consensus amino acid sequence known as the CLE domain. Phylogenic analysis suggests that the VvCLE 6, VvCLE25-1, VvCLE25-2 and VvCLE43 genes have evolved from a single common ancestor to the Arabidopsis CLV3 gene. Expression analyses showed that the five grape CLV3-like genes are expressed in leaves, stems, roots and axillary buds with significant differences in their levels of expression. For example, while all of them were strongly expressed in axillary buds, VvCLE6 and VvCLE43 expression prevailed in roots, and VvCLE25-1, VvCLE25-2 and VvCLE TDIF expression in stems. The differential expression of the five grape CLV3-like peptides suggests that they play different roles in different organs and developmental stages. Copyright © 2013 Elsevier GmbH. All rights reserved.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

The genome of Paenibacillus sabinae T27 provides insight into evolution, organization and functional elucidation of nif and nif-like genes.

Science.gov (United States)

Li, Xinxin; Deng, Zhiping; Liu, Zhanzhi; Yan, Yongliang; Wang, Tianshu; Xie, Jianbo; Lin, Min; Cheng, Qi; Chen, Sanfeng

2014-08-27

Most biological nitrogen fixation is catalyzed by the molybdenum nitrogenase. This enzyme is a complex which contains the MoFe protein encoded by nifDK and the Fe protein encoded by nifH. In addition to nifHDK, nifHDK-like genes were found in some Archaea and Firmicutes, but their function is unclear. We sequenced the genome of Paenibacillus sabinae T27. A total of 4,793 open reading frames were predicted from its 5.27 Mb genome. The genome of P. sabinae T27 contains fifteen nitrogen fixation (nif) genes, including three nifH, one nifD, one nifK, four nifB, two nifE, two nifN, one nifX and one nifV. Of the 15 nif genes, eight nif genes (nifB, nifH, nifD, nifK, nifE, nifN, nifX and nifV) and two non-nif genes (orf1 and hesA) form a complete nif gene cluster. In addition to the nif genes, there are nitrogenase-like genes, including two nifH-like genes and five pairs of nifDK-like genes. IS elements on the flanking regions of nif and nif-like genes imply that these genes might have been obtained by horizontal gene transfer. Phylogenies of the concatenated 8 nif gene (nifB, nifH, nifD, nifK, nifE, nifN, nifX and nifV) products suggest that P. sabinae T27 is closely related to Frankia. RT-PCR analysis showed that the complete nif gene cluster is organized as an operon. We demonstrated that the complete nif gene cluster under the control of σ70-dependent promoter enabled Escherichia coli JM109 to fix nitrogen. Also, here for the first time we demonstrated that unlike nif genes, the transcriptions of nifHDK-like genes were not regulated by ammonium and oxygen, and nifH-like or nifD-like gene could not restore the nitrogenase activity of Klebsiella pneumonia nifH- and nifD- mutant strains, respectively, suggesting that nifHDK-like genes were not involved in nitrogen fixation. Our data and analysis reveal the contents and distribution of nif and nif-like genes and contribute to the study of evolutionary history of nitrogen fixation in Paenibacillus. For the first time we

The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

Science.gov (United States)

Santiago, Margarita; Gardner, Richard C

2015-07-01

Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

Comparative and evolutionary studies of vertebrate ALDH1A-like genes and proteins.

Science.gov (United States)

Holmes, Roger S

2015-06-05

Vertebrate ALDH1A-like genes encode cytosolic enzymes capable of metabolizing all-trans-retinaldehyde to retinoic acid which is a molecular 'signal' guiding vertebrate development and adipogenesis. Bioinformatic analyses of vertebrate and invertebrate genomes were undertaken using known ALDH1A1, ALDH1A2 and ALDH1A3 amino acid sequences. Comparative analyses of the corresponding human genes provided evidence for distinct modes of gene regulation and expression with putative transcription factor binding sites (TFBS), CpG islands and micro-RNA binding sites identified for the human genes. ALDH1A-like sequences were identified for all mammalian, bird, lizard and frog genomes examined, whereas fish genomes displayed a more restricted distribution pattern for ALDH1A1 and ALDH1A3 genes. The ALDH1A1 gene was absent in many bony fish genomes examined, with the ALDH1A3 gene also absent in the medaka and tilapia genomes. Multiple ALDH1A1-like genes were identified in mouse, rat and marsupial genomes. Vertebrate ALDH1A1, ALDH1A2 and ALDH1A3 subunit sequences were highly conserved throughout vertebrate evolution. Comparative amino acid substitution rates showed that mammalian ALDH1A2 sequences were more highly conserved than for the ALDH1A1 and ALDH1A3 sequences. Phylogenetic studies supported an hypothesis for ALDH1A2 as a likely primordial gene originating in invertebrate genomes and undergoing sequential gene duplication to generate two additional genes, ALDH1A1 and ALDH1A3, in most vertebrate genomes. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

Genetic diversity of avenin-like b genes in Aegilops tauschii Coss.

Science.gov (United States)

Cao, Dong; Wang, Hongxia; Zhang, Bo; Liu, Baolong; Liu, Dengcai; Chen, Wenjie; Zhang, Huaigang

2018-02-01

Avenin-like storage proteins influence the rheological properties and processing quality in common wheat, and the discovery of new alleles will benefit wheat quality improvement. In this study, 13 avenin-like b alleles (TaALPb7D-A-M) were discovered in 108 Aegilops tauschii Coss. accessions. Ten alleles were reported for the first time, while the remaining three alleles were the same as alleles in other species. A total of 15 nucleotide changes were detected in the 13 alleles, resulting in only 11 amino acid changes because of synonymous mutations. Alleles TaALPb7D-E, TaALPb7D-G, and TaALPb7D-J encoded the same protein. These polymorphic sites existed in the N-terminus, Repetitive region (Left), Repetitive region (Right) and C-terminus domains, with no polymorphisms in the signal peptide sequence nor in those encoding the 18 conserved cysteine residues. Phylogenetic analysis divided the TaALPb7Ds into four clades. The Ae. tauschii alleles were distributed in all four clades, while the alleles derived from common wheat, TaALPb7D-G and TaALPb7D-C, belonged to clade III and IV, respectively. Alleles TaALPb7D-G and TaALPb7D-C were the most widely distributed, being present in nine and six countries, respectively. Iran and Turkey exhibited the highest genetic diversity with respect to TaALPb7D alleles, accessions from these countries carrying seven and six alleles, respectively, which implied that these countries were the centers of origin of the avenin-like b gene. The new alleles discovered and the phylogenetic analysis of avenin-like b genes will provide breeding materials and a theoretical basis for wheat quality improvement.

The RNase PD2 gene of almond (Prunus dulcis) represents an evolutionarily distinct class of S-like RNase genes.

Science.gov (United States)

Ma, R C; Oliveira, M M

2000-07-01

A cDNA for an S-like RNase (RNase PD2) has been isolated from a pistil cDNA library of Prunus dulcis cv. Ferragnés. The cDNA encodes an acidic protein of 226 amino acid residues with a molecular weight of 25 kDa. A potential N-glycosylation site is present at the N-terminus in RNase PD2. A signal peptide of 23 amino acid residues and a transmembrane domain are predicted. The two active-site histidines present in enzymes of the T2/S RNase superfamily were detected in RNase PD2. Its amino acid sequence shows 71.2% similarity to RNSI of Arabidopsis and RNase T2 of chickpea, respectively. Northern blotting and RT-PCR analyses indicate that PD2 is expressed predominantly in petals, pistils of open flowers and leaves of the almond tree. Analyses of shoots cultured in vitro suggested that the expression of RNase PD2 is associated with phosphate starvation. Southern analysis detected two sequences related to RNase PD2 in the P. dulcis genome. RFLP analysis showed that S-like RNase genes are polymorphic in different almond cultivars. The PD2 gene sequence was amplified by PCR and two introns were shown to interrupt the coding region. Based on sequence analysis, we have defined three classes of S-like RNase genes, with the PD2 RNase gene representing a distinct class. The significance of the structural divergence of S-like RNase genes is further discussed.

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Cloning and characterization of a gene encoding Rac/Rop-like monomeric guanosine 5'-triphosphate-binding protein from Scoparia dulcis.

Science.gov (United States)

Mitamura, Toshiaki; Shite, Masato; Yamamura, Yoshimi; Kurosaki, Fumiya

2009-06-01

A cDNA clone, designated Sd-racrop (969 bp), was isolated from seedlings of Scoparia dulcis. This gene contains an open reading frame encoding the protein of 197 amino acid residues with high homology to Rac/Rop small guanosine 5'-triphosphate-binding proteins from various plant sources. In Southern hybridization analysis, the restriction digests prepared from genomic DNA of S. dulcis showed a main signal together with a few weakly hybridized bands. The transcriptional level of Sd-racrop showed a transient decrease by exposure of the leaf tissues of S. dulcis to the ethylene-generating reagent 2-chloroethylphosphonic acid. However, an appreciable increase in gene expression was reproducibly observed upon treatment of the plant with methyl jasmonate. These results suggest that the Sd-racrop product plays roles in ethylene- and methyl jasmonate-induced responses of S. dulcis accompanying the change in the transcriptional level, however, the cellular events mediated by this protein toward these external stimuli would be regulated by various mechanisms.

Comparative genomics defines the core genome of the growing N4-like phage genus and identifies N4-like Roseophage specific genes

Directory of Open Access Journals (Sweden)

Jacqueline Zoe-Munn Chan

2014-10-01

Full Text Available Two bacteriophages, RPP1 and RLP1, infecting members of the marine Roseobacter clade were isolated from seawater. Their linear genomes are 74.7 and 74.6 kb and encode 91 and 92 coding DNA sequences, respectively. Around 30% of these are homologous to genes found in Enterobacter phage N4. Comparative genomics of these two new Roseobacter phages and twenty-three other sequenced N4-like phages (three infecting members of the Roseobacter lineage and twenty infecting other Gammaproteobacteria revealed that N4-like phages share a core genome of 14 genes responsible for control of gene expression, replication and virion proteins. Phylogenetic analysis of these genes placed the five N4-like roseophages (RN4 into a distinct subclade. Analysis of the RN4 phage genomes revealed they share a further 19 genes of which nine are found exclusively in RN4 phages and four appear to have been acquired from their bacterial hosts. Proteomic analysis of the RPP1 and RLP1 virions identified a second structural module present in the RN4 phages similar to that found in the Pseudomonas N4-like phage LIT1. Searches of various metagenomic databases, included the GOS database, using CDS sequences from RPP1 suggests these phages are widely distributed in marine environments in particular in the open ocean environment.

The amyloid precursor-like protein (APLP) gene maps to the long arm of human chromosome 19

Energy Technology Data Exchange (ETDEWEB)

Wasco, W.; Tanzi, R.E. (Harvard Medical School, Boston, MA (United States)); Brook, J.D. (Center for Medical Genetics, Nottingham (United Kingdom))

1993-01-01

We have recently isolated a cDNA from a mouse brain library that encodes a protein whose predicted amino acid sequence is 42% identical and 64% similar to that of the amyloid [beta] protein precursor (APP; 16). This 653-amino-acid amyloid precursor-like protein (APLP) is similar to APP in overall structure as well as amino acid sequence. The amino acid homologies are particularly strong in three distinct regions of the proteins where the identities are 47, 54, and 56% (16). All three of these regions are also conserved in the Drosophila APP-like gene, APPL (11). Notably, 12 cysteine residues and a N -glyco-sylation site are conserved in the extracellular portion of APLP and APP, and a clathrin-binding domain is conserved in the cytoplasmic domain. The cytoplasmic domain is also conserved in a partial CDNA reported to encode an APP-like gene in rat testes (17), These data suggest that APLP and APP are members of a highly conserved gene family. A panel of DNAs from 31 human-rodent somatic cell lines of known karyotype was digested with EcoR1. These DNAs were then probed with the human APLP cDNA clone and the hybridization pattern was consistent with the assignment of the APLP locus to chromosome 19. 17 refs., 1 fig.

The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

Directory of Open Access Journals (Sweden)

Mohammad H Dezfulian

Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

Directory of Open Access Journals (Sweden)

Lukasz Michal Szafron

Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

ClRTL1 Encodes a Chinese Fir RNase III–Like Protein Involved in Regulating Shoot Branching

Directory of Open Access Journals (Sweden)

Xia Li

2015-10-01

Full Text Available Identification of genes controlling shoot branching is crucial for improving plant architecture and increasing crop yield or biomass. A branching mutant of Chinese fir named “Dugansha” (Cunninghamia lanceolata var. dugan. has been isolated in our laboratory. We chose the cDNA-AFLP technique and an effective strategy to screen genes that potentially regulate shoot branching in Chinese fir using this mutant. An RNase III-like1 cDNA fragment named ClRTL1 was identified as a potential positive regulator. To investigate the function of ClRTL1 in regulating shoot branching, we cloned the full-length cDNA sequence from C. lanceolata (Lamb. Hook, deduced its secondary structure and function, and overexpressed the coding sequence in Arabidopsis. The ClRTL1 cDNA is 1045 bp and comprises an open reading frame of 705 bp. It encodes a protein of 235 amino acids. The deduced secondary structure of the ClRTL1 indicates that it is a mini-RNase III-like protein. The expression analysis and phenotypes of 35S: ClRTL1 in A. thaliana implies that ClRTL1 plays a role in promoting shoot branching in Chinese fir.

A multicolor panel of TALE-KRAB based transcriptional repressor vectors enabling knockdown of multiple gene targets.

Science.gov (United States)

Zhang, Zhonghui; Wu, Elise; Qian, Zhijian; Wu, Wen-Shu

2014-12-05

Stable and efficient knockdown of multiple gene targets is highly desirable for dissection of molecular pathways. Because it allows sequence-specific DNA binding, transcription activator-like effector (TALE) offers a new genetic perturbation technique that allows for gene-specific repression. Here, we constructed a multicolor lentiviral TALE-Kruppel-associated box (KRAB) expression vector platform that enables knockdown of multiple gene targets. This platform is fully compatible with the Golden Gate TALEN and TAL Effector Kit 2.0, a widely used and efficient method for TALE assembly. We showed that this multicolor TALE-KRAB vector system when combined together with bone marrow transplantation could quickly knock down c-kit and PU.1 genes in hematopoietic stem and progenitor cells of recipient mice. Furthermore, our data demonstrated that this platform simultaneously knocked down both c-Kit and PU.1 genes in the same primary cell populations. Together, our results suggest that this multicolor TALE-KRAB vector platform is a promising and versatile tool for knockdown of multiple gene targets and could greatly facilitate dissection of molecular pathways.

HIV exposed seronegative (HESN compared to HIV infected individuals have higher frequencies of telomeric Killer Immunoglobulin-like Receptor (KIR B motifs; Contribution of KIR B motif encoded genes to NK cell responsiveness.

Directory of Open Access Journals (Sweden)

Elise Jackson

Full Text Available Previously, we showed that Killer Immunoglobulin-like Receptor (KIR3DS1 homozygotes (hmz are more frequent in HIV exposed seronegative (HESN than in recently HIV infected (HIV+ individuals. KIR3DS1 encodes an activating Natural Killer (NK cell receptor (NKR. The link between KIR genotype and HIV outcomes likely arises from the function that NK cells acquire through expression of particular NKRs. An initial screen of 97 HESN and 123 HIV+ subjects for the frequency of KIR region gene carriage observed between-group differences for several telomeric KIR region loci. In a larger set of up to 106 HESN and 439 HIV+ individuals, more HESN than HIV+ subjects were KIR3DS1 homozygotes, lacked a full length KIR2DS4 gene and carried the telomeric group B KIR haplotype motif, TB01. TB01 is characterized by the presence of KIR3DS1, KIR2DL5A, KIR2DS3/5 and KIR2DS1, in linkage disequilibrium with each other. We assessed which of the TB01 encoded KIR gene products contributed to NK cell responsiveness by stimulating NK cells from 8 HIV seronegative KIR3DS1 and TB01 motif homozygotes with 721.221 HLA null cells and evaluating the frequency of KIR3DS1+/-KIR2DL5+/-, KIR3DS1+/-KIR2DS1+/-, KIR3DS1+/-KIR2DS5+/- NK cells secreting IFN-γ and/or expressing CD107a. A higher frequency of NK cells expressing, versus not, KIR3DS1 responded to 721.221 stimulation. KIR2DL5A+, KIR2DS1+ and KIR2DS5+ NK cells did not contribute to 721.221 responses or modulate those by KIR3DS1+ NK cells. Thus, of the TB01 KIR gene products, only KIR3DS1 conferred responsiveness to HLA-null stimulation, demonstrating its ligation can activate ex vivo NK cells.

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

Science.gov (United States)

Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

2002-07-01

Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

Photorhabdus insect-related (Pir) toxin-like genes in a plasmid of Vibrio parahaemolyticus, the causative agent of acute hepatopancreatic necrosis disease (AHPND) of shrimp

Science.gov (United States)

Han, Jee Eun; Tang, Kathy F. J.; Tran, Loc H.; Lightner, Donald V.

2016-01-01

The 69 kb plasmid pVPA3-1 was identified in Vibrio parahaemolyticus strain 13-028/A3 that can cause acute hepatopancreatic necrosis disease (AHPND). This disease is responsible for mass mortalities in farmed penaeid shrimp and is referred to as early mortality syndrome (EMS). The plasmid has a GC content of 45.9% with a copy number of 37 per bacterial cell as determined by comparative quantitative PCR analyses. It consists of 92 open reading frames that encode mobilization proteins, replication enzymes, transposases, virulence-associated proteins, and proteins similar to Photorhabdus insect-related (Pir) toxins. In V. parahaemolyticus, these Pir toxin-like proteins are encoded by 2 genes ( pirA- and pirB-like) located within a 3.5 kb fragment flanked with inverted repeats of a transposase-coding sequence (1 kb). The GC content of these 2 genes is only 38.2%, substantially lower than that of the rest of the plasmid, which suggests that these genes were recently acquired. Based on a proteomic analysis, the pirA-like (336 bp) and pirB-like (1317 bp) genes encode for 13 and 50 kDa proteins, respectively. In laboratory cultures of V. parahaemolyticus 13-028/A3, both proteins were secreted into the culture medium. We developed a duplex PCR diagnostic method, with a detection limit of 105 CFU ml−1 and targeting pirA- and pirB-like genes in this strain of V. parahaemolyticus. This PCR protocol can reliably detect AHPND-causing strains of V. parahaemolyticus and does not cross react with non-pathogenic strains or with other species of Vibrio isolated from shrimp ponds. PMID:25667334

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Profil Ekspresi mRNA Gen Murine Double Minute2, Kruppel-Like Factor4, dan c-Myc pada Fibrosarkoma

Directory of Open Access Journals (Sweden)

- Humaryanto

2017-02-01

Full Text Available Abstrak Fibrosarkoma hanya terjadi 1–3% dari seluruh keganasan jaringan lunak. Hingga saat ini etiologi fibrosarkoma belum diketahui dengan pasti. Beberapa faktor dapat menjadi penyebab patogenesis fibrosarkoma antara lain radiasi, terpapar zat kimia tertentu, serta infeksi human herpes virus 8 (HHV8 dan Epstein-Barr virus (EBV. Penelitian terkini menunjukkan bahwa banyak sarkoma terkait dengan mutasi genetik. Penelitian ini bertujuan melihat profil ekspresi mRNA gen Krüppel-like Factor4, Murine Double Minute2, dan c-Myc pada fibrosarkoma menggunakan teknik real time PCR kuantitatif (quantitative real time PCR, qRT-PCR. Analisis data menggunakan metode kuantititatif relatif 2-ΔΔCt. Penelitian ini menggunakan 10 sampel kasus fibrosarkoma yang ditemukan di Kota Jambi dari tahun 2011–2015. Hasil ΔCt (+SD MDM2, KLF-4, dan c-Myc disusun dari nilai yang terkecil hingga tertinggi adalah 1,85±2,14; 2,06±3,86; 2,9±2,66 secara berurutan. Dibanding dengan level ekspresi dengan GAPDH sebagai housekeeping gene, gen MDM2 dan KLF-4 relatif menurun dua kali lipat, sedangkan gen c-Myc relatif menurun lebih dari tiga kali lipat. Simpulan, penelitian ini menunjukkan bahwa pada kasus fibrosarkoma, gen c-Myc disupresi lebih kuat dibanding dengan gen MDM2 dan KLF-4. Abstract Fibrosarcoma is a rare soft tissue sarcoma, reported only 1–3% of all soft tissue sarcomas. Like any other soft-tissue sarcomas the definitive caused has not yet understood. Recognized causes include exposure to ionizing radiation, various physical and chemical factors, infection with human herpes virus (HHV8 and Epstein-Barr virus (EBV. Current research indicates many sarcomas are associated with genetic mutations. In this study, we investigated profile of mRNA gene expression KLF4, MDM2, and c-Myc of RNA in fibrosarcoma cases. The genes expression was examined using quantitative real time PCR (qRT-PCR and we analyzed the relative gene expression using the 2-ΔΔCt method. Ten

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Homozygous carriers of the G allele of rs4664447 of the glucagon gene (GCG) are characterised by decreased fasting and stimulated levels of insulin, glucagon and glucagon-like peptide (GLP)-1

DEFF Research Database (Denmark)

Torekov, S S; Ma, L; Grarup, N

2011-01-01

The glucagon gene (GCG) encodes several hormones important for energy metabolism: glucagon, oxyntomodulin and glucagon-like peptide (GLP)-1 and -2. Variants in GCG may associate with type 2 diabetes, obesity and/or related metabolic traits.......The glucagon gene (GCG) encodes several hormones important for energy metabolism: glucagon, oxyntomodulin and glucagon-like peptide (GLP)-1 and -2. Variants in GCG may associate with type 2 diabetes, obesity and/or related metabolic traits....

