DEFF Research Database (Denmark)
Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.
2002-01-01
The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...
Rato, Márcia G.; Nerlich, Andreas; Bergmann, René; Bexiga, Ricardo; Nunes, Sandro F.; Vilela, Cristina L.; Santos-Sanches, Ilda; Chhatwal, Gursharan S.
2011-01-01
A custom-designed microarray containing 220 virulence genes of Streptococcus pyogenes (group A Streptococcus [GAS]) was used to test group C Streptococcus dysgalactiae subsp. dysgalactiae (GCS) field strains causing bovine mastitis and group C or group G Streptococcus dysgalactiae subsp. equisimilis (GCS/GGS) isolates from human infections, with the latter being used for comparative purposes, for the presence of virulence genes. All bovine and all human isolates carried a fraction of the 220 genes (23% and 39%, respectively). The virulence genes encoding streptolysin S, glyceraldehyde-3-phosphate dehydrogenase, the plasminogen-binding M-like protein PAM, and the collagen-like protein SclB were detected in the majority of both bovine and human isolates (94 to 100%). Virulence factors, usually carried by human beta-hemolytic streptococcal pathogens, such as streptokinase, laminin-binding protein, and the C5a peptidase precursor, were detected in all human isolates but not in bovine isolates. Additionally, GAS bacteriophage-associated virulence genes encoding superantigens, DNase, and/or streptodornase were detected in bovine isolates (72%) but not in the human isolates. Determinants located in non-bacteriophage-related mobile elements, such as the gene encoding R28, were detected in all bovine and human isolates. Several virulence genes, including genes of bacteriophage origin, were shown to be expressed by reverse transcriptase PCR (RT-PCR). Phylogenetic analysis of superantigen gene sequences revealed a high level (>98%) of identity among genes of bovine GCS, of the horse pathogen Streptococcus equi subsp. equi, and of the human pathogen GAS. Our findings indicate that alpha-hemolytic bovine GCS, an important mastitis pathogen and considered to be a nonhuman pathogen, carries important virulence factors responsible for virulence and pathogenesis in humans. PMID:21525223
Genetic diversity and virulence genes in Streptococcus uberis strains isolated from bovine mastitis
Directory of Open Access Journals (Sweden)
Rafael Ambrósio Loures
2017-08-01
Full Text Available Mastitis is one of the most common and costly infectious diseases in dairy cattle worldwide. This is a multifactorial illness caused by different microorganisms, including virus, yeasts, algae, parasites, and several species of bacteria. Among these bacteria, Streptococcus uberis is an important environmental pathogen that is responsible for a large range of clinical and subclinical mammary infections, especially in intensively managed herds. Despite the increasing importance of this pathogen in the etiology of bovine mastitis, data on its virulence and diversity in Brazilian dairy herds are scarce. The aims of the present study were to investigate the virulence characteristics of S. uberis isolated from bovine mastitis and to assess the molecular epidemiology of the Brazilian isolates using pulsed-field gel electrophoresis (PFGE. In this work, 46 strains of S. uberis isolated from bovine mastitis from 26 Brazilian dairy herds were evaluated regarding their genetic diversity by PFGE using with the SmaI enzyme. Additionally, the presence of the virulence genes skc and pauA, which encode plasminogen activators, and the gene sua, which encodes an adhesion molecule in mammary epithelial cells, were assessed by PCR. Our results showed a high genetic diversity in the population, displaying many different patterns in the PFGE analysis. A high proportion of strains was positive for virulence genes in the sampled population (sua [100%], pauA [91%], and skc [91%]. The high frequency of skc, pauA, and sua genes among the studied strains suggests the importance of these virulence factors, possibly helping S. uberis in the colonization of the bovine mammary gland. Surveys of the genetic and molecular characteristics of this pathogen can improve our knowledge of bacterial activity and identify molecules that have roles in the establishment of the infection. This might help in the development of more effective measures to control and prevent bovine mastitis.
Disruption of the 37-kDa/67-kDa laminin receptor gene in bovine ...
African Journals Online (AJOL)
... gene encoding for the prion binding site in bovine fetal fibroblasts. The heterozygous BFF are ready to be used in producing homozygous cattle, which will be applied to study the interaction between prion and the 37-kDa/67-kDa LRP/LR. Key words: Prion, PrPC, PrPSc, 37-kDa/67-kDa laminin receptor, gene targeting.
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Mutational and Evolutionary Analyses of Bovine Reprimo Gene ...
African Journals Online (AJOL)
It can therefore be concluded that bovine RPRM gene contained 4 transition mutations and 5 indels that can be used in marker assisted selection. Evolutionary findings also demonstrated the existence of a divergent evolution between bovine RPRM gene and RPRM gene of fishes and frog. Keywords: Identity, phylogeny ...
Directory of Open Access Journals (Sweden)
Murat Karahan, Mehmet Nuri Acik1* and Burhan Cetinkaya
2011-06-01
Full Text Available The aim of the present study was to characterize coagulase (coa positive Staphylococcus aureus strains (n=92 isolated from bovine subclinical mastitis in Turkey by PCR amplification of clumping factor A (clfA and protein A (spa genes. All the coa-positive S. aureus isolates were determined to harbor the genes encoding the IgG binding region (spa-IgG and the X region (spa-X of spa. On the other hand, 84 (91.3% isolates were positive for clfA gene. These three genes displayed size polymorphisms. It was concluded that spa gene polymorphisms for S. aureus, when used together with coa-PCR, can be proposed as good alternatives to conventional methods in typing S. aureus isolates of bovine origin which may provide valuable data for the development of effective control strategies against staphylococcal mastitis. The results of the present study showed that S. aureus isolates responsible for the mastitis cases in Turkey were genetically diverse.
Mapping and polymorphism of bovine ghreline gene
Colinet, Frédéric; Eggen, André; Halleux, Caroline; Arnould, Valérie; Portetelle, Daniel; Renaville, Robert
2006-01-01
Bovine ghrelin, a 27-amino-acid peptide has been identified in bovine oxyntic glands of the abomasum. It is an endogenous growth hormone secretagogue. Total mRNA was extracted from abomasum and complete ghrelin mRNA was sequenced by rapid amplification of cDNA ends. The gene contains five exons and four introns with a short noncoding first exon of 17 bp similar to mouse and human ghrelin gene. Using a radiation hybrid panel, the gene was mapped to chromosome 22 near microsat...
Impairments of mecA gene detection in bovine Staphylococcus spp.
Directory of Open Access Journals (Sweden)
Dayanne Araújo de Melo
2014-09-01
Full Text Available Staphylococcus aureus antimicrobial resistance, especially to beta-lactams, favors treatment failures and its persistence in herd environment. This work aimed to develop a more specific primer for mecA gene detection based on the comparison of the conserved regions from distinct host origins and also investigated the presence of homologue mecA LGA251 in bovine strains. A total of 43 Staphylococcus spp. were included in this study, comprising 38 bovine S. aureus, two human and three equine coagulase-negative staphylococci (CNS. Phenotypical methicillin-resistance detection was performed through oxacillin agar-screening and cefoxitin disk-diffusion test. None isolate tested positive for mecA LGA251 gene. For mecA gene PCR, new primers were designed based on the sequences of human S. aureus (HE681097 and bovine S. sciuri (AY820253 mecA. The new primers based on the S. aureus mecA sequence amplified fragments of human and equine CNS and the ones based on S. sciuri mecA sequence only yielded fragments for S. aureus bovine strains. Multiples alignments of mecA gene sequences from bovine, human and equine revealed punctual but significant differences in bovine strains that can lead to the mecA gene detection impairment. The observed divergences of mecA gene sequences are not a matter of animal or human origin, it is a specificity of bovine samples.
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
CRISPR/Cas9 nuclease-mediated gene knock-in in bovine-induced pluripotent cells.
Heo, Young Tae; Quan, Xiaoyuan; Xu, Yong Nan; Baek, Soonbong; Choi, Hwan; Kim, Nam-Hyung; Kim, Jongpil
2015-02-01
Efficient and precise genetic engineering in livestock such as cattle holds great promise in agriculture and biomedicine. However, techniques that generate pluripotent stem cells, as well as reliable tools for gene targeting in livestock, are still inefficient, and thus not routinely used. Here, we report highly efficient gene targeting in the bovine genome using bovine pluripotent cells and clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 nuclease. First, we generate induced pluripotent stem cells (iPSCs) from bovine somatic fibroblasts by the ectopic expression of yamanaka factors and GSK3β and MEK inhibitor (2i) treatment. We observed that these bovine iPSCs are highly similar to naïve pluripotent stem cells with regard to gene expression and developmental potential in teratomas. Moreover, CRISPR/Cas9 nuclease, which was specific for the bovine NANOG locus, showed highly efficient editing of the bovine genome in bovine iPSCs and embryos. To conclude, CRISPR/Cas9 nuclease-mediated homologous recombination targeting in bovine pluripotent cells is an efficient gene editing method that can be used to generate transgenic livestock in the future.
LENUS (Irish Health Repository)
Whan, Vicki
2010-11-23
Abstract Background About forty human diseases are caused by repeat instability mutations. A distinct subset of these diseases is the result of extreme expansions of polymorphic trinucleotide repeats; typically CAG repeats encoding poly-glutamine (poly-Q) tracts in proteins. Polymorphic repeat length variation is also apparent in human poly-Q encoding genes from normal individuals. As these coding sequence repeats are subject to selection in mammals, it has been suggested that normal variations in some of these typically highly conserved genes are implicated in morphological differences between species and phenotypic variations within species. At present, poly-Q encoding genes in non-human mammalian species are poorly documented, as are their functions and propensities for polymorphic variation. Results The current investigation identified 178 bovine poly-Q encoding genes (Q ≥ 5) and within this group, 26 genes with orthologs in both human and mouse that did not contain poly-Q repeats. The bovine poly-Q encoding genes typically had ubiquitous expression patterns although there was bias towards expression in epithelia, brain and testes. They were also characterised by unusually large sizes. Analysis of gene ontology terms revealed that the encoded proteins were strongly enriched for functions associated with transcriptional regulation and many contributed to physical interaction networks in the nucleus where they presumably act cooperatively in transcriptional regulatory complexes. In addition, the coding sequence CAG repeats in some bovine genes impacted mRNA splicing thereby generating unusual transcriptional diversity, which in at least one instance was tissue-specific. The poly-Q encoding genes were prioritised using multiple criteria for their likelihood of being polymorphic and then the highest ranking group was experimentally tested for polymorphic variation within a cattle diversity panel. Extensive and meiotically stable variation was identified
Targeting the human lysozyme gene on bovine αs1- casein gene ...
African Journals Online (AJOL)
Targeting an exogenous gene into a favorable gene locus and for expression under endogenous regulators is an ideal method in mammary gland bioreactor research. For this purpose, a gene targeting vector was constructed to targeting the human lysozyme gene on bovine αs1-casein gene locus. In this case, the ...
Comparison of bovine lymphocyte antigen DRB3.2 allele ...
African Journals Online (AJOL)
STORAGESEVER
2008-08-04
Aug 4, 2008 ... The bovine lymphocyte antigen (BoLA-DRB3) gene encodes cell ... alleles were more resistant to clinical mastitis. ... DRB3.2 allele pattern in two Iranian Holstein cow .... observed and the number of immune parameters with.
Novel SNPs polymorphism of bovine CACNA2D1 gene and their ...
African Journals Online (AJOL)
In this study, the bovine CACNA2D1 gene was taken as a candidate gene for mastitis resistance. The objective of this study was to identify single nucleotide polymorphisms (SNPs) in the bovine CACNA2D1 gene and evaluate the association of these SNPs with mastitis in cattle. Through DNA sequencing and PCR-RFLP ...
Structure and regulated expression of bovine prolactin and bovine growth hormone genes
International Nuclear Information System (INIS)
Rottman, F.; Camper, S.; Goodwin, E.; Hampson, R.; Lyons, R.
1986-01-01
This paper presents a description of several studies which utilize the transfection of cloned chimeric genes in an attempt to analyze the regulatory signals found in the bPRL and bGH genes. Examination of 5' flanking region of PRL genes reveals a high degree of sequence homology between the bovine, human, and rat species. In order to assess the existence of possible regulatory sequences in a more direct manner, the authors transfected homologous and heterologous cells with chimeric gene constructs containing possible regulatory sequences derived from both the bPRL and bGH genes. An analysis is presented of the polyadenylation signal contained in the bGH 3' flanking sequence
O'Riordan, N; O'Callaghan, J; Buttò, L F; Kilcoyne, M; Joshi, L; Hickey, R M
2018-05-23
Bovine milk glycomacropeptide (GMP) is derived from κ-casein, with exclusively o-linked glycosylation. Glycomacropeptide promoted the growth of Bifidobacterium longum ssp. infantis in a concentration-dependent manner, and this activity was lost following periodate treatment of the GMP (GMP-P), which disables biological recognition of the conjugated oligosaccharides. Transcriptional analysis of B. longum ssp. infantis following exposure to GMP revealed a substantial response to GMP relative to bacteria treated with GMP-P, with a greater number of differentially expressed transcripts and larger fold changes versus the control. Therefore, stimulation of B. longum ssp. infantis growth by GMP is intrinsically linked to the peptide's O-linked glycosylation. The pool of differentially expressed transcripts included 2 glycoside hydrolase (family 25) genes, which were substantially upregulated following exposure to GMP, but not GMP-P. These GH25 genes were present in duplicated genomic islands that also contained genes encoding fibronectin type III binding domain proteins and numerous phage-related proteins, all of which were also upregulated. Homologs of this genomic arrangement were present in other Bifidobacterium species, which suggest it may be a conserved domain for the utilization of glycosylated peptides. This study provides insights into the molecular basis for the prebiotic effect of bovine milk GMP on B. longum ssp. infantis. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Prevalence of coagulase gene polymorphism in Staphylococcus aureus isolates causing bovine mastitis
DEFF Research Database (Denmark)
Aarestrup, Frank Møller; Dangler, C. A.; Sordillo, L. M.
1995-01-01
This study was conducted to investigate polymorphism of the coagulase gene of Staphylococcus aureus causing bovine mastitis. One hundred eighty-seven strains of S. aureus were isolated from bovine mastitic milk samples obtained from 187 different Danish dairy farms. The isolates were characterised......% of the isolates. The ease of analysing coagulase gene polymorphisms among a large number of strains, and the multiple distinct polymorphic patterns generated, supports the use of this technique in epidemiological investigations of bovine mastitis. The predominating variants may have predelection for causing...
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Directory of Open Access Journals (Sweden)
Mullen Michael P
2011-01-01
Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs
DEFF Research Database (Denmark)
Aarestrup, Frank Møller; Larsen, H.D.; Eriksen, N.H.R.
1999-01-01
The phenotypic expression of haemolysins and the presence of genes encoding alpha and beta-haemolysin were determined in 105 Sraphylococcus aureus isolates from bovine mastitis, 100 isolates from the nostrils of healthy humans, and 60 isolates from septicaemia in humans. Furthermore, the possible...... change in expression of haemolysins after subcultivation in human and bovine blood and milk was studied in selected isolates. alpha-haemolysin was expressed phenotypically in 39 (37%) of the bovine isolates, in 59 (59%) of the human carrier isolates, and in 40 (67%) of the isolates from septicaemia. beta......-haemolysin was expressed in 76 (72%) bovine, 11 (11%) carrier, and 8 (13%) septicaemia isolates. Significantly more bovine than human isolates expressed beta-haemolysin and significantly fewer expressed alpha-haemolysin. Genotypically, the gene encoding alpha-haemolysin was detected in all isolates. A significant...
Directory of Open Access Journals (Sweden)
Patel Osman V
2009-03-01
Full Text Available Abstract Background Bovine trophoblast binucleate cells (BNC express a plethora of molecules including bovine placental lactogen (bPL, gene name is bCSH1 and bovine prolactin-related protein-1 (bPRP1. BCSH1 and bPRP1 are members of the growth hormone (GH/prolactin (PRL gene family, which are expressed simultaneously in BNC and are central to placentation and the progression of pregnancy in cattle. However, there is a paucity of information on the transcriptional regulatory mechanisms of both the bCSH1 and bPRP1 genes. Recent studies, however, have demonstrated that the expression of a number of genes is controlled by the methylation status of their promoter region. In the present study, we examined the cell-type-specific epigenetic alterations of the 5'-flanking region of the bCSH1 and bPRP1 genes to gain an insight into their regulatory mechanisms. Results Analysis of 5-aza-2'-deoxycytidine treatment demonstrated that bCSH1 expression is moderately induced in fibroblast cultures but enhanced in BT-1 cells. Sodium bisulfite based sequencing revealed that bCSH1 is hypomethylated in the cotyledonary tissue but not in the fetal skin, and this pattern was not altered with the progression of pregnancy. On the other hand, the methylation status of bPRP1 was similar between the cotyledon and fetal skin. The bPRP1 gene was exclusively hypermethylated in a bovine trophoblast cell-derived BT-1 cell-line. While the activity of bCSH1 was similar in both BT-1 and bovine fibroblast cells, that of bPRP1 was specific to BT-1. Treatment with a demethylating agent and luciferase assays provided in vitro evidence of the positive regulation of bCSH1 but not bPRP1. Conclusion This is the first report to identify the differential regulatory mechanisms of the bCSH1 and bPRP1 genes and indicates that bCSH1 might potentially be the only transcript that is subject to DNA methyltransferase regulation. The data indicates the possibility of novel kinetics of induction of
Expression of the CTCF gene in bovine oocytes and preimplantation embryos
Directory of Open Access Journals (Sweden)
Álvaro F.L. Rios
2007-01-01
Full Text Available The CCCTC - binding factor (CTCF is a protein involved in repression, activation, hormone-inducible gene silencing, functional reading of imprinted genes and X-chromosome inactivation. We analyzed CTCF gene expression in bovine peripheral blood, oocytes and in different cellular stages (2-4 cells, 8-16 cells, 16-32 cells, morulae, and blastocysts of in vitro fertilized embryos. This is the first report of CTCF expression in oocytes and preimplantation bovine embryos and has implications for the production of embryonic stem cells and the development of novel medical technologies for humans.
Directory of Open Access Journals (Sweden)
Valentina Monistero
2018-06-01
Full Text Available Staphylococcus aureus is recognized worldwide as one of the major agents of dairy cow intra-mammary infections. This microorganism can express a wide spectrum of pathogenic factors used to attach, colonize, invade and infect the host. The present study evaluated 120 isolates from eight different countries that were genotyped by RS-PCR and investigated for 26 different virulence factors to increase the knowledge on the circulating genetic lineages among the cow population with mastitis. New genotypes were observed for South African strains while for all the other countries new variants of existing genotypes were detected. For each country, a specific genotypic pattern was found. Among the virulence factors, fmtB, cna, clfA and leucocidins genes were the most frequent. The sea and sei genes were present in seven out of eight countries; seh showed high frequency in South American countries (Brazil, Colombia, Argentina, while sel was harboured especially in one Mediterranean country (Tunisia. The etb, seb and see genes were not detected in any of the isolates, while only two isolates were MRSA (Germany and Italy confirming the low diffusion of methicillin resistance microorganism among bovine mastitis isolates. This work demonstrated the wide variety of S. aureus genotypes found in dairy cattle worldwide. This condition suggests that considering the region of interest might help to formulate strategies for reducing the infection spreading.
Analysis of the expression of putatively imprinted genes in bovine peri-implantation embryos
DEFF Research Database (Denmark)
Tveden-Nyborg, Pernille Yde; Alexopoulos, N.I.; Cooney, M.A.
2008-01-01
The application of assisted reproductive technologies (ART) has been shown to induce changes in the methylation of the embryonic genome, leading to aberrant gene expression, including that of imprinted genes. Aberrant methylation and gene expression has been linked to the large offspring syndrome...... (LOS) in bovine embryos resulting in increased embryonic morbidity and mortality. In the bovine, limited numbers of imprinted genes have been studied and studies have primarily been restricted to pre-implantation stages. This study reports original data on the expression pattern of 8 putatively...... imprinted genes (Ata3, Dlk1, Gnas, Grb10, Magel2, Mest-1, Ndn and Sgce) in bovine peri-implantation embryos. Two embryonic developmental stages were examined, Day 14 and Day 21. The gene expression pattern of single embryos was recorded for in vivo, in vitro produced (IVP) and parthenogenetic embryos...
Genes involved in bovine milk-fat composition
Schennink, A.
2009-01-01
The aim of the research described in this thesis was to identify genes that underlie the genetic variation in bovine milk-fat composition. The fat composition of milk samples from approximately 2,000 Dutch Holstein Friesian cows in their first lactation was measured by gas chromatography.
Characterization and regulation of the bovine stearoyl-CoA desaturase gene promoter
International Nuclear Information System (INIS)
Keating, Aileen F.; Kennelly, John J.; Zhao Fengqi
2006-01-01
The bovine stearoyl-CoA desaturase (Scd) gene plays an important role in the bovine mammary gland where substrates such as stearic and vaccenic acids are converted to oleic acid and conjugated linoleic acid (CLA), respectively. Up to 90% of the CLA in bovine milk is formed due to the action of this enzyme in the mammary gland. The areas of the bovine promoter of importance in regulating this key enzyme were examined and an area of 36 bp in length was identified as having a critical role in transcriptional activation and is designated the Scd transcriptional enhancer element (STE). Electrophoretic mobility shift assay detected three binding complexes on this area in Mac-T cell nuclear extracts. Treatment of cells with CLA caused a significant reduction in transcriptional activity, with this effect being mediated through the STE region. The bovine Scd gene promoter was up-regulated by insulin and down-regulated by oleic acid
Directory of Open Access Journals (Sweden)
Zharkikh Andrey A
2006-09-01
Full Text Available Abstract The structures of the canine, rabbit, bovine and equine EIF2AK2 genes were determined. Each of these genes has a 5' non-coding exon as well as 15 coding exons. All of the canine, bovine and equine EIF2AK2 introns have consensus donor and acceptor splice sites. In the equine EIF2AK2 gene, a unique single nucleotide polymorphism that encoded a Tyr329Cys substitution was detected. Regulatory elements predicted in the promoter region were conserved in ungulates, primates, rodents, Afrotheria (elephant and Insectifora (shrew. Western clawed frog and fugu EIF2AK2 gene sequences were detected in the USCS Genome Browser and compared to those of other vertebrate EIF2AK2 genes. A comparison of EIF2AK2 protein domains in vertebrates indicates that the kinase catalytic domains were evolutionarily more conserved than the nucleic acid-binding motifs. Nucleotide substitution rates were uniform among the vertebrate sequences with the exception of the zebrafish and goldfish EIF2AK2 genes, which showed substitution rates about 20% higher than those of other vertebrates. FISH was used to physically assign the horse and cattle genes to chromosome locations, ECA15q24–q25 and BTA11q12–15, respectively. Comparative mapping data confirmed conservation of synteny between ungulates, humans and rodents.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Detection of toxic shock toxin (tst gene in Staphylococcus aureus isolated from bovine milk samples
Directory of Open Access Journals (Sweden)
S. Baniardalan
2017-09-01
Full Text Available Staphylococcus aureus is a major causative pathogen of clinical and subclinical mastitis in dairy cattle all over the world. This agent produces a variety of extracellular toxins and virulence factors in-cluding toxic shock syndrome toxin-1 (TSST-1 which is the major cause of toxic shock syndrome (TSS. In the present study, 76 S. aureus isolates have been obtained from milk samples collected from 7 dairy herds in Hamedan province of Iran. The isolates were identified based on the biochemical and molecular methods using PCR amplification of the femA gene. The staphylococcal isolates were also examined for the presence of TSST-1 (tst encoding gene. This gene was detected in only one S. aureus isolate (1.3%. The results revealed that S. aureus strains causing bovine mastitis may potentially produce staphylococcal toxic shock syndrome toxin-1, indicating that it is very important to follow the presence of TSST-1 producing S. aureus isolates in foodstuffs to protect consumers against the risk of toxic shock syndrome
Directory of Open Access Journals (Sweden)
Dastmalchi Saei, H.