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

T4 genes in the marine ecosystem: studies of the T4-like cyanophages and their role in marine ecology

Directory of Open Access Journals (Sweden)

Millard Andrew D

2010-10-01

Full Text Available Abstract From genomic sequencing it has become apparent that the marine cyanomyoviruses capable of infecting strains of unicellular cyanobacteria assigned to the genera Synechococcus and Prochlorococcus are not only morphologically similar to T4, but are also genetically related, typically sharing some 40-48 genes. The large majority of these common genes are the same in all marine cyanomyoviruses so far characterized. Given the fundamental physiological differences between marine unicellular cyanobacteria and heterotrophic hosts of T4-like phages it is not surprising that the study of cyanomyoviruses has revealed novel and fascinating facets of the phage-host relationship. One of the most interesting features of the marine cyanomyoviruses is their possession of a number of genes that are clearly of host origin such as those involved in photosynthesis, like the psbA gene that encodes a core component of the photosystem II reaction centre. Other host-derived genes encode enzymes involved in carbon metabolism, phosphate acquisition and ppGpp metabolism. The impact of these host-derived genes on phage fitness has still largely to be assessed and represents one of the most important topics in the study of this group of T4-like phages in the laboratory. However, these phages are also of considerable environmental significance by virtue of their impact on key contributors to oceanic primary production and the true extent and nature of this impact has still to be accurately assessed.

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Multiple and variable NHEJ-like genes are involved in resistance to DNA damage in Streptomyces ambofaciens

Directory of Open Access Journals (Sweden)

Grégory Hoff

2016-11-01

Full Text Available Non homologous end-joining (NHEJ is a double strand break (DSB repair pathway which does not require any homologous template and can ligate two DNA ends together. The basic bacterial NHEJ machinery involves two partners: the Ku protein, a DNA end binding protein for DSB recognition and the multifunctional LigD protein composed a ligase, a nuclease and a polymerase domain, for end processing and ligation of the broken ends. In silico analyses performed in the 38 sequenced genomes of Streptomyces species revealed the existence of a large panel of NHEJ-like genes. Indeed, ku genes or ligD domain homologues are scattered throughout the genome in multiple copies and can be distinguished in two categories: the core NHEJ gene set constituted of conserved loci and the variable NHEJ gene set constituted of NHEJ-like genes present in only a part of the species. In Streptomyces ambofaciens ATCC 23877, not only the deletion of core genes but also that of variable genes led to an increased sensitivity to DNA damage induced by electron beam irradiation. Multiple mutants of ku, ligase or polymerase encoding genes showed an aggravated phenotype compared to single mutants. Biochemical assays revealed the ability of Ku-like proteins to protect and to stimulate ligation of DNA ends. RT-qPCR and GFP fusion experiments suggested that ku-like genes show a growth phase dependent expression profile consistent with their involvement in DNA repair during spores formation and/or germination.

Genome-wide analysis of esterase-like genes in the striped rice stem borer, Chilo suppressalis.

Science.gov (United States)

Wang, Baoju; Wang, Ying; Zhang, Yang; Han, Ping; Li, Fei; Han, Zhaojun

2015-06-01

The striped rice stem borer, Chilo suppressalis, a destructive pest of rice, has developed high levels of resistance to certain insecticides. Esterases are reported to be involved in insecticide resistance in several insects. Therefore, this study systematically analyzed esterase-like genes in C. suppressalis. Fifty-one esterase-like genes were identified in the draft genomic sequences of the species, and 20 cDNA sequences were derived which encoded full- or nearly full-length proteins. The putative esterase proteins derived from these full-length genes are overall highly diversified. However, key residues that are functionally important including the serine residue in the active site are conserved in 18 out of the 20 proteins. Phylogenetic analysis revealed that most of these genes have homologues in other lepidoptera insects. Genes CsuEst6, CsuEst10, CsuEst11, and CsuEst51 were induced by the insecticide triazophos, and genes CsuEst9, CsuEst11, CsuEst14, and CsuEst51 were induced by the insecticide chlorantraniliprole. Our results provide a foundation for future studies of insecticide resistance in C. suppressalis and for comparative research with esterase genes from other insect species.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae

Directory of Open Access Journals (Sweden)

Dunham Stephen

2009-11-01

Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

Directory of Open Access Journals (Sweden)

Řičicová Markéta

2010-04-01

Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

The SlZRT1 Gene Encodes a Plasma Membrane-Located ZIP (Zrt-, Irt-Like Protein Transporter in the Ectomycorrhizal Fungus Suillus luteus

Directory of Open Access Journals (Sweden)

Laura Coninx

2017-11-01

Full Text Available Zinc (Zn is an essential micronutrient but may become toxic when present in excess. In Zn-contaminated environments, trees can be protected from Zn toxicity by their root-associated micro-organisms, in particular ectomycorrhizal fungi. The mechanisms of cellular Zn homeostasis in ectomycorrhizal fungi and their contribution to the host tree’s Zn status are however not yet fully understood. The aim of this study was to identify and characterize transporters involved in Zn uptake in the ectomycorrhizal fungus Suillus luteus, a cosmopolitan pine mycobiont. Zn uptake in fungi is known to be predominantly governed by members of the ZIP (Zrt/IrtT-like protein family of Zn transporters. Four ZIP transporter encoding genes were identified in the S. luteus genome. By in silico and phylogenetic analysis, one of these proteins, SlZRT1, was predicted to be a plasma membrane located Zn importer. Heterologous expression in yeast confirmed the predicted function and localization of the protein. A gene expression analysis via RT-qPCR was performed in S. luteus to establish whether SlZRT1 expression is affected by external Zn concentrations. SlZRT1 transcripts accumulated almost immediately, though transiently upon growth in the absence of Zn. Exposure to elevated concentrations of Zn resulted in a significant reduction of SlZRT1 transcripts within the first hour after initiation of the exposure. Altogether, the data support a role as cellular Zn importer for SlZRT1 and indicate a key role in cellular Zn uptake of S. luteus. Further research is needed to understand the eventual contribution of SlZRT1 to the Zn status of the host plant.

The SlZRT1 Gene Encodes a Plasma Membrane-Located ZIP (Zrt-, Irt-Like Protein) Transporter in the Ectomycorrhizal Fungus Suillus luteus.

Science.gov (United States)

Coninx, Laura; Thoonen, Anneleen; Slenders, Eli; Morin, Emmanuelle; Arnauts, Natascha; Op De Beeck, Michiel; Kohler, Annegret; Ruytinx, Joske; Colpaert, Jan V

2017-01-01

Zinc (Zn) is an essential micronutrient but may become toxic when present in excess. In Zn-contaminated environments, trees can be protected from Zn toxicity by their root-associated micro-organisms, in particular ectomycorrhizal fungi. The mechanisms of cellular Zn homeostasis in ectomycorrhizal fungi and their contribution to the host tree's Zn status are however not yet fully understood. The aim of this study was to identify and characterize transporters involved in Zn uptake in the ectomycorrhizal fungus Suillus luteus , a cosmopolitan pine mycobiont. Zn uptake in fungi is known to be predominantly governed by members of the ZIP (Zrt/IrtT-like protein) family of Zn transporters. Four ZIP transporter encoding genes were identified in the S. luteus genome. By in silico and phylogenetic analysis, one of these proteins, SlZRT1, was predicted to be a plasma membrane located Zn importer. Heterologous expression in yeast confirmed the predicted function and localization of the protein. A gene expression analysis via RT-qPCR was performed in S. luteus to establish whether SlZRT1 expression is affected by external Zn concentrations. SlZRT1 transcripts accumulated almost immediately, though transiently upon growth in the absence of Zn. Exposure to elevated concentrations of Zn resulted in a significant reduction of SlZRT1 transcripts within the first hour after initiation of the exposure. Altogether, the data support a role as cellular Zn importer for SlZRT1 and indicate a key role in cellular Zn uptake of S. luteus . Further research is needed to understand the eventual contribution of SlZRT1 to the Zn status of the host plant.

Molecular Characterization and Expression Analysis of Insulin-like Growth Factor-1 and Insulin-like Growth Factor Binding Protein-1 Genes in Qinghai-Tibet Plateau and Lowland

Directory of Open Access Journals (Sweden)

Ya-bing Chen

2015-01-01

Full Text Available Insulin-like growth factor-1 (IGF-1 and insulin-like growth factor binding protein-1 (IGFBP-1 play a pivotal role in regulating cellular hypoxic response. In this study, we cloned and characterized the genes encoding IGF-1 and IGFBP-1 to improve the current knowledge on their roles in highland Bos grunniens (Yak. We also compared their expression levels in the liver and kidney tissues between yaks and lowland cattle. We obtained full-length 465 bp IGF-1 and 792 bp IGFBP-1, encoding 154 amino acids (AA IGF-1, and 263 AA IGFBP-1 protein, respectively using reverse transcriptase-polyerase chain reaction (RT-PCR technology. Analysis of their corresponding amino acid sequences showed a high identity between B. grunniens and lowland mammals. Moreover, the two genes were proved to be widely distributed in the examined tissues through expression pattern analysis. Real-time PCR results revealed that IGF-1 expression was higher in the liver and kidney tissues in B. grunniens than in Bos taurus (p<0.05. The IGFBP-1 gene was expressed at a higher level in the liver (p<0.05 of B. taurus than B. grunniens, but it has a similar expression level in the kidneys of the two species. These results indicated that upregulated IGF-1 and downregulated IGFBP-1 are associated with hypoxia adaptive response in B. grunniens.

Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

Science.gov (United States)

Vouille, V; Amiche, M; Nicolas, P

1997-09-01

We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

A deletion of the gene encoding amino aldehyde dehydrogenase enhances the "pandan-like" aroma of winter melon (Benincasa hispida) and is a functional marker for the development of the aroma.

Science.gov (United States)

Ruangnam, Saowalak; Wanchana, Samart; Phoka, Nongnat; Saeansuk, Chatree; Mahatheeranont, Sugunya; de Hoop, Simon Jan; Toojinda, Theerayut; Vanavichit, Apichart; Arikit, Siwaret

2017-12-01

The gene conferring a "pandan-like" aroma of winter melon was identified. The sequence variation (804-bp deletion) found in the gene was used as the target for functional marker development. Winter melon (Benincasa hispida), a member of the Cucurbitaceae family, is a commonly consumed vegetable in Asian countries that is popular for its nutritional and medicinal value. A "pandan-like" aroma, which is economically important in crops including rice and soybean, is rarely found in most commercial varieties of winter melon, but is present in some landraces. This aroma is a value-added potential trait in breeding winter melon with a higher economic value. In this study, we confirmed that the aroma of winter melon is due to the potent volatile compound 2-acetyl-1-pyrroline (2AP) as previously identified in other plants. Based on an analysis of public transcriptome data, BhAMADH encoding an aminoaldehyde dehydrogenase (AMADH) was identified as a candidate gene conferring aroma of winter melon. A sequence comparison of BhAMADH between the aromatic and non-aromatic accessions revealed an 804-bp deletion encompassing exons 11-13 in the aromatic accession. The deletion caused several premature stop codons and could result in a truncated protein with a length of only 208 amino acids compared with 503 amino acids in the normal protein. A functional marker was successfully developed based on the 804-bp deletion and validated in 237 F 2 progenies. A perfect association of the marker genotypes and aroma phenotypes indicates that BhAMADH is the major gene conferring the aroma. The recently developed functional marker could be efficiently used in breeding programs for the aroma trait in winter melon.

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Mutation of Rice BC12/GDD1, Which Encodes a Kinesin-Like Protein That Binds to a GA Biosynthesis Gene Promoter, Leads to Dwarfism with Impaired Cell Elongation[W][OA

Science.gov (United States)

Li, Juan; Jiang, Jiafu; Qian, Qian; Xu, Yunyuan; Zhang, Cui; Xiao, Jun; Du, Cheng; Luo, Wei; Zou, Guoxing; Chen, Mingluan; Huang, Yunqing; Feng, Yuqi; Cheng, Zhukuan; Yuan, Ming; Chong, Kang

2011-01-01

The kinesins are a family of microtubule-based motor proteins that move directionally along microtubules and are involved in many crucial cellular processes, including cell elongation in plants. Less is known about kinesins directly regulating gene transcription to affect cellular physiological processes. Here, we describe a rice (Oryza sativa) mutant, gibberellin-deficient dwarf1 (gdd1), that has a phenotype of greatly reduced length of root, stems, spikes, and seeds. This reduced length is due to decreased cell elongation and can be rescued by exogenous gibberellic acid (GA3) treatment. GDD1 was cloned by a map-based approach, was expressed constitutively, and was found to encode the kinesin-like protein BRITTLE CULM12 (BC12). Microtubule cosedimentation assays revealed that BC12/GDD1 bound to microtubules in an ATP-dependent manner. Whole-genome microarray analysis revealed the expression of ent-kaurene oxidase (KO2), which encodes an enzyme involved in GA biosynthesis, was downregulated in gdd1. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that GDD1 bound to the element ACCAACTTGAA in the KO2 promoter. In addition, GDD1 was shown to have transactivation activity. The level of endogenous GAs was reduced in gdd1, and the reorganization of cortical microtubules was altered. Therefore, BC12/GDD1, a kinesin-like protein with transcription regulation activity, mediates cell elongation by regulating the GA biosynthesis pathway in rice. PMID:21325138

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

A site-specific endonuclease encoded by a typical archaeal intron

DEFF Research Database (Denmark)

Dalgaard, Jacob; Garrett, Roger Antony; Belfort, Malene

1993-01-01

The protein encoded by the archaeal intron in the 23S rRNA gene of the hyperthermophile Desulfurococcus mobilis is a double-strand DNase that, like group I intron homing endonucleases, is capable of cleaving an intronless allele of the gene. This enzyme, I-Dmo I, is unusual among the intron...

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

Identification of a STOP1-like protein in Eucalyptus that regulates transcription of Al tolerance genes.

Science.gov (United States)

Sawaki, Yoshiharu; Kobayashi, Yuriko; Kihara-Doi, Tomonori; Nishikubo, Nobuyuki; Kawazu, Tetsu; Kobayashi, Masatomo; Kobayashi, Yasufumi; Iuchi, Satoshi; Koyama, Hiroyuki; Sato, Shigeru

2014-06-01

Tolerance to soil acidity is an important trait for eucalyptus clones that are introduced to commercial forestry plantations in pacific Asian countries, where acidic soil is dominant in many locations. A conserved transcription factor regulating aluminum (Al) and proton (H⁺) tolerance in land-plant species, STOP1 (SENSITIVE TOPROTON RHIZOTOXICITY 1)-like protein, was isolated by polymerase chain reaction-based cloning, and then suppressed by RNA interference in hairy roots produced by Agrobacterium rhizogenes-mediated transformation. Eucalyptus STOP1-like protein complemented proton tolerance in an Arabidopsis thaliana stop1-mutant, and localized to the nucleus in a transient assay of a green fluorescent protein fusion protein expressed in tobacco leaves by Agrobacterium tumefaciens-mediated transformation. Genes encoding a citrate transporting MULTIDRUGS AND TOXIC COMPOUND EXTRUSION protein and an orthologue of ALUMINUM SENSITIVE 3 were suppressed in transgenic hairy roots in which the STOP1 orthologue was knocked down. In summary, we identified a series of genes for Al-tolerance in eucalyptus, including a gene for STOP1-like protein and the Al-tolerance genes it regulates. These genes may be useful for molecular breeding and genomic selection of elite clones to introduce into acid soil regions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

Science.gov (United States)

Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

2016-06-01

The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

batman Interacts with polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor.

Science.gov (United States)

Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L

2003-02-01

Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

Science.gov (United States)

Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

2016-03-01

The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

Science.gov (United States)

Roten, C A; Brandt, C; Karamata, D

1991-04-01

Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

Science.gov (United States)

Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

2005-05-15

Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

Diversification of the insulin-like growth factor 1 gene in mammals.

Directory of Open Access Journals (Sweden)

Peter Rotwein

Full Text Available Insulin-like growth factor 1 (IGF1, a small, secreted peptide growth factor, is involved in a variety of physiological and patho-physiological processes, including somatic growth, tissue repair, and metabolism of carbohydrates, proteins, and lipids. IGF1 gene expression appears to be controlled by several different signaling cascades in the few species in which it has been evaluated, with growth hormone playing a major role by activating a pathway involving the Stat5b transcription factor. Here, genes encoding IGF1 have been evaluated in 25 different mammalian species representing 15 different orders and ranging over ~180 million years of evolutionary diversification. Parts of the IGF1 gene have been fairly well conserved. Like rat Igf1 and human IGF1, 21 of 23 other genes are composed of 6 exons and 5 introns, and all 23 also contain recognizable tandem promoters, each with a unique leader exon. Exon and intron lengths are similar in most species, and DNA sequence conservation is moderately high in orthologous exons and proximal promoter regions. In contrast, putative growth hormone-activated Stat5b-binding enhancers found in analogous locations in rodent Igf1 and in human IGF1 loci, have undergone substantial variation in other mammals, and a processed retro-transposed IGF1 pseudogene is found in the sloth locus, but not in other mammalian genomes. Taken together, the fairly high level of organizational and nucleotide sequence similarity in the IGF1 gene among these 25 species supports the contention that some common regulatory pathways had existed prior to the beginning of mammalian speciation.

Induction of Xa10-like Genes in Rice Cultivar Nipponbare Confers Disease Resistance to Rice Bacterial Blight.