2014-11-01
Full Text Available Coagulase-negative staphylococci (CoNS are often associated with bovine mastitis and may be resistant to antimicrobial therapy. The aim of the current study was to investigate the presence of blaZ (responsible for penicillin resistance and mecA (responsible for methicillin resistance genes among 108 CoNS belonging to 9 different species isolated from bovine mastitis in seven dairy herds (H1-H7. Of 108 CoNS isolates, 44 were Staphylococcus haemolyticus, 17 S. chromogenes, 11 S. epidermidis, 11 S. warneri, 11 S. cohnii, 6 S. simulans, 4 S. hominis, 3 S. capitis, and 1 S. xylosus. The blaZ was detected in 65.7% (n=71 of all Staphylococcus spp. isolates. Five isolates were positive for the presence of mecA gene (4.6%, including 2 S. hominis, 1 S. haemolyticus, 1 S. epidermidis, and 1 S. warneri. All mecA-carrying CoNS were also positive for the blaZ gene and were recovered from two studied herds (H3 and H6. Some variations were also observed in distribution of both blaZ and mecA genes between CoNS species. This study demonstrates that CoNS from bovine mastitis can be reservoirs of blaZ gene. This study also provides evidence of the presence of methicillin resistant CoNS (MR-CoNS and emphasizes the need for their epidemiological monitoring, in order to prevent the risk of spread to human through direct contact and/or consumption of contaminated food.
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
Franzin, Alessandra Mara; Maruyama, Sandra Regina; Garcia, Gustavo Rocha; Oliveira, Rosane Pereira; Ribeiro, José Marcos Chaves; Bishop, Richard; Maia, Antônio Augusto Mendes; Moré, Daniela Dantas; Ferreira, Beatriz Rossetti; Santos, Isabel Kinney Ferreira de Miranda
2017-01-31
Ticks attach to and penetrate their hosts' skin and inactivate multiple components of host responses in order to acquire a blood meal. Infestation loads with the cattle tick, Rhipicephalus microplus, are heritable: some breeds carry high loads of reproductively successful ticks, whereas in others, few ticks feed and reproduce efficiently. In order to elucidate the mechanisms that result in the different outcomes of infestations with cattle ticks, we examined global gene expression and inflammation induced by tick bites in skins from one resistant and one susceptible breed of cattle that underwent primary infestations with larvae and nymphs of R. microplus. We also examined the expression profiles of genes encoding secreted tick proteins that mediate parasitism in larvae and nymphs feeding on these breeds. Functional analyses of differentially expressed genes in the skin suggest that allergic contact-like dermatitis develops with ensuing production of IL-6, CXCL-8 and CCL-2 and is sustained by HMGB1, ISG15 and PKR, leading to expression of pro-inflammatory chemokines and cytokines that recruit granulocytes and T lymphocytes. Importantly, this response is delayed in susceptible hosts. Histopathological analyses of infested skins showed inflammatory reactions surrounding tick cement cones that enable attachment in both breeds, but in genetically tick-resistant bovines they destabilized the cone. The transcription data provided insights into tick-mediated activation of basophils, which have previously been shown to be a key to host resistance in model systems. Skin from tick-susceptible bovines expressed more transcripts encoding enzymes that detoxify tissues. Interestingly, these enzymes also produce volatile odoriferous compounds and, accordingly, skin rubbings from tick-susceptible bovines attracted significantly more tick larvae than rubbings from resistant hosts. Moreover, transcripts encoding secreted modulatory molecules by the tick were significantly more
Generation of Active Bovine Terminal Deoxynucleotidyl Transferase (TdT in E.coli
Directory of Open Access Journals (Sweden)
Wee Liang Kuan
2010-08-01
Full Text Available A synthetic gene encoding bovine terminal deoxynucleotidyl transferase (TdT was generated, cloned into an expression vector and expressed in E.coli. The effects of altering culture and induction conditions on the nature of recombinant protein production were investigated. This led to the expression of active recombinant bovine TdT in E.coli. After purification and characterisation, the activity of the enzyme was assessed in a biological assay for apoptosis. The process described in this report enables the economical production of TdT for high throughput applications.
Generation of Active Bovine Terminal Deoxynucleotidyl Transferase (TdT in E.coli
Directory of Open Access Journals (Sweden)
Wee Liang Kuan
2010-01-01
Full Text Available A synthetic gene encoding bovine terminal deoxynucleotidyl transferase (TdT was generated, cloned into an expression vector and expressed in E.coli. The effects of altering culture and induction conditions on the nature of recombinant protein production were investigated. This led to the expression of active recombinant bovine TdT in E.coli. After purification and characterisation, the activity of the enzyme was assessed in a biological assay for apoptosis. The process described in this report enables the economical production of TdT for high throughput applications.
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Wang, Dong; Zhang, Limei; Yong, Changfu; Shen, Mingliang; Ali, Tariq; Shahid, Muhammad; Han, Kun; Zhou, Xuezhang; Han, Bo
2017-06-01
Staphylococcus aureus is one of the major etiological agents of bovine mastitis, harboring a wide variety of staphylococcal superantigen (SAg) toxin genes. The SAg toxin genes are reported to be closely associated with the pathogenicity of the Staph. aureus causing the bovine mastitis. This study was conducted to investigate SAg toxin gene profiles and to assess the relationships among SAg toxin genes, genotypes of Staph. aureus, and their pathogenic properties. A total of 327 quarter milk samples were collected from bovine mastitis cases for isolation and identification of pathogens. In total, 35 isolates were identified as Staph. aureus, and the prevalence of Staph. aureus in milk samples was 13.6% (35/256). Polymerase chain reaction (PCR) and randomly amplified polymorphic DNA (RAPD) assays were used to detect the SAg toxin genes and to genotype Staph. aureus strains isolated from milk samples of bovine mastitis in 10 dairy herds located in Ningxia, China, respectively. The results showed that among the Staph. aureus isolates (n = 35), 71.4% (n = 25) of isolates carried at least one SAg toxin gene. In total, 18 SAg genes and 21 different gene combination patterns were detected among these isolates. The most common SAg genes in Staph. aureus isolates were sei, sen, and seu (44.0% each), followed by seo, tst, and etB (28.0% each), etA (24.0%), sem and sep (16.0% each), seb, sec, sed, and sek (12.0% each), and sea and seh genes (8.0% each); the seg, sej, and ser genes were present in 4.0% of the isolates. Three gene combinations were found to be related to mobile genetic elements that carried 2 or more genes. The egc-cluster of the seg-sei-sem-sen-seo genes, located on the pathogenicity island Type I υSaβ, was detected in 16% of isolates. Interestingly, we observed 6 RAPD genotypes (I to VI) in Staph. aureus isolates, and 2 of these genotypes were strongly associated with the severity of bovine mastitis; there was a close relationship between the RAPD genotypes
Directory of Open Access Journals (Sweden)
Schwerin Manfred
2003-06-01
Full Text Available Abstract In this study the mRNA differential display method was applied to identify mastitis-associated expressed DNA sequences based on different expression patterns in mammary gland samples of non-infected and infected udder quarters of a cow. In total, 704 different cDNA bands were displayed in both udder samples. Five hundred-and-thirty two bands, (75.6% were differentially displayed. Ninety prominent cDNA bands were isolated, re-amplified, cloned and sequenced resulting in 87 different sequences. Amongst the 19 expressed sequence tags showing a similarity with previously described genes, the majority of these sequences exhibited homology to protein kinase encoding genes (26.3%, to genes involved in the regulation of gene expression (26.3%, to growth and differentiation factor encoding genes (21.0% and to immune response or inflammation marker encoding genes (21.0%. These sequences were shown to have mastitis-associated expression in the udder samples of animals with and without clinical mastitis by quantitative RT-PCR. They were mapped physically using a bovine-hamster somatic cell hybrid panel and a 5000 rad bovine whole genome radiation hybrid panel. According to their localization in QTL regions based on an established integrated marker/gene-map and their disease-associated expression, four genes (AHCY, PRKDC, HNRPU, OSTF1 were suggested as potentially involved in mastitis defense.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Haplotype combination of the bovine PCSK1 gene sequence ...
Indian Academy of Sciences (India)
Prohormone convertase subtilisin/kexin type 1 gene. (PCSK1) plays a role in body mass control. Recent associa- tion studies have shown that three common nonsynonymous. SNPs are linked to increase risk of obesity and therefore it has been the focus of this study. Hence, in this study, polymorphisms of the bovine ...
Genetic variability of bovine GHR, IGF-1 and IGFBP-3 genes in ...
African Journals Online (AJOL)
These polymorphisms were confirmed by direct sequencing. The comparative gene sequence analysis in cattle and buffalo breeds revealed 18 single nucleotide polymorphisms (SNPs) across different loci. Eight SNPs were detected in the bovine growth hormone receptor (GHR) gene, of which four were found in the ...
Aberrant DNA methylation in 5'regions of DNA methyltransferase genes in aborted bovine clones
Institute of Scientific and Technical Information of China (English)
2008-01-01
High rate of abortion and developmental abnormalities is thought to be closely associated with inefficient epigenetic reprogramming of the transplanted nuclei during bovine cloning.It is known that one of the important mechanisms for epigenetic reprogramming is DNA methylation.DNA methylation is established and maintained by DNA methyltransferases(DNMTs),therefore,it is postulated that the inefficient epigenetic reprogramming of transplanted nuclei may be due to abnormal expression of DNMTs.Since DNA methylation can strongly inhibit gene expression,aberrant DNA methylation of DNMT genes may disturb gene expression.But presently,it is not clear whether the methylation abnormality of DNMT genes is related to developmental failure of somatic cell nuclear transfer embryos.In our study,we analyzed methylation patterns of the 5' regions of four DNMT genes including Dnmt3a,Dnmt3b,Dnmtl and Dnmt2 in four aborted bovine clones.Using bisulfite sequencing method,we found that 3 out of 4 aborted bovine clones(AF1,AF2 and AF3)showed either hypermethylation or hypomethylation in the 5' regions of Dnmt3a and Dnmt3b.indicating that Dnmt3a and Dnmt3b genes are not properly reprogrammed.However,the individual AF4 exhibited similar methylation level and pattern to age-matched in vitro fertilized (IVF)fetuses.Besides,we found that tle 5'regions of Dnmtl and Dnmt2 were nearly completely unmethylated in all normal adults.IVF fetuses,sperm and aborted clones.Together,our results suggest that the aberrant methylation of Dnmt3a and Dnmt3b 5' regions is probably associated with the high abortion of bovine clones.
Differential neutrophil gene expression in early bovine pregnancy
Directory of Open Access Journals (Sweden)
Kizaki Keiichiro
2013-02-01
Full Text Available Abstract Background In food production animals, especially cattle, the diagnosis of gestation is important because the timing of gestation directly affects the running of farms. Various methods have been used to detect gestation, but none of them are ideal because of problems with the timing of detection or the accuracy, simplicity, or cost of the method. A new method for detecting gestation, which involves assessing interferon-tau (IFNT-stimulated gene expression in peripheral blood leukocytes (PBL, was recently proposed. PBL fractionation methods were used to examine whether the expression profiles of various PBL populations could be used as reliable diagnostic markers of bovine gestation. Methods PBL were collected on days 0 (just before artificial insemination, 7, 14, 17, 21, and 28 of gestation. The gene expression levels of the PBL were assessed with microarray analysis and/or quantitative real-time reverse transcription (q PCR. PBL fractions were collected by flow cytometry or density gradient cell separation using Histopaque 1083 or Ficoll-Conray solutions. The expression levels of four IFNT-stimulated genes, interferon-stimulated protein 15 kDa (ISG15, myxovirus-resistance (MX 1 and 2, and 2′-5′-oligoadenylate synthetase (OAS1, were then analyzed in each fraction through day 28 of gestation using qPCR. Results Microarray analysis detected 72 and 28 genes in whole PBL that were significantly higher on days 14 and 21 of gestation, respectively, than on day 0. The upregulated genes included IFNT-stimulated genes. The expression levels of these genes increased with the progression of gestation until day 21. In flow cytometry experiments, on day 14 the expression levels of all of the genes were significantly higher in the granulocyte fraction than in the other fractions. Their expression gradually decreased through day 28 of gestation. Strong correlations were observed between the expression levels of the four genes in the granulocyte
Czech Academy of Sciences Publication Activity Database
Machatková, M.; Jeseta, M.; Hulínská, P.; Knitlová, D.; Němcová, Lucie; Kaňka, Jiří
2012-01-01
Roč. 47, č. 5 (2012), s. 806-814 ISSN 0936-6768 R&D Projects: GA MZe QI91A018 Grant - others:GA ČR(CZ) GD523/08/H064 Program:GD Institutional research plan: CEZ:AV0Z50450515 Keywords : bovine oocytes * mitochondrial status * nuclear-encoded factors Subject RIV: GI - Animal Husbandry ; Breeding Impact factor: 1.392, year: 2012
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Early bovine embryos regulate oviduct epithelial cell gene expression during in vitro co-culture.
Schmaltz-Panneau, Barbara; Cordova, Amanda; Dhorne-Pollet, Sophie; Hennequet-Antier, Christelle; Uzbekova, Sveltlana; Martinot, Emmanuelle; Doret, Sarah; Martin, Patrice; Mermillod, Pascal; Locatelli, Yann
2014-10-01
In mammals, the oviduct may participate to the regulation of early embryo development. In vitro co-culture of early bovine embryos with bovine oviduct epithelial cells (BOEC) has been largely used to mimic the maternal environment. However, the mechanisms of BOEC action have not been clearly elucidated yet. The aim of this study was to determine the response of BOEC cultures to the presence of developing bovine embryos. A 21,581-element bovine oligonucleotide array was used compare the gene expression profiles of confluent BOEC cultured for 8 days with or without embryos. This study revealed 34 differentially expressed genes (DEG). Of these 34 genes, IFI6, ISG15, MX1, IFI27, IFI44, RSAD2, IFITM1, EPSTI1, USP18, IFIT5, and STAT1 expression increased to the greatest extent due to the presence of embryos with a major impact on antiviral and immune response. Among the mRNAs at least 25 are already described as induced by interferons. In addition, transcript levels of new candidate genes involved in the regulation of transcription, modulation of the maternal immune system and endometrial remodeling were found to be increased. We selected 7 genes and confirmed their differential expression by quantitative RT-PCR. The immunofluorescence imaging of cellular localization of STAT1 protein in BOEC showed a nuclear translocation in the presence of embryos, suggesting the activation of interferon signaling pathway. This first systematic study of BOEC transcriptome changes in response to the presence of embryos in cattle provides some evidences that these cells are able to adapt their transcriptomic profile in response to embryo signaling. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Alvarez, Rene; Seal, Bruce S
2005-01-01
Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the
Directory of Open Access Journals (Sweden)
Alvarez Rene
2005-04-01
Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among
Lammers, A.; Kruijt, E.; Kuijt, van de C.; Nuijten, P.J.M.; Smith, H.E.
2000-01-01
Staphylococcus aureus is a major cause of bovine mastitis. Since gene expression of many bacteria is known to be regulated by the environment, milk may play an important role in the regulation of the early steps in the pathogenesis of bovine mastitis by S. aureus. To get insight into the response of
Li, Robert W; Li, CongJun
2006-01-01
Abstract Background Global gene expression profiles of bovine kidney epithelial cells regulated by sodium butyrate were investigated with high-density oligonucleotide microarrays. The bovine microarray with 86,191 distinct 60mer oligonucleotides, each with 4 replicates, was designed and produced with Maskless Array Synthesizer technology. These oligonucleotides represent approximately 45,383 unique cattle sequences. Results 450 genes significantly regulated by butyrate with a median False Dis...
Description and physical localization of the bovine survival of motor neuron gene (SMN).
Pietrowski, D; Goldammer, T; Meinert, S; Schwerin, M; Förster, M
1998-01-01
Proximal spinal muscular atrophy (SMA) is an autosomal recessive disease in humans and other mammals, characterized by degeneration of anterior horn cells of the spinal cord. In humans, the survival of motor neuron gene (SMN) has been recognized as the SMA-determining gene and has been mapped to 5q13. In cattle, SMA is a recurrent, inherited disease that plays an important economic role in breeding programs of Brown Swiss stock. Now we have identified the full- length cDNA sequence of the bovine SMN gene. Molecular analysis and characterization of the sequence documents 85% identity to its human counterpart and three evolutionarily conserved domains in different species. Physical mapping data reveals that bovine SMN is localized to chromosome region 20q12-->q13, supporting the conserved synteny of this chromosomal region between humans and cattle.
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.
Pietrowski, D; Förster, M
2000-01-01
The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
Directory of Open Access Journals (Sweden)
Byrne Keren A
2007-08-01
Full Text Available Abstract Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60, secondary myogenesis (d 135, as well as beginning (d 195 and final stages (birth of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24 were from Hereford dams and crossed with either Wagyu (high intramuscular fat or Piedmontese (GDF8 mutant sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5 RNA at birth. The developing longissimus muscle of
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Sharma, Neelesh; Huynh, Do Luong; Kim, Sung Woo; Ghosh, Mrinmoy; Sodhi, Simrinder Singh; Singh, Amit Kumar; Kim, Nam Eun; Lee, Sung Jin; Hussain, Kafil; Oh, Sung Jong; Jeong, Dong Kee
2017-11-28
The antibacterial and anti-inflammatory properties of lactoferricin have been ascribed to its ability to sequester essential iron. The objective of the study was to clone bovine lactoferricin ( LFcinB ) gene into PiggyBac Transposon vector, expression study in the bovine mammary epithelial stem cells (bMESCs) and also to determine the antimicrobial property of recombinant LFcinB against bovine mastitis-causing organisms. The PiggyBac-LFcinB was transfected into bMESCs by electroporation and a three fold of LFcinB secretion was observed in the transfected bMESCs medium by ELISA assay. Furthermore, the assessment of antimicrobial activity against mastitis causing pathogens Staphylococcus aureus and Escherichia coli demonstrated convincing evidence to prove strong antibacterial activity of LFcinB with 14.0±1.0 mm and 18.0±1.5 mm zone of inhibition against both organisms, respectively. The present study provides the convincing evidence to suggest the potential of PiggyBac transposon system to transfer antibacterial peptide into bMESCs or cow mammary gland and also pave the way to use bovine mammary gland as the bioreactors. Simultaneously, it also suggest toward commercial utilization of LFcinB bioreactor system in pharmaceutical industry.
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Experimental infection of calves with a gI, gE, US9 negative bovine herpesvirus type 5
Hubner, S.O.; Oliveira, A.P.; Franco, A.C.; Rijsewijk, F.A.M.; Roehe, P.M.
2005-01-01
In this work, a role for the genes encoding glycoproteins I (gI) and E (gE) and the US9 protein of bovine herpesvirus type 5 (BHV-5) in neuropathogenicity and reactivation of latent infections was examined. Calves infected intranasally with a gI/gE/US9 deleted recombinant shed up to 102.85 TCID50/ml
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J
1994-07-08
The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Directory of Open Access Journals (Sweden)
Phongsakorn Chuammitri
2017-04-01
Full Text Available Aim: To investigate gene expression of microRNA (miRNA milieus (MIRLET7E, MIR17, MIR24-2, MIR146A, and MIR181C, inflammatory cytokine genes (interleukin 1β [IL1B], IL6, CXCL8, and tumor necrosis factor [TNF], and the pathogen receptor toll-like receptor (TLR4 in bovine neutrophils under quercetin supplementation. Materials and Methods: Isolated bovine neutrophils were incubated with bacterial lipopolysaccharide under quercetin treatment or left untreated. Real-time polymerase chain reaction was performed to determine the expression of the miRNAs and messenger RNA (mRNA transcripts in neutrophils. Results: Quercetin-treated neutrophils exhibited a remarkable suppression in MIR24-2, MIR146A, and MIR181C expression. Similarly, mRNA expression of IL1B, IL6, CXCL8, TLR4, and TNF genes noticeably declined in the quercetin group. Many proinflammatory genes (IL1B, IL6, and CXCL8 and the pathogen receptor TLR4 had a negative correlation with MIR146A and MIR181C as revealed by Pearson correlation. Conclusion: Interaction between cognate mRNAs and miRNAs under quercetin supplementation can be summarized as a positive or negative correlation. This finding may help understand the effects of quercetin either on miRNA or gene expression during inflammation, especially as a potentially applicable indicator in bovine mastitis.
DEFF Research Database (Denmark)
Goldeman, Charlotte; Saaby, Lasse; Brodin, Birger
Cultures of primary bovine brain endothelial cells (BECs) grown, often together with astrocytes, on permeable supports in two-compartment culture systems are commonly used as an in vitro model of the blood-brain barrier (BBB). While trans-endothelial electrical resistance, restriction...... the in vivo gene expression of brain capillary endothelial cells. Primary bovine endothelial cells and rat astrocytes were cultured in different culture configurations and the mRNA expression of selected genes (vWF, Glut-1, P-gp, claudin-1,-5, occludin, JAM-1, LAT-1, SLC16A1, MRP-1,-4, BCRP, ZO-1, AP, TPA...
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Bertin, Yolande; Girardeau, J P; Chaucheyras-Durand, F; Lyan, Bernard; Pujos-Guillot, Estelle; Harel, Josée; Martin, Christine
2011-02-01
The bovine gastrointestinal tract is the main reservoir for enterohaemorrhagic Escherichia coli (EHEC) responsible for food-borne infections. Characterization of nutrients that promote the carriage of these pathogens by the ruminant would help to develop ecological strategies to reduce their survival in the bovine gastrointestinal tract. In this study, we show for the first time that free ethanolamine (EA) constitutes a nitrogen source for the O157:H7 EHEC strain EDL933 in the bovine intestinal content because of induction of the eut (ethanolamine utilization) gene cluster. In contrast, the eut gene cluster is absent in the genome of most species constituting the mammalian gut microbiota. Furthermore, the eutB gene (encoding a subunit of the enzyme that catalyses the release of ammonia from EA) is poorly expressed in non-pathogenic E. coli. Accordingly, EA is consumed by EHEC but is poorly metabolized by endogenous microbiota of the bovine small intestine, including commensal E. coli. Interestingly, the capacity to utilize EA as a nitrogen source confers a growth advantage to E. coli O157:H7 when the bacteria enter the stationary growth phase. These data demonstrate that EHEC strains take advantage of a nitrogen source that is not consumed by the resident microbiota, and suggest that EA represents an ecological niche favouring EHEC persistence in the bovine intestine.
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Directory of Open Access Journals (Sweden)
Kelton David F
2010-04-01
Full Text Available Abstract Background Johne's disease is a chronic inflammatory bowel disease (IBD of ruminants caused by Mycobacterium avium ssp. paratuberculosis (MAP. Since this pathogen has been implicated in the pathogenesis of human IBDs, the goal of this study was to assess whether single nucleotide polymorphism (SNPs in several well-known candidate genes for human IBD are associated with susceptibility to MAP infection in dairy cattle. Methods The bovine candidate genes, interleukin-10 (IL10, IL10 receptor alpha/beta (IL10RA/B, transforming growth factor beta 1 (TGFB1, TGFB receptor class I/II (TGFBR1/2, and natural resistance-associated macrophage protein 1 (SLC11A1 were sequenced for SNP discovery using pooled DNA samples, and the identified SNPs were genotyped in a case-control association study comprised of 242 MAP negative and 204 MAP positive Holstein dairy cattle. Logistic regression was used to determine the association of SNPs and reconstructed haplotypes with MAP infection status. Results A total of 13 SNPs were identified. Four SNPs in IL10RA (984G > A, 1098C > T, 1269T > C, and 1302A > G were tightly linked, and showed a strong additive and dominance relationship with MAP infection status. Haplotypes AGC and AAT, containing the SNPs IL10RA 633C > A, 984G > A and 1185C > T, were associated with an elevated and reduced likelihood of positive diagnosis by serum ELISA, respectively. Conclusions SNPs in IL10RA are associated with MAP infection status in dairy cattle. The functional significance of these SNPs warrants further investigation.
Song, Minyan; He, Yanghua; Zhou, Huangkai; Zhang, Yi; Li, Xizhi; Yu, Ying
2016-07-14
Subclinical mastitis is a widely spread disease of lactating cows. Its major pathogen is Staphylococcus aureus (S. aureus). In this study, we performed genome-wide integrative analysis of DNA methylation and transcriptional expression to identify candidate genes and pathways relevant to bovine S. aureus subclinical mastitis. The genome-scale DNA methylation profiles of peripheral blood lymphocytes in cows with S. aureus subclinical mastitis (SA group) and healthy controls (CK) were generated by methylated DNA immunoprecipitation combined with microarrays. We identified 1078 differentially methylated genes in SA cows compared with the controls. By integrating DNA methylation and transcriptome data, 58 differentially methylated genes were shared with differently expressed genes, in which 20.7% distinctly hypermethylated genes showed down-regulated expression in SA versus CK, whereas 14.3% dramatically hypomethylated genes showed up-regulated expression. Integrated pathway analysis suggested that these genes were related to inflammation, ErbB signalling pathway and mismatch repair. Further functional analysis revealed that three genes, NRG1, MST1 and NAT9, were strongly correlated with the progression of S. aureus subclinical mastitis and could be used as powerful biomarkers for the improvement of bovine mastitis resistance. Our studies lay the groundwork for epigenetic modification and mechanistic studies on susceptibility of bovine mastitis.