Science.gov (United States)

Wang, Jun; Tian, Dongsheng; Gu, Keyu; Yang, Xiaobei; Wang, Lanlan; Zeng, Xuan; Yin, Zhongchao

2017-06-01

Bacterial blight of rice, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive bacterial diseases throughout the major rice-growing regions in the world. The rice disease resistance (R) gene Xa10 confers race-specific disease resistance to X. oryzae pv. oryzae strains that deliver the corresponding transcription activator-like (TAL) effector AvrXa10. Upon bacterial infection, AvrXa10 binds specifically to the effector binding element in the promoter of the R gene and activates its expression. Xa10 encodes an executor R protein that triggers hypersensitive response and activates disease resistance. 'Nipponbare' rice carries two Xa10-like genes in its genome, of which one is the susceptible allele of the Xa23 gene, a Xa10-like TAL effector-dependent executor R gene isolated recently from 'CBB23' rice. However, the function of the two Xa10-like genes in disease resistance to X. oryzae pv. oryzae strains has not been investigated. Here, we designated the two Xa10-like genes as Xa10-Ni and Xa23-Ni and characterized their function for disease resistance to rice bacterial blight. Both Xa10-Ni and Xa23-Ni provided disease resistance to X. oryzae pv. oryzae strains that deliver the matching artificially designed TAL effectors (dTALE). Transgenic rice plants containing Xa10-Ni and Xa23-Ni under the Xa10 promoter provided specific disease resistance to X. oryzae pv. oryzae strains that deliver AvrXa10. Xa10-Ni and Xa23-Ni knock-out mutants abolished dTALE-dependent disease resistance to X. oryzae pv. oryzae. Heterologous expression of Xa10-Ni and Xa23-Ni in Nicotiana benthamiana triggered cell death. The 19-amino-acid residues at the N-terminal regions of XA10 or XA10-Ni are dispensable for their function in inducing cell death in N. benthamiana and the C-terminal regions of XA10, XA10-Ni, and XA23-Ni are interchangeable among each other without affecting their function. Like XA10, both XA10-Ni and XA23-Ni locate to the endoplasmic reticulum (ER) membrane

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

Suppression of a NAC-like transcription factor gene improves boron-toxicity tolerance in rice.

Science.gov (United States)

Ochiai, Kumiko; Shimizu, Akifumi; Okumoto, Yutaka; Fujiwara, Toru; Matoh, Toru

2011-07-01

We identified a gene responsible for tolerance to boron (B) toxicity in rice (Oryza sativa), named BORON EXCESS TOLERANT1. Using recombinant inbred lines derived from the B-toxicity-sensitive indica-ecotype cultivar IR36 and the tolerant japonica-ecotype cultivar Nekken 1, the region responsible for tolerance to B toxicity was narrowed to 49 kb on chromosome 4. Eight genes are annotated in this region. The DNA sequence in this region was compared between the B-toxicity-sensitive japonica cultivar Wataribune and the B-toxicity-tolerant japonica cultivar Nipponbare by eco-TILLING analysis and revealed a one-base insertion mutation in the open reading frame sequence of the gene Os04g0477300. The gene encodes a NAC (NAM, ATAF, and CUC)-like transcription factor and the function of the transcript is abolished in B-toxicity-tolerant cultivars. Transgenic plants in which the expression of Os04g0477300 is abolished by RNA interference gain tolerance to B toxicity.

Topology of transmembrane channel-like gene 1 protein.

Science.gov (United States)

Labay, Valentina; Weichert, Rachel M; Makishima, Tomoko; Griffith, Andrew J

2010-10-05

Mutations of transmembrane channel-like gene 1 (TMC1) cause hearing loss in humans and mice. TMC1 is the founding member of a family of genes encoding proteins of unknown function that are predicted to contain multiple transmembrane domains. The goal of our study was to define the topology of mouse TMC1 expressed heterologously in tissue culture cells. TMC1 was retained in the endoplasmic reticulum (ER) membrane of five tissue culture cell lines that we tested. We used anti-TMC1 and anti-HA antibodies to probe the topologic orientation of three native epitopes and seven HA epitope tags along full-length TMC1 after selective or complete permeabilization of transfected cells with digitonin or Triton X-100, respectively. TMC1 was present within the ER as an integral membrane protein containing six transmembrane domains and cytosolic N- and C-termini. There is a large cytoplasmic loop, between the fourth and fifth transmembrane domains, with two highly conserved hydrophobic regions that might associate with or penetrate, but do not span, the plasma membrane. Our study is the first to demonstrate that TMC1 is a transmembrane protein. The topologic organization revealed by this study shares some features with that of the shaker-TRP superfamily of ion channels.

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

Cloning and functional analysis of human mTERFL encoding a novel mitochondrial transcription termination factor-like protein

International Nuclear Information System (INIS)

Chen Yao; Zhou Guangjin; Yu Min; He Yungang; Tang Wei; Lai Jianhua; He Jie; Liu Wanguo; Tan Deyong

2005-01-01

Serum plays an important role in the regulation of cell cycle and cell growth. To identify novel serum-inhibitory factors and study their roles in cell cycle regulation, we performed mRNA differential display analysis of U251 cells in the presence or absence of serum and cloned a novel gene encoding the human mitochondrial transcription termination factor-like protein (mTERFL). The full-length mTERFL cDNA has been isolated and the genomic structure determined. The mTERFL gene consists of three exons and encodes 385 amino acids with 52% sequence similarity to the human mitochondrial transcription termination factor (mTERF). However, mTERFL and mTERF have an opposite expression pattern in response to serum. The expression of mTERFL is dramatically inhibited by the addition of serum in serum-starved cells while the mTERF is rather induced. Northern blot analysis detected three mTERFL transcripts of 1.7, 3.2, and 3.5 kb. Besides the 3.2 kb transcript that is unique to skeletal muscle, other two transcripts express predominant in heart, liver, pancreas, and skeletal muscle. Expression of the GFP-mTERFL fusion protein in HeLa cells localized it to the mitochondria. Furthermore, ectopic expression of mTERFL suppresses cell growth and arrests cells in the G1 stage demonstrated by MTT and flow cytometry analysis. Collectively, our data suggest that mTERFL is a novel mTERF family member and a serum-inhibitory factor probably participating in the regulation of cell growth through the modulation of mitochondrial transcription

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

Science.gov (United States)

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

The Networks of Genes Encoding Palmitoylated Proteins in Axonal and Synaptic Compartments Are Affected in PPT1 Overexpressing Neuronal-Like Cells

Directory of Open Access Journals (Sweden)

Francesco Pezzini

2017-08-01

Full Text Available CLN1 disease (OMIM #256730 is an early childhood ceroid-lipofuscinosis associated with mutated CLN1, whose product Palmitoyl-Protein Thioesterase 1 (PPT1 is a lysosomal enzyme involved in the removal of palmitate residues from S-acylated proteins. In neurons, PPT1 expression is also linked to synaptic compartments. The aim of this study was to unravel molecular signatures connected to CLN1. We utilized SH-SY5Y neuroblastoma cells overexpressing wild type CLN1 (SH-p.wtCLN1 and five selected CLN1 patients’ mutations. The cellular distribution of wtPPT1 was consistent with regular processing of endogenous protein, partially detected inside Lysosomal Associated Membrane Protein 2 (LAMP2 positive vesicles, while the mutants displayed more diffuse cytoplasmic pattern. Transcriptomic profiling revealed 802 differentially expressed genes (DEGs in SH-p.wtCLN1 (as compared to empty-vector transfected cells, whereas the number of DEGs detected in the two mutants (p.L222P and p.M57Nfs*45 was significantly lower. Bioinformatic scrutiny linked DEGs with neurite formation and neuronal transmission. Specifically, neuritogenesis and proliferation of neuronal processes were predicted to be hampered in the wtCLN1 overexpressing cell line, and these findings were corroborated by morphological investigations. Palmitoylation survey identified 113 palmitoylated protein-encoding genes in SH-p.wtCLN1, including 25 ones simultaneously assigned to axonal growth and synaptic compartments. A remarkable decrease in the expression of palmitoylated proteins, functionally related to axonal elongation (GAP43, CRMP1 and NEFM and of the synaptic marker SNAP25, specifically in SH-p.wtCLN1 cells was confirmed by immunoblotting. Subsequent, bioinformatic network survey of DEGs assigned to the synaptic annotations linked 81 DEGs, including 23 ones encoding for palmitoylated proteins. Results obtained in this experimental setting outlined two affected functional modules (connected to

Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

Directory of Open Access Journals (Sweden)

Craxton Molly

2007-07-01

Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

Science.gov (United States)

Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

2010-03-01

Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

Directory of Open Access Journals (Sweden)

Beatriz Moreno

2016-07-01

Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

DEFF Research Database (Denmark)

Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

2009-01-01

). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

The genome of Paenibacillus sabinae T27 provides insight into evolution, organization and functional elucidation of nif and nif-like genes

OpenAIRE

Li, Xinxin; Deng, Zhiping; Liu, Zhanzhi; Yan, Yongliang; Wang, Tianshu; Xie, Jianbo; Lin, Min; Cheng, Qi; Chen, Sanfeng

2014-01-01

Background Most biological nitrogen fixation is catalyzed by the molybdenum nitrogenase. This enzyme is a complex which contains the MoFe protein encoded by nifDK and the Fe protein encoded by nifH. In addition to nifHDK, nifHDK-like genes were found in some Archaea and Firmicutes, but their function is unclear. Results We sequenced the genome of Paenibacillus sabinae T27. A total of 4,793 open reading frames were predicted from its 5.27 Mb genome. The genome of P. sabinae T27 contains fiftee...

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Functional evolution of cis-regulatory modules at a homeotic gene in Drosophila.

Directory of Open Access Journals (Sweden)

Margaret C W Ho

2009-11-01

Full Text Available It is a long-held belief in evolutionary biology that the rate of molecular evolution for a given DNA sequence is inversely related to the level of functional constraint. This belief holds true for the protein-coding homeotic (Hox genes originally discovered in Drosophila melanogaster. Expression of the Hox genes in Drosophila embryos is essential for body patterning and is controlled by an extensive array of cis-regulatory modules (CRMs. How the regulatory modules functionally evolve in different species is not clear. A comparison of the CRMs for the Abdominal-B gene from different Drosophila species reveals relatively low levels of overall sequence conservation. However, embryonic enhancer CRMs from other Drosophila species direct transgenic reporter gene expression in the same spatial and temporal patterns during development as their D. melanogaster orthologs. Bioinformatic analysis reveals the presence of short conserved sequences within defined CRMs, representing gap and pair-rule transcription factor binding sites. One predicted binding site for the gap transcription factor KRUPPEL in the IAB5 CRM was found to be altered in Superabdominal (Sab mutations. In Sab mutant flies, the third abdominal segment is transformed into a copy of the fifth abdominal segment. A model for KRUPPEL-mediated repression at this binding site is presented. These findings challenge our current understanding of the relationship between sequence evolution at the molecular level and functional activity of a CRM. While the overall sequence conservation at Drosophila CRMs is not distinctive from neighboring genomic regions, functionally critical transcription factor binding sites within embryonic enhancer CRMs are highly conserved. These results have implications for understanding mechanisms of gene expression during embryonic development, enhancer function, and the molecular evolution of eukaryotic regulatory modules.

topIb, a phylogenetic hallmark gene of Thaumarchaeota encodes a functional eukaryote-like topoisomerase IB.

Science.gov (United States)

Dahmane, Narimane; Gadelle, Danièle; Delmas, Stéphane; Criscuolo, Alexis; Eberhard, Stephan; Desnoues, Nicole; Collin, Sylvie; Zhang, Hongliang; Pommier, Yves; Forterre, Patrick; Sezonov, Guennadi

2016-04-07

Type IB DNA topoisomerases can eliminate torsional stresses produced during replication and transcription. These enzymes are found in all eukaryotes and a short version is present in some bacteria and viruses. Among prokaryotes, the long eukaryotic version is only observed in archaea of the phylum Thaumarchaeota. However, the activities and the roles of these topoisomerases have remained an open question. Here, we demonstrate that all available thaumarchaeal genomes contain a topoisomerase IB gene that defines a monophyletic group closely related to the eukaryotic enzymes. We show that the topIB gene is expressed in the model thaumarchaeon Nitrososphaera viennensis and we purified the recombinant enzyme from the uncultivated thaumarchaeon Candidatus Caldiarchaeum subterraneum. This enzyme is active in vitro at high temperature, making it the first thermophilic topoisomerase IB characterized so far. We have compared this archaeal type IB enzyme to its human mitochondrial and nuclear counterparts. The archaeal enzyme relaxes both negatively and positively supercoiled DNA like the eukaryotic enzymes. However, its pattern of DNA cleavage specificity is different and it is resistant to camptothecins (CPTs) and non-CPT Top1 inhibitors, LMP744 and lamellarin D. This newly described thermostable topoisomerases IB should be a promising new model for evolutionary, mechanistic and structural studies. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

Science.gov (United States)

Keebaugh, Alaine C; Thomas, James W

2010-06-01

Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

Suppression of a NAC-Like Transcription Factor Gene Improves Boron-Toxicity Tolerance in Rice1

Science.gov (United States)

Ochiai, Kumiko; Shimizu, Akifumi; Okumoto, Yutaka; Fujiwara, Toru; Matoh, Toru

2011-01-01

We identified a gene responsible for tolerance to boron (B) toxicity in rice (Oryza sativa), named BORON EXCESS TOLERANT1. Using recombinant inbred lines derived from the B-toxicity-sensitive indica-ecotype cultivar IR36 and the tolerant japonica-ecotype cultivar Nekken 1, the region responsible for tolerance to B toxicity was narrowed to 49 kb on chromosome 4. Eight genes are annotated in this region. The DNA sequence in this region was compared between the B-toxicity-sensitive japonica cultivar Wataribune and the B-toxicity-tolerant japonica cultivar Nipponbare by eco-TILLING analysis and revealed a one-base insertion mutation in the open reading frame sequence of the gene Os04g0477300. The gene encodes a NAC (NAM, ATAF, and CUC)-like transcription factor and the function of the transcript is abolished in B-toxicity-tolerant cultivars. Transgenic plants in which the expression of Os04g0477300 is abolished by RNA interference gain tolerance to B toxicity. PMID:21543724

Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway.

Science.gov (United States)

Bassler, B L; Wright, M; Silverman, M R

1994-07-01

Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.

Global analysis of gene expression mediated by OX1 orexin receptor signaling in a hypothalamic cell line.

Directory of Open Access Journals (Sweden)

Eric Koesema

Full Text Available The orexins and their cognate G-protein coupled receptors have been widely studied due to their associations with various behaviors and cellular processes. However, the detailed downstream signaling cascades that mediate these effects are not completely understood. We report the generation of a neuronal model cell line that stably expresses the OX1 orexin receptor (OX1 and an RNA-Seq analysis of changes in gene expression seen upon receptor activation. Upon treatment with orexin, several families of related transcription factors are transcriptionally regulated, including the early growth response genes (Egr, the Kruppel-like factors (Klf, and the Nr4a subgroup of nuclear hormone receptors. Furthermore, some of the transcriptional effects observed have also been seen in data from in vivo sleep deprivation microarray studies, supporting the physiological relevance of the data set. Additionally, inhibition of one of the most highly regulated genes, serum and glucocorticoid-regulated kinase 1 (Sgk1, resulted in the diminished orexin-dependent induction of a subset of genes. These results provide new insight into the molecular signaling events that occur during OX1 signaling and support a role for orexin signaling in the stimulation of wakefulness during sleep deprivation studies.

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

International Nuclear Information System (INIS)

Menaa, F.

2003-12-01

Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

Identification of mip-like genes in the genus Legionella

DEFF Research Database (Denmark)

Cianciotto, N P; Bangsborg, Jette Marie; Eisenstein, B I

1990-01-01

The mip gene of Legionella pneumophila serogroup 1 strain AA100 encodes a 24-kilodalton surface protein (Mip) and enhances the abilities of L. pneumophila to parasitize human macrophages and to cause pneumonia in experimental animals. To determine whether this virulence factor is conserved in the...

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Evolutionary maintenance of filovirus-like genes in bat genomes

Directory of Open Access Journals (Sweden)

Taylor Derek J

2011-11-01

Full Text Available Abstract Background Little is known of the biological significance and evolutionary maintenance of integrated non-retroviral RNA virus genes in eukaryotic host genomes. Here, we isolated novel filovirus-like genes from bat genomes and tested for evolutionary maintenance. We also estimated the age of filovirus VP35-like gene integrations and tested the phylogenetic hypotheses that there is a eutherian mammal clade and a marsupial/ebolavirus/Marburgvirus dichotomy for filoviruses. Results We detected homologous copies of VP35-like and NP-like gene integrations in both Old World and New World species of Myotis (bats. We also detected previously unknown VP35-like genes in rodents that are positionally homologous. Comprehensive phylogenetic estimates for filovirus NP-like and VP35-like loci support two main clades with a marsupial and a rodent grouping within the ebolavirus/Lloviu virus/Marburgvirus clade. The concordance of VP35-like, NP-like and mitochondrial gene trees with the expected species tree supports the notion that the copies we examined are orthologs that predate the global spread and radiation of the genus Myotis. Parametric simulations were consistent with selective maintenance for the open reading frame (ORF of VP35-like genes in Myotis. The ORF of the filovirus-like VP35 gene has been maintained in bat genomes for an estimated 13. 4 MY. ORFs were disrupted for the NP-like genes in Myotis. Likelihood ratio tests revealed that a model that accommodates positive selection is a significantly better fit to the data than a model that does not allow for positive selection for VP35-like sequences. Moreover, site-by-site analysis of selection using two methods indicated at least 25 sites in the VP35-like alignment are under positive selection in Myotis. Conclusions Our results indicate that filovirus-like elements have significance beyond genomic imprints of prior infection. That is, there appears to be, or have been, functionally maintained

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

Hc-daf-2 encodes an insulin-like receptor kinase in the barber's pole worm, Haemonchus contortus, and restores partial dauer regulation.

Science.gov (United States)

Li, Facai; Lok, James B; Gasser, Robin B; Korhonen, Pasi K; Sandeman, Mark R; Shi, Deshi; Zhou, Rui; Li, Xiangrui; Zhou, Yanqin; Zhao, Junlong; Hu, Min

2014-06-01

Infective L3s (iL3s) of parasitic nematodes share common behavioural, morphological and developmental characteristics with the developmentally arrested (dauer) larvae of the free-living nematode Caenorhabditis elegans. It is proposed that similar molecular mechanisms regulate entry into or exit from the dauer stage in C. elegans, and the transition from free-living to parasitic forms of parasitic nematodes. In C. elegans, one of the key factors regulating the dauer transition is the insulin-like receptor (designated Ce-DAF-2) encoded by the gene Ce-daf-2. However, nothing is known about DAF-2 homologues in most parasitic nematodes. Here, using a PCR-based approach, we identified and characterised a gene (Hc-daf-2) and its inferred product (Hc-DAF-2) in Haemonchus contortus (a socioeconomically important parasitic nematode of ruminants). The sequence of Hc-DAF-2 displays significant sequence homology to insulin receptors (IR) in both vertebrates and invertebrates, and contains conserved structural domains. A sequence encoding an important proteolytic motif (RKRR) identified in the predicted peptide sequence of Hc-DAF-2 is consistent with that of the human IR, suggesting that it is involved in the formation of the IR complex. The Hc-daf-2 gene was transcribed in all life stages of H. contortus, with a significant up-regulation in the iL3 compared with other stages. To compare patterns of expression between Hc-daf-2 and Ce-daf-2, reporter constructs fusing the Ce-daf-2 or Hc-daf-2 promoter to sequence encoding GFP were microinjected into the N2 strain of C. elegans, and transgenic lines were established and examined. Both genes showed similar patterns of expression in amphidial (head) neurons, which relate to sensation and signal transduction. Further study by heterologous genetic complementation in a daf-2-deficient strain of C. elegans (CB1370) showed partial rescue of function by Hc-daf-2. Taken together, these findings provide a first insight into the roles of Hc

Identification of a novel splice variant of human PD-L1 mRNA encoding an isoform-lacking Igv-like domain.