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Directory of Open Access Journals (Sweden)
Jacques G. Lussier
2017-11-01
Full Text Available Abstract Background Ovulation and luteinization of follicles are complex biological processes initiated by the preovulatory luteinizing hormone surge. The objective of this study was to identify genes that are differentially expressed in bovine granulosa cells (GC of ovulatory follicles. Methods Granulosa cells were collected during the first follicular wave of the bovine estrous cycle from dominant follicles (DF and from ovulatory follicles (OF obtained 24 h following injection of human chorionic gonadotropin (hCG. A granulosa cell subtracted cDNA library (OF-DF was generated using suppression subtractive hybridization and screened. Results Detection of genes known to be upregulated in bovine GC during ovulation, such as ADAMTS1, CAV1, EGR1, MMP1, PLAT, PLA2G4A, PTGES, PTGS2, RGS2, TIMP1, TNFAIP6 and VNN2 validated the physiological model and analytical techniques used. For a subset of genes that were identified for the first time, gene expression profiles were further compared by semiquantitative RT-PCR in follicles obtained at different developmental stages. Results confirmed an induction or upregulation of the respective mRNAs in GC of OF 24 h after hCG-injection compared with those of DF for the following genes: ADAMTS9, ARAF, CAPN2, CRISPLD2, FKBP5, GFPT2, KIT, KITLG, L3MBLT3, MRO, NUDT10, NUDT11, P4HA3, POSTN, PSAP, RBP1, SAT1, SDC4, TIMP2, TNC and USP53. In bovine GC, CRISPLD2 and POSTN mRNA were found as full-length transcript whereas L3MBLT3 mRNA was alternatively spliced resulting in a truncated protein missing the carboxy-terminal end amino acids, 774KNSHNEL780. Conversely, L3MBLT3 is expressed as a full-length mRNA in a bovine endometrial cell line. The 774KNSHNEL780 sequence is well conserved in all mammalian species and follows a SAM domain known to confer protein/protein interactions, which suggest a key function for these amino acids in the epigenetic control of gene expression. Conclusions We conclude that we have identified
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Cloning and sequencing of the bovine gastrin gene
DEFF Research Database (Denmark)
Lund, T; Rehfeld, J F; Olsen, Jørgen
1989-01-01
In order to deduce the primary structure of bovine preprogastrin we therefore sequenced a gastrin DNA clone isolated from a bovine liver cosmid library. Bovine preprogastrin comprises 104 amino acids and consists of a signal peptide, a 37 amino acid spacer-sequence, the gastrin-34 sequence followed...
Directory of Open Access Journals (Sweden)
Zotta, Claudio Marcelo
2016-05-01
Full Text Available Escherichia coli producing-Shiga toxin (STEC is associated with foodborne illness (ETA. It can cause bloody diarrhea, hemorrhagic colitis, hemolytic uremic syndrome and thrombotic thrombocytopenic purpura. The aim of the study was to detect the presence of STEC in samples of organs (offal of bovine animals and chicken intended for human consumption. Between 2008-2009, 76 samples bovine entrails and 22 chicken viscera samples, were processed and underwent, as screening technique, the polymerase chain reaction (PCR for detection of multiple genes coding for the factors virulence: Shiga toxin (stx1, stx2 and rfbO157 gene coding for capsular O157 lipopolysaccharide LPS. Samples from bovine offal development showed 84.2% for coliform bacteria. These isolates showed no virulence factor that characterized as STEC or Escherichia coli O157. The chicken offal samples showed 95.5% of development for coliform bacteria, being negative for the presence of genes encoding the Shiga toxins 1 and 2 (stx1, stx2 and rfbO157 gene. While this work does not STEC was detected, the presence of coliform bacteria in the samples studied makes these foods should be considered as potentially hazardous to consume undercooked with the consequent possibility of filing ETA.
Aguilar-Calvo, Patricia; Fast, C.; Tauscher, Kerstin; Espinosa, J.C.; Groschup, M.H.; Muhammad, Nadeem; Goldmann, W.; Langeveld, J.P.M.; Bossers, A.; Andreoletti, O.
2015-01-01
Background. The prion protein-encoding gene (PRNP) is one of the major determinants for scrapie occurrence in sheep and goats. However, its effect on bovine spongiform encephalopathy (BSE) transmission to goats is not clear.
Methods. Goats harboring wild-type, R/Q211 or Q/K222 PRNP
Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)
International Nuclear Information System (INIS)
Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.
1987-01-01
The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Yu, Ting; He, Tao; Yao, Hong; Zhang, Jin-Bao; Li, Xiao-Na; Zhang, Rong-Ming; Wang, Gui-Qin
2015-09-01
The aim of this study is to understand the prevalence and molecular characterization of 16S rRNA methylase gene, rmtB, among Escherichia coli strains isolated from bovine mastitis in China. A total of 245 E. coli isolates were collected from bovine mastitis in China between 2013 and 2014 and were screened for 16S rRNA methylase genes (armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA) by polymerase chain reaction. About 5.3% (13/245) of the isolates carried the rmtB gene; the isolates were highly resistant to amikacin. Thirteen rmtB-positive strains were analyzed for the presence of extended-spectrum β-lactamase genes (bla(TEM), bla(CTX-M), bla(OXA), and bla(SHV)). All the isolates harbored both bla(TEM-1) and bla(CTX-M-15) genes and two of the isolates were also positive for bla(OXA-1). Pulsed-field gel electrophoresis (PFGE) analysis indicated that the nine rmtB-positive strains belonging to ST10 from one farm showed the similar PFGE pattern, indicating a clonal expansion in this farm. S1-PFGE and Southern blotting showed that 12 isolates harbored the rmtB gene in plasmids of two different sizes (≈45 kb [n=10] and ≈48 kb [n=2]), while only 1 strain harbored the rmtB gene in the chromosome. These plasmids were transferable by conjugation studies, and two isolates from two respective farms carried the same size of plasmid, suggesting that the horizontal transmission of plasmids also contributed to the spread of rmtB gene. This is the first report of prevalence of the 16S rRNA methylase gene rmtB among E. coli isolated from bovine mastitis in China, and rmtB-carrying E. coli may pose a threat to the treatment of bovine mastitis.
Alves-Barroco, Cinthia; Roma-Rodrigues, Catarina; Raposo, Luís R; Brás, Catarina; Diniz, Mário; Caço, João; Costa, Pedro M; Santos-Sanches, Ilda; Fernandes, Alexandra R
2018-03-25
Streptococcus dysgalactiae subsp. dysgalactiae (SDSD) is a major cause of bovine mastitis and has been regarded as an animal-restricted pathogen, although rare infections have been described in humans. Previous studies revealed the presence of virulence genes encoded by phages of the human pathogen Group A Streptococcus pyogenes (GAS) in SDSD isolated from the milk of bovine udder with mastitis. The isolates SDSD VSD5 and VSD13 could adhere and internalize human primary keratinocyte cells, suggesting a possible human infection potential of bovine isolates. In this work, the in vitro and in vivo potential of SDSD to internalize/adhere human cells of the respiratory track and zebrafish as biological models was evaluated. Our results showed that, in vitro, bovine SDSD strains could interact and internalize human respiratory cell lines and that this internalization was dependent on an active transport mechanism and that, in vivo, SDSD are able to cause invasive infections producing zebrafish morbidity and mortality. The infectious potential of these isolates showed to be isolate-specific and appeared to be independent of the presence or absence of GAS phage-encoded virulence genes. Although the infection ability of the bovine SDSD strains was not as strong as the human pathogenic S. pyogenes in the zebrafish model, results suggested that these SDSD isolates are able to interact with human cells and infect zebrafish, a vertebrate infectious model, emerging as pathogens with zoonotic capability. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Methicillin resistant S. aureus in human and bovine mastitis.
Holmes, Mark A; Zadoks, Ruth N
2011-12-01
Staphylococcus aureus is a ubiquitous organism that causes a variety of diseases including mastitis in cattle and humans. High-level resistance of S. aureus to β-lactams conferred by a mecA gene encoding a modified penicillin binding protein (PBP2a) was first observed in the early 1960's. These methicillin resistant S. aureus (MRSA) have been responsible for both hospital acquired infections (HA-MRSA) and, more recently, community acquired MRSA (CA-MRSA). A small number of human MRSA mastitis cases and outbreaks in maternity or neonatal units have been reported which are generally the result of CA-MRSA. The establishment of the sequence type 398 (ST398) in farm animals, primarily pigs, in the early 2000's has provided a reservoir of infection for humans and dairy cattle, particularly in continental Europe, described as livestock-associated MRSA (LA-MRSA). Prior to the emergence of ST398 there were sporadic reports of MRSA in bovine milk and cases of mastitis, often caused by strains from human associated lineages. Subsequently, there have been several reports describing bovine udder infections caused by ST-398 MRSA. Recently, another group of LA-MRSA strains was discovered in humans and dairy cattle in Europe. This group carries a divergent mecA gene and includes a number of S. aureus lineages (CC130, ST425, and CC1943) that were hitherto thought to be bovine-specific but are now also found as carriage or clinical isolates in humans. The emergence of MRSA in dairy cattle may be associated with contact with other host species, as in the case of ST398, or with the exchange of genetic material between S. aureus and coagulase negative Staphylococcus species, which are the most common species associated with bovine intramammary infections and commonly carry antimicrobial resistance determinants.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
Lai, Y C; Fujikawa, T; Ando, T; Kitahara, G; Koiwa, M; Kubota, C; Miura, N
2017-06-01
Our aim was to identify a suitable microRNA housekeeping gene for real-time PCR analysis of bovine mastitis-related microRNA in milk. We identified , , and as housekeeping gene candidates on the basis of previous Solexa sequencing results. Threshold cycle (CT) values for , , and did not differ between milk from control cows and milk from mastitis-affected cows. NormFinder software identified as the most stable single housekeeping gene. We evaluated the suitability of the housekeeping gene candidates by using them to assess expression levels of the inflammation-related gene . Regardless of the housekeeping gene candidates used for normalization, relative expression levels of were significantly higher in mastitis-affected samples than in control samples. However, of all the housekeeping genes and gene combinations investigated, normalization with alone generated the difference in relative expression between mastitis-affected and control samples with the highest significance. These results suggest that is suitable for use as a housekeeping gene for analysis of bovine mastitis-related microRNA in milk.
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Strube, C; Buschbaum, S; Schnieder, T
2012-08-01
Genes necessary to enable nematode parasitic life after free-living larval life are of substantial interest to understand parasitism. We investigated transcriptional changes during transition to parasitism in the bovine lungworm Dictyocaulus viviparus, one of the most important parasites in cattle farming due to substantial economic losses. Upregulated transcripts in either free-living, developmentally arrested L3 or parasitic immature L5 were identified by suppression subtractive hybridization (SSH) followed by differential screening and subsequent virtual Northern blot verification. From 400 sequenced clones of parasitic L5, 372 (93.0%) upregulated high quality ESTs were obtained clustering into 30 contigs and 38 singletons. Most conceptual translated peptides were SCP/TAPS "family" members also known as pathogenesis-related protein (PRP) superfamily (28.5% of total ESTs), cysteine proteases (24.5%), and H-gal-GP orthologues (9.9%). These proteins are predicted to play key roles in fundamental biological processes such as nutrition and development but also parasite-host interactions and immune defense mechanisms. Increased energy requirement of the rapidly developing L5 lungworm stage was obvious in a proportion of 12.2% upregulated ESTs being components of the respiratory chain. From the developmentally arrested L3 stage sequencing of 200 clones resulted in 195 high quality ESTs (97.0%) clustering into 7 contigs and 3 singletons only. Besides a hypothetical protein (70.1% of total ESTs) most transcripts encoded the cleavage stimulation factor subunit 2 (17.5%), which is a component of the poly(A(+)) machinery and found to be involved in gene silencing. Obtained data provide the basis for future fundamental research into genes associated with parasitic lifestyle but also applied research like vaccine and/or drug development. Copyright © 2012 Elsevier B.V. All rights reserved.
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
Identification and expression analysis of genes associated with bovine blastocyst formation
Directory of Open Access Journals (Sweden)
Van Zeveren Alex
2007-06-01
Full Text Available Abstract Background Normal preimplantation embryo development encompasses a series of events including first cleavage division, activation of the embryonic genome, compaction and blastocyst formation. First lineage differentiation starts at the blastocyst stage with the formation of the trophectoderm and the inner cell mass. The main objective of this study was the detection, identification and expression analysis of genes associated with blastocyst formation in order to help us better understand this process. This information could lead to improvements of in vitro embryo production procedures. Results A subtractive cDNA library was constructed enriched for transcripts preferentially expressed at the blastocyst stage compared to the 2-cell and 8-cell stage. Sequence information was obtained for 65 randomly selected clones. The RNA expression levels of 12 candidate genes were determined throughout 3 stages of preimplantation embryo development (2-cell, 8-cell and blastocyst and compared with the RNA expression levels of in vivo "golden standard" embryos using real-time PCR. The RNA expression profiles of 9 (75% transcripts (KRT18, FN1, MYL6, ATP1B3, FTH1, HINT1, SLC25A5, ATP6V0B, RPL10 were in agreement with the subtractive cDNA cloning approach, whereas for the remaining 3 (25% (ACTN1, COPE, EEF1A1 the RNA expression level was equal or even higher at the earlier developmental stages compared to the blastocyst stage. Moreover, significant differences in RNA expression levels were observed between in vitro and in vivo produced embryos. By immunofluorescent labelling, the protein expression of KRT18, FN1 and MYL6 was determined throughout bovine preimplantation embryo development and showed the same pattern as the RNA expression analyses. Conclusion By subtractive cDNA cloning, candidate genes involved in blastocyst formation were identified. For several candidate genes, important differences in gene expression were observed between in vivo and in
Heterologous expression of bovine lactoferricin in Pichia methanolica.
Wang, Haikuan; Zhao, Xinhuai; Lu, Fuping
2007-06-01
According to the bias of codon utilization of Pichia methanolica, a fragment encoding bovine lactoferricin has been cloned and expressed in the P. methanolica under the control of the alcohol oxidase promoter, which was followed by the Saccharomyces cerevisiae alpha-factor signal peptide. The alpha-factor signal peptide efficiently directed the secretion of bovine lactoferricin from the recombinant yeast cell. The recombinant bovine lactoferricin appears to be successfully expressed, as it displays antibacterial activity (antibacterial assay). Moreover, the identity of the recombinant product was estimated by Tricine-SDS-PAGE.
Ahmady, Malahat; Kazemi, Sahar
2013-07-01
Staphylococcus aureus is a major causative pathogen of clinical and subclinical mastitis of dairy domestic ruminants. This organism produces a variety of extracellular toxins and virulence factors such as enterotoxin SEI and SEJ that contribute to its pathogenic potential. In this study 25 S. aureus isolates obtained from four dairy herds of Urmia region which is located in West Azerbaijan province in Iran. The tested isolates were identified on the basis of the cultural and biochemical properties, as well as amplification of the aroA gene which is specific for S. aureus . All isolates were also analyzed for the presence of the SEI ( sei ) and SEJ ( sej ) encoding genes using polymerase chain reaction (PCR). Seven positive isolates were detected for sei , but sej gene was not detected in any of the total number of 25 isolates. The present study revealed that the PCR amplification of the aroA gene could be used as a powerful tool for identification of S. aureus from the cases of bovine mastitis. Results of the present study also showed that the strains of S. aureus which cause mastitis can potentially produce enterotoxin SEI. Overall, our results suggest that it is of special importance to follow the presence of enterotoxin-producing S. aureus in other dairy products, especially for protecting the consumers from staphylococcal food poisoning.
Directory of Open Access Journals (Sweden)
Li CongJun
2006-09-01
Full Text Available Abstract Background Global gene expression profiles of bovine kidney epithelial cells regulated by sodium butyrate were investigated with high-density oligonucleotide microarrays. The bovine microarray with 86,191 distinct 60mer oligonucleotides, each with 4 replicates, was designed and produced with Maskless Array Synthesizer technology. These oligonucleotides represent approximately 45,383 unique cattle sequences. Results 450 genes significantly regulated by butyrate with a median False Discovery Rate (FDR = 0 % were identified. The majority of these genes were repressed by butyrate and associated with cell cycle control. The expression levels of 30 selected genes identified by the microarray were confirmed using real-time PCR. The results from real-time PCR positively correlated (R = 0.867 with the results from the microarray. Conclusion This study presented the genes related to multiple signal pathways such as cell cycle control and apoptosis. The profound changes in gene expression elucidate the molecular basis for the pleiotropic effects of butyrate on biological processes. These findings enable better recognition of the full range of beneficial roles butyrate may play during cattle energy metabolism, cell growth and proliferation, and possibly in fighting gastrointestinal pathogens.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Richards, Vincent P.; Lang, Ping; Pavinski Bitar, Paulina D.; Lefébure, Tristan; Schukken, Ynte H.; Zadoks, Ruth N.; Stanhope, Michael J.
2011-01-01
In addition to causing severe invasive infections in humans, Streptococcus agalactiae, or group B Streptococcus (GBS), is also a major cause of bovine mastitis. Here we provide the first genome sequence for S. agalactiae isolated from a cow diagnosed with clinical mastitis (strain FSL S3-026). Comparison to eight S. agalactiae genomes obtained from human disease isolates revealed 183 genes specific to the bovine strain. Subsequent polymerase chain reaction (PCR) screening for the presence/absence of a subset of these loci in additional bovine and human strains revealed strong differentiation between the two groups (Fisher exact test: p S. agalactiae with Streptococcus uberis (nisin U operon) and Streptococcus dysgalactiae subsp. dysgalactiae (lactose operon). We also found evidence for LGT, involving the salivaricin operon, between the bovine S. agalactiae strain and either Streptococcus pyogenes or Streptococcus salivarius. Our findings provide insight intomechanismsfacilitatingenvironmentaladaptationandacquisitionofpotential virulence factors, while highlighting both the key role LGT has played in the recent evolution of the bovine S. agalactiae strain, and the importance of LGT among pathogens within a shared environment. PMID:21536150
Transcriptional reprogramming of gene expression in bovine somatic cell chromatin transfer embryos
Directory of Open Access Journals (Sweden)
Page Grier P
2009-04-01
Full Text Available Abstract Background Successful reprogramming of a somatic genome to produce a healthy clone by somatic cells nuclear transfer (SCNT is a rare event and the mechanisms involved in this process are poorly defined. When serial or successive rounds of cloning are performed, blastocyst and full term development rates decline even further with the increasing rounds of cloning. Identifying the "cumulative errors" could reveal the epigenetic reprogramming blocks in animal cloning. Results Bovine clones from up to four generations of successive cloning were produced by chromatin transfer (CT. Using Affymetrix bovine microarrays we determined that the transcriptomes of blastocysts derived from the first and the fourth rounds of cloning (CT1 and CT4 respectively have undergone an extensive reprogramming and were more similar to blastocysts derived from in vitro fertilization (IVF than to the donor cells used for the first and the fourth rounds of chromatin transfer (DC1 and DC4 respectively. However a set of transcripts in the cloned embryos showed a misregulated pattern when compared to IVF embryos. Among the genes consistently upregulated in both CT groups compared to the IVF embryos were genes involved in regulation of cytoskeleton and cell shape. Among the genes consistently upregulated in IVF embryos compared to both CT groups were genes involved in chromatin remodelling and stress coping. Conclusion The present study provides a data set that could contribute in our understanding of epigenetic errors in somatic cell chromatin transfer. Identifying "cumulative errors" after serial cloning could reveal some of the epigenetic reprogramming blocks shedding light on the reprogramming process, important for both basic and applied research.
Evaluation of suitable reference genes for gene expression studies in bovine muscular tissue
Directory of Open Access Journals (Sweden)
Dunner Susana
2008-09-01
Full Text Available Abstract Background Real-time reverse transcriptase quantitative polymerase chain reaction (real-time RTqPCR is a technique used to measure mRNA species copy number as a way to determine key genes involved in different biological processes. However, the expression level of these key genes may vary among tissues or cells not only as a consequence of differential expression but also due to different factors, including choice of reference genes to normalize the expression levels of the target genes; thus the selection of reference genes is critical for expression studies. For this purpose, ten candidate reference genes were investigated in bovine muscular tissue. Results The value of stability of ten candidate reference genes included in three groups was estimated: the so called 'classical housekeeping' genes (18S, GAPDH and ACTB, a second set of genes used in expression studies conducted on other tissues (B2M, RPII, UBC and HMBS and a third set of novel genes (SF3A1, EEF1A2 and CASC3. Three different statistical algorithms were used to rank the genes by their stability measures as produced by geNorm, NormFinder and Bestkeeper. The three methods tend to agree on the most stably expressed genes and the least in muscular tissue. EEF1A2 and HMBS followed by SF3A1, ACTB, and CASC3 can be considered as stable reference genes, and B2M, RPII, UBC and GAPDH would not be appropriate. Although the rRNA-18S stability measure seems to be within the range of acceptance, its use is not recommended because its synthesis regulation is not representative of mRNA levels. Conclusion Based on geNorm algorithm, we propose the use of three genes SF3A1, EEF1A2 and HMBS as references for normalization of real-time RTqPCR in muscle expression studies.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Rhipicephalus (Boophilus) microplus (Bm) ticks are vectors of bovine babesiosis and anaplasmosis. Tick resistance to organophosphate (OP) acaricide involves acetylcholinesterase (AChE) insensitivity to OP and metabolic detoxification. Sequencing and in vitro expression of Bm genes encoding AChE allo...
Rhipicephalus (Boophilus) microplus (Bm) is a vector of bovine babesiosis and anaplasmosis. Tick resistance to organophosphate (OP) acaricide involves acetylcholinesterase (AChE) insensitivity to OP and metabolic detoxification. In vitro expression of Bm genes encoding AChE allowed biochemical chara...
DEFF Research Database (Denmark)
Aarestrup, Frank Møller; Wegener, H. C.; Rosdahl, V. T.
1995-01-01
The value of five different typing methods (antibiogram typing, biotyping, phage typing, plasmid profiling and restriction fragment length polymorphism of the gene encoding 16S and 23S ribosomal RNA (ribotyping)), in discriminating 105 Staphylococcus aureus strains from bovine milk samples obtained....... The combination of phage, bio- or ribotyping or all three methods in combination are considered to be an efficient combination of typing methods for epidemiological investigation of S. aureus mastitis....
Directory of Open Access Journals (Sweden)
In-Seon Bae
Full Text Available Circulating microRNAs in body fluids have been implicated as promising biomarkers for physiopathology disorders. Currently, the expression levels of circulating microRNAs are estimated by reverse transcription quantitative real-time polymerase chain reaction. Use of appropriate reference microRNAs for normalization is critical for accurate microRNA expression analysis. However, no study has systematically investigated reference genes for evaluating circulating microRNA expression in cattle. In this study, we describe the identification and characterization of appropriate reference microRNAs for use in the normalization of circulating microRNA levels in bovine serum. We evaluated the expression stability of ten candidate reference genes in bovine serum by using reverse transcription quantitative real-time polymerase chain reaction. Data were analyzed using geNorm, NormFinder, and BestKeeper statistical algorithms. The results consistently showed that a combination of miR-93 and miR-127 provided the most stably expressed reference. The suitability of these microRNAs was validated, and even when compared among different genders or breeds, the combination of miR-93 and miR-127 was ranked as the most stable microRNA reference. Therefore, we conclude that this combination is the optimal endogenous reference for reverse transcription quantitative real-time polymerase chain reaction-based detection of microRNAs in bovine serum. The data presented in this study are crucial to successful biomarker discovery and validation for the diagnosis of physiopathological conditions in cattle.
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos
DEFF Research Database (Denmark)
Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.
2006-01-01
Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Felipe, Verónica; Morgante, Carolina A; Somale, Paola S; Varroni, Florencia; Zingaretti, María L; Bachetti, Romina A; Correa, Silvia G; Porporatto, Carina
2017-03-01
Staphylococcus aureus and coagulase-negative staphylococci (CNS) are important causes of intramammary infection in dairy cattle, and their ability to produce biofilm is considered an important virulence property in the pathogenesis of mastitis. However, the published date on mechanisms and factors involved in infection persistence in the mammary gland remains unclear. The aim of this study was to investigate whether the main Staphylococcus species involved in bovine intramammary infections possess specific characteristics that promote colonization of the udder. We evaluated the biofilm-forming ability and distribution of adhesion- and biofilm-associated genes of Staphylococcus spp. isolated from bovine mastitis infected animals in Argentinean dairy farms. For this purpose, the phenotypic biofilm formation ability of 209 Staphylococcus spp. from bovine mastitis was investigated. All isolates produced biofilm in vitro, being 35,0% and 45,0% of the 127 S. aureus or 51,0% and 29,0% of the 82 CNS strong and moderate biofilm producers respectively. All S. aureus samples were PCR-positive for icaA, icaD, clfA, clfB and fnbpA genes, 76.3% were positive for fnbpB gene and 11.0% were positive for bap gene. In CNS isolates, the positive rates for icaA and icaD were 73.2%, while for clfA, clfB, fnbpA fnbpB and bap genes the percentage were lower. The results demonstrate that in Staphylococcus spp. biofilm formation, the polysaccharide and the adhesion- and biofilm-associated genes are of overall importance on bovine mastitis in Argentina. Therefore, future works should focus on these pathogenic specific factors for the development of more effective therapies of control, being essential to consider the ability of isolates to produce biofilm. Copyright © 2017 Elsevier Ltd. All rights reserved.
Jamali, Hossein; Radmehr, Behrad
2013-11-01
The aims of this study were to determine the prevalence, characteristics and antimicrobial resistance of Listeria spp. isolated from bovine clinical mastitis in Iran. Listeria spp. were detected in 21/207 bovine mastitic milk samples from dairy farms in Iran, comprising L. monocytogenes (n=17), L. innocua (n=3) and L. ivanovii (n=1). L. monocytogenes isolates were grouped into serogroups '4b, 4d, 4e', '1/2a, 3a', '1/2b, 3b, 7' and '1/2c, 3c'; all harboured inlA, inlC and inlJ virulence genes. Listeria spp. were most frequently resistant to penicillin G (14/21 isolates, 66.7%) and tetracyclines (11/21 isolates, 52.4%). Copyright © 2013 Elsevier Ltd. All rights reserved.
Guzmán-Rodríguez, Jaquelina J; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Ochoa-Zarzosa, Alejandra; Suárez-Rodríguez, Luis María; Rodríguez-Zapata, Luis C; Salgado-Garciglia, Rafael; Jimenez-Moraila, Beatriz; López-Meza, Joel E; López-Gómez, Rodolfo
2013-09-01
Avocado is one of the most important fruits in the world. Avocado "native mexicano" (Persea americana var. drymifolia) seeds are widely used in the propagation of this plant and are the primary source of rootstocks globally for a variety of avocado cultivars, such as the Hass avocado. Here, we report the isolation of 5005 ESTs from the 5' ends of P. americana var. drymifolia seed cDNA clones representing 1584 possible unigenes. These avocado seed ESTs were compared with the avocado flower EST library, and we detected several genes that are expressed either in both tissues or only in the seed. The snakin gene, which encodes an element of the innate immune response in plants, was one of those most frequently found among the seed ESTs, and this suggests that it is abundantly expressed in the avocado seed. We expressed the snakin gene in a heterologous system, namely the bovine endothelial cell line BVE-E6E7. Conditioned media from transfected BVE-E6E7 cells showed antimicrobial activity against strains of Escherichia coli and Staphylococcus aureus. This is the first study of the function of the snakin gene in plant seed tissue, and our observations suggest that this gene might play a protective role in the avocado seed. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Zhou, Wenli; Sadeghieh, Sanaz; Abruzzese, Ronald; Uppada, Subhadra; Meredith, Justin; Ohlrichs, Charletta; Broek, Diane; Polejaeva, Irina
2009-09-01
Among many factors that potentially affect somatic cell nuclear transfer (SCNT) embryo development is the donor cell itself. Cloning potentials of somatic donor cells vary greatly, possibly because the cells have different capacities to be reprogrammed by ooplasma. It is therefore intriguing to identify factors that regulate the reprogrammability of somatic donor cells. Gene expression analysis is a widely used tool to investigate underlying mechanisms of various phenotypes. In this study, we conducted a retrospective analysis investigating whether donor cell lines with distinct cloning efficiencies express different levels of genes involved in epigenetic reprogramming including histone deacetylase-1 (HDAC1), -2 (HDAC2); DNA methyltransferase-1 (DNMT1), -3a (DNMT3a),-3b (DNMT3b), and the bovine homolog of yeast sucrose nonfermenting-2 (SNF2L), a SWI/SNF family of ATPases. Cell samples from 12 bovine donor cell lines were collected at the time of nuclear transfer experiments and expression levels of the genes were measured using quantitative polymerase chain reaction (PCR). Our results show that there are no significant differences in expression levels of these genes between donor cell lines of high and low cloning efficiency defined as live calving rates, although inverse correlations are observed between in vitro embryo developmental rates and expression levels of HDAC2 and SNF2L. We also show that selection of stable reference genes is important for relative quantification, and different batches of cells can have different gene expression patterns. In summary, we demonstrate that expression levels of these epigenome regulatory genes in bovine donor cells are not correlated with cloning potential. The experimental design and data analysis method reported here can be applied to study any genes expressed in donor cells.
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Directory of Open Access Journals (Sweden)
Mamta Janmeda
2017-05-01
Full Text Available Aim: Aim of the study was to study the relative gene expression of genes associated with fatty acid synthesis at 60 days postpartum (pp in bovine mammary epithelial cells (MECs of Surti and Jafarabadi buffaloes. Materials and Methods: A total of 10 healthy Surti and Jafarabadi buffaloes of each breed were selected at random from Livestock Research Station, Navsari and Cattle Breeding Farm, Junagadh, Gujarat, respectively, for this study. Milk sample was collected from each selected buffalo at day 60 pp from these two breeds to study relative gene expression of major milk fat genes using non-invasive approach of obtaining primary bovine MECs (pBMEC from milk samples. Results: In this study overall, the relative expression of the six major milk lipogenic genes butyrophilin subfamily 1 member A1 (BTN1A1, stearoyl-CoA desaturase (SCD, lipoprotein lipase (LPL, glycerol-3-phosphate acyltransferase mitochondrial (GPAM, acetyl-coenzyme A carboxylase alpha (ACACA, and lipin (LPIN did not show changes in expression patterns at 60th day of lactation in both Surti and Jafarabadi buffaloes. Conclusion: The pBMEC can be successfully recovered from 1500 ml of milk of Surti and Jafarabadi buffaloes using antibody-mediated magnetic bead separation and can be further used for recovering RNA for down step quantification of major milk lipogenic gene expression. The relative expression of the six major milk lipogenic genes BTN1A1, SCD, LPL, GPAM, ACACA, and LPIN did not show changes in expression patterns in both Surti and Jafarabadi buffaloes, suggesting expression levels of lipogenic genes are maintained almost uniform till peak lactation without any significant difference.
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
International Nuclear Information System (INIS)
Hering, Thomas M.; Kazmi, Najam H.; Huynh, Tru D.; Kollar, John; Xu, Laura; Hunyady, Aaron B.; Johnstone, Brian
2004-01-01
As part of a study to identify novel transcriptional regulators of chondrogenesis-related gene expression, we have cloned and characterized cDNA for zinc-finger protein 470 (ZNF470), the human ortholog of which encodes a 717 amino acid residue protein containing 17 Cys 2 His 2 zinc-finger domains, as well as KRAB-A and KRAB-B motifs. The cDNA library used to isolate the initial ZNF470 clone was prepared from human bone marrow-derived mesenchymal progenitor cells at an intermediate stage of chondrogenic differentiation. We have determined the intron-exon structure of the human ZNF470 gene, which has been mapped to a zinc-finger cluster in a known imprinted region of human chromosome 19q13.4. ZNF470 is expressed at high levels in human testis and is expressed at low or undetectible levels in other adult tissues. Human ZNF470 expressed in mammalian cells as an EGFP fusion protein localizes predominantly to the nucleus, consistent with a role in transcriptional regulation. ZNF470, analyzed by quantitative real time PCR, was transiently expressed before the maximal expression of COL2A1 during chondrogenic differentiation in vitro. We have also characterized the bovine ortholog of human ZNF470, which encodes a 508 amino acid residue protein having 10 zinc-finger domains. A bovine ZNF470 cDNA clone was used to examine expression of ZNF470 in bovine articular chondrocytes treated with retinoic acid to stimulate dedifferentiation. Bovine ZNF470 expression was undetectable in freshly isolated bovine articular chondrocytes, but was dramatically upregulated in dedifferentiated retinoic acid-treated chondrocytes. These results, in two model systems, suggest a possible role for ZNF470 in the regulation of chondrogenesis-specific gene expression
Serial analysis of gene expression (SAGE in bovine trypanotolerance: preliminary results
Directory of Open Access Journals (Sweden)
David Berthier
2003-06-01
Full Text Available Abstract In Africa, trypanosomosis is a tsetse-transmitted disease which represents the most important constraint to livestock production. Several indigenous West African taurine (Bos taurus breeds, such as the Longhorn (N'Dama cattle are well known to control trypanosome infections. This genetic ability named "trypanotolerance" results from various biological mechanisms under multigenic control. The methodologies used so far have not succeeded in identifying the complete pool of genes involved in trypanotolerance. New post genomic biotechnologies such as transcriptome analyses are efficient in characterising the pool of genes involved in the expression of specific biological functions. We used the serial analysis of gene expression (SAGE technique to construct, from Peripheral Blood Mononuclear Cells of an N'Dama cow, 2 total mRNA transcript libraries, at day 0 of a Trypanosoma congolense experimental infection and at day 10 post-infection, corresponding to the peak of parasitaemia. Bioinformatic comparisons in the bovine genomic databases allowed the identification of 187 up- and down- regulated genes, EST and unknown functional genes. Identification of the genes involved in trypanotolerance will allow to set up specific microarray sets for further metabolic and pharmacological studies and to design field marker-assisted selection by introgression programmes.
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Perrig, Melina S; Ambroggio, María B; Buzzola, Fernanda R; Marcipar, Iván S; Calvinho, Luis F; Veaute, Carolina M; Barbagelata, María Sol
2015-01-01
This study aimed to determine the clonal relationship among 137 Streptococcus uberis isolates from bovine milk with subclinical or clinical mastitis in Argentina and to assess the prevalence and conservation of pauA and sua genes. This information is critical for the rational design of a vaccine for the prevention of bovine mastitis caused by S. uberis. The isolates were typed by random amplified polymorphic DNA (RAPD) analysis and by pulsed-field gel electrophoresis (PFGE). The 137 isolates exhibited 61 different PFGE types and 25 distinct RAPD profiles. Simpson's diversity index was calculated both for PFGE (0.983) and for RAPD (0.941), showing a high discriminatory power in both techniques. The analysis of the relationship between pairs of isolates showed 92.6% concordance between both techniques indicating that any given pair of isolates distinguished by one method tended to be distinguished by the other. The prevalence of the sua and pauA genes was 97.8% (134/137) and 94.9% (130/137), respectively. Nucleotide and amino acid sequences of the sua and pauA genes from 20 S. uberis selected isolates, based on their PFGE and RAPD types and geographical origin, showed an identity between 95% and 100% with respect to all reference sequences registered in GenBank. These results demonstrate that, in spite of S. uberis clonal diversity, the sua and pauA genes are prevalent and highly conserved, showing their importance to be included in future vaccine studies to prevent S. uberis bovine mastitis. Copyright © 2015 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
Bovine mammary gene expression profiling during the onset of lactation.
Directory of Open Access Journals (Sweden)
Yuanyuan Gao
Full Text Available BACKGROUND: Lactogenesis includes two stages. Stage I begins a few weeks before parturition. Stage II is initiated around the time of parturition and extends for several days afterwards. METHODOLOGY/PRINCIPAL FINDINGS: To better understand the molecular events underlying these changes, genome-wide gene expression profiling was conducted using digital gene expression (DGE on bovine mammary tissue at three time points (on approximately day 35 before parturition (-35 d, day 7 before parturition (-7 d and day 3 after parturition (+3 d. Approximately 6.2 million (M, 5.8 million (M and 6.1 million (M 21-nt cDNA tags were sequenced in the three cDNA libraries (-35 d, -7 d and +3 d, respectively. After aligning to the reference sequences, the three cDNA libraries included 8,662, 8,363 and 8,359 genes, respectively. With a fold change cutoff criteria of ≥ 2 or ≤-2 and a false discovery rate (FDR of ≤ 0.001, a total of 812 genes were significantly differentially expressed at -7 d compared with -35 d (stage I. Gene ontology analysis showed that those significantly differentially expressed genes were mainly associated with cell cycle, lipid metabolism, immune response and biological adhesion. A total of 1,189 genes were significantly differentially expressed at +3 d compared with -7 d (stage II, and these genes were mainly associated with the immune response and cell cycle. Moreover, there were 1,672 genes significantly differentially expressed at +3 d compared with -35 d. Gene ontology analysis showed that the main differentially expressed genes were those associated with metabolic processes. CONCLUSIONS: The results suggest that the mammary gland begins to lactate not only by a gain of function but also by a broad suppression of function to effectively push most of the cell's resources towards lactation.
MicroRNA-2400 promotes bovine preadipocyte proliferation
International Nuclear Information System (INIS)
Wei, Yao; Cui, Ya Feng; Tong, Hui Li; Zhang, Wei Wei; Yan, Yun Qin
2016-01-01
MicroRNAs (miRNAs) play critical roles in the proliferation of bovine preadipocytes. miR-2400 is a novel and unique miRNA from bovines. In the present study, we separated and identified preadipocytes from bovine samples. miR-2400 overexpression increased the rate of preadipocyte proliferation, which was analyzed with a combination of EdU and flow cytometry. Simultaneously, functional genes related to proliferation (PCNA, CCND2, CCNB1) were also increased, which was detected by real-time PCR. Furthermore, luciferase reporter assays showed that miR-2400 bound directly to the 3'untranslated regions (3′UTRs) of PRDM11 mRNA. These data suggested that miR-2400 could promote preadipocyte proliferation by targeting PRDM11. - Highlights: • miRNAs are important in bovine preadipocyte proliferation. • miR-2400 is a novel miRNA from bovines. • miR-2400 overexpression increased preadipocyte proliferation. • Functional genes related to preadipocyte proliferation were upregulated. • Preadipocyte proliferation was promoted by targeting PRDM11.
Global gene expression response to telomerase in bovine adrenocortical cells
International Nuclear Information System (INIS)
Perrault, Steven D.; Hornsby, Peter J.; Betts, Dean H.
2005-01-01
The infinite proliferative capability of most immortalized cells is dependent upon the presence of the enzyme telomerase and its ability to maintain telomere length and structure. However, telomerase may be involved in a greater system than telomere length regulation, as recent evidence has shown it capable of increasing wound healing in vivo, and improving cellular proliferation rate and survival from apoptosis in vitro. Here, we describe the global gene expression response to ectopic telomerase expression in an in vitro bovine adrenocortical cell model. Telomerase-immortalized cells showed an increased ability for proliferation and survival in minimal essential medium above cells transgenic for GFP. cDNA microarray analyses revealed an altered cell state indicative of increased adrenocortical cell proliferation regulated by the IGF2 pathway and alterations in members of the TGF-B family. As well, we identified alterations in genes associated with development and wound healing that support a model that high telomerase expression induces a highly adaptable, progenitor-like state
van der Weijden, Vera A; Chen, Shuai; Bauersachs, Stefan; Ulbrich, Susanne E; Schoen, Jennifer
2017-11-25
We recently developed an air-liquid interface long-term culture of differentiated bovine oviductal epithelial cells (ALI-BOEC). This ex vivo oviduct epithelium is capable of supporting embryo development in co-culture up to the blastocyst stage without addition of embryo culture medium. However, blastocyst rates in co-culture were markedly lower than in conventional in vitro embryo production procedures. In the present study, we assessed target gene expression of ALI-BOEC derived embryos to test their similarity to embryos from conventional in vitro embryo culture. We screened previously published data from developing bovine embryos and selected 41 genes which are either differentially expressed during embryo development, or reflect differences between various in vitro culture conditions or in vitro and in vivo embryos. Target gene expression was measured in 8-cell embryos and blastocysts using a 48.48 Dynamic Array™ on a Biomark HD instrument. For comparison with the ALI-BOEC system, we generated embryos by two different standard IVP protocols. The culture conditions lead to differential gene expression in both 8-cell embryos and blastocysts. Across the expression of all target genes the embryos developing on ALI-BOEC did not depart from conventional IVP embryos. These first results prove that gene expression in ALI-BOEC embryos is not largely aberrant. However, there was no clear indication for a more in vivo-like target gene expression of these embryos. This calls for further optimization of the ALI-BOEC system to increase its efficiency both quantitatively and qualitatively.
Directory of Open Access Journals (Sweden)
Saurabh Majumder
2013-10-01
Full Text Available Aim: To characterize one of the major glycoprotein genes viz., glycoprotein C (gC; UL44, unique long region 44 of bovineherpesvirus 1(BoHV1 of Indian origin at genetic and phylogenetic level.Materials and Methods: A bovine herpesvirus 1 isolate viz., (BoHV1/IBR 216 II/ 1976/ India maintained at Division ofVirology, IVRI, Mukteswar was used for the current study. The DNA was extracted using commercial kit and the completeORF of gC gene was amplified, cloned, and sequenced by conventional Sanger sequencing method. The sequence wasgenetically and phylogenetically analysed using various bioinformatic tools. The sequence was submitted in the Genbankwith accession number Kc756965.Results: The complete ORF of gC gene was amplified and sequenced. It showed 100% sequence homology with referencecooper strain of BoHV1 and divergence varied from 0% to 2.7% with other isolates of BoHV1. The isolate under study haddivergence of 9.2%, 13%, 26.6%, and 9.2% with BoHV5 (Bovine herpesvirus 5, CvHV1 (Cervid herpesvirus 1, CpHV1(Caprine herpesvirus 1, and BuHV1 (Bubaline herpesvirus 1, respectively.Conclusion: This is the first genetic characterization of complete open reading frame (ORF of glycoprotein C gene (UL44 ofIndian isolate of BoHV1. The gC gene of BoHV1 is highly conserved among all BoHV1 isolates and it can be used as a targetfor designing diagnostic primers for the specific detection of BoHV1.
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Bovine Lhx8, a Germ Cell-Specific Nuclear Factor, Interacts with Figla.
Directory of Open Access Journals (Sweden)
Liyuan Fu
Full Text Available LIM homeobox 8 (Lhx8 is a germ cell-specific transcription factor essential for the development of oocytes during early oogenesis. In mice, Lhx8 deficiency causes postnatal oocyte loss and affects the expression of many oocyte-specific genes. The aims of this study were to characterize the bovine Lhx8 gene, determine its mRNA expression during oocyte development and early embryogenesis, and evaluate its interactions with other oocyte-specific transcription factors. The bovine Lhx8 gene encodes a protein of 377 amino acids. A splice variant of Lhx8 (Lhx8_v1 was also identified. The predicted bovine Lhx8 protein contains two LIM domains and one homeobox domain. However, one of the LIM domains in Lhx8_v1 is incomplete due to deletion of 83 amino acids near the N terminus. Both Lhx8 and Lhx8_v1 transcripts were only detected in the gonads but none of the somatic tissues examined. The expression of Lhx8 and Lhx8_v1 appears to be restricted to oocytes as none of the transcripts was detectable in granulosa or theca cells. The maternal Lhx8 transcript is abundant in GV and MII stage oocytes as well as in early embryos but disappear by morula stage. A nuclear localization signal that is required for the import of Lhx8 into nucleus was identified, and Lhx8 is predominantly localized in the nucleus when ectopically expressed in mammalian cells. Finally, a novel interaction between Lhx8 and Figla, another transcription factor essential for oogenesis, was detected. The results provide new information for studying the mechanisms of action for Lhx8 in oocyte development and early embryogenesis.