Science.gov (United States)

He, Xian-hui; Xu, Li-hui; Liu, Yi

2005-04-01

To investigate the expression and regulation of PD-1 ligand 1 (PD-L1) in peripheral blood mononuclear cells (PBMC). The cDNA encoding human PD-L1 precursor was cloned from the total RNA extracted from the resting and phorbol dibutyrate plus ionomycin- or phytohemagglutinin-activated PBMC, by reverse transcription polymerase chain reaction (RT-PCR), and independent clones were sequenced and analyzed. The expression and subcellular localization were examined in transiently transfected cells. The PD-L1 gene expression in different PBMC was also analyzed by RT-PCR. A novel human PD-L1 splice variant was identified from the activated PBMC. It was generated by splicing out exon? encoding an immunoglobulin variable domain (Igv)-like domain but retaining all other exons without a frame-shift. Consequently, the putative translated protein contained all other domains including the transmembrane region except for the Igv-like domain. Furthermore, the conventional isoform was expressed on the plasma surface whereas the novel isoform showed a pattern of intracellular membrane distribution in transiently transfected K562 cells. In addition, the expression pattern of the PD-L1 splice variant was variable in different individuals and in different cellular status. PD-L1 expression may be regulated at the posttranscriptional level through alternative splicing, and modulation of the PD-L1 isoform expression may influence the outcome of specific immune responses in the peripheral tissues.

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

Molecular identification and characterisation of catalase and catalase-like protein genes in urease-positive thermophilic Campylobacter (UPTC).

Science.gov (United States)

Nakajima, T; Kuribayashi, T; Moore, J E; Millar, B C; Yamamoto, S; Matsuda, Motoo

2016-01-01

Thermophilic Campylobacter are important bacterial pathogens of foodborne diseases worldwide. These organisms' physiology requires a microaerophilic atmosphere. To date, little is known about the protective catalase mechanism in urease-positive thermophilic campylobacters (UPTC); hence, it was the aim of this study to identify and characterise catalase and catalase-like protein genes in these organisms. Catalase (katA) and catalase (Kat)-like protein genes from the Japanese UPTC CF89-12 strain were molecularly analysed and compared with C. lari RM2100 and other C. lari and thermophilic Campylobacter reference isolates. A possible open reading frame of 1,422 base pairs, predicted to encode a peptide of 474 amino acid residues, with calculated molecular weight of 52.7 kilo Daltons for katA, was identified within UPTC CF89-12. A probable ribosome binding site, two putative promoters and a putative ρ-independent transcription terminator were also identified within katA. A similar katA cluster also existed in the C. lari RM2100 strain, except that this strain carries no DcuB genes. However, the Kat-like protein gene or any other homologue(s) were never identified in the C. lari RM2100 strain, or in C. jejuni and C. upsaliensis. This study demonstrates the presence of catalase/catalase-like protein genes in UPTC organisms. These findings are significant in that they suggest that UPTC organisms have the protective genetic capability of helping protect the organisms from toxic oxygen stress, which may help them to survive in physiologically harsh environments, both within human and animal hosts, as well as in the natural environment.

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

Science.gov (United States)

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-06-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

Directory of Open Access Journals (Sweden)

Borchardt Stephanie M

2006-07-01

Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

Molecular cloning and characterization of novel Morus alba germin-like protein gene which encodes for a silkworm gut digestion-resistant antimicrobial protein.

Directory of Open Access Journals (Sweden)

Bharat Bhusan Patnaik

Full Text Available Silkworm fecal matter is considered one of the richest sources of antimicrobial and antiviral protein (substances and such economically feasible and eco-friendly proteins acting as secondary metabolites from the insect system can be explored for their practical utility in conferring broad spectrum disease resistance against pathogenic microbial specimens.Silkworm fecal matter extracts prepared in 0.02 M phosphate buffer saline (pH 7.4, at a temperature of 60°C was subjected to 40% saturated ammonium sulphate precipitation and purified by gel-filtration chromatography (GFC. SDS-PAGE under denaturing conditions showed a single band at about 21.5 kDa. The peak fraction, thus obtained by GFC wastested for homogeneityusing C18reverse-phase high performance liquid chromatography (HPLC. The activity of the purified protein was tested against selected Gram +/- bacteria and phytopathogenic Fusarium species with concentration-dependent inhibitionrelationship. The purified bioactive protein was subjected to matrix-assisted laser desorption and ionization-time of flight mass spectrometry (MALDI-TOF-MS and N-terminal sequencing by Edman degradation towards its identification. The N-terminal first 18 amino acid sequence following the predicted signal peptide showed homology to plant germin-like proteins (Glp. In order to characterize the full-length gene sequence in detail, the partial cDNA was cloned and sequenced using degenerate primers, followed by 5'- and 3'-rapid amplification of cDNA ends (RACE-PCR. The full-length cDNA sequence composed of 630 bp encoding 209 amino acids and corresponded to germin-like proteins (Glps involved in plant development and defense.The study reports, characterization of novel Glpbelonging to subfamily 3 from M. alba by the purification of mature active protein from silkworm fecal matter. The N-terminal amino acid sequence of the purified protein was found similar to the deduced amino acid sequence (without the transit

Molecular Cloning and Characterization of Novel Morus alba Germin-Like Protein Gene Which Encodes for a Silkworm Gut Digestion-Resistant Antimicrobial Protein

Science.gov (United States)

Patnaik, Bharat Bhusan; Kim, Dong Hyun; Oh, Seung Han; Song, Yong-Su; Chanh, Nguyen Dang Minh; Kim, Jong Sun; Jung, Woo-jin; Saha, Atul Kumar; Bindroo, Bharat Bhushan; Han, Yeon Soo

2012-01-01

Background Silkworm fecal matter is considered one of the richest sources of antimicrobial and antiviral protein (substances) and such economically feasible and eco-friendly proteins acting as secondary metabolites from the insect system can be explored for their practical utility in conferring broad spectrum disease resistance against pathogenic microbial specimens. Methodology/Principal Findings Silkworm fecal matter extracts prepared in 0.02 M phosphate buffer saline (pH 7.4), at a temperature of 60°C was subjected to 40% saturated ammonium sulphate precipitation and purified by gel-filtration chromatography (GFC). SDS-PAGE under denaturing conditions showed a single band at about 21.5 kDa. The peak fraction, thus obtained by GFC wastested for homogeneityusing C18reverse-phase high performance liquid chromatography (HPLC). The activity of the purified protein was tested against selected Gram +/− bacteria and phytopathogenic Fusarium species with concentration-dependent inhibitionrelationship. The purified bioactive protein was subjected to matrix-assisted laser desorption and ionization-time of flight mass spectrometry (MALDI-TOF-MS) and N-terminal sequencing by Edman degradation towards its identification. The N-terminal first 18 amino acid sequence following the predicted signal peptide showed homology to plant germin-like proteins (Glp). In order to characterize the full-length gene sequence in detail, the partial cDNA was cloned and sequenced using degenerate primers, followed by 5′- and 3′-rapid amplification of cDNA ends (RACE-PCR). The full-length cDNA sequence composed of 630 bp encoding 209 amino acids and corresponded to germin-like proteins (Glps) involved in plant development and defense. Conclusions/Significance The study reports, characterization of novel Glpbelonging to subfamily 3 from M. alba by the purification of mature active protein from silkworm fecal matter. The N-terminal amino acid sequence of the purified protein was found

[Abnormal floral meristem development in transgenic tomato plants do not depend on the expression of genes encoding defense-related PR-proteins and antimicrobial peptides].

Science.gov (United States)

Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu

2014-01-01

In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial

Identification of Putative Precursor Genes for the Biosynthesis of Cannabinoid-Like Compound in Radula marginata

Directory of Open Access Journals (Sweden)

Tajammul Hussain

2018-05-01

Full Text Available The liverwort Radula marginata belongs to the bryophyte division of land plants and is a prospective alternate source of cannabinoid-like compounds. However, mechanistic insights into the molecular pathways directing the synthesis of these cannabinoid-like compounds have been hindered due to the lack of genetic information. This prompted us to do deep sequencing, de novo assembly and annotation of R. marginata transcriptome, which resulted in the identification and validation of the genes for cannabinoid biosynthetic pathway. In total, we have identified 11,421 putative genes encoding 1,554 enzymes from 145 biosynthetic pathways. Interestingly, we have identified all the upstream genes of the central precursor of cannabinoid biosynthesis, cannabigerolic acid (CBGA, including its two first intermediates, stilbene acid (SA and geranyl diphosphate (GPP. Expression of all these genes was validated using quantitative real-time PCR. We have characterized the protein structure of stilbene synthase (STS, which is considered as a homolog of olivetolic acid in R. marginata. Moreover, the metabolomics approach enabled us to identify CBGA-analogous compounds using electrospray ionization mass spectrometry (ESI-MS/MS and gas chromatography mass spectrometry (GC-MS. Transcriptomic analysis revealed 1085 transcription factors (TF from 39 families. Comparative analysis showed that six TF families have been uniquely predicted in R. marginata. In addition, the bioinformatics analysis predicted a large number of simple sequence repeats (SSRs and non-coding RNAs (ncRNAs. Our results collectively provide mechanistic insights into the putative precursor genes for the biosynthesis of cannabinoid-like compounds and a novel transcriptomic resource for R. marginata. The large-scale transcriptomic resource generated in this study would further serve as a reference transcriptome to explore the Radulaceae family.

The YABBY Genes of Leaf and Leaf-Like Organ Polarity in Leafless Plant Monotropa hypopitys

Directory of Open Access Journals (Sweden)

Anna V. Shchennikova

2018-01-01

Full Text Available Monotropa hypopitys is a mycoheterotrophic, nonphotosynthetic plant acquiring nutrients from the roots of autotrophic trees through mycorrhizal symbiosis, and, similar to other extant plants, forming asymmetrical lateral organs during development. The members of the YABBY family of transcription factors are important players in the establishment of leaf and leaf-like organ polarity in plants. This is the first report on the identification of YABBY genes in a mycoheterotrophic plant devoid of aboveground vegetative organs. Seven M. hypopitys YABBY members were identified and classified into four clades. By structural analysis of putative encoded proteins, we confirmed the presence of YABBY-defining conserved domains and identified novel clade-specific motifs. Transcriptomic and qRT-PCR analyses of different tissues revealed MhyYABBY transcriptional patterns, which were similar to those of orthologous YABBY genes from other angiosperms. These data should contribute to the understanding of the role of the YABBY genes in the regulation of developmental and physiological processes in achlorophyllous leafless plants.

Genome-wide identification, phylogeny and expression analyses of SCARECROW-LIKE(SCL) genes in millet (Setaria italica).

Science.gov (United States)

Liu, Hongyun; Qin, Jiajia; Fan, Hui; Cheng, Jinjin; Li, Lin; Liu, Zheng

2017-07-01

As a member of the GRAS gene family, SCARECROW - LIKE ( SCL ) genes encode transcriptional regulators that are involved in plant information transmission and signal transduction. In this study, 44 SCL genes including two SCARECROW genes in millet were identified to be distributed on eight chromosomes, except chromosome 6. All the millet genes contain motifs 6-8, indicating that these motifs are conserved during the evolution. SCL genes of millet were divided into eight groups based on the phylogenetic relationship and classification of Arabidopsis SCL genes. Several putative millet orthologous genes in Arabidopsis , maize and rice were identified. High throughput RNA sequencing revealed that the expressions of millet SCL genes in root, stem, leaf, spica, and along leaf gradient varied greatly. Analyses combining the gene expression patterns, gene structures, motif compositions, promoter cis -elements identification, alternative splicing of transcripts and phylogenetic relationship of SCL genes indicate that the these genes may play diverse functions. Functionally characterized SCL genes in maize, rice and Arabidopsis would provide us some clues for future characterization of their homologues in millet. To the best of our knowledge, this is the first study of millet SCL genes at the genome wide level. Our work provides a useful platform for functional analysis of SCL genes in millet, a model crop for C 4 photosynthesis and bioenergy studies.

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

The 380 kb pCMU01 plasmid encodes chloromethane utilization genes and redundant genes for vitamin B12- and tetrahydrofolate-dependent chloromethane metabolism in Methylobacterium extorquens CM4: a proteomic and bioinformatics study.

Directory of Open Access Journals (Sweden)

Sandro Roselli

Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

DEFF Research Database (Denmark)

Abildgaard, L; Engberg, RM; Pedersen, Karl

2009-01-01

The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

International Nuclear Information System (INIS)

Hayat, S.; Cheng, Z.; Chen, X.

2016-01-01

The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

Directory of Open Access Journals (Sweden)

Ghaffari Novin M.

2015-06-01

Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

Directory of Open Access Journals (Sweden)

Jacqueline Schmuckli-Maurer

Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

Molecular quantification of genes encoding for green-fluorescent proteins

DEFF Research Database (Denmark)

Felske, A; Vandieken, V; Pauling, B V

2003-01-01

A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

An evolutionarily conserved gene family encodes proton-selective ion channels.

Science.gov (United States)

Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

2018-03-02

Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

The Arabidopsis GASA10 gene encodes a cell wall protein strongly expressed in developing anthers and seeds.

Science.gov (United States)

Trapalis, Menelaos; Li, Song Feng; Parish, Roger W

2017-07-01

The Arabidopsis GASA10 gene encodes a GAST1-like (Gibberellic Acid-Stimulated) protein. Reporter gene analysis identified consistent expression in anthers and seeds. In anthers expression was developmentally regulated, first appearing at stage 7 of anther development and reaching a maximum at stage 11. Strongest expression was in the tapetum and developing microspores. GASA10 expression also occurred throughout the seed and in root vasculature. GASA10 was shown to be transported to the cell wall. Using GASA1 and GASA6 as positive controls, gibberellic acid was found not to induce GASA10 expression in Arabidopsis suspension cells. Overexpression of GASA10 (35S promoter-driven) resulted in a reduction in silique elongation. GASA10 shares structural similarities to the antimicrobial peptide snakin1, however, purified GASA10 failed to influence the growth of a variety of bacterial and fungal species tested. We propose cell wall associated GASA proteins are involved in regulating the hydroxyl radical levels at specific sites in the cell wall to facilitate wall growth (regulating cell wall elongation). Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.

Science.gov (United States)

Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng

2014-04-18

The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

Directory of Open Access Journals (Sweden)

Kouji Shimoda

2002-01-01

Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

DEFF Research Database (Denmark)

Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

2018-01-01

The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

Science.gov (United States)

Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

Science.gov (United States)

O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

1999-01-01

Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

Science.gov (United States)

Pyne, C; Bognar, A L

1992-03-01

The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

Science.gov (United States)

Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

2017-12-26

The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

Map-based cloning and characterization of Zea mays male sterility33 (ZmMs33) gene, encoding a glycerol-3-phosphate acyltransferase.

Science.gov (United States)

Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan

2018-06-01

Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.

Characterization of big bang, a novel gene encoding for PDZ domain-containing proteins that are dynamically expressed throughout Drosophila development.

Science.gov (United States)

Kim, Sabrina Y; Renihan, Maia K; Boulianne, Gabrielle L

2006-06-01

PDZ (PSD-95, Discs-large, ZO-1) domain proteins often function as scaffolding proteins and have been shown to play important roles in diverse cellular processes such as the establishment and maintenance of cell polarity, and signal transduction. Here, we report the identification and cloning of a novel Drosophila melanogaster gene that is predicted to produce several different PDZ domain-containing proteins through alternative promoter usage and alternative splicing. This gene, that we have named big bang (bbg), was first identified as C96-GAL4, a GAL4 enhancer trap line that was generated in our lab. To further characterize bbg, its expression pattern was examined in ovaries, embryos, and late third instar larvae using UAS reporter gene constructs, in situ hybridization, or immunocytochemistry. In addition, the expression of alternatively spliced transcripts was examined in more detail using in situ hybridization. We find that during embryogenesis bbg is predominantly expressed in the developing gut, but it is also expressed in external sensory organs found in the epidermis. In the late third instar larva, bbg is expressed along the presumptive wing margin in the wing disc, broadly in the eye disc, and in other imaginal discs as well as in the brain. The expression patterns observed are dynamic and specific during development, suggesting that like other genes that encode for several different PDZ domain protein isoforms, bbg likely plays important roles in multiple developmental processes.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Science.gov (United States)

Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

2013-01-01

The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Directory of Open Access Journals (Sweden)

Linda J Savage

Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

NARCIS (Netherlands)

Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

2015-01-01

Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

NARCIS (Netherlands)

Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

Science.gov (United States)

Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

2005-01-01

Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

Science.gov (United States)

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

Genomics and physiology of a marine flavobacterium encoding a proteorhodopsin and a xanthorhodopsin-like protein.

Directory of Open Access Journals (Sweden)

Thomas Riedel

Full Text Available Proteorhodopsin (PR photoheterotrophy in the marine flavobacterium Dokdonia sp. PRO95 has previously been investigated, showing no growth stimulation in the light at intermediate carbon concentrations. Here we report the genome sequence of strain PRO95 and compare it to two other PR encoding Dokdonia genomes: that of strain 4H-3-7-5 which shows the most similar genome, and that of strain MED134 which grows better in the light under oligotrophic conditions. Our genome analysis revealed that the PRO95 genome as well as the 4H-3-7-5 genome encode a protein related to xanthorhodopsins. The genomic environment and phylogenetic distribution of this gene suggest that it may have frequently been recruited by lateral gene transfer. Expression analyses by RT-PCR and direct mRNA-sequencing showed that both rhodopsins and the complete β-carotene pathway necessary for retinal production are transcribed in PRO95. Proton translocation measurements showed enhanced proton pump activity in response to light, supporting that one or both rhodopsins are functional. Genomic information and carbon source respiration data were used to develop a defined cultivation medium for PRO95, but reproducible growth always required small amounts of yeast extract. Although PRO95 contains and expresses two rhodopsin genes, light did not stimulate its growth as determined by cell numbers in a nutrient poor seawater medium that mimics its natural environment, confirming previous experiments at intermediate carbon concentrations. Starvation or stress conditions might be needed to observe the physiological effect of light induced energy acquisition.

A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

DEFF Research Database (Denmark)

Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

2016-01-01

genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation.

Science.gov (United States)

Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S

1996-01-01

we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

Drought and exogenous abscisic acid alter hydrogen peroxide accumulation and differentially regulate the expression of two maize RD22-like genes.

Science.gov (United States)

Phillips, Kyle; Ludidi, Ndiko

2017-08-18

Increased biosynthesis of abscisic acid (ABA) occurs in plants in response to water deficit, which is mediated by changes in the levels of reactive oxygen species such as H 2 O 2 . Water deficit and ABA induce expression of some RD22-like proteins. This study aimed to evaluate the effect of water deficit and exogenous ABA (50 µM ABA applied every 24 hours for a total of 72 hours) on H 2 O 2 content in Zea mays (maize) and to characterise genes encoding two putative maize RD22-like proteins (designated ZmRD22A and ZmRD22B). The expression profiles of the two putative maize RD22-like genes in response to water deficit and treatment with ABA were examined in leaves. In silico analyses showed that the maize RD22-like proteins share domain organisation with previously characterized RD22-like proteins. Both water deficit and exogenous ABA resulted in increased H 2 O 2 content in leaves but the increase was more pronounced in response to water deficit than to exogenous ABA. Lignin content was not affected by exogenous ABA, whereas it was decreased by water deficit. Expression of both RD22-like genes was up-regulated by drought but the ZmRD22A gene was not influenced by exogenous ABA, whereas ZmRD22B was highly responsive to exogenous ABA.