LENUS (Irish Health Repository)
Mamo, Solomon
2011-03-16
Abstract Background Without intensive selection, the majority of bovine oocytes submitted to in vitro embryo production (IVP) fail to develop to the blastocyst stage. This is attributed partly to their maturation status and competences. Using the Affymetrix GeneChip Bovine Genome Array, global mRNA expression analysis of immature (GV) and in vitro matured (IVM) bovine oocytes was carried out to characterize the transcriptome of bovine oocytes and then use a variety of approaches to determine whether the observed transcriptional changes during IVM was real or an artifact of the techniques used during analysis. Results 8489 transcripts were detected across the two oocyte groups, of which ~25.0% (2117 transcripts) were differentially expressed (p < 0.001); corresponding to 589 over-expressed and 1528 under-expressed transcripts in the IVM oocytes compared to their immature counterparts. Over expression of transcripts by IVM oocytes is particularly interesting, therefore, a variety of approaches were employed to determine whether the observed transcriptional changes during IVM were real or an artifact of the techniques used during analysis, including the analysis of transcript abundance in oocytes in vitro matured in the presence of α-amanitin. Subsets of the differentially expressed genes were also validated by quantitative real-time PCR (qPCR) and the gene expression data was classified according to gene ontology and pathway enrichment. Numerous cell cycle linked (CDC2, CDK5, CDK8, HSPA2, MAPK14, TXNL4B), molecular transport (STX5, STX17, SEC22A, SEC22B), and differentiation (NACA) related genes were found to be among the several over-expressed transcripts in GV oocytes compared to the matured counterparts, while ANXA1, PLAU, STC1and LUM were among the over-expressed genes after oocyte maturation. Conclusion Using sequential experiments, we have shown and confirmed transcriptional changes during oocyte maturation. This dataset provides a unique reference resource
Directory of Open Access Journals (Sweden)
Mullen Michael P
2010-10-01
Full Text Available Abstract Background Studies in mice and humans have shown that imprinted genes, whereby expression from one of the two parentally inherited alleles is attenuated or completely silenced, have a major effect on mammalian growth, metabolism and physiology. More recently, investigations in livestock species indicate that genes subject to this type of epigenetic regulation contribute to, or are associated with, several performance traits, most notably muscle mass and fat deposition. In the present study, a candidate gene approach was adopted to assess 17 validated single nucleotide polymorphisms (SNPs and their association with a range of performance traits in 848 progeny-tested Irish Holstein-Friesian artificial insemination sires. These SNPs are located proximal to, or within, the bovine orthologs of eight genes (CALCR, GRB10, PEG3, PHLDA2, RASGRF1, TSPAN32, ZIM2 and ZNF215 that have been shown to be imprinted in cattle or in at least one other mammalian species (i.e. human/mouse/pig/sheep. Results Heterozygosities for all SNPs analysed ranged from 0.09 to 0.46 and significant deviations from Hardy-Weinberg proportions (P ≤ 0.01 were observed at four loci. Phenotypic associations (P ≤ 0.05 were observed between nine SNPs proximal to, or within, six of the eight analysed genes and a number of performance traits evaluated, including milk protein percentage, somatic cell count, culled cow and progeny carcass weight, angularity, body conditioning score, progeny carcass conformation, body depth, rump angle, rump width, animal stature, calving difficulty, gestation length and calf perinatal mortality. Notably, SNPs within the imprinted paternally expressed gene 3 (PEG3 gene cluster were associated (P ≤ 0.05 with calving, calf performance and fertility traits, while a single SNP in the zinc finger protein 215 gene (ZNF215 was associated with milk protein percentage (P ≤ 0.05, progeny carcass weight (P ≤ 0.05, culled cow carcass weight (P ≤ 0
2010-01-01
Background Studies in mice and humans have shown that imprinted genes, whereby expression from one of the two parentally inherited alleles is attenuated or completely silenced, have a major effect on mammalian growth, metabolism and physiology. More recently, investigations in livestock species indicate that genes subject to this type of epigenetic regulation contribute to, or are associated with, several performance traits, most notably muscle mass and fat deposition. In the present study, a candidate gene approach was adopted to assess 17 validated single nucleotide polymorphisms (SNPs) and their association with a range of performance traits in 848 progeny-tested Irish Holstein-Friesian artificial insemination sires. These SNPs are located proximal to, or within, the bovine orthologs of eight genes (CALCR, GRB10, PEG3, PHLDA2, RASGRF1, TSPAN32, ZIM2 and ZNF215) that have been shown to be imprinted in cattle or in at least one other mammalian species (i.e. human/mouse/pig/sheep). Results Heterozygosities for all SNPs analysed ranged from 0.09 to 0.46 and significant deviations from Hardy-Weinberg proportions (P ≤ 0.01) were observed at four loci. Phenotypic associations (P ≤ 0.05) were observed between nine SNPs proximal to, or within, six of the eight analysed genes and a number of performance traits evaluated, including milk protein percentage, somatic cell count, culled cow and progeny carcass weight, angularity, body conditioning score, progeny carcass conformation, body depth, rump angle, rump width, animal stature, calving difficulty, gestation length and calf perinatal mortality. Notably, SNPs within the imprinted paternally expressed gene 3 (PEG3) gene cluster were associated (P ≤ 0.05) with calving, calf performance and fertility traits, while a single SNP in the zinc finger protein 215 gene (ZNF215) was associated with milk protein percentage (P ≤ 0.05), progeny carcass weight (P ≤ 0.05), culled cow carcass weight (P ≤ 0.01), angularity (P
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
Åvall-Jääskeläinen, Silja; Paulin, Lars; Blom, Jochen
2018-01-01
Non-aureus staphylococci (NAS) are most commonly isolated from subclinical mastitis. Different NAS species may, however, have diverse effects on the inflammatory response in the udder. We determined the genome sequences of 20 staphylococcal isolates from clinical or subclinical bovine mastitis, belonging to the NAS species Staphylococcus agnetis, S. chromogenes, and S. simulans, and focused on the putative virulence factor genes present in the genomes. For comparison we used our previously published genome sequences of four S. aureus isolates from bovine mastitis. The pan-genome and core genomes of the non-aureus isolates were characterized. After that, putative virulence factor orthologues were searched in silico. We compared the presence of putative virulence factors in the NAS species and S. aureus and evaluated the potential association between bacterial genotype and type of mastitis (clinical vs. subclinical). The NAS isolates had much less virulence gene orthologues than the S. aureus isolates. One third of the virulence genes were detected only in S. aureus. About 100 virulence genes were present in all S. aureus isolates, compared to about 40 to 50 in each NAS isolate. S. simulans differed the most. Several of the virulence genes detected among NAS were harbored only by S. simulans, but it also lacked a number of genes present both in S. agnetis and S. chromogenes. The type of mastitis was not associated with any specific virulence gene profile. It seems that the virulence gene profiles or cumulative number of different virulence genes are not directly associated with the type of mastitis (clinical or subclinical), indicating that host derived factors such as the immune status play a pivotal role in the manifestation of mastitis. PMID:29610707
Directory of Open Access Journals (Sweden)
Silja Åvall-Jääskeläinen
2018-03-01
Full Text Available Non-aureus staphylococci (NAS are most commonly isolated from subclinical mastitis. Different NAS species may, however, have diverse effects on the inflammatory response in the udder. We determined the genome sequences of 20 staphylococcal isolates from clinical or subclinical bovine mastitis, belonging to the NAS species Staphylococcus agnetis, S. chromogenes, and S. simulans, and focused on the putative virulence factor genes present in the genomes. For comparison we used our previously published genome sequences of four S. aureus isolates from bovine mastitis. The pan-genome and core genomes of the non-aureus isolates were characterized. After that, putative virulence factor orthologues were searched in silico. We compared the presence of putative virulence factors in the NAS species and S. aureus and evaluated the potential association between bacterial genotype and type of mastitis (clinical vs. subclinical. The NAS isolates had much less virulence gene orthologues than the S. aureus isolates. One third of the virulence genes were detected only in S. aureus. About 100 virulence genes were present in all S. aureus isolates, compared to about 40 to 50 in each NAS isolate. S. simulans differed the most. Several of the virulence genes detected among NAS were harbored only by S. simulans, but it also lacked a number of genes present both in S. agnetis and S. chromogenes. The type of mastitis was not associated with any specific virulence gene profile. It seems that the virulence gene profiles or cumulative number of different virulence genes are not directly associated with the type of mastitis (clinical or subclinical, indicating that host derived factors such as the immune status play a pivotal role in the manifestation of mastitis.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
No evidence for a bovine mastitis Escherichia coli pathotype.
Leimbach, Andreas; Poehlein, Anja; Vollmers, John; Görlich, Dennis; Daniel, Rolf; Dobrindt, Ulrich
2017-05-08
Escherichia coli bovine mastitis is a disease of significant economic importance in the dairy industry. Molecular characterization of mastitis-associated E. coli (MAEC) did not result in the identification of common traits. Nevertheless, a mammary pathogenic E. coli (MPEC) pathotype has been proposed suggesting virulence traits that differentiate MAEC from commensal E. coli. The present study was designed to investigate the MPEC pathotype hypothesis by comparing the genomes of MAEC and commensal bovine E. coli. We sequenced the genomes of eight E. coli isolated from bovine mastitis cases and six fecal commensal isolates from udder-healthy cows. We analyzed the phylogenetic history of bovine E. coli genomes by supplementing this strain panel with eleven bovine-associated E. coli from public databases. The majority of the isolates originate from phylogroups A and B1, but neither MAEC nor commensal strains could be unambiguously distinguished by phylogenetic lineage. The gene content of both MAEC and commensal strains is highly diverse and dominated by their phylogenetic background. Although individual strains carry some typical E. coli virulence-associated genes, no traits important for pathogenicity could be specifically attributed to MAEC. Instead, both commensal strains and MAEC have very few gene families enriched in either pathotype. Only the aerobactin siderophore gene cluster was enriched in commensal E. coli within our strain panel. This is the first characterization of a phylogenetically diverse strain panel including several MAEC and commensal isolates. With our comparative genomics approach we could not confirm previous studies that argue for a positive selection of specific traits enabling MAEC to elicit bovine mastitis. Instead, MAEC are facultative and opportunistic pathogens recruited from the highly diverse bovine gastrointestinal microbiota. Virulence-associated genes implicated in mastitis are a by-product of commensalism with the primary function
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Sánchez-Villalba, Esther; Arias, María Elena; Zambrano, Fabiola; Loren, Pía; Felmer, Ricardo
2018-02-01
Sperm-mediated gene transfer (SMGT) is a simple, fast, and economical biotechnological tool for producing transgenic animals. However, transgene expression with this technique in bovine embryos is still inefficient due to low uptake and binding of exogenous DNA in spermatozoa. The present study evaluated the effects of sperm membrane destabilization on the binding capacity, location and quantity of bound exogenous DNA in cryopreserved bovine spermatozoa using Triton X-100 (TX-100), lysolecithin (LL) and sodium hydroxide (NaOH). Effects of these treatments were also evaluated by intracytoplasmic sperm injection (ICSI)-SMGT. Results showed that all treatments bound exogenous DNA to spermatozoa including the control. Spermatozoa treated with different membrane destabilizing agents bound the exogenous DNA throughout the head and tail of spermatozoa, compared with the control, in which binding occurred mainly in the post-acrosomal region and tail. The amount of exogenous DNA bound to spermatozoa was much higher for the different sperm treatments than the control (P Exogenous gene expression in embryos was also improved by these treatments. These results demonstrated that sperm membrane destabilization could be a novel strategy in bovine SMGT protocols for the generation of transgenic embryos by ICSI.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Directory of Open Access Journals (Sweden)
S. H. Choi
2015-03-01
Full Text Available We previously demonstrated that bovine subcutaneous preadipocytes promote adipogenic gene expression in muscle satellite cells in a co-culture system. Herein we hypothesize that saturated fatty acids would promote adipogenic/lipogenic gene expression, whereas mono- and polyunsaturated fatty acids would have the opposite effect. Bovine semimembranosus satellite cells (BSC and intramuscular preadipocytes (IPA were isolated from crossbred steers and cultured with 10% fetal bovine serum (FBS/Dulbecco’s Modified Eagle Medium (DMEM and 1% antibiotics during the 3-d proliferation period. After proliferation, cells were treated for 3 d with 3% horse serum/DMEM (BSC or 5% FBS/DMEM (IPA with antibiotics. Media also contained 10 μg/mL insulin and 10 μg/mL pioglitazone. Subsequently, differentiating BSC and IPA were cultured in their respective media with 40 μM palmitic, stearic, oleic, or linoleic acid for 4 d. Finally, BSC and IPA were single- or co-cultured for an additional 2 h. All fatty acid treatments increased (p = 0.001 carnitine palmitoyltransferase-1 beta (CPT1β gene expression, but the increase in CPT1β gene expression was especially pronounced in IPA incubated with palmitic and stearic acid (6- to 17- fold increases. Oleic and linoleic acid decreased (p = 0.001 stearoyl-CoA desaturase (SCD gene expression over 80% in both BSC and IPA. Conversely, palmitic and stearic acid increased SCD gene expression three fold in co-cultured in IPA, and stearic acid increased AMPKα gene expression in single- and co-cultured BSC and IPA. Consistent with our hypothesis, saturated fatty acids, especially stearic acid, promoted adipogenic and lipogenic gene expression, whereas unsaturated fatty acids decreased expression of those genes associated with fatty acid metabolism.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene
International Nuclear Information System (INIS)
Gorodetskii, S.I.; Tkach, T.M.; Kapelinskaya, T.V.
1988-01-01
The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Directory of Open Access Journals (Sweden)
Li Qianqian
2010-10-01
Full Text Available Abstract Background Spontaneous immortalisation of cultured mammary epithelial cells (MECs is an extremely rare event, and the molecular mechanism behind spontaneous immortalisation of MECs is unclear. Here, we report the establishment of a spontaneously immortalised bovine mammary epithelial cell line (BME65Cs and the changes in gene expression associated with BME65Cs cells. Results BME65Cs cells maintain the general characteristics of normal mammary epithelial cells in morphology, karyotype and immunohistochemistry, and are accompanied by the activation of endogenous bTERT (bovine Telomerase Reverse Transcriptase and stabilisation of the telomere. Currently, BME65Cs cells have been passed for more than 220 generations, and these cells exhibit non-malignant transformation. The expression of multiple genes was investigated in BME65Cs cells, senescent BMECs (bovine MECs cells, early passage BMECs cells and MCF-7 cells (a human breast cancer cell line. In comparison with early passage BMECs cells, the expression of senescence-relevant apoptosis-related gene were significantly changed in BME65Cs cells. P16INK4a was downregulated, p53 was low expressed and Bax/Bcl-2 ratio was reversed. Moreover, a slight upregulation of the oncogene c-Myc, along with an undetectable level of breast tumor-related gene Bag-1 and TRPS-1, was observed in BME65Cs cells while these genes are all highly expressed in MCF-7. In addition, DNMT1 is upregulated in BME65Cs. These results suggest that the inhibition of both senescence and mitochondrial apoptosis signalling pathways contribute to the immortality of BME65Cs cells. The expression of p53 and p16INK4a in BME65Cs was altered in the pattern of down-regulation but not "loss", suggesting that this spontaneous immortalization is possibly initiated by other mechanism rather than gene mutation of p53 or p16INK4a. Conclusions Spontaneously immortalised BME65Cs cells maintain many characteristics of normal BMEC cells and
Sun, Jiajie; Jin, Qijiang; Zhang, Chunlei; Fang, Xingtang; Gu, Chuanwen; Lei, Chuzhao; Wang, Juqiang; Chen, Hong
2011-06-01
Transgenically expressed Syndecan-1 was found in the hypothalamic nuclei that control energy balance, and was associated with maturity-onset obesity, while ghrelin has been shown to play important roles in the control of food intake, gastric acid secretion, energy homeostasis, and glucose and lipid metabolism. However, the roles of genetic variations of Syndecan-1 and ghrelin on growth trait have few been reported in cattle. Herein, five Chinese cattle breeds were analyzed by PCR-SSCP and DNA sequencing methods. The bovine ghrelin gene showed eleven SNPs g.[267G>A, 271G>A, 290C>T, 326A>G, 327T>C, 420C>A, 569A>G, 945C>T, 993C>T, 4491A>G, 4644G>A] and three SNPs g.[420C>A, 569 A>G, 945C>T] were firstly detected in cattle. The bovine Syndecan-1 gene showed two SNPs. One SNP showed a transition C>G at position 21514, resulting in a synonymous mutation p.G(GGC)169G(GGG) and another showed a transversion C>T at position 22591, resulting in a synonymous mutation p.D(GAC)283D(GAT). In ghrelin gene, no significant associations were revealed between any variant sites and body weight, average daily gain, body sizes for different growth periods (6, 12, 18, and 24 months old), as well as for the milk yield at 305 days, milk protein rate and milk fat percentage. However, the polymorphism of Syndecan-1 gene was significantly associated with bovine birth weight and body length. Hence, we first suggested that Syndecan-1 gene could be regarded as molecular marker for superior birth weight and body length.
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Zhang, Ya-Ran; Gui, Lin-Sheng; Li, Yao-Kun; Jiang, Bi-Jie; Wang, Hong-Cheng; Zhang, Ying-Ying; Zan, Lin-Sen
2015-07-27
Smoothened (Smo)-mediated Hedgehog (Hh) signaling pathway governs the patterning, morphogenesis and growth of many different regions within animal body plans. This study evaluated the effects of genetic variations of the bovine SMO gene on economically important body size traits in Chinese Qinchuan cattle. Altogether, eight single nucleotide polymorphisms (SNPs: 1-8) were identified and genotyped via direct sequencing covering most of the coding region and 3'UTR of the bovine SMO gene. Both the p.698Ser.>Ser. synonymous mutation resulted from SNP1 and the p.700Ser.>Pro. non-synonymous mutation caused by SNP2 mapped to the intracellular C-terminal tail of bovine Smo protein; the other six SNPs were non-coding variants located in the 3'UTR. The linkage disequilibrium was analyzed, and five haplotypes were discovered in 520 Qinchuan cattle. Association analyses showed that SNP2, SNP3/5, SNP4 and SNP6/7 were significantly associated with some body size traits (p 0.05). Meanwhile, cattle with wild-type combined haplotype Hap1/Hap1 had significantly (p cattle, and the wild-type haplotype Hap1 together with the wild-type alleles of these detected SNPs in the SMO gene could be used to breed cattle with superior body size traits. Therefore, our results could be helpful for marker-assisted selection in beef cattle breeding programs.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Zhang, Ya-Ran; Gui, Lin-Sheng; Li, Yao-Kun; Jiang, Bi-Jie; Wang, Hong-Cheng; Zhang, Ying-Ying; Zan, Lin-Sen
2015-01-01
Smoothened (Smo)-mediated Hedgehog (Hh) signaling pathway governs the patterning, morphogenesis and growth of many different regions within animal body plans. This study evaluated the effects of genetic variations of the bovine SMO gene on economically important body size traits in Chinese Qinchuan cattle. Altogether, eight single nucleotide polymorphisms (SNPs: 1–8) were identified and genotyped via direct sequencing covering most of the coding region and 3ʹUTR of the bovine SMO gene. Both the p.698Ser.>Ser. synonymous mutation resulted from SNP1 and the p.700Ser.>Pro. non-synonymous mutation caused by SNP2 mapped to the intracellular C-terminal tail of bovine Smo protein; the other six SNPs were non-coding variants located in the 3ʹUTR. The linkage disequilibrium was analyzed, and five haplotypes were discovered in 520 Qinchuan cattle. Association analyses showed that SNP2, SNP3/5, SNP4 and SNP6/7 were significantly associated with some body size traits (p 0.05). Meanwhile, cattle with wild-type combined haplotype Hap1/Hap1 had significantly (p < 0.05) greater body length than those with Hap2/Hap2. Our results indicate that variations in the SMO gene could affect body size traits of Qinchuan cattle, and the wild-type haplotype Hap1 together with the wild-type alleles of these detected SNPs in the SMO gene could be used to breed cattle with superior body size traits. Therefore, our results could be helpful for marker-assisted selection in beef cattle breeding programs. PMID:26225956
Directory of Open Access Journals (Sweden)
Feng Wang
Full Text Available To evaluate the potential effects of melatonin on the kinetics of embryo development and quality of blastocyst during the process of in vitro bovine embryo culture. Bovine cumulus-oocyte complexes (COCs were fertilized after in vitro maturation. The presumed zygotes were cultured in in vitro culture medium supplemented with or without 10(-7 M melatonin. The cleavage rate, 8-cell rate and blastocyst rate were examined to identify the kinetics of embryo development. The hatched blastocyst rate, mortality rate after thawing and the relevant transcript abundance were measured to evaluate the quality of blastocyst. The results showed that melatonin significantly promoted the cleavage rate and 8-cell embryo yield of in vitro produced bovine embryo. In addition, significantly more blastocysts were observed by Day 7 of embryo culture at the presence of melatonin. These results indicated that melatonin accelerated the development of in vitro produced bovine embryos. Following vitrification at Day 7 of embryo culture, melatonin (10(-7 M significantly increased the hatched blastocyst rate from 24 h to 72 h and decreased the mortality rate from 48 h to 72 h after thawing. The presence of melatonin during the embryo culture resulted in a significant increase in the gene expressions of DNMT3A, OCC, CDH1 and decrease in that of AQP3 after thawing. In conclusion, melatonin not only promoted blastocyst yield and accelerated in vitro bovine embryo development, but also improved the quality of blastocysts which was indexed by an elevated cryotolerance and the up-regulated expressions of developmentally important genes.
77 FR 29914 - Bovine Spongiform Encephalopathy; Importation of Bovines and Bovine Products
2012-05-21
... Spongiform Encephalopathy; Importation of Bovines and Bovine Products AGENCY: Animal and Plant Health... derived from bovines with regard to bovine spongiform encephalopathy. This action will allow interested... importation of live bovines and products derived from bovines with regard to bovine spongiform encephalopathy...
Methicillin resistant staphylococci associated with bovine mastitis and their zoonotic importance
Directory of Open Access Journals (Sweden)
S. Vishnupriya
2014-06-01
Full Text Available Aim: The present study was conducted to determine the zoonotic importance of methicillin resistant staphylococci associated with bovine mastitis and their potential role in transmission to animal handlers. Materials and Methods: A total of 158 milk samples from bovine mastitis cases and 126 nasal swabs from the animal handlers were sampled in and around Pondicherry (Southern India. The Presence of Staphylococcal organism was confirmed by PCR amplification using the genus specific primers and among the isolated Staphylococci; methicillin resistance was identified by genetic amplification of mec A methicillin resistant gene. Then the amplified gene from the bacteria expressing the mecA gene (PBP2a (~2kb fragment was further sequenced using four sets of primer pairs and aligned for determining their genetic relatedness between the sequences. Both phenotypic and genotypic analysis was carried out for the six MRS isolates (three bovine and three human in this study. Results: Out of 158 mastitis milk samples; 96 and 19 bovine isolates were found to be positive for Staphylococcal genus specific PCR and methicillin resistant (mecA gene PCR, respectively. Similarly, Out of 126 human nasal swabs, 64 and 13 human isolates were found to be positive for Staphylococcal genus specific PCR and mec A gene PCR, respectively. Among the 160 staphylococcal isolates (Bovine and Human origin; 51 were identified as coagulase-positive staphylococci (CPS and remaining as coagulase-negative staphylococci (CONS. The results obtained in this study revealed the presence of many species of Staphylococci but the predominant species were Staphylococcus aureus and S. epidermidis. The Sequence analysis of the mec A gene of human isolates obtained in this study had a maximum identity (99% -100% with the bovine isolates. Conclusion: The phenotypic and genotypic analysis carried out for the six MRS (Methicillin Resistant Staphylococci isolates in this study were indistinguishable
Gene number determination and genetic polymorphism of the gamma delta T cell co-receptor WC1 genes
Directory of Open Access Journals (Sweden)
Chen Chuang
2012-10-01
Full Text Available Abstract Background WC1 co-receptors belong to the scavenger receptor cysteine-rich (SRCR superfamily and are encoded by a multi-gene family. Expression of particular WC1 genes defines functional subpopulations of WC1+ γδ T cells. We have previously identified partial or complete genomic sequences for thirteen different WC1 genes through annotation of the bovine genome Btau_3.1 build. We also identified two WC1 cDNA sequences from other cattle that did not correspond to sequences in the Btau_3.1 build. Their absence in the Btau_3.1 build may have reflected gaps in the genome assembly or polymorphisms among animals. Since the response of γδ T cells to bacterial challenge is determined by WC1 gene expression, it was critical to understand whether individual cattle or breeds differ in the number of WC1 genes or display polymorphisms. Results Real-time quantitative PCR using DNA from the animal whose genome was sequenced (“Dominette” and sixteen other animals representing ten breeds of cattle, showed that the number of genes coding for WC1 co-receptors is thirteen. The complete coding sequences of those thirteen WC1 genes is presented, including the correction of an error in the WC1-2 gene due to mis-assembly in the Btau_3.1 build. All other cDNA sequences were found to agree with the previous annotation of complete or partial WC1 genes. PCR amplification and sequencing of the most variable N-terminal SRCR domain (domain 1 which has the SRCR “a” pattern of each of the thirteen WC1 genes showed that the sequences are highly conserved among individuals and breeds. Of 160 sequences of domain 1 from three breeds of cattle, no additional sequences beyond the thirteen described WC1 genes were found. Analysis of the complete WC1 cDNA sequences indicated that the thirteen WC1 genes code for three distinct WC1 molecular forms. Conclusion The bovine WC1 multi-gene family is composed of thirteen genes coding for three structural forms whose
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
International Nuclear Information System (INIS)
Slavikova, K.; Zajac, V.