REGULATION OF TLR/RLR GENE ACTIVITY AND SYNTHESIS OF CYTOKINES DURING PHORBOL MYRISTATE ACETATE (PMA-INDUCED DIFFERENTIATION OF THP-1 MONOCYTES INTO MACROPHAGE-LIKE CELLS

Directory of Open Access Journals (Sweden)

T. M. Sokolova

2017-01-01

Full Text Available The levels of TLR/RLR gene expression and production of some cytokines were studied in monocytic THP-1 cell line during its differentiation to mature macrophage-like forms induced by phorbol 12-myristate 13-acetate (PMA treatment for 1 and 5 days in vitro. For the first time, we have shown high induction levels for the genes that encode signaling immune receptors and transcription factors in response to PMA, as well as inhibitory effects of TLR3, TLR7/TLR8, TLR9-agonists in mature macrophages. The PMAactivated THP-1 macrophage-like cells secreted large quantitities of inflammatory IL-1β and TNFα cytokines into culture medium.

A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

Science.gov (United States)

Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

2015-01-01

This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

Science.gov (United States)

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-12-12

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Meng Sun

2014-12-01

Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Genetic analysis and morphological identification of pilus-like structures in members of the genus Bifidobacterium

LENUS (Irish Health Repository)

2011-08-30

Abstract Background Cell surface pili in Gram positive bacteria have been reported to orchestrate the colonization of host tissues, evasion of immunity and the development of biofilms. So far, little if any information is available on the presence of pilus-like structures in human gut commensals like bifidobacteria. Results and discussion In this report, Atomic Force Microscopy (AFM) of various bifidobacterial strains belonging to Bifidobacterium bifidum, Bifidobacterium longum subsp. longum, Bifidobacterium dentium, Bifidobacterium adolescentis and Bifidobacterium animalis subsp. lactis revealed the existence of appendages resembling pilus-like structures. Interestingly, these microorganisms harbour two to six predicted pilus gene clusters in their genome, with each organized in an operon encompassing the major pilin subunit-encoding gene (designated fimA or fimP) together with one or two minor pilin subunit-encoding genes (designated as fimB and\\/or fimQ), and a gene encoding a sortase enzyme (strA). Quantitative Real Time (qRT)-PCR analysis and RT-PCR experiments revealed a polycistronic mRNA, encompassing the fimA\\/P and fimB\\/Q genes, which are differentially expressed upon cultivation of bifidobacteria on various glycans.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

OpenAIRE

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-01-01

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

The arabidopsis wall associated kinase-like 10 gene encodes a functional guanylyl cyclase and is co-expressed with pathogen defense related genes

KAUST Repository

Meier, Stuart; Ruzvidzo, Oziniel; Morse, Monique; Donaldson, Lara; Kwezi, Lusisizwe; Gehring, Christoph A

2010-01-01

Background: Second messengers have a key role in linking environmental stimuli to physiological responses. One such messenger, guanosine 3?,5?-cyclic monophosphate (cGMP), has long been known to be an essential signaling molecule in many different physiological processes in higher plants, including biotic stress responses. To date, however, the guanylyl cyclase (GC) enzymes that catalyze the formation of cGMP from GTP have largely remained elusive in higher plants. Principal Findings: We have identified an Arabidopsis receptor type wall associated kinase-like molecule (AtWAKL10) as a candidate GC and provide experimental evidence to show that the intracellular domain of AtWAKL10431-700 can generate cGMP in vitro. Further, we also demonstrate that the molecule has kinase activity indicating that AtWAKL10 is a twin-domain catalytic protein. A co-expression and stimulus-specific expression analysis revealed that AtWAKL10 is consistently coexpressed with well characterized pathogen defense related genes and along with these genes is induced early and sharply in response to a range of pathogens and their elicitors. Conclusions: We demonstrate that AtWAKL10 is a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that are critically dependent on the second messenger cGMP. © 2010 Meier et al.

The arabidopsis wall associated kinase-like 10 gene encodes a functional guanylyl cyclase and is co-expressed with pathogen defense related genes

KAUST Repository

Meier, Stuart

2010-01-26

Background: Second messengers have a key role in linking environmental stimuli to physiological responses. One such messenger, guanosine 3?,5?-cyclic monophosphate (cGMP), has long been known to be an essential signaling molecule in many different physiological processes in higher plants, including biotic stress responses. To date, however, the guanylyl cyclase (GC) enzymes that catalyze the formation of cGMP from GTP have largely remained elusive in higher plants. Principal Findings: We have identified an Arabidopsis receptor type wall associated kinase-like molecule (AtWAKL10) as a candidate GC and provide experimental evidence to show that the intracellular domain of AtWAKL10431-700 can generate cGMP in vitro. Further, we also demonstrate that the molecule has kinase activity indicating that AtWAKL10 is a twin-domain catalytic protein. A co-expression and stimulus-specific expression analysis revealed that AtWAKL10 is consistently coexpressed with well characterized pathogen defense related genes and along with these genes is induced early and sharply in response to a range of pathogens and their elicitors. Conclusions: We demonstrate that AtWAKL10 is a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that are critically dependent on the second messenger cGMP. © 2010 Meier et al.

A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

Directory of Open Access Journals (Sweden)

Ashley L Waldron

Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

A novel, mouse mammary tumor virus encoded protein with Rev-like properties

International Nuclear Information System (INIS)

Indik, Stanislav; Guenzburg, Walter H.; Salmons, Brian; Rouault, Francoise

2005-01-01

We have identified a novel, multiple spliced, subgenomic mRNA species in MMTV producing cells of different origin containing an open reading frame encoding a 39-kDa Rev-like protein, Rem (regulator of expression of MMTV). An EGFP-Rem fusion protein is shown to be predominantly in the nucleolus. Further leptomycin B inhibits the nuclear export of nonspliced MMTV transcripts, implicating Rem in nuclear export by the Crm1 pathway in MMTV. Rem is thus reminiscent of the Rec protein from the related endogenous human retrovirus, HERV-K

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

Science.gov (United States)

Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

2005-06-01

Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

LENUS (Irish Health Repository)

Dunlop, Rebecca L E

2012-02-01

Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

Survey of the rubber tree genome reveals a high number of cysteine protease-encoding genes homologous to Arabidopsis SAG12.

Science.gov (United States)

Zou, Zhi; Liu, Jianting; Yang, Lifu; Xie, Guishui

2017-01-01

Arabidopsis thaliana SAG12, a senescence-specific gene encoding a cysteine protease, is widely used as a molecular marker for the study of leaf senescence. To date, its potential orthologues have been isolated from several plant species such as Brassica napus and Nicotiana tabacum. However, little information is available in rubber tree (Hevea brasiliensis), a rubber-producing plant of the Euphorbiaceae family. This study presents the identification of SAG12-like genes from the rubber tree genome. Results showed that an unexpected high number of 17 rubber orthologues with a single intron were found, contrasting the single copy with two introns in Arabidopsis. The gene expansion was also observed in another two Euphorbiaceae plants, castor bean (Ricinus communis) and physic nut (Jatropha curcas), both of which contain 8 orthologues. In accordance with no occurrence of recent whole-genome duplication (WGD) events, most duplicates in castor and physic nut were resulted from tandem duplications. In contrast, the duplicated HbSAG12H genes were derived from tandem duplications as well as the recent WGD. Expression analysis showed that most HbSAG12H genes were lowly expressed in examined tissues except for root and male flower. Furthermore, HbSAG12H1 exhibits a strictly senescence-associated expression pattern in rubber tree leaves, and thus can be used as a marker gene for the study of senescence mechanism in Hevea.

Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

Directory of Open Access Journals (Sweden)

Yuepeng eHan

2015-04-01

Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

Molecular cloning and characterization of a novel salt-inducible gene encoding an acidic isoform of PR-5 protein in soybean (Glycine max [L.] Merr.).

Science.gov (United States)

Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H

2006-10-01

We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.

Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

Science.gov (United States)

Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

2009-01-01

There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

Evolutionary hierarchy of vertebrate-like heterotrimeric G protein families.

Science.gov (United States)

Krishnan, Arunkumar; Mustafa, Arshi; Almén, Markus Sällman; Fredriksson, Robert; Williams, Michael J; Schiöth, Helgi B

2015-10-01

Heterotrimeric G proteins perform a crucial role as molecular switches controlling various cellular responses mediated by G protein-coupled receptor (GPCR) signaling pathway. Recent data have shown that the vertebrate-like G protein families are found across metazoans and their closest unicellular relatives. However, an overall evolutionary hierarchy of vertebrate-like G proteins, including gene family annotations and in particular mapping individual gene gain/loss events across diverse holozoan lineages is still incomplete. Here, with more expanded invertebrate taxon sampling, we have reconstructed phylogenetic trees for each of the G protein classes/families and provide a robust classification and hierarchy of vertebrate-like heterotrimeric G proteins. Our results further extend the evidence that the common ancestor (CA) of holozoans had at least five ancestral Gα genes corresponding to all major vertebrate Gα classes and contain a total of eight genes including two Gβ and one Gγ. Our results also indicate that the GNAI/O-like gene likely duplicated in the last CA of metazoans to give rise to GNAI- and GNAO-like genes, which are conserved across invertebrates. Moreover, homologs of GNB1-4 paralogon- and GNB5 family-like genes are found in most metazoans and that the unicellular holozoans encode two ancestral Gβ genes. Similarly, most bilaterian invertebrates encode two Gγ genes which include a representative of the GNG gene cluster and a putative homolog of GNG13. Interestingly, our results also revealed key evolutionary events such as the Drosophila melanogaster eye specific Gβ subunit that is found conserved in most arthropods and several previously unidentified species specific expansions within Gαi/o, Gαs, Gαq, Gα12/13 classes and the GNB1-4 paralogon. Also, we provide an overall proposed evolutionary scenario on the expansions of all G protein families in vertebrate tetraploidizations. Our robust classification/hierarchy is essential to further

RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

International Nuclear Information System (INIS)

Reynolds, P.; Weber, S.; Prakash, L.

1985-01-01

The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

Science.gov (United States)

Lu, Y P; Li, Z S; Rea, P A

1997-07-22

Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

Science.gov (United States)

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

Directory of Open Access Journals (Sweden)

Elías Trujillo-Esquivel

2017-09-01

Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

TAIL1: an isthmin-like gene, containing type 1 thrombospondin-repeat and AMOP domain, mapped to ARVD1 critical region.

Science.gov (United States)

Rossi, Valeria; Beffagna, Giorgia; Rampazzo, Alessandra; Bauce, Barbara; Danieli, Gian Antonio

2004-06-23

Isthmins represent a novel family of vertebrate secreted proteins containing one copy of the thrombospondin type 1 repeat (TSR), which in mammals is shared by several proteins with diverse biological functions, including cell adhesion, angiogenesis, and patterning of developing nervous system. We have determined the genomic organization of human TAIL1 (thrombospondin and AMOP containing isthmin-like 1), a novel isthmin-like gene encoding a protein that contains a TSR and a C-terminal AMOP domain (adhesion-associated domain in MUC4 and other proteins), characteristic of extracellular proteins involved in adhesion processes. TAIL1 gene encompasses more than 24.4 kb. Analysis of the DNA sequence surrounding the putative transcriptional start region revealed a TATA-less promoter located in a CpG island. Several consensus binding sites for the transcription factors Sp1 and MZF-1 were identified in this promoter region. In humans, TAIL1 gene is located on chromosome 14q24.3 within ARVD1 (arrhythmogenic right ventricular dysplasia/cardiomyopathy, type 1) critical region; preliminary evidence suggests that it is expressed in several tissues, showing multiple alternative splicing.

The pmr gene, encoding a Ca2+-ATPase, is required for calcium and manganese homeostasis and normal development of hyphae and conidia in Neurospora crassa.

Science.gov (United States)

Bowman, Barry J; Abreu, Stephen; Johl, Jessica K; Bowman, Emma Jean

2012-11-01

The pmr gene is predicted to encode a Ca(2+)-ATPase in the secretory pathway. We examined two strains of Neurospora crassa that lacked PMR: the Δpmr strain, in which pmr was completely deleted, and pmr(RIP), in which the gene was extensively mutated. Both strains had identical, complex phenotypes. Compared to the wild type, these strains required high concentrations of calcium or manganese for optimal growth and had highly branched, slow-growing hyphae. They conidiated poorly, and the shape and size of the conidia were abnormal. Calcium accumulated in the Δpmr strains to only 20% of the wild-type level. High concentrations of MnCl(2) (1 to 5 mM) in growth medium partially suppressed the morphological defects but did not alter the defect in calcium accumulation. The Δpmr Δnca-2 double mutant (nca-2 encodes a Ca(2+)-ATPase in the plasma membrane) accumulated 8-fold more calcium than the wild type, and the morphology of the hyphae was more similar to that of wild-type hyphae. Previous experiments failed to show a function for nca-1, which encodes a SERCA-type Ca(2+)-ATPase in the endoplasmic reticulum (B. J. Bowman, S. Abreu, E. Margolles-Clark, M. Draskovic, and E. J. Bowman, Eukaryot. Cell 10:654-661, 2011). The pmr(RIP) Δnca-1 double mutant accumulated small amounts of calcium, like the Δpmr strain, but exhibited even more extreme morphological defects. Thus, PMR can apparently replace NCA-1 in the endoplasmic reticulum, but NCA-1 cannot replace PMR. The morphological defects in the Δpmr strain are likely caused, in part, by insufficient concentrations of calcium and manganese in the Golgi compartment; however, PMR is also needed to accumulate normal levels of calcium in the whole cell.

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

DEFF Research Database (Denmark)

Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

2015-01-01

at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

Vast diversity of prokaryotic virus genomes encoding double jelly-roll major capsid proteins uncovered by genomic and metagenomic sequence analysis.

Science.gov (United States)

Yutin, Natalya; Bäckström, Disa; Ettema, Thijs J G; Krupovic, Mart; Koonin, Eugene V

2018-04-10

Analysis of metagenomic sequences has become the principal approach for the study of the diversity of viruses. Many recent, extensive metagenomic studies on several classes of viruses have dramatically expanded the visible part of the virosphere, showing that previously undetected viruses, or those that have been considered rare, actually are important components of the global virome. We investigated the provenance of viruses related to tail-less bacteriophages of the family Tectiviridae by searching genomic and metagenomics sequence databases for distant homologs of the tectivirus-like Double Jelly-Roll major capsid proteins (DJR MCP). These searches resulted in the identification of numerous genomes of virus-like elements that are similar in size to tectiviruses (10-15 kilobases) and have diverse gene compositions. By comparison of the gene repertoires, the DJR MCP-encoding genomes were classified into 6 distinct groups that can be predicted to differ in reproduction strategies and host ranges. Only the DJR MCP gene that is present by design is shared by all these genomes, and most also encode a predicted DNA-packaging ATPase; the rest of the genes are present only in subgroups of this unexpectedly diverse collection of DJR MCP-encoding genomes. Only a minority encode a DNA polymerase which is a hallmark of the family Tectiviridae and the putative family "Autolykiviridae". Notably, one of the identified putative DJR MCP viruses encodes a homolog of Cas1 endonuclease, the integrase involved in CRISPR-Cas adaptation and integration of transposon-like elements called casposons. This is the first detected occurrence of Cas1 in a virus. Many of the identified elements are individual contigs flanked by inverted or direct repeats and appear to represent complete, extrachromosomal viral genomes, whereas others are flanked by bacterial genes and thus can be considered as proviruses. These contigs come from metagenomes of widely different environments, some dominated by

Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

International Nuclear Information System (INIS)

Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin

2008-01-01

Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy

Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

Science.gov (United States)

Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

2002-05-25

All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

Science.gov (United States)

Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

2012-01-01

We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

[Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

Science.gov (United States)

Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

2008-01-01

The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

Nopaline-type Ti plasmid of Agrobacterium encodes a VirF-like functional F-box protein.

Science.gov (United States)

Lacroix, Benoît; Citovsky, Vitaly

2015-11-20

During Agrobacterium-mediated genetic transformation of plants, several bacterial virulence (Vir) proteins are translocated into the host cell to facilitate infection. One of the most important of such translocated factors is VirF, an F-box protein produced by octopine strains of Agrobacterium, which presumably facilitates proteasomal uncoating of the invading T-DNA from its associated proteins. The presence of VirF also is thought to be involved in differences in host specificity between octopine and nopaline strains of Agrobacterium, with the current dogma being that no functional VirF is encoded by nopaline strains. Here, we show that a protein with homology to octopine VirF is encoded by the Ti plasmid of the nopaline C58 strain of Agrobacterium. This protein, C58VirF, possesses the hallmarks of functional F-box proteins: it contains an active F-box domain and specifically interacts, via its F-box domain, with SKP1-like (ASK) protein components of the plant ubiquitin/proteasome system. Thus, our data suggest that nopaline strains of Agrobacterium have evolved to encode a functional F-box protein VirF.

Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

NARCIS (Netherlands)

Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

2008-01-01

The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

Purification of cold-shock-like proteins from Stigmatella aurantiaca - molecular cloning and characterization of the cspA gene.

Science.gov (United States)

Stamm, I; Leclerque, A; Plaga, W

1999-09-01

Prominent low-molecular-weight proteins were isolated from vegetative cells of the myxobacterium Stigmatella aurantiaca and were found to be members of the cold-shock protein family. A first gene of this family (cspA) was cloned and sequenced. It encodes a protein of 68 amino acid residues that displays up to 71% sequence identity with other bacterial cold-shock(-like) proteins. A cysteine residue within the RNP-2 motif is a peculiarity of Stigmatella CspA. A cspA::(Deltatrp-lacZ) fusion gene construct was introduced into Stigmatella by electroporation, a method that has not been used previously for this strain. Analysis of the resultant transformants revealed that cspA transcription occurs at high levels during vegetative growth at 20 and 32 degrees C, and during fruiting body formation.

Association of MYF5 and KLF15 gene polymorphisms with carcass traits in domestic pigeons (Columba livia).

Science.gov (United States)

Yin, Z Z; Dong, X Y; Dong, D J; Ma, Y Z

2016-10-01

Single nucleotide polymorphisms (SNPs) in the exons of the myogenic factor 5 (MYF5) and Kruppel-like factor 15 (KLF15) genes were identified and analysed by using DNA sequencing methods in 60 female domestic pigeons (Columba livia). Five SNPs (T5067A, C5084T, C5101T, T5127A and C5154G) were detected in exon 3 of MYF5 and 6 SNPs (C1398T, C1464T, G1542A, C1929T, G1965A and A2355G) were found in exon 2 of KLF15, respectively. The analysis revealed three genotypes, in which the AA genotype was dominant and the A allele showed a dominant advantage. For the MYF5 gene, the C5084T and T5127A SNP genotypes were significantly associated with carcass traits of pigeons. Within those two SNPs, the BB genotype showed relatively higher trait association values than those of AA or AB genotypes. No significant association was observed between the KLF15 SNP genotypes and carcass traits. These results indicated that the MYF5 gene is a potential major gene affecting carcass traits in domestic pigeons. The BB genotype of the C5084T and T5127A SNPs could be a potential candidate genetic marker for marker-assisted selection in pigeon.

Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

Science.gov (United States)

Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

2015-01-01

For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

Mutacins and bacteriocins like genes in Streptococcus mutans isolated from participants with high, moderate, and low salivary count.

Science.gov (United States)

Soto, Carolina; Padilla, Carlos; Lobos, Olga

2017-02-01

To detect S. mutans producers of mutacins and bacteriocins like substances (BLIS) from saliva of participants with low, moderate, and high salivary counts. 123 strains of S. mutans were obtained from participants with low, moderate, and high salivary counts (age 18 and 20 years old) and their antibacterial capacity analyzed. By using PCR amplification, the expression levels of mutacins and BLIS genes were studied (expressed in arbitrary units/ml) in all three levels. S. mutans strains from participants with low salivary counts show high production of mutacins (63%). In contrast, participants with moderate and high salivary counts depict relatively low levels of mutacins (22 and 15%, respectively). Moreover, participants with low salivary counts showed high expression levels of genes encoding mutacins, a result that correlates with the strong antimicrobial activity of the group. Participants with moderate and high salivary counts however depict low expression levels of mutacin related genes, and little antimicrobial activity. No BLIS were detected in any of the groups studied. S. mutans isolated from the saliva of participants with low bacterial counts have significant antibacterial capacity compared to that of participants with moderate and high salivary counts. The superior lethality of S. mutans in participants with low salivary counts is likely due to the augmented expression of mutacin- related genes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

Directory of Open Access Journals (Sweden)

Hui-Yeng Y Yap

Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

International Nuclear Information System (INIS)

Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin

2006-01-01

Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist

Directory of Open Access Journals (Sweden)

Wernegreen Jennifer J

2010-12-01

Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

Science.gov (United States)

Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

2009-02-27

All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

OpenAIRE

Hahn, F M; Baker, J A; Poulter, C D

1996-01-01

Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

Science.gov (United States)

Tornow, J; Santangelo, G M

1994-06-01

A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

International Nuclear Information System (INIS)

Chisholm, G.E.; Summers, W.C.

1986-01-01

The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

Variation at innate immunity Toll-like receptor genes in a bottlenecked population of a New Zealand robin.

Directory of Open Access Journals (Sweden)

Catherine E Grueber

Full Text Available Toll-like receptors (TLRs are an ancient family of genes encoding transmembrane proteins that bind pathogen-specific molecules and initiate both innate and adaptive aspects of the immune response. Our goal was to determine whether these genes show sufficient genetic diversity in a bottlenecked population to be a useful addition or alternative to the more commonly employed major histocompatibility complex (MHC genotyping in a conservation genetics context. We amplified all known avian TLR genes in a severely bottlenecked population of New Zealand's Stewart Island robin (Petroica australis rakiura, for which reduced microsatellite diversity was previously observed. We genotyped 17-24 birds from a reintroduced island population (including the 12 founders for nine genes, seven of which were polymorphic. We observed a total of 24 single-nucleotide polymorphisms overall, 15 of which were non-synonymous, representing up to five amino-acid variants at a locus. One locus (TLR1LB showed evidence of past directional selection. Results also confirmed a passerine duplication of TLR7. The levels of TLR diversity that we observe are sufficient to justify their further use in addressing conservation genetic questions, even in bottlenecked populations.

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

NARCIS (Netherlands)

Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

2002-01-01

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

Science.gov (United States)

van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

2016-01-01

Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy

International Nuclear Information System (INIS)

Mangin, M.; Webb, A.C.; Dreyer, B.E.

1988-01-01

Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12

Involvement of insulin-like factor 3 (Insl3) in diethylstilbestrol-induced cryptorchidism

NARCIS (Netherlands)

J.M.A. Emmen (Judith); A. McLuskey; I.M. Adham; W. Engel; M. Verhoef-Post (Miriam); A.P.N. Themmen (Axel); J.A. Grootegoed (Anton); A.O. Brinkmann (Albert)

2000-01-01

textabstractRecently, it has been shown that targeted inactivation of the Insl3 gene in male mice results in cryptorchidism. The Insl3 gene encodes insulin-like factor 3 (Insl3), which is expressed in fetal Leydig cells. The testicular factor Insl3 appears to play an

On the relationships between generative encodings, regularity, and learning abilities when evolving plastic artificial neural networks.

Directory of Open Access Journals (Sweden)

Paul Tonelli

Full Text Available A major goal of bio-inspired artificial intelligence is to design artificial neural networks with abilities that resemble those of animal nervous systems. It is commonly believed that two keys for evolving nature-like artificial neural networks are (1 the developmental process that links genes to nervous systems, which enables the evolution of large, regular neural networks, and (2 synaptic plasticity, which allows neural networks to change during their lifetime. So far, these two topics have been mainly studied separately. The present paper shows that they are actually deeply connected. Using a simple operant conditioning task and a classic evolutionary algorithm, we compare three ways to encode plastic neural networks: a direct encoding, a developmental encoding inspired by computational neuroscience models, and a developmental encoding inspired by morphogen gradients (similar to HyperNEAT. Our results suggest that using a developmental encoding could improve the learning abilities of evolved, plastic neural networks. Complementary experiments reveal that this result is likely the consequence of the bias of developmental encodings towards regular structures: (1 in our experimental setup, encodings that tend to produce more regular networks yield networks with better general learning abilities; (2 whatever the encoding is, networks that are the more regular are statistically those that have the best learning abilities.

The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

Science.gov (United States)

Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2017-03-01

The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

Science.gov (United States)

Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

2016-06-01

The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

Science.gov (United States)

Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

2003-08-01

ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

Genome-wide identification and expression analysis of SBP-like transcription factor genes in Moso Bamboo (Phyllostachys edulis).

Science.gov (United States)

Pan, Feng; Wang, Yue; Liu, Huanglong; Wu, Min; Chu, Wenyuan; Chen, Danmei; Xiang, Yan

2017-06-27

The SQUAMOSA promoter binding protein-like (SPL) proteins are plant-specific transcription factors (TFs) that function in a variety of developmental processes including growth, flower development, and signal transduction. SPL proteins are encoded by a gene family, and these genes have been characterized in two model grass species, Zea mays and Oryza sativa. The SPL gene family has not been well studied in moso bamboo (Phyllostachys edulis), a woody grass species. We identified 32 putative PeSPL genes in the P. edulis genome. Phylogenetic analysis arranged the PeSPL protein sequences in eight groups. Similarly, phylogenetic analysis of the SBP-like and SBP proteins from rice and maize clustered them into eight groups analogous to those from P. edulis. Furthermore, the deduced PeSPL proteins in each group contained very similar conserved sequence motifs. Our analyses indicate that the PeSPL genes experienced a large-scale duplication event ~15 million years ago (MYA), and that divergence between the PeSPL and OsSPL genes occurred 34 MYA. The stress-response expression profiles and tissue-specificity of the putative PeSPL gene promoter regions showed that SPL genes in moso bamboo have potential biological functions in stress resistance as well as in growth and development. We therefore examined PeSPL gene expression in response to different plant hormone and drought (polyethylene glycol-6000; PEG) treatments to mimic biotic and abiotic stresses. Expression of three (PeSPL10, -12, -17), six (PeSPL1, -10, -12, -17, -20, -31), and nine (PeSPL5, -8, -9, -14, -15, -19, -20, -31, -32) genes remained relatively stable after treating with salicylic acid (SA), gibberellic acid (GA), and PEG, respectively, while the expression patterns of other genes changed. In addition, analysis of tissue-specific expression of the moso bamboo SPL genes during development showed differences in their spatiotemporal expression patterns, and many were expressed at high levels in flowers and

Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

Science.gov (United States)

Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

2011-01-01

Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

Silencing of a Germin-Like Protein Gene (CchGLP in Geminivirus-Resistant Pepper (Capsicum chinense Jacq. BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV

Directory of Open Access Journals (Sweden)

Laura Mejía-Teniente

2015-11-01

Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

Silencing of a Germin-Like Protein Gene (CchGLP) in Geminivirus-Resistant Pepper (Capsicum chinense Jacq.) BG-3821 Increases Susceptibility to Single and Mixed Infections by Geminiviruses PHYVV and PepGMV.

Science.gov (United States)

Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G

2015-11-25

Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.

The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

Science.gov (United States)

Shukla, Avi; Chatterjee, Anirvan

2018-01-01

Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

Identification of the S-transferase like superfamily bacillithiol transferases encoded by Bacillus subtilis

Science.gov (United States)

Perera, Varahenage R.; Lapek, John D.; Newton, Gerald L.; Gonzalez, David J.; Pogliano, Kit

2018-01-01

Bacillithiol is a low molecular weight thiol found in Firmicutes that is analogous to glutathione, which is absent in these bacteria. Bacillithiol transferases catalyze the transfer of bacillithiol to various substrates. The S-transferase-like (STL) superfamily contains over 30,000 putative members, including bacillithiol transferases. Proteins in this family are extremely divergent and are related by structural rather than sequence similarity, leaving it unclear if all share the same biochemical activity. Bacillus subtilis encodes eight predicted STL superfamily members, only one of which has been shown to be a bacillithiol transferase. Here we find that the seven remaining proteins show varying levels of metal dependent bacillithiol transferase activity. We have renamed the eight enzymes BstA-H. Mass spectrometry and gene expression studies revealed that all of the enzymes are produced to varying levels during growth and sporulation, with BstB and BstE being the most abundant and BstF and BstH being the least abundant. Interestingly, several bacillithiol transferases are induced in the mother cell during sporulation. A strain lacking all eight bacillithiol transferases showed normal growth in the presence of stressors that adversely affect growth of bacillithiol-deficient strains, such as paraquat and CdCl2. Thus, the STL bacillithiol transferases represent a new group of proteins that play currently unknown, but potentially significant roles in bacillithiol-dependent reactions. We conclude that these enzymes are highly divergent, perhaps to cope with an equally diverse array of endogenous or exogenous toxic metabolites and oxidants. PMID:29451913

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

Directory of Open Access Journals (Sweden)

Mignon A Keaton

2011-03-01

Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

NARCIS (Netherlands)

Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

2015-01-01

The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

Identification of a novel prophage-like gene cluster actively expressed in both virulent and avirulent strains of Leptospira interrogans serovar Lai.

Science.gov (United States)

Qin, Jin-Hong; Zhang, Qing; Zhang, Zhi-Ming; Zhong, Yi; Yang, Yang; Hu, Bao-Yu; Zhao, Guo-Ping; Guo, Xiao-Kui

2008-06-01

DNA microarray analysis was used to compare the differential gene expression profiles between Leptospira interrogans serovar Lai type strain 56601 and its corresponding attenuated strain IPAV. A 22-kb genomic island covering a cluster of 34 genes (i.e., genes LA0186 to LA0219) was actively expressed in both strains but concomitantly upregulated in strain 56601 in contrast to that of IPAV. Reverse transcription-PCR assays proved that the gene cluster comprised five transcripts. Gene annotation of this cluster revealed characteristics of a putative prophage-like remnant with at least 8 of 34 sequences encoding prophage-like proteins, of which the LA0195 protein is probably a putative prophage CI-like regulator. The transcription initiation activities of putative promoter-regulatory sequences of transcripts I, II, and III, all proximal to the LA0195 gene, were further analyzed in the Escherichia coli promoter probe vector pKK232-8 by assaying the reporter chloramphenicol acetyltransferase (CAT) activities. The strong promoter activities of both transcripts I and II indicated by the E. coli CAT assay were well correlated with the in vitro sequence-specific binding of the recombinant LA0195 protein to the corresponding promoter probes detected by the electrophoresis mobility shift assay. On the other hand, the promoter activity of transcript III was very low in E. coli and failed to show active binding to the LA0195 protein in vitro. These results suggested that the LA0195 protein is likely involved in the transcription of transcripts I and II. However, the identical complete DNA sequences of this prophage remnant from these two strains strongly suggests that possible regulatory factors or signal transduction systems residing outside of this region within the genome may be responsible for the differential expression profiling in these two strains.

A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

Science.gov (United States)

Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

2015-07-01

The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

Clonal diversity and detection of carbapenem resistance encoding genes among multidrug-resistant Acinetobacter baumannii isolates recovered from patients and environment in two intensive care units in a Moroccan hospital

Directory of Open Access Journals (Sweden)

Jean Uwingabiye

2017-09-01

Full Text Available Abstract Background Carbapenem-resistant Acinetobacter baumannii has recently been defined by the World Health Organization as a critical pathogen. The aim of this study was to compare clonal diversity and carbapenemase-encoding genes of A. baumannii isolates collected from colonized or infected patients and hospital environment in two intensive care units (ICUs in Morocco. Methods The patient and environmental sampling was carried out in the medical and surgical ICUs of Mohammed V Military teaching hospital from March to August 2015. All A. baumannii isolates recovered from clinical and environmental samples, were identified using routine microbiological techniques and Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry. Antimicrobial susceptibility testing was performed using disc diffusion method. The carbapenemase-encoding genes were screened for by PCR. Clonal relatedness was analyzed by digestion of the DNA with low frequency restriction enzymes and pulsed field gel electrophoresis (PFGE and the multi locus sequence typing (MLST was performed on two selected isolates from two major pulsotypes. Results A total of 83 multidrug-resistant A. baumannii isolates were collected: 47 clinical isolates and 36 environmental isolates. All isolates were positive for the bla OXA51-like and bla OXA23-like genes. The coexistence of bla NDM-1 /bla OXA-23-like and bla OXA 24-like /bla OXA-23-like were detected in 27 (32.5% and 2 (2.4% of A. baumannii isolates, respectively. The environmental samples and the fecally-colonized patients were significantly identified (p < 0.05 as the most common sites of isolation of NDM-1-harboring isolates. PFGE grouped all isolates into 9 distinct clusters with two major groups (0007 and 0008 containing up to 59% of the isolates. The pulsotype 0008 corresponds to sequence type (ST 195 while pulsotype 0007 corresponds to ST 1089.The genetic similarity between the clinical and environmental isolates

Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

Science.gov (United States)

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

2013-01-01

Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

Deep sequencing revealed molecular signature of horizontal gene transfer of plant like transcripts in the mosquito Anopheles culicifacies: an evolutionary puzzle [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Punita Sharma

2015-12-01

Full Text Available In prokaryotes, horizontal gene transfer (HGT has been regarded as an important evolutionary drive to acquire and retain beneficial genes for their survival in diverse ecologies. However, in eukaryotes, the functional role of HGTs remains questionable, although current genomic tools are providing increased evidence of acquisition of novel traits within non-mating metazoan species. Here, we provide another transcriptomic evidence for the acquisition of massive plant genes in the mosquito, Anopheles culicifacies. Our multiple experimental validations including genomic PCR, RT-PCR, real-time PCR, immuno-blotting and immuno-florescence microscopy, confirmed that plant like transcripts (PLTs are of mosquito origin and may encode functional proteins. A comprehensive molecular analysis of the PLTs and ongoing metagenomic analysis of salivary microbiome provide initial clues that mosquitoes may have survival benefits through the acquisition of nuclear as well as chloroplast encoded plant genes. Our findings of PLTs further support the similar questionable observation of HGTs in other higher organisms, which is still a controversial and debatable issue in the community of evolutionists. We believe future understanding of the underlying mechanism of the feeding associated molecular responses may shed new insights in the functional role of PLTs in the mosquito.

Cloning and bioinformatic analysis of lovastatin biosynthesis regulatory gene lovE.

Science.gov (United States)

Huang, Xin; Li, Hao-ming

2009-08-05

Lovastatin is an effective drug for treatment of hyperlipidemia. This study aimed to clone lovastatin biosynthesis regulatory gene lovE and analyze the structure and function of its encoding protein. According to the lovastatin synthase gene sequence from genebank, primers were designed to amplify and clone the lovastatin biosynthesis regulatory gene lovE from Aspergillus terrus genomic DNA. Bioinformatic analysis of lovE and its encoding animo acid sequence was performed through internet resources and software like DNAMAN. Target fragment lovE, almost 1500 bp in length, was amplified from Aspergillus terrus genomic DNA and the secondary and three-dimensional structures of LovE protein were predicted. In the lovastatin biosynthesis process lovE is a regulatory gene and LovE protein is a GAL4-like transcriptional factor.

aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

Directory of Open Access Journals (Sweden)

Tuffery Pierre

2009-12-01

Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

Directory of Open Access Journals (Sweden)

Moysés Elias-Neto

2013-06-01

Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

Science.gov (United States)

Sudagidan, Mert; Aydin, Ali

2010-04-15

In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

Cell culture density affects the stemness gene expression of adipose tissue-derived mesenchymal stem cells.

Science.gov (United States)

Kim, Dae Seong; Lee, Myoung Woo; Lee, Tae-Hee; Sung, Ki Woong; Koo, Hong Hoe; Yoo, Keon Hee

2017-03-01

The results of clinical trials using mesenchymal stem cells (MSCs) are controversial due to the heterogeneity of human MSCs and differences in culture conditions. In this regard, it is important to identify gene expression patterns according to culture conditions, and to determine how the cells are expanded and when they should be clinically used. In the current study, stemness gene expression was investigated in adipose tissue-derived MSCs (AT-MSCs) harvested following culture at different densities. AT-MSCs were plated at a density of 200 or 5,000 cells/cm 2 . After 7 days of culture, stemness gene expression was examined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. The proliferation rate of AT-MSCs harvested at a low density (~50% confluent) was higher than that of AT-MSCs harvested at a high density (~90% confluent). Although there were differences in the expression levels of stemness gene, such as octamer-binding transcription factor 4, nanog homeobox ( Nanog ), SRY-box 2, Kruppel like factor 4, v-myc avian myelocytomatosis viral oncogene homolog ( c-Myc ), and lin-28 homolog A, in the AT-MSCs obtained from different donors, RT-qPCR analysis demonstrated differential gene expression patterns according to the cell culture density. Expression levels of stemness genes, particularly Nanog and c-Myc , were upregulated in AT-MSCs harvested at a low density (~50% confluent) in comparison to AT-MSCs from the same donor harvested at a high density (~90% confluent). These results imply that culture conditions, such as the cell density at harvesting, modulate the stemness gene expression and proliferation of MSCs.

ngs (Notochord Granular Surface) Gene Encodes a Novel Type of Intermediate Filament Family Protein Essential for Notochord Maintenance in Zebrafish*

Science.gov (United States)

Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

2013-01-01

The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins. PMID:23132861

ngs (notochord granular surface) gene encodes a novel type of intermediate filament family protein essential for notochord maintenance in zebrafish.

Science.gov (United States)

Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

2013-01-25

The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins.

MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

Science.gov (United States)

Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

2006-01-24

Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

Molecular Cloning and Characterization of Four Genes Encoding Ethylene Receptors Associated with Pineapple (Ananas comosus L.) Flowering.

Science.gov (United States)

Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming

2016-01-01

Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5' flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1-9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1-4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon.

Identification of Novel Targets for Lung Cancer Therapy Using an Induced Pluripotent Stem Cell Model.

Science.gov (United States)

Shukla, Vivek; Rao, Mahadev; Zhang, Hongen; Beers, Jeanette; Wangsa, Darawalee; Wangsa, Danny; Buishand, Floryne O; Wang, Yonghong; Yu, Zhiya; Stevenson, Holly; Reardon, Emily; McLoughlin, Kaitlin C; Kaufman, Andrew; Payabyab, Eden; Hong, Julie A; Zhang, Mary; Davis, Sean R; Edelman, Daniel C; Chen, Guokai; Miettinen, Markku; Restifo, Nicholas; Ried, Thomas; Meltzer, Paul S; Schrump, David S

2018-04-01

Despite extensive studies, the genetic and epigenetic mechanisms that mediate initiation and progression of lung cancers have not been fully elucidated. Previously, we have demonstrated that via complementary mechanisms, including DNA methylation, polycomb repressive complexes, and noncoding RNAs, cigarette smoke induces stem-like phenotypes that coincide with progression to malignancy in normal respiratory epithelia as well as enhanced growth and metastatic potential of lung cancer cells. To further investigate epigenetic mechanisms contributing to stemness/pluripotency in lung cancers and potentially identify novel therapeutic targets in these malignancies, induced pluripotent stem cells were generated from normal human small airway epithelial cells. Lung induced pluripotent stem cells were generated by lentiviral transduction of small airway epithelial cells of OSKM (Yamanaka) factors (octamer-binding transcription factor 4 [Oct4], sex-determining region Y box 2 [SOX2], Kruppel-like factor 4 [KLF4], and MYC proto-oncogene, bHLH transcription factor [MYC]). Western blot, real-time polymerase chain reaction, and chromatin immunoprecipitation sequencing analysis were performed. The lung induced pluripotent stem cells exhibited hallmarks of pluripotency, including morphology, surface antigen and stem cell gene expression, in vitro proliferation, and teratoma formation. In addition, lung induced pluripotent stem cells exhibited no chromosomal aberrations, complete silencing of reprogramming transgenes, genomic hypermethylation, upregulation of genes encoding components of polycomb repressive complex 2, hypermethylation of stem cell polycomb targets, and modulation of more than 15,000 other genes relative to parental small airway epithelial cells. Additional sex combs like-3 (ASXL3), encoding a polycomb repressive complex 2-associated protein not previously described in reprogrammed cells, was markedly upregulated in lung induced pluripotent stem cell as well as human

Transcriptome sequencing of Mycosphaerella fijiensis during association with Musa acuminata reveals candidate pathogenicity genes.