1989-01-01
Sera from bovine leukaemia virus (BLV)-infected cattle and sheep were tested by radioimmunoassay and Western blot for their reactivity with 60,000 protein coded by the env gene of BLV and expressed in Escherichia coli. This protein, antigenically similar to BLV protein, reacted with antibodies against BLV antigens in the sera tested. (author). 3 figs., 1 tab., 13 refs
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Directory of Open Access Journals (Sweden)
Boussaha Mekki
2006-05-01
Full Text Available Abstract Background The Fragile Histidine Triad gene (FHIT is an oncosuppressor implicated in many human cancers, including vesical tumors. FHIT is frequently hit by deletions caused by fragility at FRA3B, the most active of human common fragile sites, where FHIT lays. Vesical tumors affect also cattle, including animals grazing in the wild on bracken fern; compounds released by the fern are known to induce chromosome fragility and may trigger cancer with the interplay of latent Papilloma virus. Results The bovine FHIT was characterized by assembling a contig of 78 BACs. Sequence tags were designed on human exons and introns and used directly to select bovine BACs, or compared with sequence data in the bovine genome database or in the trace archive of the bovine genome sequencing project, and adapted before use. FHIT is split in ten exons like in man, with exons 5 to 9 coding for a 149 amino acids protein. VISTA global alignments between bovine genomic contigs retrieved from the bovine genome database and the human FHIT region were performed. Conservation was extremely high over a 2 Mb region spanning the whole FHIT locus, including the size of introns. Thus, the bovine FHIT covers about 1.6 Mb compared to 1.5 Mb in man. Expression was analyzed by RT-PCR and Northern blot, and was found to be ubiquitous. Four cDNA isoforms were isolated and sequenced, that originate from an alternative usage of three variants of exon 4, revealing a size very close to the major human FHIT cDNAs. Conclusion A comparative genomic approach allowed to assemble a contig of 78 BACs and to completely annotate a 1.6 Mb region spanning the bovine FHIT gene. The findings confirmed the very high level of conservation between human and bovine genomes and the importance of comparative mapping to speed the annotation process of the recently sequenced bovine genome. The detailed knowledge of the genomic FHIT region will allow to study the role of FHIT in bovine cancerogenesis
Uboldi, Cristina; Guidi, Elena; Roperto, Sante; Russo, Valeria; Roperto, Franco; Di Meo, Giulia Pia; Iannuzzi, Leopoldo; Floriot, Sandrine; Boussaha, Mekki; Eggen, André; Ferretti, Luca
2006-05-23
The Fragile Histidine Triad gene (FHIT) is an oncosuppressor implicated in many human cancers, including vesical tumors. FHIT is frequently hit by deletions caused by fragility at FRA3B, the most active of human common fragile sites, where FHIT lays. Vesical tumors affect also cattle, including animals grazing in the wild on bracken fern; compounds released by the fern are known to induce chromosome fragility and may trigger cancer with the interplay of latent Papilloma virus. The bovine FHIT was characterized by assembling a contig of 78 BACs. Sequence tags were designed on human exons and introns and used directly to select bovine BACs, or compared with sequence data in the bovine genome database or in the trace archive of the bovine genome sequencing project, and adapted before use. FHIT is split in ten exons like in man, with exons 5 to 9 coding for a 149 amino acids protein. VISTA global alignments between bovine genomic contigs retrieved from the bovine genome database and the human FHIT region were performed. Conservation was extremely high over a 2 Mb region spanning the whole FHIT locus, including the size of introns. Thus, the bovine FHIT covers about 1.6 Mb compared to 1.5 Mb in man. Expression was analyzed by RT-PCR and Northern blot, and was found to be ubiquitous. Four cDNA isoforms were isolated and sequenced, that originate from an alternative usage of three variants of exon 4, revealing a size very close to the major human FHIT cDNAs. A comparative genomic approach allowed to assemble a contig of 78 BACs and to completely annotate a 1.6 Mb region spanning the bovine FHIT gene. The findings confirmed the very high level of conservation between human and bovine genomes and the importance of comparative mapping to speed the annotation process of the recently sequenced bovine genome. The detailed knowledge of the genomic FHIT region will allow to study the role of FHIT in bovine cancerogenesis, especially of vesical papillomavirus-associated cancers of
Directory of Open Access Journals (Sweden)
Nicholas J Hudson
Full Text Available BACKGROUND: Despite modern technologies and novel computational approaches, decoding causal transcriptional regulation remains challenging. This is particularly true for less well studied organisms and when only gene expression data is available. In muscle a small number of well characterised transcription factors are proposed to regulate development. Therefore, muscle appears to be a tractable system for proposing new computational approaches. METHODOLOGY/PRINCIPAL FINDINGS: Here we report a simple algorithm that asks "which transcriptional regulator has the highest average absolute co-expression correlation to the genes in a co-expression module?" It correctly infers a number of known causal regulators of fundamental biological processes, including cell cycle activity (E2F1, glycolysis (HLF, mitochondrial transcription (TFB2M, adipogenesis (PIAS1, neuronal development (TLX3, immune function (IRF1 and vasculogenesis (SOX17, within a skeletal muscle context. However, none of the canonical pro-myogenic transcription factors (MYOD1, MYOG, MYF5, MYF6 and MEF2C were linked to muscle structural gene expression modules. Co-expression values were computed using developing bovine muscle from 60 days post conception (early foetal to 30 months post natal (adulthood for two breeds of cattle, in addition to a nutritional comparison with a third breed. A number of transcriptional landscapes were constructed and integrated into an always correlated landscape. One notable feature was a 'metabolic axis' formed from glycolysis genes at one end, nuclear-encoded mitochondrial protein genes at the other, and centrally tethered by mitochondrially-encoded mitochondrial protein genes. CONCLUSIONS/SIGNIFICANCE: The new module-to-regulator algorithm complements our recently described Regulatory Impact Factor analysis. Together with a simple examination of a co-expression module's contents, these three gene expression approaches are starting to illuminate the in vivo
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Molecular cloning and characterization of Izumo1 gene from bovine testis
Kim, Ekyune
2015-01-01
A well-characterized sperm specific protein of the Member of immunoglobulin superfamily, IZUMO1, has crucial role in fertilization by mediating sperm binding to the egg plasma membrane in the mouse. However little is known about IZUMO1 in bovine. Here, we describe the molecular cloning and expression analysis of bovine IZUMO1 (bIZUMO1). RT-PCR and Western blot analysis of the bovine tissues indicated that bIZUMO1 was specifically expressed in the testis and sperm, Furthermore, the result of o...
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
Characterization of Bovine 5′-flanking Region during Differentiation of Mouse Embryonic Stem Cells
Directory of Open Access Journals (Sweden)
Hye-Jeong Jang
2015-12-01
Full Text Available Embryonic stem cells (ESCs have been used as a powerful tool for research including gene manipulated animal models and the study of developmental gene regulation. Among the critical regulatory factors that maintain the pluripotency and self-renewal of undifferentiated ESCs, NANOG plays a very important role. Nevertheless, because pluripotency maintaining factors and specific markers for livestock ESCs have not yet been probed, few studies of the NANOG gene from domestic animals including bovine have been reported. Therefore, we chose mouse ESCs in order to understand and compare NANOG expression between bovine, human, and mouse during ESCs differentiation. We cloned a 600 bp (−420/+181 bovine NANOG 5′-flanking region, and tagged it with humanized recombinant green fluorescent protein (hrGFP as a tracing reporter. Very high GFP expression for bovine NANOG promoter was observed in the mouse ESC line. GFP expression was monitored upon ESC differentiation and was gradually reduced along with differentiation toward neurons and adipocyte cells. Activity of bovine NANOG (−420/+181 promoter was compared with already known mouse and human NANOG promoters in mouse ESC and they were likely to show a similar pattern of regulation. In conclusion, bovine NANOG 5-flanking region functions in mouse ES cells and has characteristics similar to those of mouse and human. These results suggest that bovine gene function studied in mouse ES cells should be evaluated and extrapolated for application to characterization of bovine ES cells.
The influence of bovine milk high or low in isoflavones on hepatic gene expression in mice
DEFF Research Database (Denmark)
Skaanild, Mette Tingleff; Nielsen, Tina Skau
2012-01-01
Isoflavones have generated much attention due to their potential positive effects in various diseases. Phytoestrogens especially equol can be found in bovine milk, as feed ration for dairy cows is comprised of plants containing phytoestrogens. The aim of this study was to analyze the changes...... in hepatic gene expression after dietary intake of milk high and low in isoflavones. In addition to pelleted feed female NMRI mice were offered water, water added either 17β-estradiol, equol, Tween 80, and milk high and low in isoflavone content for a week. Gene expression was analyzed using an array q......PCR kit. It was revealed that Tween 80 and 17β-estradiol upregulated both phase I and phase II genes to the same extent whereas equol alone, high and low isoflavone milk did not alter the expression of phase I genes but decreased the expression of phase II genes. This study shows that dietary isoflavones...
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Directory of Open Access Journals (Sweden)
Y. Suzuki
2012-09-01
Full Text Available Adipokines, adipocyte-derived protein, have important roles in various kinds of physiology including energy homeostasis. Chemerin, one of adipocyte-derived adipokines, is highly expressed in differentiated adipocytes and is known to induce macrophage chemotaxis and glucose intolerance. The objective of the present study was to investigate the changes of chemerin and the chemokine-like-receptor 1 (CMKLR1 gene expression levels during differentiation of the bovine adipocyte and in differentiated adipocytes treated with tumor necrosis factor-α (TNF-α, adiponectin, leptin, and chemerin (peptide analog. The expression levels of the chemerin gene increased at d 6 and 12 of the differentiation period accompanied by increased cytoplasm lipid droplets. From d 6 onward, peroxisome proliferator-activated receptor-γ2 (PPAR-γ2 gene expression levels were significantly higher than that of d 0 and 3. In contrast, CMKLR1 expression levels decreased at the end of the differentiation period. In fully differentiated adipocytes (i.e. at d 12, the treatment of TNF-α and adiponectin upregulated both chemerin and CMKLR1 gene expression levels, although leptin did not show such effects. Moreover, chemerin analog treatment was shown to upregulate chemerin gene expression levels regardless of doses. These results suggest that the expression of chemerin in bovine adipocyte might be regulated by chemerin itself and other adipokines, which indicates its possible role in modulating the adipokine secretions in adipose tissues.
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Graham, Simon P; Honda, Yoshikazu; Pellé, Roger; Mwangi, Duncan M; Glew, E Jane; de Villiers, Etienne P; Shah, Trushar; Bishop, Richard; van der Bruggen, Pierre; Nene, Vishvanath; Taracha, Evans L N
2007-02-09
Immunity against the bovine protozoan parasite Theileria parva has previously been shown to be mediated through lysis of parasite-infected cells by MHC class I restricted CD8+ cytotoxic T lymphocytes. It is hypothesized that identification of CTL target schizont antigens will aid the development of a sub-unit vaccine. We exploited the availability of the complete genome sequence data and bioinformatics tools to identify genes encoding secreted or membrane anchored proteins that may be processed and presented by the MHC class I molecules of infected cells to CTL. Of the 986 predicted open reading frames (ORFs) encoded by chromosome 1 of the T. parva genome, 55 were selected based on the presence of a signal peptide and/or a transmembrane helix domain. Thirty six selected ORFs were successfully cloned into a eukaryotic expression vector, transiently transfected into immortalized bovine skin fibroblasts and screened in vitro using T. parva-specific CTL. Recognition of gene products by CTL was assessed using an IFN-gamma ELISpot assay. A 525 base pair ORF encoding a 174 amino acid protein, designated Tp2, was identified by T. parva-specific CTL from 4 animals. These CTL recognized and lysed Tp2 transfected skin fibroblasts and recognized 4 distinct epitopes. Significantly, Tp2 specific CD8+ T cell responses were observed during the protective immune response against sporozoite challenge. The identification of an antigen containing multiple CTL epitopes and its apparent immunodominance during a protective anti-parasite response makes Tp2 an attractive candidate for evaluation of its vaccine potential.
International Nuclear Information System (INIS)
Peng, Jing; Zhang, Xinming; Li, Zhaoyang; Liu, Yunde; Yang, Xianjin
2015-01-01
Titania nanotube (TNT) delivery of fetal bovine serum (FBS) was conducted on titanium (Ti) to enhance bone tissue repair. Scanning electron microscopy (SEM) and energy dispersive spectrometer (EDS) showed FBS increased the tube wall thickness and decreased the tube diameter. Attenuated total reflectance Fourier transform infrared further confirmed that FBS completely covered the TNT and changed the surface composition. Water contact angle tests showed TNT/FBS possessed hydrophilic properties. Compared to original Ti, the TNT/FBS group had more attached osteoblasts after 2 h and enhanced filopodia growth at 0.5 h. Significantly, more osteoblasts were also observed on TNT/FBS after 7 d culturing. FBS was released steadily from TNT; about 70% of FBS had been released at 3 d and 90% at 5 d, as shown by the bicinchoninic acid method. TNT/FBS also enhanced subsequent osteoblast differentiation and gene expression; the quantum real-time polymerase chain reaction test showed that TNT/FBS up-regulated alkaline phosphatase and osteocalcin gene expression at 7 d and 14 d. Therefore, TNT/FBS delivered sustained in situ nutrition and enhanced osteoblast activity and osteogenic gene expression. - Highlights: • Fetal Bovine Serum (FBS) was filled in titania nanotube (TNT) structures. • FBS provided sustained-release in situ nutrition for surface osteoblast growth. • TNT/FBS enhanced osteoblast activity and osteogenic gene expression
Energy Technology Data Exchange (ETDEWEB)
Peng, Jing, E-mail: pengjingtd@163.com [Airport College, Civil Aviation University of China, Tianjin 300300 (China); Zhang, Xinming, E-mail: xinmingmail@163.com [Tianjin Product Quality Inspection Technology Research Institute, Tianjin 300384 (China); School of Materials Science and Engineering, Tianjin University, Tianjin 300072 (China); Li, Zhaoyang [School of Materials Science and Engineering, Tianjin University, Tianjin 300072 (China); Liu, Yunde [School of Medical Laboratory, Tianjin Medical University, Tianjin 300203 (China); Yang, Xianjin [School of Materials Science and Engineering, Tianjin University, Tianjin 300072 (China)
2015-11-01
Titania nanotube (TNT) delivery of fetal bovine serum (FBS) was conducted on titanium (Ti) to enhance bone tissue repair. Scanning electron microscopy (SEM) and energy dispersive spectrometer (EDS) showed FBS increased the tube wall thickness and decreased the tube diameter. Attenuated total reflectance Fourier transform infrared further confirmed that FBS completely covered the TNT and changed the surface composition. Water contact angle tests showed TNT/FBS possessed hydrophilic properties. Compared to original Ti, the TNT/FBS group had more attached osteoblasts after 2 h and enhanced filopodia growth at 0.5 h. Significantly, more osteoblasts were also observed on TNT/FBS after 7 d culturing. FBS was released steadily from TNT; about 70% of FBS had been released at 3 d and 90% at 5 d, as shown by the bicinchoninic acid method. TNT/FBS also enhanced subsequent osteoblast differentiation and gene expression; the quantum real-time polymerase chain reaction test showed that TNT/FBS up-regulated alkaline phosphatase and osteocalcin gene expression at 7 d and 14 d. Therefore, TNT/FBS delivered sustained in situ nutrition and enhanced osteoblast activity and osteogenic gene expression. - Highlights: • Fetal Bovine Serum (FBS) was filled in titania nanotube (TNT) structures. • FBS provided sustained-release in situ nutrition for surface osteoblast growth. • TNT/FBS enhanced osteoblast activity and osteogenic gene expression.
Emaneini, Mohammad; Khoramian, Babak; Jabalameli, Fereshteh; Abani, Samira; Dabiri, Hossein; Beigverdi, Reza
2016-02-01
Streptococcus agalactiae is a leading cause of human and bovine infections. A total of 194 S. agalactiae isolates, 55 isolates from bovines and 139 from humans, were analyzed for capsular types, virulence genes (scpB, hly, rib, bca and bac) and mobile genetic elements (IS1548 and GBSi1) using polymerase chain reaction (PCR) and multiplex PCR. Capsular type III was predominant (61%), followed by types V, II, Ib, and IV. The scpB, hly, bca and bac virulence genes were only found among human isolates. Twelve and 2 distinct virulence gene profiles were identified among human and bovine isolates respectively. The virulence gene profiles scpB- hly- IS1548- rib-bca (51%) and scpB- hly- IS1548- bca (19%) were only predominant among human isolates. The rib gene was the most common virulence gene in both human and bovine isolates. The study showed a high prevalence of virulence genes in S. agalactiae strains isolated from human infections, these result can support the idea that S. agalactiae isolated from humans and bovines are generally unrelated and probably belonged to separate populations. Copyright © 2015 Elsevier Ltd. All rights reserved.
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
Hu, Qian; Tong, Huili; Zhao, Dandan; Cao, Yunkao; Zhang, Weiwei; Chang, Shuwei; Yang, Yu; Yan, Yunqin
2015-03-01
The promoter of skeletal muscle α-actin gene (ACTA1) is highly muscle specific. The core of the bovine ACTA1 promoter extends from +29 to -233, about 262 base pairs (bp), which is sufficient to activate transcription in bovine muscle satellite cells. In this study, analysis by PCR site-specific mutagenesis showed that the cis-acting element SRE (serum response element binding factor) was processed as a transcriptional activator. In order to enhance the bovine ACTA1 promoter's activity, we used a strategy to modify it. We cloned a fragment containing three SREs from the promoter of ACTA1, and then one or two clones were linked upstream of the core promoter (262 bp) of ACTA1. One and two clones increased the activity of the ACTA1 promoter 3-fold and 10-fold, respectively, and maintained muscle tissue specificity. The modified promoter with two clones could increase the level of ACTA1 mRNA and protein 4-fold and 1.1-fold, respectively. Immunofluorescence results showed that green fluorescence of ACTA1 increased. Additionally, the number of total muscle microfilaments increased. These genetically engineered promoters might be useful for regulating gene expression in muscle cells and improving muscle mass in livestock.
Directory of Open Access Journals (Sweden)
J. Huang
2017-10-01
Full Text Available PPARD is involved in multiple biological processes, especially for those associated with energy metabolism. PPARD regulates lipid metabolism through up-regulate expression of genes associating with adipogenesis. This makes PPARD a significant candidate gene for production traits of livestock animals. Association studies between PPARD polymorphisms and production traits have been reported in pigs but are limited for other animals, including cattle. Here, we investigated the expression profile and polymorphism of bovine PPARD as well as their association with growth traits in Chinese cattle. Our results showed that the highest expression of PPARD was detected in kidney, following by adipose, which is consistent with its involvement in energy metabolism. Three SNPs of PPARD were detected and used to undergo selection pressure according the result of Hardy–Weinberg equilibrium analysis (P < 0.05. Moreover, all of these SNPs showed moderate diversity (0.25 < PIC < 0.5, indicating their relatively high selection potential. Association analysis suggested that individuals with the GAAGTT combined genotype of three SNPs detected showed optimal values in all of the growth traits analyzed. These results revealed that the GAAGTT combined genotype of three SNPs detected in the bovine PPARD gene was a significant potential genetic marker for marker-assisted selection in Chinese cattle. However, this should be further verified in larger populations before being applied to breeding.
Directory of Open Access Journals (Sweden)
Ouali Ahmed
2008-04-01
Full Text Available Abstract Background The superfamily of serine proteinase inhibitors (serpins is involved in numerous fundamental biological processes as inflammation, blood coagulation and apoptosis. Our interest is focused on the SERPINA3 sub-family. The major human plasma protease inhibitor, α1-antichymotrypsin, encoded by the SERPINA3 gene, is homologous to genes organized in clusters in several mammalian species. However, although there is a similar genic organization with a high degree of sequence conservation, the reactive-centre-loop domains, which are responsible for the protease specificity, show significant divergences. Results We provide additional information by analyzing the situation of SERPINA3 in the bovine genome. A cluster of eight genes and one pseudogene sharing a high degree of identity and the same structural organization was characterized. Bovine SERPINA3 genes were localized by radiation hybrid mapping on 21q24 and only spanned over 235 Kilobases. For all these genes, we propose a new nomenclature from SERPINA3-1 to SERPINA3-8. They share approximately 70% of identity with the human SERPINA3 homologue. In the cluster, we described an original sub-group of six members with an unexpected high degree of conservation for the reactive-centre-loop domain, suggesting a similar peptidase inhibitory pattern. Preliminary expression analyses of these bovSERPINA3s showed different tissue-specific patterns and diverse states of glycosylation and phosphorylation. Finally, in the context of phylogenetic analyses, we improved our knowledge on mammalian SERPINAs evolution. Conclusion Our experimental results update data of the bovine genome sequencing, substantially increase the bovSERPINA3 sub-family and enrich the phylogenetic tree of serpins. We provide new opportunities for future investigations to approach the biological functions of this unusual subset of serine proteinase inhibitors.
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Naushad, Sohail; Barkema, Herman W.; Luby, Christopher; Condas, Larissa A. Z.; Nobrega, Diego B.; Carson, Domonique A.; De Buck, Jeroen
2016-01-01
Non-aureus staphylococci (NAS), a heterogeneous group of a large number of species and subspecies, are the most frequently isolated pathogens from intramammary infections in dairy cattle. Phylogenetic relationships among bovine NAS species are controversial and have mostly been determined based on single-gene trees. Herein, we analyzed phylogeny of bovine NAS species using whole-genome sequencing (WGS) of 441 distinct isolates. In addition, evolutionary relationships among bovine NAS were estimated from multilocus data of 16S rRNA, hsp60, rpoB, sodA, and tuf genes and sequences from these and numerous other single genes/proteins. All phylogenies were created with FastTree, Maximum-Likelihood, Maximum-Parsimony, and Neighbor-Joining methods. Regardless of methodology, WGS-trees clearly separated bovine NAS species into five monophyletic coherent clades. Furthermore, there were consistent interspecies relationships within clades in all WGS phylogenetic reconstructions. Except for the Maximum-Parsimony tree, multilocus data analysis similarly produced five clades. There were large variations in determining clades and interspecies relationships in single gene/protein trees, under different methods of tree constructions, highlighting limitations of using single genes for determining bovine NAS phylogeny. However, based on WGS data, we established a robust phylogeny of bovine NAS species, unaffected by method or model of evolutionary reconstructions. Therefore, it is now possible to determine associations between phylogeny and many biological traits, such as virulence, antimicrobial resistance, environmental niche, geographical distribution, and host specificity. PMID:28066335
DEFF Research Database (Denmark)
Mazzoni, Gianluca; Razza, Eduardo; Pedersen, Hanne S.
2017-01-01
In vitro production (IW) of bovine embryos has become widespread technology implemented in cattle breeding and production. Here, we review novel data on cumulus/granulosa cell gene expression, as determined by RNAseq on cellular material from pooled follicular fluids at the single animal level...
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Construction and application of a bovine immune-endocrine cDNA microarray.
Tao, Wenjing; Mallard, Bonnie; Karrow, Niel; Bridle, Byram
2004-09-01
A variety of commercial DNA arrays specific for humans and rodents are widely available; however, microarrays containing well-characterized genes to study pathway-specific gene expression are not as accessible for domestic animals, such as cattle, sheep and pigs. Therefore, a small-scale application-targeted bovine immune-endocrine cDNA array was developed to evaluate genetic pathways involved in the immune-endocrine axis of cattle during periods of altered homeostasis provoked by physiological or environmental stressors, such as infection, vaccination or disease. For this purpose, 167 cDNA sequences corresponding to immune, endocrine and inflammatory response genes were collected and categorized. Positive controls included 5 housekeeping genes (glyceraldehydes-3-phosphate dehydrogenase, hypoxanthine phosphoribosyltransferase, ribosomal protein L19, beta-actin, beta2-microglobulin) and bovine genomic DNA. Negative controls were a bacterial gene (Rhodococcus equi 17-kDa virulence-associated protein) and a partial sequence of the plasmid pACYC177. In addition, RNA extracted from un-stimulated, as well as superantigen (Staphylococcus aureus enterotoxin-A, S. aureus Cowan Pansorbin Cells) and mitogen-stimulated (LPS, ConA) bovine blood leukocytes was mixed, reverse transcribed and PCR amplified using gene-specific primers. The endocrine-associated genes were amplified from cDNA derived from un-stimulated bovine hypothalamus, pituitary, adrenal and thyroid gland tissues. The array was constructed in 4 repeating grids of 180 duplicated spots by coupling the PCR amplified 213-630 bp gene fragments onto poly-l-lysine coated glass slides. The bovine immune-endocrine arrays were standardized and preliminary gene expression profiles generated using Cy3 and Cy5 labelled cDNA from un-stimulated and ConA (5 microg/ml) stimulated PBMC of 4 healthy Holstein cows (2-4 replicate arrays/cow) in a time course study. Mononuclear cell-derived cytokine and chemokine (IL-2, IL-1alpha
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Herman Tse
Full Text Available Partetravirus is a recently described group of animal parvoviruses which include the human partetravirus, bovine partetravirus and porcine partetravirus (previously known as human parvovirus 4, bovine hokovirus and porcine hokovirus respectively. In this report, we describe the discovery and genomic characterization of partetraviruses in bovine and ovine samples from China. These partetraviruses were detected by PCR in 1.8% of bovine liver samples, 66.7% of ovine liver samples and 71.4% of ovine spleen samples. One of the bovine partetraviruses detected in the present samples is phylogenetically distinct from previously reported bovine partetraviruses and likely represents a novel genotype. The ovine partetravirus is a novel partetravirus and phylogenetically most related to the bovine partetraviruses. The genome organization is conserved amongst these viruses, including the presence of a putative transmembrane protein encoded by an overlapping reading frame in ORF2. Results from the present study provide further support to the classification of partetraviruses as a separate genus in Parvovirinae.
Okawara, Sumika; Hamano, Seizo; Tetsuka, Masafumi
2009-04-01
Glycerol plays multi-functional roles in cellular physiology. Other than forming the backbone molecule for glycerophospholipid and triglyceride (TG), glycerol acts as an energy substrate for glycolysis. Spermatozoa are known to utilize glycerol for energy production, but there are no reports of this in oocytes. In this study, the value of glycerol as an energy substrate for bovine oocyte maturation (Exp. 1) and the gene expression of glycerol kinase (GK), an enzyme crucial for cellular glycerol utilization, in bovine oocytes and early embryos (Exp. 2) were examined. In Exp. 1, in vitro maturation (IVM) was conducted using synthetic oviduct fluid supplemented with/without glucose (1.5 mM) and/or glycerol (1.0 mM), and maturation rate, degree of cumulus expansion, glucose consumption and lactate production by cumulus-oocyte complexes (COC) were examined. In Exp. 2, to examine the developmental expression of GK mRNA, cumulus cells, oocytes and embryos at the 2-, 8- and 16-cell, morula, expanded blastocyst and hatched blastocyst stages were obtained in separate experiments, and the expression of GK mRNA was quantified using a real-time PCR. Glycerol did not support oocyte maturation or cumulus expansion. Addition of glycerol to glucose-supplemented media significantly decreased the maturation rate. Expression of GK mRNA was very low in cumulus cells, whereas an appreciable level of the transcript was observed in the oocytes. GK mRNA was detected in embryos at all the stages examined, and its expression significantly increased at the morula stage. These results indicate that glycerol, at least at the present concentration, is not beneficial as a constituent of the medium for bovine oocyte maturation. However, the appreciable levels of GK mRNA found in the oocyte and embryo imply a physiological role for glycerol in bovine oocyte maturation and embryo development.