Science.gov (United States)

Noar, Roslyn D; Daub, Margaret E

2016-08-30

Mycosphaerella fijiensis, causative agent of the black Sigatoka disease of banana, is considered the most economically damaging banana disease. Despite its importance, the genetics of pathogenicity are poorly understood. Previous studies have characterized polyketide pathways with possible roles in pathogenicity. To identify additional candidate pathogenicity genes, we compared the transcriptome of this fungus during the necrotrophic phase of infection with that during saprophytic growth in medium. Transcriptome analysis was conducted, and the functions of differentially expressed genes were predicted by identifying conserved domains, Gene Ontology (GO) annotation and GO enrichment analysis, Carbohydrate-Active EnZymes (CAZy) annotation, and identification of genes encoding effector-like proteins. The analysis showed that genes commonly involved in secondary metabolism have higher expression in infected leaf tissue, including genes encoding cytochrome P450s, short-chain dehydrogenases, and oxidoreductases in the 2-oxoglutarate and Fe(II)-dependent oxygenase superfamily. Other pathogenicity-related genes with higher expression in infected leaf tissue include genes encoding salicylate hydroxylase-like proteins, hydrophobic surface binding proteins, CFEM domain-containing proteins, and genes encoding secreted cysteine-rich proteins characteristic of effectors. More genes encoding amino acid transporters, oligopeptide transporters, peptidases, proteases, proteinases, sugar transporters, and proteins containing Domain of Unknown Function (DUF) 3328 had higher expression in infected leaf tissue, while more genes encoding inhibitors of peptidases and proteinases had higher expression in medium. Sixteen gene clusters with higher expression in leaf tissue were identified including clusters for the synthesis of a non-ribosomal peptide. A cluster encoding a novel fusicoccane was also identified. Two putative dispensable scaffolds were identified with a large proportion of

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

Directory of Open Access Journals (Sweden)

DEWI FITRIANI

2010-06-01

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

OpenAIRE

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

DEFF Research Database (Denmark)

Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

2014-01-01

OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

Directory of Open Access Journals (Sweden)

Melanie Brunsch

Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

OpenAIRE

Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

2017-01-01

Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

PDGF-DD, a novel mediator of smooth muscle cell phenotypic modulation, is upregulated in endothelial cells exposed to atherosclerosis-prone flow patterns.

Science.gov (United States)

Thomas, James A; Deaton, Rebecca A; Hastings, Nicole E; Shang, Yueting; Moehle, Christopher W; Eriksson, Ulf; Topouzis, Stavros; Wamhoff, Brian R; Blackman, Brett R; Owens, Gary K

2009-02-01

Platelet-derived growth factor (PDGF)-BB is a well-known smooth muscle (SM) cell (SMC) phenotypic modulator that signals by binding to PDGF alphaalpha-, alphabeta-, and betabeta-membrane receptors. PDGF-DD is a recently identified PDGF family member, and its role in SMC phenotypic modulation is unknown. Here we demonstrate that PDGF-DD inhibited expression of multiple SMC genes, including SM alpha-actin and SM myosin heavy chain, and upregulated expression of the potent SMC differentiation repressor gene Kruppel-like factor-4 at the mRNA and protein levels. On the basis of the results of promoter-reporter assays, changes in SMC gene expression were mediated, at least in part, at the level of transcription. Attenuation of the SMC phenotypic modulatory activity of PDGF-DD by pharmacological inhibitors of ERK phosphorylation and by a small interfering RNA to Kruppel-like factor-4 highlight the role of these two pathways in this process. PDGF-DD failed to repress SM alpha-actin and SM myosin heavy chain in mouse SMCs lacking a functional PDGF beta-receptor. Importantly, PDGF-DD expression was increased in neointimal lesions in the aortic arch region of apolipoprotein C-deficient (ApoE(-/-)) mice. Furthermore, human endothelial cells exposed to an atherosclerosis-prone flow pattern, as in vascular regions susceptible to the development of atherosclerosis, exhibited a significant increase in PDGF-DD expression. These findings demonstrate a novel activity for PDGF-DD in SMC biology and highlight the potential contribution of this molecule to SMC phenotypic modulation in the setting of disturbed blood flow.

Patterns of Nucleotide Diversity at the Regions Encompassing the Drosophila Insulin-Like Peptide (dilp) Genes: Demography vs. Positive Selection in Drosophila melanogaster

Science.gov (United States)

Guirao-Rico, Sara; Aguadé, Montserrat

2013-01-01

In Drosophila, the insulin-signaling pathway controls some life history traits, such as fertility and lifespan, and it is considered to be the main metabolic pathway involved in establishing adult body size. Several observations concerning variation in body size in the Drosophila genus are suggestive of its adaptive character. Genes encoding proteins in this pathway are, therefore, good candidates to have experienced adaptive changes and to reveal the footprint of positive selection. The Drosophila insulin-like peptides (DILPs) are the ligands that trigger the insulin-signaling cascade. In Drosophila melanogaster, there are several peptides that are structurally similar to the single mammalian insulin peptide. The footprint of recent adaptive changes on nucleotide variation can be unveiled through the analysis of polymorphism and divergence. With this aim, we have surveyed nucleotide sequence variation at the dilp1-7 genes in a natural population of D. melanogaster. The comparison of polymorphism in D. melanogaster and divergence from D. simulans at different functional classes of the dilp genes provided no evidence of adaptive protein evolution after the split of the D. melanogaster and D. simulans lineages. However, our survey of polymorphism at the dilp gene regions of D. melanogaster has provided some evidence for the action of positive selection at or near these genes. The regions encompassing the dilp1-4 genes and the dilp6 gene stand out as likely affected by recent adaptive events. PMID:23308258

aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

OpenAIRE

Xu, J; Johnson, R C

1995-01-01

Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

Cop-like operon: Structure and organization in species of the Lactobacillale order

Directory of Open Access Journals (Sweden)

ANGÉLICA REYES

2006-01-01

Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

Ectopic overexpression of castor bean LEAFY COTYLEDON2 (LEC2 in Arabidopsis triggers the expression of genes that encode regulators of seed maturation and oil body proteins in vegetative tissues

Directory of Open Access Journals (Sweden)

Hyun Uk Kim

2014-01-01

Full Text Available The LEAFY COTYLEDON2 (LEC2 gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis, and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1, LEAFY COTYLEDON1-LIKE (L1L, FUSCA3 (FUS3, and ABSCISIC ACID INSENSITIVE 3 (ABI3 transcripts for seed maturation, and WRINKELED1 (WRI1 transcripts for fatty acid biosynthesis, as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1 and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1Δ11, in vegetative tissues.

Ectopic overexpression of castor bean LEAFY COTYLEDON2 (LEC2) in Arabidopsis triggers the expression of genes that encode regulators of seed maturation and oil body proteins in vegetative tissues.

Science.gov (United States)

Kim, Hyun Uk; Jung, Su-Jin; Lee, Kyeong-Ryeol; Kim, Eun Ha; Lee, Sang-Min; Roh, Kyung Hee; Kim, Jong-Bum

2013-01-01

The LEAFY COTYLEDON2 (LEC2) gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis), and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV) 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON1-LIKE (L1L), FUSCA3 (FUS3), and ABSCISIC ACID INSENSITIVE 3 (ABI3) transcripts for seed maturation, and WRINKELED1 (WRI1) transcripts for fatty acid biosynthesis), as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1) and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1(Δ11)), in vegetative tissues.

Ectopic overexpression of castor bean LEAFY COTYLEDON2 (LEC2) in Arabidopsis triggers the expression of genes that encode regulators of seed maturation and oil body proteins in vegetative tissues☆

Science.gov (United States)

Kim, Hyun Uk; Jung, Su-Jin; Lee, Kyeong-Ryeol; Kim, Eun Ha; Lee, Sang-Min; Roh, Kyung Hee; Kim, Jong-Bum

2013-01-01

The LEAFY COTYLEDON2 (LEC2) gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis), and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV) 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON1-LIKE (L1L), FUSCA3 (FUS3), and ABSCISIC ACID INSENSITIVE 3 (ABI3) transcripts for seed maturation, and WRINKELED1 (WRI1) transcripts for fatty acid biosynthesis), as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1) and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1Δ11), in vegetative tissues. PMID:24363987

Identification of functional elements and regulatory circuits by Drosophila modENCODE

Energy Technology Data Exchange (ETDEWEB)

Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

2010-12-22

of {approx}40% of the protein and nonprotein-coding genes [FlyBase 5.12 (4)] have been determined from cDNA collections (5, 6), manual curation of gene models (7), gene mutations and comprehensive genome-wide RNA interference screens (8-10), and comparative genomic analyses (11, 12). The Drosophila modENCODE project has generated more than 700 data sets that profile transcripts, histone modifications and physical nucleosome properties, general and specific transcription factors (TFs), and replication programs in cell lines, isolated tissues, and whole organisms across several developmental stages (Fig. 1). Here, we computationally integrate these data sets and report (i) improved and additional genome annotations, including full-length proteincoding genes and peptides as short as 21 amino acids; (ii) noncoding transcripts, including 132 candidate structural RNAs and 1608 nonstructural transcripts; (iii) additional Argonaute (Ago)-associated small RNA genes and pathways, including new microRNAs (miRNAs) encoded within protein-coding exons and endogenous small interfering RNAs (siRNAs) from 3-inch untranslated regions; (iv) chromatin 'states' defined by combinatorial patterns of 18 chromatin marks that are associated with distinct functions and properties; (v) regions of high TF occupancy and replication activity with likely epigenetic regulation; (vi)mixed TF and miRNA regulatory networks with hierarchical structure and enriched feed-forward loops; (vii) coexpression- and co-regulation-based functional annotations for nearly 3000 genes; (viii) stage- and tissue-specific regulators; and (ix) predictive models of gene expression levels and regulator function.

Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

Directory of Open Access Journals (Sweden)

Riley Laura M

2012-03-01

Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

Science.gov (United States)

Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

2017-10-01

Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

Pmr, a histone-like protein H1 (H-NS) family protein encoded by the IncP-7 plasmid pCAR1, is a key global regulator that alters host function.

Science.gov (United States)

Yun, Choong-Soo; Suzuki, Chiho; Naito, Kunihiko; Takeda, Toshiharu; Takahashi, Yurika; Sai, Fumiya; Terabayashi, Tsuguno; Miyakoshi, Masatoshi; Shintani, Masaki; Nishida, Hiromi; Yamane, Hisakazu; Nojiri, Hideaki

2010-09-01

Histone-like protein H1 (H-NS) family proteins are nucleoid-associated proteins (NAPs) conserved among many bacterial species. The IncP-7 plasmid pCAR1 is transmissible among various Pseudomonas strains and carries a gene encoding the H-NS family protein, Pmr. Pseudomonas putida KT2440 is a host of pCAR1, which harbors five genes encoding the H-NS family proteins PP_1366 (TurA), PP_3765 (TurB), PP_0017 (TurC), PP_3693 (TurD), and PP_2947 (TurE). Quantitative reverse transcription-PCR (qRT-PCR) demonstrated that the presence of pCAR1 does not affect the transcription of these five genes and that only pmr, turA, and turB were primarily transcribed in KT2440(pCAR1). In vitro pull-down assays revealed that Pmr strongly interacted with itself and with TurA, TurB, and TurE. Transcriptome comparisons of the pmr disruptant, KT2440, and KT2440(pCAR1) strains indicated that pmr disruption had greater effects on the host transcriptome than did pCAR1 carriage. The transcriptional levels of some genes that increased with pCAR1 carriage, such as the mexEF-oprN efflux pump genes and parI, reverted with pmr disruption to levels in pCAR1-free KT2440. Transcriptional levels of putative horizontally acquired host genes were not altered by pCAR1 carriage but were altered by pmr disruption. Identification of genome-wide Pmr binding sites by ChAP-chip (chromatin affinity purification coupled with high-density tiling chip) analysis demonstrated that Pmr preferentially binds to horizontally acquired DNA regions. The Pmr binding sites overlapped well with the location of the genes differentially transcribed following pmr disruption on both the plasmid and the chromosome. Our findings indicate that Pmr is a key factor in optimizing gene transcription on pCAR1 and the host chromosome.

Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

Science.gov (United States)

Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

2013-12-01

The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

Structural evolution of the 4/1 genes and proteins in non-vascular and lower vascular plants.

Science.gov (United States)

Morozov, Sergey Y; Milyutina, Irina A; Bobrova, Vera K; Ryazantsev, Dmitry Y; Erokhina, Tatiana N; Zavriev, Sergey K; Agranovsky, Alexey A; Solovyev, Andrey G; Troitsky, Alexey V

2015-12-01

The 4/1 protein of unknown function is encoded by a single-copy gene in most higher plants. The 4/1 protein of Nicotiana tabacum (Nt-4/1 protein) has been shown to be alpha-helical and predominantly expressed in conductive tissues. Here, we report the analysis of 4/1 genes and the encoded proteins of lower land plants. Sequences of a number of 4/1 genes from liverworts, lycophytes, ferns and gymnosperms were determined and analyzed together with sequences available in databases. Most of the vascular plants were found to encode Magnoliophyta-like 4/1 proteins exhibiting previously described gene structure and protein properties. Identification of the 4/1-like proteins in hornworts, liverworts and charophyte algae (sister lineage to all land plants) but not in mosses suggests that 4/1 proteins are likely important for plant development but not required for a primary metabolic function of plant cell. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

Science.gov (United States)

Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

2018-02-01

Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

Two pheromone precursor genes are transcriptionally expressed in the homothallic ascomycete Sordaria macrospora.

Science.gov (United States)

Pöggeler, S

2000-06-01

In order to analyze the involvement of pheromones in cell recognition and mating in a homothallic fungus, two putative pheromone precursor genes, named ppg1 and ppg2, were isolated from a genomic library of Sordaria macrospora. The ppg1 gene is predicted to encode a precursor pheromone that is processed by a Kex2-like protease to yield a pheromone that is structurally similar to the alpha-factor of the yeast Saccharomyces cerevisiae. The ppg2 gene encodes a 24-amino-acid polypeptide that contains a putative farnesylated and carboxy methylated C-terminal cysteine residue. The sequences of the predicted pheromones display strong structural similarity to those encoded by putative pheromones of heterothallic filamentous ascomycetes. Both genes are expressed during the life cycle of S. macrospora. This is the first description of pheromone precursor genes encoded by a homothallic fungus. Southern-hybridization experiments indicated that ppg1 and ppg2 homologues are also present in other homothallic ascomycetes.

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

Science.gov (United States)

Lin, J W; Lu, H C; Chen, H Y; Weng, S F

1997-10-09

Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

An Alfin-like gene from Atriplex hortensis enhances salt and drought tolerance and abscisic acid response in transgenic Arabidopsis.

Science.gov (United States)

Tao, Jian-Jun; Wei, Wei; Pan, Wen-Jia; Lu, Long; Li, Qing-Tian; Ma, Jin-Biao; Zhang, Wan-Ke; Ma, Biao; Chen, Shou-Yi; Zhang, Jin-Song

2018-02-09

Alfin-like (AL) is a small plant-specific gene family with prominent roles in root growth and abiotic stress response. Here, we aimed to identify novel stress tolerance AL genes from the stress-tolerant species Atriplex hortensis. Totally, we isolated four AhAL genes, all encoding nuclear-localized proteins with cis-element-binding and transrepression activities. Constitutive expression of AhAL1 in Arabidopsis facilitated plants to survive under saline condition, while expressing anyone of the other three AhAL genes led to salt-hypersensitive response, indicating functional divergence of AhAL family. AhAL1 also conferred enhanced drought tolerance, as judged from enhanced survival, improved growth, decreased malonaldehyde (MDA) content and reduced water loss in AhAL1-expressing plants compared to WT. In addition, abscisic acid (ABA)-mediated stomatal closure and inhibition of seed germination and primary root elongation were enhanced in AhAL1-transgenic plants. Further analysis demonstrated that AhAL1 could bind to promoter regions of GRF7, DREB1C and several group-A PP2C genes and repress their expression. Correspondingly, the expression levels of positive stress regulator genes DREB1A, DREB2A and three ABFs were all increased in AhAL1-expressing plants. Based on these results, AhAL1 was identified as a novel candidate gene for improving abiotic stress tolerance of crop plants.

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

DEFF Research Database (Denmark)

Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

2014-01-01

The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

Science.gov (United States)

Hempel, Niels; Görisch, Helmut; Mern, Demissew S

2013-09-01

Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

Directory of Open Access Journals (Sweden)

Tiane Martin de Moura

2012-10-01

Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

Energy Technology Data Exchange (ETDEWEB)

Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

1996-03-05

We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

Science.gov (United States)

Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

2014-01-01

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

Science.gov (United States)

Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

2014-05-09

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

Existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot

Science.gov (United States)

Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza

2016-01-01

Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

Science.gov (United States)

Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

2015-11-14

FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

LENUS (Irish Health Repository)

Martin, Ronny

2011-04-01

The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

Science.gov (United States)

Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

2007-07-01

Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

Comprehensive Analysis of the COBRA-Like (COBL) Gene Family in Gossypium Identifies Two COBLs Potentially Associated with Fiber Quality

Science.gov (United States)

Niu, Erli; Shang, Xiaoguang; Cheng, Chaoze; Bao, Jianghao; Zeng, Yanda; Cai, Caiping; Du, Xiongming; Guo, Wangzhen

2015-01-01

COBRA-Like (COBL) genes, which encode a plant-specific glycosylphosphatidylinositol (GPI) anchored protein, have been proven to be key regulators in the orientation of cell expansion and cellulose crystallinity status. Genome-wide analysis has been performed in A. thaliana, O. sativa, Z. mays and S. lycopersicum, but little in Gossypium. Here we identified 19, 18 and 33 candidate COBL genes from three sequenced cotton species, diploid cotton G. raimondii, G. arboreum and tetraploid cotton G. hirsutum acc. TM-1, respectively. These COBL members were anchored onto 10 chromosomes in G. raimondii and could be divided into two subgroups. Expression patterns of COBL genes showed highly developmental and spatial regulation in G. hirsutum acc. TM-1. Of them, GhCOBL9 and GhCOBL13 were preferentially expressed at the secondary cell wall stage of fiber development and had significantly co-upregulated expression with cellulose synthase genes GhCESA4, GhCESA7 and GhCESA8. Besides, GhCOBL9 Dt and GhCOBL13 Dt were co-localized with previously reported cotton fiber quality quantitative trait loci (QTLs) and the favorable allele types of GhCOBL9 Dt had significantly positive correlations with fiber quality traits, indicating that these two genes might play an important role in fiber development. PMID:26710066

Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

Directory of Open Access Journals (Sweden)

Peter K Busk

Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

Spreading of genes encoding enterotoxins, haemolysins, adhesin and biofilm among methicillin resistant Staphylococcus aureus strains with staphylococcal cassette chromosome mec type IIIA isolated from burn patients.

Science.gov (United States)

Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad

2016-08-01

The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.

Molecular cloning and functional analysis of the gene encoding ...

African Journals Online (AJOL)

Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

Spatio-Temporal Expression Patterns of Arabidopsis thaliana and Medicago truncatula Defensin-Like Genes

Science.gov (United States)

Nallu, Sumitha; Wang, Lin; Botanga, Christopher J.; Gomez, S. Karen; Costa, Liliana M.; Harrison, Maria J.; Samac, Deborah A.; Glazebrook, Jane; Katagiri, Fumiaki; Gutierrez-Marcos, Jose F.; VandenBosch, Kathryn A.

2013-01-01

Plant genomes contain several hundred defensin-like (DEFL) genes that encode short cysteine-rich proteins resembling defensins, which are well known antimicrobial polypeptides. Little is known about the expression patterns or functions of many DEFLs because most were discovered recently and hence are not well represented on standard microarrays. We designed a custom Affymetrix chip consisting of probe sets for 317 and 684 DEFLs from Arabidopsis thaliana and Medicago truncatula, respectively for cataloging DEFL expression in a variety of plant organs at different developmental stages and during symbiotic and pathogenic associations. The microarray analysis provided evidence for the transcription of 71% and 90% of the DEFLs identified in Arabidopsis and Medicago, respectively, including many of the recently annotated DEFL genes that previously lacked expression information. Both model plants contain a subset of DEFLs specifically expressed in seeds or fruits. A few DEFLs, including some plant defensins, were significantly up-regulated in Arabidopsis leaves inoculated with Alternaria brassicicola or Pseudomonas syringae pathogens. Among these, some were dependent on jasmonic acid signaling or were associated with specific types of immune responses. There were notable differences in DEFL gene expression patterns between Arabidopsis and Medicago, as the majority of Arabidopsis DEFLs were expressed in inflorescences, while only a few exhibited root-enhanced expression. By contrast, Medicago DEFLs were most prominently expressed in nitrogen-fixing root nodules. Thus, our data document salient differences in DEFL temporal and spatial expression between Arabidopsis and Medicago, suggesting distinct signaling routes and distinct roles for these proteins in the two plant species. PMID:23527067

Spatio-temporal expression patterns of Arabidopsis thaliana and Medicago truncatula defensin-like genes.

Directory of Open Access Journals (Sweden)

Mesfin Tesfaye

Full Text Available Plant genomes contain several hundred defensin-like (DEFL genes that encode short cysteine-rich proteins resembling defensins, which are well known antimicrobial polypeptides. Little is known about the expression patterns or functions of many DEFLs because most were discovered recently and hence are not well represented on standard microarrays. We designed a custom Affymetrix chip consisting of probe sets for 317 and 684 DEFLs from Arabidopsis thaliana and Medicago truncatula, respectively for cataloging DEFL expression in a variety of plant organs at different developmental stages and during symbiotic and pathogenic associations. The microarray analysis provided evidence for the transcription of 71% and 90% of the DEFLs identified in Arabidopsis and Medicago, respectively, including many of the recently annotated DEFL genes that previously lacked expression information. Both model plants contain a subset of DEFLs specifically expressed in seeds or fruits. A few DEFLs, including some plant defensins, were significantly up-regulated in Arabidopsis leaves inoculated with Alternaria brassicicola or Pseudomonas syringae pathogens. Among these, some were dependent on jasmonic acid signaling or were associated with specific types of immune responses. There were notable differences in DEFL gene expression patterns between Arabidopsis and Medicago, as the majority of Arabidopsis DEFLs were expressed in inflorescences, while only a few exhibited root-enhanced expression. By contrast, Medicago DEFLs were most prominently expressed in nitrogen-fixing root nodules. Thus, our data document salient differences in DEFL temporal and spatial expression between Arabidopsis and Medicago, suggesting distinct signaling routes and distinct roles for these proteins in the two plant species.

Extensive diversification of IgD-, IgY-, and truncated IgY(δFc)-encoding genes in the red-eared turtle (Trachemys scripta elegans).

Science.gov (United States)

Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng

2012-10-15

IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.

Identification and Characterization of Putative Integron-Like Elements of the Heavy-Metal-Hypertolerant Strains of Pseudomonas spp.

Science.gov (United States)

Ciok, Anna; Adamczuk, Marcin; Bartosik, Dariusz; Dziewit, Lukasz

2016-11-28

Pseudomonas strains isolated from the heavily contaminated Lubin copper mine and Zelazny Most post-flotation waste reservoir in Poland were screened for the presence of integrons. This analysis revealed that two strains carried homologous DNA regions composed of a gene encoding a DNA_BRE_C domain-containing tyrosine recombinase (with no significant sequence similarity to other integrases of integrons) plus a three-component array of putative integron gene cassettes. The predicted gene cassettes encode three putative polypeptides with homology to (i) transmembrane proteins, (ii) GCN5 family acetyltransferases, and (iii) hypothetical proteins of unknown function (homologous proteins are encoded by the gene cassettes of several class 1 integrons). Comparative sequence analyses identified three structural variants of these novel integron-like elements within the sequenced bacterial genomes. Analysis of their distribution revealed that they are found exclusively in strains of the genus Pseudomonas .

Antibiotic and antiseptic resistance genes are linked on a novel mobile genetic element: Tn6087

Science.gov (United States)

Ciric, Lena; Mullany, Peter; Roberts, Adam P.

2011-01-01

Objectives Tn916-like elements are one of the most common types of integrative and conjugative element (ICE). In this study we aimed to determine whether novel accessory genes, i.e. genes whose products are not involved in mobility or regulation, were present on a Tn916-like element (Tn6087) isolated from Streptococcus oralis from the human oral cavity. Methods A minocycline-resistant isolate was analysed using restriction fragment length polymorphism (RFLP) analysis on amplicons derived from Tn916 and DNA sequencing to determine whether there were genetic differences in Tn6087 compared with Tn916. Mutational analysis was used to determine whether the novel accessory gene found was responsible for an observed extra phenotype. Results A novel Tn916-like element, Tn6087, is described that encodes both antibiotic and antiseptic resistance. The antiseptic resistance protein is encoded by a novel small multidrug resistance gene, designated qrg, that was shown to encode resistance to cetyltrimethylammonium bromide (CTAB), also known as cetrimide bromide. Conclusions This is the first Tn916-like element described that confers both antibiotic and antiseptic resistance, suggesting that selection of either antibiotic or antiseptic resistance will also select for the other and further highlights the need for prudent use of both types of compound. PMID:21816764

Safety profile, efficacy, and biodistribution of a bicistronic high-capacity adenovirus vector encoding a combined immunostimulation and cytotoxic gene therapy as a prelude to a phase I clinical trial for glioblastoma

Energy Technology Data Exchange (ETDEWEB)

Puntel, Mariana [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Ghulam, Muhammad A.K.M. [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Farrokhi, Catherine [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); VanderVeen, Nathan; Paran, Christopher; Appelhans, Ashley [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Kroeger, Kurt M.; Salem, Alireza [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Lacayo, Liliana [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Pechnick, Robert N. [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Department of Psychiatry and Behavioral Neurosciences, David Geffen School of Medicine, University of California, Los Angeles, CA (United States); Kelson, Kyle R.; Kaur, Sukhpreet; Kennedy, Sean [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Palmer, Donna; Ng, Philip [Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030 (United States); and others

2013-05-01

Adenoviral vectors (Ads) are promising gene delivery vehicles due to their high transduction efficiency; however, their clinical usefulness has been hampered by their immunogenicity and the presence of anti-Ad immunity in humans. We reported the efficacy of a gene therapy approach for glioma consisting of intratumoral injection of Ads encoding conditionally cytotoxic herpes simplex type 1 thymidine kinase (Ad-TK) and the immunostimulatory cytokine fms-like tyrosine kinase ligand 3 (Ad-Flt3L). Herein, we report the biodistribution, efficacy, and neurological and systemic effects of a bicistronic high-capacity Ad, i.e., HC-Ad-TK/TetOn-Flt3L. HC-Ads elicit sustained transgene expression, even in the presence of anti-Ad immunity, and can encode large therapeutic cassettes, including regulatory elements to enable turning gene expression “on” or “off” according to clinical need. The inclusion of two therapeutic transgenes within a single vector enables a reduction of the total vector load without adversely impacting efficacy. Because clinically the vectors will be delivered into the surgical cavity, normal regions of the brain parenchyma are likely to be transduced. Thus, we assessed any potential toxicities elicited by escalating doses of HC-Ad-TK/TetOn-Flt3L (1 × 10{sup 8}, 1 × 10{sup 9}, or 1 × 10{sup 10} viral particles [vp]) delivered into the rat brain parenchyma. We assessed neuropathology, biodistribution, transgene expression, systemic toxicity, and behavioral impact at acute and chronic time points. The results indicate that doses up to 1 × 10{sup 9} vp of HC-Ad-TK/TetOn-Flt3L can be safely delivered into the normal rat brain and underpin further developments for its implementation in a phase I clinical trial for glioma. - Highlights: ► High capacity Ad vectors elicit sustained therapeutic gene expression in the brain. ► HC-Ad-TK/TetOn-Flt3L encodes two therapeutic genes and a transcriptional switch. ► We performed a dose escalation study at

Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.

Directory of Open Access Journals (Sweden)

Fang Liu

Full Text Available The productivity of maize (Zea mays L. depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59 were divided into seven groups (I-VII. By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses.

Different patterns of gene expression in rice varieties undergoing a ...

African Journals Online (AJOL)

Some genes specifically up-regulated in infected 9804-Rxo1 were defenserelated, including the genes encoding pathogenesis-related protein, terpene synthase family, transcription factors (TFs) AP2 domain containing protein, myb-like deoxyribonucleic acid (DNA)- binding domain containing protein, and C2H2-type ...

The fixABCX genes in Rhodospirillum rubrum encode a putative membrane complex participating in electron transfer to nitrogenase.

Science.gov (United States)

Edgren, Tomas; Nordlund, Stefan

2004-04-01

In our efforts to identify the components participating in electron transport to nitrogenase in Rhodospirillum rubrum, we used mini-Tn5 mutagenesis followed by metronidazole selection. One of the mutants isolated, SNT-1, exhibited a decreased growth rate and about 25% of the in vivo nitrogenase activity compared to the wild-type values. The in vitro nitrogenase activity was essentially wild type, indicating that the mutation affects electron transport to nitrogenase. Sequencing showed that the Tn5 insertion is located in a region with a high level of similarity to fixC, and extended sequencing revealed additional putative fix genes, in the order fixABCX. Complementation of SNT-1 with the whole fix gene cluster in trans restored wild-type nitrogenase activity and growth. Using Western blotting, we demonstrated that expression of fixA and fixB occurs only under conditions under which nitrogenase also is expressed. SNT-1 was further shown to produce larger amounts of both ribulose 1,5-bisphosphate carboxylase/oxygenase and polyhydroxy alkanoates than the wild type, indicating that the redox status is affected in this mutant. Using Western blotting, we found that FixA and FixB are soluble proteins, whereas FixC most likely is a transmembrane protein. We propose that the fixABCX genes encode a membrane protein complex that plays a central role in electron transfer to nitrogenase in R. rubrum. Furthermore, we suggest that FixC is the link between nitrogen fixation and the proton motive force generated in the photosynthetic reactions.

Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

Science.gov (United States)

Tzagoloff, A; Shtanko, A

1995-06-01

Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles.

Science.gov (United States)

Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai

2018-04-01

Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

Genomes of ubiquitous marine and hypersaline Hydrogenovibrio, Thiomicrorhabdus and Thiomicrospira spp. encode a diversity of mechanisms to sustain chemolithoautotrophy in heterogeneous environments.

Science.gov (United States)

Scott, Kathleen M; Williams, John; Porter, Cody M B; Russel, Sydney; Harmer, Tara L; Paul, John H; Antonen, Kirsten M; Bridges, Megan K; Camper, Gary J; Campla, Christie K; Casella, Leila G; Chase, Eva; Conrad, James W; Cruz, Mercedez C; Dunlap, Darren S; Duran, Laura; Fahsbender, Elizabeth M; Goldsmith, Dawn B; Keeley, Ryan F; Kondoff, Matthew R; Kussy, Breanna I; Lane, Marannda K; Lawler, Stephanie; Leigh, Brittany A; Lewis, Courtney; Lostal, Lygia M; Marking, Devon; Mancera, Paola A; McClenthan, Evan C; McIntyre, Emily A; Mine, Jessica A; Modi, Swapnil; Moore, Brittney D; Morgan, William A; Nelson, Kaleigh M; Nguyen, Kimmy N; Ogburn, Nicholas; Parrino, David G; Pedapudi, Anangamanjari D; Pelham, Rebecca P; Preece, Amanda M; Rampersad, Elizabeth A; Richardson, Jason C; Rodgers, Christina M; Schaffer, Brent L; Sheridan, Nancy E; Solone, Michael R; Staley, Zachery R; Tabuchi, Maki; Waide, Ramond J; Wanjugi, Pauline W; Young, Suzanne; Clum, Alicia; Daum, Chris; Huntemann, Marcel; Ivanova, Natalia; Kyrpides, Nikos; Mikhailova, Natalia; Palaniappan, Krishnaveni; Pillay, Manoj; Reddy, T B K; Shapiro, Nicole; Stamatis, Dimitrios; Varghese, Neha; Woyke, Tanja; Boden, Rich; Freyermuth, Sharyn K; Kerfeld, Cheryl A

2018-03-09

Chemolithoautotrophic bacteria from the genera Hydrogenovibrio, Thiomicrorhabdus and Thiomicrospira are common, sometimes dominant, isolates from sulfidic habitats including hydrothermal vents, soda and salt lakes and marine sediments. Their genome sequences confirm their membership in a deeply branching clade of the Gammaproteobacteria. Several adaptations to heterogeneous habitats are apparent. Their genomes include large numbers of genes for sensing and responding to their environment (EAL- and GGDEF-domain proteins and methyl-accepting chemotaxis proteins) despite their small sizes (2.1-3.1 Mbp). An array of sulfur-oxidizing complexes are encoded, likely to facilitate these organisms' use of multiple forms of reduced sulfur as electron donors. Hydrogenase genes are present in some taxa, including group 1d and 2b hydrogenases in Hydrogenovibrio marinus and H. thermophilus MA2-6, acquired via horizontal gene transfer. In addition to high-affinity cbb 3 cytochrome c oxidase, some also encode cytochrome bd-type quinol oxidase or ba 3 -type cytochrome c oxidase, which could facilitate growth under different oxygen tensions, or maintain redox balance. Carboxysome operons are present in most, with genes downstream encoding transporters from four evolutionarily distinct families, which may act with the carboxysomes to form CO 2 concentrating mechanisms. These adaptations to habitat variability likely contribute to the cosmopolitan distribution of these organisms. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

Molecular characterization of a fungal gene paralogue of the penicillin penDE gene of Penicillium chrysogenum

Science.gov (United States)

2009-01-01

Background Penicillium chrysogenum converts isopenicillin N (IPN) into hydrophobic penicillins by means of the peroxisomal IPN acyltransferase (IAT), which is encoded by the penDE gene. In silico analysis of the P. chrysogenum genome revealed the presence of a gene, Pc13g09140, initially described as paralogue of the IAT-encoding penDE gene. We have termed this gene ial because it encodes a protein with high similarity to IAT (IAL for IAT-Like). We have conducted an investigation to characterize the ial gene and to determine the role of the IAL protein in the penicillin biosynthetic pathway. Results The IAL contains motifs characteristic of the IAT such as the processing site, but lacks the peroxisomal targeting sequence ARL. Null ial mutants and overexpressing strains indicated that IAL lacks acyltransferase (penicillin biosynthetic) and amidohydrolase (6-APA forming) activities in vivo. When the canonical ARL motif (leading to peroxisomal targeting) was added to the C-terminus of the IAL protein (IALARL) by site-directed mutagenesis, no penicillin biosynthetic activity was detected. Since the IAT is only active after an accurate self-processing of the preprotein into α and β subunits, self-processing of the IAL was tested in Escherichia coli. Overexpression experiments and SDS-PAGE analysis revealed that IAL is also self-processed in two subunits, but despite the correct processing, the enzyme remained inactive in vitro. Conclusion No activity related to the penicillin biosynthesis was detected for the IAL. Sequence comparison among the P. chrysogenum IAL, the A. nidulans IAL homologue and the IAT, revealed that the lack of enzyme activity seems to be due to an alteration of the essential Ser309 in the thioesterase active site. Homologues of the ial gene have been found in many other ascomycetes, including non-penicillin producers. Our data suggest that like in A. nidulans, the ial and penDE genes might have been formed from a single ancestral gene that became

Fungi unearthed: transcripts encoding lignocellulolytic and chitinolytic enzymes in forest soil.

Directory of Open Access Journals (Sweden)

Harald Kellner

Full Text Available BACKGROUND: Fungi are the main organisms responsible for the degradation of biopolymers such as lignin, cellulose, hemicellulose, and chitin in forest ecosystems. Soil surveys largely target fungal diversity, paying less attention to fungal activity. METHODOLOGY/PRINCIPAL FINDINGS: Here we have focused on the organic horizon of a hardwood forest dominated by sugar maple that spreads widely across Eastern North America. The sampling site included three plots receiving normal atmospheric nitrogen deposition and three that received an extra 3 g nitrogen m(2 y(1 in form of sodium nitrate pellets since 1994, which led to increased accumulation of organic matter in the soil. Our aim was to assess, in samples taken from all six plots, transcript-level expression of fungal genes encoding lignocellulolytic and chitinolytic enzymes. For this we collected RNA from the forest soil, reverse-transcribed it, and amplified cDNAs of interest, using both published primer pairs as well as 23 newly developed ones. We thus detected transcript-level expression of 234 genes putatively encoding 26 different groups of fungal enzymes, notably major ligninolytic and diverse aromatic-oxidizing enzymes, various cellulose- and hemicellulose-degrading glycoside hydrolases and carbohydrate esterases, enzymes involved in chitin breakdown, N-acetylglucosamine metabolism, and cell wall degradation. Among the genes identified, 125 are homologous to known ascomycete genes and 105 to basidiomycete genes. Transcripts corresponding to all 26 enzyme groups were detected in both control and nitrogen-supplemented plots. CONCLUSIONS/SIGNIFICANCE: Many of these enzyme groups are known to be important in soil turnover processes, but the contribution of some is probably underestimated. Our data highlight the importance of ascomycetes, as well as basidiomycetes, in important biogeochemical cycles. In the nitrogen-supplemented plots, we have detected no transcript-level gap likely to explain

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds.

Science.gov (United States)

de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap

2002-04-15

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.

Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

Directory of Open Access Journals (Sweden)

Hongle Xu

Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

Science.gov (United States)

Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

2015-12-01

In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

Directory of Open Access Journals (Sweden)

Royah Vaezi

2013-12-01

Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

Envelope-like retrotransposons in the plant kingdom: evidence of their presence in gymnosperms (Pinus pinaster).

Science.gov (United States)

Miguel, Célia; Simões, Marta; Oliveira, Maria Margarida; Rocheta, Margarida

2008-11-01

Retroviruses differ from retrotransposons due to their infective capacity, which depends critically on the encoded envelope. Some plant retroelements contain domains reminiscent of the env of animal retroviruses but the number of such elements described to date is restricted to angiosperms. We show here the first evidence of the presence of putative env-like gene sequences in a gymnosperm species, Pinus pinaster (maritime pine). Using a degenerate primer approach for conserved domains of RNaseH gene, three clones from putative envelope-like retrotransposons (PpRT2, PpRT3, and PpRT4) were identified. The env-like sequences of P. pinaster clones are predicted to encode proteins with transmembrane domains. These sequences showed identity scores of up to 30% with env-like sequences belonging to different organisms. A phylogenetic analysis based on protein alignment of deduced aminoacid sequences revealed that these clones clustered with env-containing plant retrotransposons, as well as with retrotransposons from invertebrate organisms. The differences found among the sequences of maritime pine clones isolated here suggest the existence of different putative classes of env-like retroelements. The identification for the first time of env-like genes in a gymnosperm species may support the ancestrality of retroviruses among plants shedding light on their role in plant evolution.