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
Directory of Open Access Journals (Sweden)
Maura E Casey
2015-02-01
Full Text Available Johne’s disease, caused by infection with Mycobacterium avium subsp. paratuberculosis, (MAP, is a chronic intestinal disease of ruminants with serious economic consequences for cattle production in the United States and elsewhere. During infection, MAP bacilli are phagocytosed and subvert host macrophage processes, resulting in subclinical infections that can lead to immunopathology and dissemination of disease. Analysis of the host macrophage transcriptome during infection can therefore shed light on the molecular mechanisms and host-pathogen interplay associated with Johne’s disease. Here we describe results of an in vitro study of the bovine monocyte-derived macrophage (MDM transcriptome response during MAP infection using RNA-seq. MDM were obtained from seven age- and sex-matched Holstein-Friesian cattle and were infected with MAP across a six-hour infection time course with non-infected controls. We observed 245 and 574 differentially expressed genes in MAP-infected versus non-infected control samples (adjusted P value ≤ 0.05 at 2 and 6 hours post-infection, respectively. Functional analyses of these differentially expressed genes, including biological pathway enrichment, highlighted potential functional roles for genes that have not been previously described in the host response to infection with MAP bacilli. In addition, differential expression of pro- and anti-inflammatory cytokine genes, such as those associated with the IL-10 signaling pathway, and other immune-related genes that encode proteins involved in the bovine macrophage response to MAP infection emphasize the balance between protective host immunity and bacilli survival and proliferation. Systematic comparisons of RNA-seq gene expression results with Affymetrix® microarray data generated from the same experimental samples also demonstrated that RNA-seq represents a superior technology for studying host transcriptional responses to intracellular infection.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
Twenty-six confirmed imprinted genes in the bovine were quantified in in vivo produced oocytes and embryos. Eighteen were detectable and their transcriptional abundance were categorized into five patterns: largely decreased (MEST and PLAGL1); first decreased and then increased (CDKN1C and IGF2R); p...
DEFF Research Database (Denmark)
Liu, Yongfeng; Zan, Linsen; Zhao, Shuanping
2010-01-01
effects on the BL (p = 0.0047) and CD (p = 0.0454. Regarding association analysis of combination of the two SNPs, there are significant effects on the BL (p = 0.0215), CD (p = 0.0282) and PBW (p = 0.0329) in the total population. The results suggest that the UQCC gene is a candidate gene of body...... measurement traits in bovine reproduction and breeding, and provide data for establishing of an animal model using cattle to study big animal body type....... models of height as well as other stature indexes. We have cloned the cDNA sequence coding UQCC gene in bovine. Genomic structural analysis indicated that bovine UQCC shares a high similarity with human UQCC. Furthermore, Real-Time PCR analysis show that the expression of bovine UQCC is remarkably...
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Bouchard, Damien S; Seridan, Bianca; Saraoui, Taous; Rault, Lucie; Germon, Pierre; Gonzalez-Moreno, Candelaria; Nader-Macias, Fatima M E; Baud, Damien; François, Patrice; Chuat, Victoria; Chain, Florian; Langella, Philippe; Nicoli, Jacques; Le Loir, Yves; Even, Sergine
2015-01-01
Bovine mastitis is a costly disease in dairy cattle worldwide. As of yet, the control of bovine mastitis is mostly based on prevention by thorough hygienic procedures during milking. Additional strategies include vaccination and utilization of antibiotics. Despite these measures, mastitis is not fully under control, thus prompting the need for alternative strategies. The goal of this study was to isolate autochthonous lactic acid bacteria (LAB) from bovine mammary microbiota that exhibit beneficial properties that could be used for mastitis prevention and/or treatment. Sampling of the teat canal led to the isolation of 165 isolates, among which a selection of ten non-redundant LAB strains belonging to the genera Lactobacillus and Lactococcus were further characterized with regard to several properties: surface properties (hydrophobicity, autoaggregation); inhibition potential of three main mastitis pathogens, Staphylococcus aureus, Escherichia coli and Streptococcus uberis; colonization capacities of bovine mammary epithelial cells (bMEC); and immunomodulation properties. Three strains, Lactobacillus brevis 1595 and 1597 and Lactobacillus plantarum 1610, showed high colonization capacities and a medium surface hydrophobicity. These strains are good candidates to compete with pathogens for mammary gland colonization. Moreover, nine strains exhibited anti-inflammatory properties, as illustrated by the lower IL-8 secretion by E. coli-stimulated bMEC in the presence of these LAB. Full genome sequencing of five candidate strains allowed to check for undesirable genetic elements such as antibiotic resistance genes and to identify potential bacterial determinants involved in the beneficial properties. This large screening of beneficial properties while checking for undesirable genetic markers allowed the selection of promising candidate LAB strains from bovine mammary microbiota for the prevention and/or treatment of bovine mastitis.
Directory of Open Access Journals (Sweden)
Damien S Bouchard
Full Text Available Bovine mastitis is a costly disease in dairy cattle worldwide. As of yet, the control of bovine mastitis is mostly based on prevention by thorough hygienic procedures during milking. Additional strategies include vaccination and utilization of antibiotics. Despite these measures, mastitis is not fully under control, thus prompting the need for alternative strategies. The goal of this study was to isolate autochthonous lactic acid bacteria (LAB from bovine mammary microbiota that exhibit beneficial properties that could be used for mastitis prevention and/or treatment. Sampling of the teat canal led to the isolation of 165 isolates, among which a selection of ten non-redundant LAB strains belonging to the genera Lactobacillus and Lactococcus were further characterized with regard to several properties: surface properties (hydrophobicity, autoaggregation; inhibition potential of three main mastitis pathogens, Staphylococcus aureus, Escherichia coli and Streptococcus uberis; colonization capacities of bovine mammary epithelial cells (bMEC; and immunomodulation properties. Three strains, Lactobacillus brevis 1595 and 1597 and Lactobacillus plantarum 1610, showed high colonization capacities and a medium surface hydrophobicity. These strains are good candidates to compete with pathogens for mammary gland colonization. Moreover, nine strains exhibited anti-inflammatory properties, as illustrated by the lower IL-8 secretion by E. coli-stimulated bMEC in the presence of these LAB. Full genome sequencing of five candidate strains allowed to check for undesirable genetic elements such as antibiotic resistance genes and to identify potential bacterial determinants involved in the beneficial properties. This large screening of beneficial properties while checking for undesirable genetic markers allowed the selection of promising candidate LAB strains from bovine mammary microbiota for the prevention and/or treatment of bovine mastitis.
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
Sousa, Liza Margareth Medeiros de Carvalho; Mendes, Gabriela Pacheco; Campos, Danila Barreiro; Baruselli, Pietro Sampaio; Papa, Paula de Carvalho
2016-01-01
We hypothesized that stimulatory and superovulatory treatments, using equine chorionic gonadotropin (eCG), modulate the expression of genes related to insulin, cellular modelling and angiogenesis signaling pathways in the bovine corpus luteum (CL). Therefore, we investigated: 1-the effect of these treatments on circulating insulin and somatomedin C concentrations and on gene and protein expression of INSR, IGF1 and IGFR1, as well as other insulin signaling molecules; 2-the effects of eCG on gene and protein expression of INSR, IGF1, GLUT4 and NFKB1A in bovine luteal cells; and 3-the effect of stimulatory and superovulatory treatments on gene and protein expression of ANG, ANGPT1, NOS2, ADM, PRSS2, MMP9 and PLAU. Serum insulin did not differ among groups (P = 0.96). However, serum somatomedin C levels were higher in both stimulated and superovulated groups compared to the control (P = 0.01). In stimulated cows, lower expression of INSR mRNA and higher expression of NFKB1A mRNA and IGF1 protein were observed. In superovulated cows, lower INSR mRNA expression, but higher INSR protein expression and higher IGF1, IGFR1 and NFKB1A gene and protein expression were observed. Expression of angiogenesis and cellular modelling pathway-related factors were as follows: ANGPT1 and PLAU protein expression were higher and MMP9 gene and protein expression were lower in stimulated animals. In superovulated cows, ANGPT1 mRNA expression was higher and ANG mRNA expression was lower. PRSS2 gene and protein expression were lower in both stimulated and superovulated animals related to the control. In vitro, eCG stimulated luteal cells P4 production as well as INSR and GLUT4 protein expression. In summary, our results suggest that superovulatory treatment induced ovarian proliferative changes accompanied by increased expression of genes providing the CL more energy substrate, whereas stimulatory treatment increased lipogenic activity, angiogenesis and plasticity of the extracellular matrix
Directory of Open Access Journals (Sweden)
Liza Margareth Medeiros de Carvalho Sousa
Full Text Available We hypothesized that stimulatory and superovulatory treatments, using equine chorionic gonadotropin (eCG, modulate the expression of genes related to insulin, cellular modelling and angiogenesis signaling pathways in the bovine corpus luteum (CL. Therefore, we investigated: 1-the effect of these treatments on circulating insulin and somatomedin C concentrations and on gene and protein expression of INSR, IGF1 and IGFR1, as well as other insulin signaling molecules; 2-the effects of eCG on gene and protein expression of INSR, IGF1, GLUT4 and NFKB1A in bovine luteal cells; and 3-the effect of stimulatory and superovulatory treatments on gene and protein expression of ANG, ANGPT1, NOS2, ADM, PRSS2, MMP9 and PLAU. Serum insulin did not differ among groups (P = 0.96. However, serum somatomedin C levels were higher in both stimulated and superovulated groups compared to the control (P = 0.01. In stimulated cows, lower expression of INSR mRNA and higher expression of NFKB1A mRNA and IGF1 protein were observed. In superovulated cows, lower INSR mRNA expression, but higher INSR protein expression and higher IGF1, IGFR1 and NFKB1A gene and protein expression were observed. Expression of angiogenesis and cellular modelling pathway-related factors were as follows: ANGPT1 and PLAU protein expression were higher and MMP9 gene and protein expression were lower in stimulated animals. In superovulated cows, ANGPT1 mRNA expression was higher and ANG mRNA expression was lower. PRSS2 gene and protein expression were lower in both stimulated and superovulated animals related to the control. In vitro, eCG stimulated luteal cells P4 production as well as INSR and GLUT4 protein expression. In summary, our results suggest that superovulatory treatment induced ovarian proliferative changes accompanied by increased expression of genes providing the CL more energy substrate, whereas stimulatory treatment increased lipogenic activity, angiogenesis and plasticity of the
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
The Role of MicroRNAs in Bovine Infection and Immunity
Directory of Open Access Journals (Sweden)
Nathan eLawless
2014-11-01
Full Text Available MicroRNAs (miRNAs are a class of small, non-coding RNAs that are recognised as critical regulators of immune gene expression during infection. Many immunologically significant human miRNAs have been found to be conserved in agriculturally important species, including cattle. Discovering how bovine miRNAs mediate the immune defence during infection is critical to understanding the aetiology of the most prevalent bovine diseases. Here, we review current knowledge of miRNAs in the bovine genome, and discuss the advances in understanding of miRNAs as regulators of immune cell function, and bovine immune response activation, regulation, and resolution. Finally, we consider the future perspectives on miRNAs in bovine viral disease, their role as potential biomarkers and in therapy.
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
Expression of somatotropin receptor messenger ribonucleic acid in bovine tissues
International Nuclear Information System (INIS)
Lucy, M.C.; Boyd, C.K.; Koenigsfeld, A.T.; Okamura, C.S.
1998-01-01
The somatotropin receptor mRNA is controlled by at least two different gene promoters that generate 2 two variants with different exon 1 sequences (1A and 1B). The location of 1A and 1B somatotropin receptor mRNA within cattle tissues and, hence, the tissue specificity of the 1A and 1B promoters are unknown. In addition, the cDNA sequence of the 1B somatotropin receptor has not been determined. Our objective, therefore, was to sequence a cDNA for the 1B somatotropin receptor and to analyze bovine tissues for expression of 1A and 1B somatotropin receptor mRNA. Twenty adult tissues and six fetal tissues were collected at slaughter from each of four cows and two fetuses. Messenger RNA was analyzed using ribonuclease protection assays. The adult liver expressed both 1A and 1B mRNA. All other adult tissues expressed 1B mRNA but not 1A mRNA. The greatest amount of 1B mRNA was detected in liver and adipose (abdominal and subcutaneous) tissues. Other tissues had approximately one-half to one-tenth of the amount of 1B mRNA in the liver or adipose tissue. Fetal tissues (including fetal liver) expressed 1B mRNA and not 1A mRNA. Based on cDNA sequencing, the protein encoded by the 1A and 1B mRNA was nearly identical. We concluded that 1A somatotropin receptor mRNA is specific to adult bovine liver. Other adult and fetal bovine tissues expressed 1B somatotropin receptor mRNA with a predicted protein sequence that was similar to the 1A somatotropin receptor
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
Expression of infectious bovine rhinotracheitis virus glycoprotein D ...
African Journals Online (AJOL)
Bovine Herpesvirus 1 (BHV-1) belongs to the genus of Varicellovirus and the family of Herpesviridae which contains three main gB, gC and gD genes. In order to cloning of the coding region of gD gene of IBR virus , PCR product of the open reading frame of the gene from IBR virus isolated in Iran was amplified by PCR.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Jeong, Young-Hee; Kim, Yeong Ji; Kim, Eun Young; Kim, Se Eun; Kim, Jiwoo; Park, Min Jee; Lee, Hong-Gu; Park, Se Pill; Kang, Man-Jong
2016-06-01
Many transgenic domestic animals have been developed to produce therapeutic proteins in the mammary gland, and this approach is one of the most important methods for agricultural and biomedical applications. However, expression and secretion of a protein varies because transgenes are integrated at random sites in the genome. In addition, distal enhancers are very important for transcriptional gene regulation and tissue-specific gene expression. Development of a vector system regulated accurately in the genome is needed to improve production of therapeutic proteins. The objective of this study was to develop a knock-in system for expression of human fibroblast growth factor 2 (FGF2) in the bovine β-casein gene locus. The F2A sequence was fused to the human FGF2 gene and inserted into exon 3 of the β-casein gene. We detected expression of human FGF2 mRNA in the HC11 mouse mammary epithelial cells by RT-PCR and human FGF2 protein in the culture media using western blot analysis when the knock-in vector was introduced. We transfected the knock-in vector into bovine ear fibroblasts and produced knock-in fibroblasts using the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. Moreover, the CRISPR/Cas9 system was more efficient than conventional methods. In addition, we produced knock-in blastocysts by somatic cell nuclear transfer using the knock-in fibroblasts. Our knock-in fibroblasts may help to create cloned embryos for development of transgenic dairy cattle expressing human FGF2 protein in the mammary gland via the expression system of the bovine β-casein gene.
Muylkens, Benoît; Meurens, François; Schynts, Frédéric; de Fays, Katalin; Pourchet, Aldo; Thiry, Julien; Vanderplasschen, Alain; Antoine, Nadine; Thiry, Etienne
2006-03-31
Intramolecular recombination is a frequent event during the replication cycle of bovine herpesvirus 1 (BoHV-1). Recombinant viruses frequently arise and survive in cattle after concomitant nasal infections with two BoHV-1 mutants. The consequences of this process, related to herpesvirus evolution, have to be assessed in the context of large use of live marker vaccines based on glycoprotein E (gE) gene deletion. In natural conditions, double nasal infections by vaccine and wild-type strains are likely to occur. This situation might generate virulent recombinant viruses inducing a serological response indistinguishable from the vaccine one. This question was addressed by generating in vitro BoHV-1 recombinants deleted in the gE gene from seven wild-type BoHV-1 strains and one mutant strain deleted in the genes encoding gC and gE. In vitro growth properties were assessed by virus production, one step growth kinetics and plaque size assay. Heterogeneity in the biological properties was shown among the investigated recombinant viruses. The results demonstrated that some recombinants, in spite of their gE minus phenotype, have biological characteristics close to wild-type BoHV-1.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Comparison of transcriptomic landscapes of bovine embryos using RNA-Seq
Directory of Open Access Journals (Sweden)
Khatib Hasan
2010-12-01
Full Text Available Abstract Background Advances in sequencing technologies have opened a new era of high throughput investigations. Although RNA-seq has been demonstrated in many organisms, no study has provided a comprehensive investigation of the bovine transcriptome using RNA-seq. Results In this study, we provide a deep survey of the bovine embryonic transcriptomes, the first application of RNA-seq in cattle. Embryos cultured in vitro were used as models to study early embryonic development in cattle. RNA amplified from limited amounts of starting total RNA were sequenced and mapped to the reference genome to obtain digital gene expression at single base resolution. In particular, gene expression estimates from more than 1.6 million unannotated bases in 1785 novel transcribed units were obtained. We compared the transcriptomes of embryos showing distinct developmental statuses and found genes that showed differential overall expression as well as alternative splicing. Conclusion Our study demonstrates the power of RNA-seq and provides further understanding of bovine preimplantation embryonic development at a fine scale.
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
SREBP-1c Gene Silencing can Decrease Lipid Deposits in Bovine Hepatocytes Cultured in Vitro
Directory of Open Access Journals (Sweden)
Qinghua Deng
2014-05-01
Full Text Available Background: Fatty liver is a major metabolic disorder that occurs during early lactation in high-producing dairy cows. Sterol regulatory element-binding protein-1c (SREBP-1c is an important transcription factor that regulates lipid synthesis by regulating the expression of lipid metabolism genes. Methods: In this study, we reduced the expression of SREBP-1c by adenovirus-mediated SREBP-1c with a low expression vector (AD-GFP-SREBP-1c to study the effects of SREBP-1c on lipid deposits in bovine hepatocytes. The expression levels and enzyme activities of SERBP-1c and its target genes were determined by real-time PCR, western blot, and ELISA. Results: These results showed that Ad-GFP-SREBP-1c could inhibit SREBP-1c expression. The expression of the lipid synthesis enzyme acetyl-CoA carboxylase (ACC was down-regulated. The expression levels of the lipid oxidation enzymes long-chain fatty acyl-COA synthetase (ACSL-1, carnitine palmitoyltransferase І (CPT-І, carnitine palmitoyltransferase II (CPT- II, and β-hydroxyacyl-CoA-DH (HADH were significantly elevated. Furthermore, the expression levels of factors involved in the assembly and transport of very low-density lipoproteins (VLDLs, such as apolipoprotein B100 (ApoB, apolipoprotein E (ApoE, and microsomal triglyceride transfer protein (MTTP were decreased comparison with the negative control and the blank control groups, but the low-density lipoprotein receptor (LDLR was elevated. The concentrations of TG (triglyceride and VLDL were also reduced. Conclusion: These data suggest that low SREBP-1c expression can decrease lipid synthesis, increase lipid oxidation, and decrease the TG and VLDL content in bovine hepatocytes.
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Melchior, M B; van Osch, M H J; Lam, T J G M; Vernooij, J C M; Gaastra, W; Fink-Gremmels, J
2011-12-01
Staphylococcus aureus is one of the most prevalent causes of bovine mastitis. The antimicrobial treatment of this disease is currently based on antimicrobial susceptibility tests according to Clinical and Laboratory Standards Institute standards. However, various authors have shown a discrepancy between the results of this standard susceptibility test and the actual cure rate of the applied antimicrobial treatment. Increasing evidence suggests that in vivo biofilm formation by Staph. aureus, which is not assessed in the antimicrobial susceptibility tests, is associated with this problem, resulting in disappointing cure rates, especially for infections of longer duration. Previous data obtained with a limited number of strains showed that the extended biofilm antimicrobial susceptibility (EBS) assay reveals differences between strains, which cannot be derived from a standard susceptibility test or from a 24-h biofilm susceptibility test. The objective of this study was to test a collection of Staph. aureus bovine mastitis strains in the EBS assay and to model the effect of antimicrobial exposure, duration of antimicrobial exposure, and genotype profile of the strains on antimicrobial susceptibility. With the results from a previous study with the same collection of strains, the effect of genotype represented by accessory gene regulator gene (agr-type), the presence of insertional sequence 257 (IS257), intercellular adhesion (ica), and the β-lactamase (blaZ) gene were entered as explanatory factors in a logistic regression model. The agr locus of Staph. aureus controls the expression of most of the virulence factors, represses the transcription of several cell wall-associated proteins, and activates several exoproteins during the post-exponential phase. The IS257 gene has been related to biofilm formation in vitro and was found earlier in 50% of the agr-type 2 strains. The ica gene cluster encodes for the production of an extracellular polysaccharide adhesin, termed
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Spalenza, Veronica; Girolami, Flavia; Bevilacqua, Claudia; Riondato, Fulvio; Rasero, Roberto; Nebbia, Carlo; Sacchi, Paola; Martin, Patrice
2011-09-01
Gene expression studies in blood cells, particularly lymphocytes, are useful for monitoring potential exposure to toxicants or environmental pollutants in humans and livestock species. Quantitative PCR is the method of choice for obtaining accurate quantification of mRNA transcripts although variations in the amount of starting material, enzymatic efficiency, and the presence of inhibitors can lead to evaluation errors. As a result, normalization of data is of crucial importance. The most common approach is the use of endogenous reference genes as an internal control, whose expression should ideally not vary among individuals and under different experimental conditions. The accurate selection of reference genes is therefore an important step in interpreting quantitative PCR studies. Since no systematic investigation in bovine lymphocytes has been performed, the aim of the present study was to assess the expression stability of seven candidate reference genes in circulating lymphocytes collected from 15 dairy cows. Following the characterization by flow cytometric analysis of the cell populations obtained from blood through a density gradient procedure, three popular softwares were used to evaluate the gene expression data. The results showed that two genes are sufficient for normalization of quantitative PCR studies in cattle lymphocytes and that YWAHZ, S24 and PPIA are the most stable genes. Copyright © 2010 Elsevier Ltd. All rights reserved.
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Engineered Bovine Antibodies in the Development of Novel Therapeutics, Immunomodulators and Vaccines
Directory of Open Access Journals (Sweden)
Madhuri Koti
2014-05-01
Full Text Available Some bovine antibodies across all classes are unique, such as the CDR3 of the variable heavy-domain (VH CDR3, which is exceptionally long (up to 66 amino acids, unlike most conventional antibodies where the VH CDR3 loops range from 10 to 25 amino acids. The exceptionally long VH CDR3 is encoded by unusually long germline IGHD genes together with insertion of novel “a” nucleotide rich conserved short nucleotide sequence (CSNS specifically at the IGH V-D junction. Such an exceptionally long VH CDR3 confers unique “knob and stalk” structural architecture where the knob, formed by intra-VH CDR3 disulfide bridges, is separated by 20 Å solvent exposed stalk composed of anti-parallel beta strands. The substitution of the knob with cytokines, such as, erythropoietin and granulocyte colony stimulating factor 3 (granulocyte colony stimulating factor, results in expression of functional fusion proteins with enhanced pharmacokinetics. The beta stranded stalk can be substituted with other rigid structures, for example, repeat alpha helices to form coiled-coil that mimics the beta-stranded stalk and, thus, opens opportunities for insertion of this structure in the CDRs of antibodies across species. Given the versatility of such a structural platform in bovine antibody VH CDR3, it provides the opportunity for the development of new generation of diagnostics, therapeutics, vaccines and immunomodulating drugs.
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Directory of Open Access Journals (Sweden)
Hayashi Ken-go
2011-03-01
Full Text Available Abstract Background It has been reported that calf oocytes are less developmentally competent than oocytes obtained from adult cows. Bone morphogenetic protein 15 (BMP15 and growth and differentiation factor 9 (GDF9 play critical roles in folliculogenesis, follicular development and ovulation in mammalian ovaries. In the present study, we attempted to compare the expression patterns of BMP15 and GDF9 in the cells of calf and cow ovaries to determine a relationship between the level of these genes and the low developmental competence of calf oocytes. Methods Bovine tissues were collected from 9-11 months-old calves and from 4-6 years-old cows. We characterized the gene expression of BMP15 and GDF9 in calf and adult bovine oocytes and cumulus cells using quantitative real-time reverse transcriptase polymerase chain reaction (QPCR and in situ hybridization. Immunohistochemical analysis was also performed. Results The expression of BMP15 and GDF9 in cumulus cells of adult ovaries was significantly higher than that in calf ovaries, as revealed by QPCR. GDF9 expression in the oocytes of calf ovaries was significantly higher than in those of the adult ovaries. In contrast, BMP15 expression in the oocytes of calf and adult ovaries was not significantly different. The localization of gene expression and protein were ascertained by histochemistry. Conclusions Our result showed for the first time BMP15 and GDF9 expression in bovine cumulus cells. BMP15 and GDF9 mRNA expression in oocytes and cumulus cells was different in calves and cows.
SUZAN, Victor M.; ONUMA, Misao; AGUILAR, Romero E.; MURAKAMI, Yosuke
1983-01-01
Sera were collected from dairy and beef cattle in 19 different states of Mexico. These sera were tested for bovine herpesvirus-1 (BHV-1), parainfluenza-3 virus (PIV-3), bovine rotavirus (BRV), bovine leukemia virus (BLV), bovine adenovirus-7 (BAV-7), bluetongue virus (BTV) and bovine viral diarrhea virus (BVDV). Seropositive rates for each virus for dairy cattle tested were 158/277(57.0%) for BHV-1,217/286(75.0%) for PIV-3,541/1498(36.1%) for BLV, 134/144(93.1%) for BRV, 39/90(43.3%) for BTV,...
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Directory of Open Access Journals (Sweden)
M.C.S. Brum
2010-02-01
Full Text Available Bovine herpesvirus type 5 (BoHV-5 is an important pathogen of cattle in South America. We describe here the construction and characterization of deletion mutants defective in the glycoprotein E (gE or thymidine kinase (TK gene or both (gE/TK from a highly neurovirulent and well-characterized Brazilian BoHV-5 strain (SV507/99. A gE-deleted recombinant virus (BoHV-5 gE∆ was first generated in which the entire gE open reading frame was replaced with a chimeric green fluorescent protein gene. A TK-deleted recombinant virus (BoHV-5 TK∆ was then generated in which most of the TK open reading frame sequences were deleted and replaced with a chimeric β-galactosidase gene. Subsequently, using the BoHV-5 gE∆ virus as backbone, a double gene-deleted (TK plus gE BoHV-5 recombinant (BoHV-5 gE/TK∆ was generated. The deletion of the gE and TK genes was confirmed by immunoblotting and PCR, respectively. In Madin Darby bovine kidney (MDBK cells, the mutants lacking gE (BoHV-5 gE∆ and TK + gE (BoHV-5 gE/TK∆ produced small plaques while the TK-deleted BoHV-5 produced wild-type-sized plaques. The growth kinetics and virus yields in MDBK cells for all three recombinants (BoHV-5 gE∆, BoHV-5 TK∆ and BoHV-5 gE/TK∆ were similar to those of the parental virus. It is our belief that the dual gene-deleted recombinant (BoHV-5 gE/TK∆ produced on the background of a highly neurovirulent Brazilian BoHV-5 strain may have potential application in a vaccine against BoHV-5.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
Y. Suzuki; Y. H. Hong; S. H. Song; A. Ardiyanti; D. Kato; K. H. So; K. Katoh; S. G Roh
2012-01-01
Adipokines, adipocyte-derived protein, have important roles in various kinds of physiology including energy homeostasis. Chemerin, one of adipocyte-derived adipokines, is highly expressed in differentiated adipocytes and is known to induce macrophage chemotaxis and glucose intolerance. The objective of the present study was to investigate the changes of chemerin and the chemokine-like-receptor 1 (CMKLR1) gene expression levels during differentiation of the bovine adipocyte and in differentiat...
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
Groebner, A E; Schulke, K; Unterseer, S; Reichenbach, H D; Reichenbach, M; Büttner, M; Wolf, E; Meyer, H H D; Ulbrich, S E
2010-03-01
Bovine trophoblast cells release interferon-tau (IFNT), a type I IFN, as the pregnancy recognition signal. Since type I IFNs exert growth inhibitory and proapoptotic actions, the effect of the conceptus on components of the apoptosis pathways was determined in the bovine endometrium during the periimplantation period. Uteri of Simmental heifers were flushed post mortem at days 12, 15, and 18 of cycle or pregnancy for the recovery of conceptuses and the sampling of ipsilateral endometrial tissue at slaughter for quantitative RT-PCR, immunohistochemistry, caspase activity and TUNEL assays. Endometrium samples of pregnant animals revealed increased transcript levels for the proapoptotic genes XAF1 (day 15: 2.9-fold; day 18: 15.1-fold; p=0.005) and CASP8 (day 18: 2.4-fold; p=0.007). The mRNA expression increased significantly with the day of the cycle for the proapoptotic genes FASLG, TNFSF10, TNF and TNFSF1A (p=0.004, p=0.006, p=0.001 and p=0.007) and the antiapoptotic gene BIRC4 (p=0.03). We detected high amounts of FASLG transcripts in day 18 conceptuses (16-fold higher than day 18 endometria). This finding was validated at the protein level by immunohistochemistry. To further analyse the endometrial activation of the caspase cascade, the activities of initiator caspase 8 and effector caspases 3/7 were determined luminometrically. No difference between pregnant and cyclic animals was found for either caspase activity. Additionally, a TUNEL assay showed no increase of apoptotic cells in the pregnant endometrium. In conclusion, although the bovine conceptus induces the expression of proapoptotic genes, neither an activation of a caspase cascade nor an increase of apoptotic cells was noticed. These results suggest inhibitory mechanisms preventing endometrial cells from programmed cell death. Copyright 2009 Elsevier Ltd. All rights reserved.
Evaluation of bovine chemerin (RARRES2 gene variation on beef cattle production traits
Directory of Open Access Journals (Sweden)
Amanda K Lindholm-Perry
2012-03-01
Full Text Available A previous study in cattle based on >48,000 markers identified markers on chromosome 4 near the chemerin gene associated with average daily feed intake (ADFI in steers (P<0.008. Chemerin is an adipokine associated with obesity and metabolic syndrome in humans, representing a strong candidate gene potentially underlying the observed association. To evaluate whether the bovine chemerin gene is involved in feed intake, 16 markers within and around the gene were tested for association in the same resource population. Eleven were nominally significant for ADFI (P<0.05 and two were significant after Bonferroni correction. Two and five SNP in this region were nominally significant for the related traits of average daily gain (ADG and residual feed intake (RFI, respectively. All markers were evaluated for effects on meat quality and carcass phenotypes. Many of the markers associated with ADFI were associated with hot carcass weight (HCW, adjusted fat thickness (AFT, and marbling (P<0.05. Marker alleles that were associated with lower ADFI were also associated with lower HCW, AFT, and marbling. Markers associated with ADFI were genotyped in a validation population of steers representing 14 breeds to determine predictive merit across populations. No consistent relationships for ADFI were detected. To determine whether cattle feed intake or growth phenotypes might be related to chemerin transcript abundance, the expression of chemerin was evaluated in adipose of 114 heifers that were siblings of the steers in the discovery population. Relative chemerin transcript abundance was not correlated with ADFI, ADG, or RFI, but associations with body condition score and yearling weight were observed. We conclude that variation in the chemerin gene may underlie observed association in the resource population, but that additional research is required to determine if this variation is widespread among breeds and to develop robust markers with predictive merit across
Directory of Open Access Journals (Sweden)
Lidiane C. Soares
2012-08-01
Full Text Available The present study evaluated the pheno- and genotypical antimicrobial resistance profile of coagulase-negative Staphylococcus (CNS species isolated from dairy cows milk, specially concerning to oxacillin. Of 100 CNS isolates, the S. xylosus was the prevalent species, followed by S. cohnii, S. hominis, S. capitis and S. haemolyticus. Only 6% were phenotypically susceptible to the antimicrobial agents tested in disk diffusion assay. Penicillin and ampicillin resistance rates were significantly higher than others antimicrobials. Four isolates were positive to mecA gene (4%, all represented by the S. xylosus species. The blaZ gene was detected in 16% of the isolates (16/100. It was noticed that all mecA + were also positive to this gene and the presence of both genes was correlated to phenotypic beta-lactamic resistance. We conclude that CNS species from bovine milk presented significantly distinct antimicrobial resistance profiles, evaluated by phenotypic and genotypic tests, which has implications for treatment and management decisions.
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
Castilho, Ivana G; Dantas, Stéfani Thais Alves; Langoni, Hélio; Araújo, João P; Fernandes, Ary; Alvarenga, Fernanda C L; Maia, Leandro; Cagnini, Didier Q; Rall, Vera L M
2017-08-01
Staphylococcus aureus is a common pathogen that causes subclinical bovine mastitis due to several virulence factors. In this study, we analyzed S. aureus isolates collected from the milk of cows with subclinical mastitis that had 8 possible combinations of bap, icaA, and icaD genes, to determine their capacity to produce biofilm on biotic (bovine primary mammary epithelial cells and HeLa cells) and abiotic (polystyrene microplates) surfaces, and their ability to adhere to and invade these cells. We also characterized isolates for microbial surface components recognizing adhesive matrix molecules (MSCRAMM) and agr genes, and for their susceptibility to cefquinome sulfate in the presence of biofilm. All isolates adhered to and invaded both cell types, but invasion indexes were higher in bovine primary mammary epithelial cells. Using tryptic soy broth + 1% glucose on abiotic surfaces, 5 out of 8 isolates were biofilm producers, but only the bap + icaA + icaD + isolate was positive in Dulbecco's Modified Eagle's medium. The production of biofilm on biotic surfaces occurred only with this isolate and only on HeLa cells, because the invasion index for bovine primary mammary epithelial cells was too high, making it impossible to use these cells in this assay. Of the 5 biofilm producers in tryptic soy broth + 1% glucose, 4 presented with the bap/fnbA/clfA/clfB/eno/fib/ebpS combination, and all were protected from cefquinome sulfate. We found no predominance of any agr group. The high invasive potential of S. aureus made it impossible to observe biofilm in bovine primary mammary epithelial cells, and we concluded that cells with lower invasion rates, such as HeLa cells, were more appropriate for this assay. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Directory of Open Access Journals (Sweden)
Arainga Mariluz
2012-03-01
Full Text Available Abstract Background Bovine leukemia virus (BLV is associated with enzootic bovine leukosis and is closely related to human T-cell leukemia virus type I. The Tax protein of BLV is a transcriptional activator of viral replication and a key contributor to oncogenic potential. We previously identified interesting mutant forms of Tax with elevated (TaxD247G or reduced (TaxS240P transactivation effects on BLV replication and propagation. However, the effects of these mutations on functions other than transcriptional activation are unknown. In this study, to identify genes that play a role in the cascade of signal events regulated by wild-type and mutant Tax proteins, we used a large-scale host cell gene-profiling approach. Results Using a microarray containing approximately 18,400 human mRNA transcripts, we found several alterations after the expression of Tax proteins in genes involved in many cellular functions such as transcription, signal transduction, cell growth, apoptosis, stress response, and immune response, indicating that Tax protein has multiple biological effects on various cellular environments. We also found that TaxD247G strongly regulated more genes involved in transcription, signal transduction, and cell growth functions, contrary to TaxS240P, which regulated fewer genes. In addition, the expression of genes related to stress response significantly increased in the presence of TaxS240P as compared to wild-type Tax and TaxD247G. By contrast, the largest group of downregulated genes was related to immune response, and the majority of these genes belonged to the interferon family. However, no significant difference in the expression level of downregulated genes was observed among the Tax proteins. Finally, the expression of important cellular factors obtained from the human microarray results were validated at the RNA and protein levels by real-time quantitative reverse transcription-polymerase chain reaction and western blotting
Directory of Open Access Journals (Sweden)
Duban-Deweer Sophie
2010-11-01
Full Text Available Abstract Background Brain capillary endothelial cells (BCECs form the physiological basis of the blood-brain barrier (BBB. The barrier function is (at least in part due to well-known proteins such as transporters, tight junctions and metabolic barrier proteins (e.g. monoamine oxidase, gamma glutamyltranspeptidase and P-glycoprotein. Our previous 2-dimensional gel proteome analysis had identified a large number of proteins and revealed the major role of dynamic cytoskeletal remodelling in the differentiation of bovine BCECs. The aim of the present study was to elaborate a reference proteome of Triton X-100-soluble species from bovine BCECs cultured in the well-established in vitro BBB model developed in our laboratory. Results A total of 215 protein spots (corresponding to 130 distinct proteins were identified by 2-dimensional gel electrophoresis, whereas over 350 proteins were identified by a shotgun approach. We classified around 430 distinct proteins expressed by bovine BCECs. Our large-scale gene expression analysis enabled the correction of mistakes referenced into protein databases (e.g. bovine vinculin and constitutes valuable evidence for predictions based on genome annotation. Conclusions Elaboration of a reference proteome constitutes the first step in creating a gene expression database dedicated to capillary endothelial cells displaying BBB characteristics. It improves of our knowledge of the BBB and the key proteins in cell structures, cytoskeleton organization, metabolism, detoxification and drug resistance. Moreover, our results emphasize the need for both appropriate experimental design and correct interpretation of proteome datasets.
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
Protein Hydrolysates from Non-bovine and Plant Sources Replaces Tryptone in Microbiological Media
Ranganathan, Yamini; Patel, Shifa; Pasupuleti, Vijai K.; Meganathan, R.
Tryptone (pancreatic digest of casein) is a common ingredient in laboratory and fermentation media for growing wild-type and genetically modified microorganisms. Many of the commercially manufactured products such as human growth hormone, antibiotics, insulin, etc. are produced by recombinant strains grown on materials derived from bovine sources. With the emergence of Bovine Spongiform Encephalopathy (BSE) and the consequent increase in Food and Drug Administration (FDA) regulations, elimination of materials of bovine origin from fermentation media is of paramount importance. To achieve this objective, a number of protein hydrolysates derived from non-bovine animal and plant sources were evaluated. Tryptone in Luria-Bertani (LB) broth was replaced with an equal quantity of alternate protein hydrolysates. Four of the six hydrolysates (one animal and three from plants) were found to efficiently replace the tryptone present in LB-medium as measured by growth rate and growth yield of a recombinant Escherichia coli strain. In addition, we have determined plasmid stability, inducibility and activity of the plasmid encoded β-galactosidase in the recombinant strain grown in the presence of various protein hydrolysates.
Zhang, Jin-You; Wu, Yi; Zhao, Shuan; Liu, Zhen-Xing; Zeng, Shen-Ming; Zhang, Gui-Xue
2015-09-15
Progesterone is an important steroid hormone in the regulation of the bovine estrous cycle. The steroidogenic acute regulatory protein (StAR) is an indispensable component for transporting cholesterol to the inner mitochondrial membrane, which is one of the rate-limiting steps for progesterone synthesis. Low-density lipoprotein (LDL) supplies cholesterol precursors for progesterone formation, and the lysosomal degradation pathway of LDL is essential for progesterone biosynthesis in granulosa cells after ovulation. However, it is currently unknown how LDL and lysosomes coordinate the expression of the StAR gene and progesterone production in bovine granulosa cells. Here, we investigated the role of lysosomes in LDL-treated bovine granulosa cells. Our results reported that LDL induced expression of StAR messenger RNA and protein as well as expression of cholesterol side-chain cleavage cytochrome P-450 (CYP11A1) messenger RNA and progesterone production in cultured bovine granulosa cells. The number of lysosomes in the granulosa cells was also significantly increased by LDL; whereas the lysosomal inhibitor, chloroquine, strikingly abolished these LDL-induced effects. Our results indicate that LDL promotes StAR expression, synthesis of progesterone, and formation of lysosomes in bovine granulosa cells, and lysosomes participate in the process by releasing free cholesterol from hydrolyzed LDL. Copyright © 2015 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Buitenhuis, Albert Johannes; Rontved, Christine M.; Edwards, Stefan McKinnon
2011-01-01
Background Bovine mastitis is one of the most costly and prevalent diseases affecting dairy cows worldwide. In order to develop new strategies to prevent Escherichia coli-induced mastitis, a detailed understanding of the molecular mechanisms underlying the host immune response to an E. coli.......i. to represent the acute phase response (APR) and chronic stage, respectively. Differentially expressed (DE) genes for each stage were analyzed and the DE genes detected at T=24h were also compared to data collected from two previous E. coli mastitis studies that were carried out on post mortem tissue. Results...... of the up-regulated transcripts were associated with tissue healing processes. Comparison of T=24h DE genes detected in the three E. coli mastitis studies revealed 248 were common and mainly involved immune response functions. KEGG pathway analysis indicated these genes were involved in 12 pathways related...
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Bacteriocins of Non-aureus Staphylococci Isolated from Bovine Milk
Carson, Domonique A.; Barkema, Herman W.; Naushad, Sohail
2017-01-01
ABSTRACT Non-aureus staphylococci (NAS), the bacteria most commonly isolated from the bovine udder, potentially protect the udder against infection by major mastitis pathogens due to bacteriocin production. In this study, we determined the inhibitory capability of 441 bovine NAS isolates (comprising 26 species) against bovine Staphylococcus aureus. Furthermore, inhibiting isolates were tested against a human methicillin-resistant S. aureus (MRSA) isolate using a cross-streaking method. We determined the presence of bacteriocin clusters in NAS whole genomes using genome mining tools, BLAST, and comparison of genomes of closely related inhibiting and noninhibiting isolates and determined the genetic organization of any identified bacteriocin biosynthetic gene clusters. Forty isolates from 9 species (S. capitis, S. chromogenes, S. epidermidis, S. pasteuri, S. saprophyticus, S. sciuri, S. simulans, S. warneri, and S. xylosus) inhibited growth of S. aureus in vitro, 23 isolates of which, from S. capitis, S. chromogenes, S. epidermidis, S. pasteuri, S. simulans, and S. xylosus, also inhibited MRSA. One hundred five putative bacteriocin gene clusters encompassing 6 different classes (lanthipeptides, sactipeptides, lasso peptides, class IIa, class IIc, and class IId) in 95 whole genomes from 16 species were identified. A total of 25 novel bacteriocin precursors were described. In conclusion, NAS from bovine mammary glands are a source of potential bacteriocins, with >21% being possible producers, representing potential for future characterization and prospective clinical applications. IMPORTANCE Mastitis (particularly infections caused by Staphylococcus aureus) costs Canadian dairy producers $400 million/year and is the leading cause of antibiotic use on dairy farms. With increasing antibiotic resistance and regulations regarding use, there is impetus to explore bacteriocins (bacterially produced antimicrobial peptides) for treatment and prevention of bacterial infections
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
Bovine origin Staphylococcus aureus: A new zoonotic agent?
Rao, Relangi Tulasi; Jayakumar, Kannan; Kumar, Pavitra
2017-10-01
The study aimed to assess the nature of animal origin Staphylococcus aureus strains. The study has zoonotic importance and aimed to compare virulence between two different hosts, i.e., bovine and ovine origin. Conventional polymerase chain reaction-based methods used for the characterization of S. aureus strains and chick embryo model employed for the assessment of virulence capacity of strains. All statistical tests carried on R program, version 3.0.4. After initial screening and molecular characterization of the prevalence of S. aureus found to be 42.62% in bovine origin samples and 28.35% among ovine origin samples. Meanwhile, the methicillin-resistant S. aureus prevalence is found to be meager in both the hosts. Among the samples, only 6.8% isolates tested positive for methicillin resistance. The biofilm formation quantified and the variation compared among the host. A Welch two-sample t -test found to be statistically significant, t=2.3179, df=28.103, and p=0.02795. Chicken embryo model found effective to test the pathogenicity of the strains. The study helped to conclude healthy bovines can act as S. aureus reservoirs. Bovine origin S. aureus strains are more virulent than ovine origin strains. Bovine origin strains have high probability to become zoonotic pathogen. Further, gene knock out studies may be conducted to conclude zoonocity of the bovine origin strains.
Directory of Open Access Journals (Sweden)
Laura Starvaggi Cucuzza
Full Text Available Regucalcin (RGN is a mammalian Ca2+-binding protein that plays an important role in intracellular Ca2+ homeostasis. Recently, RGN has been identified as a target gene for sex steroid hormones in the prostate glands and testis of rats and humans, but no studies have focused on RGN expression in bovine tissues. Thus, in the present study, we examined RGN mRNA and protein expression in the different tissues and organs of veal calves and beef cattle. Moreover, we investigated whether RGN expression is controlled through sex steroid hormones in bovine target tissues, namely the bulbo-urethral and prostate glands and the testis. Sex steroid hormones are still illegally used in bovine husbandry to increase muscle mass. The screening of the regulation and function of anabolic sex steroids via modified gene expression levels in various tissues represents a new approach for the detection of illicit drug treatments. Herein, we used quantitative PCR, western blot and immunohistochemistry analyses to demonstrate RGN mRNA and protein expression in bovine tissues. In addition, estrogen administration down-regulated RGN gene expression in the accessory sex glands of veal calves and beef cattle, while androgen treatment reduced RGN gene expression only in the testis. The confirmation of the regulation of RGN gene expression through sex steroid hormones might facilitate the potential detection of hormone abuse in bovine husbandry. Particularly, the specific response in the testis suggests that this tissue is ideal for the detection of illicit androgen administration in veal calves and beef cattle.
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Detection of genes associated with developmental competence of bovine oocytes
Czech Academy of Sciences Publication Activity Database
Němcová, Lucie; Jansová, Denisa; Vodičková Kepková, Kateřina; Vodička, Petr; Jeseta, M.; Machatková, M.; Kaňka, Jiří
2016-01-01
Roč. 166, č. 1 (2016), s. 58-71 ISSN 0378-4320 Institutional support: RVO:67985904 Keywords : oocyte * embryo * bovine * developmental competence * transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.605, year: 2016
Brulc, Jennifer M; Antonopoulos, Dionysios A; Miller, Margret E Berg; Wilson, Melissa K; Yannarell, Anthony C; Dinsdale, Elizabeth A; Edwards, Robert E; Frank, Edward D; Emerson, Joanne B; Wacklin, Pirjo; Coutinho, Pedro M; Henrissat, Bernard; Nelson, Karen E; White, Bryan A
2009-02-10
The complex microbiome of the rumen functions as an effective system for the conversion of plant cell wall biomass to microbial protein, short chain fatty acids, and gases. As such, it provides a unique genetic resource for plant cell wall degrading microbial enzymes that could be used in the production of biofuels. The rumen and gastrointestinal tract harbor a dense and complex microbiome. To gain a greater understanding of the ecology and metabolic potential of this microbiome, we used comparative metagenomics (phylotype analysis and SEED subsystems-based annotations) to examine randomly sampled pyrosequence data from 3 fiber-adherent microbiomes and 1 pooled liquid sample (a mixture of the liquid microbiome fractions from the same bovine rumens). Even though the 3 animals were fed the same diet, the community structure, predicted phylotype, and metabolic potentials in the rumen were markedly different with respect to nutrient utilization. A comparison of the glycoside hydrolase and cellulosome functional genes revealed that in the rumen microbiome, initial colonization of fiber appears to be by organisms possessing enzymes that attack the easily available side chains of complex plant polysaccharides and not the more recalcitrant main chains, especially cellulose. Furthermore, when compared with the termite hindgut microbiome, there are fundamental differences in the glycoside hydrolase content that appear to be diet driven for either the bovine rumen (forages and legumes) or the termite hindgut (wood).
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Directory of Open Access Journals (Sweden)
Gang Wang
Full Text Available Mucosal vaccination has been demonstrated to be an effective means of eliciting protective immunity against aerosol infections of foot and mouth disease virus (FMDV and various approaches have been used to improve mucosal response to this pathogen. In this study, cationic PLGA (poly(lactide-co-glycolide nano/microparticles were used as an intranasal delivery vehicle as a means administering FMDV DNA vaccine encoding the FMDV capsid protein and the bovine IL-6 gene as a means of enhancing mucosal and systemic immune responses in animals. Three eukaryotic expression plasmids with or without bovine IL-6 gene (pc-P12A3C, pc-IL2AP12A3C and pc-P12AIL3C were generated. The two latter plasmids were designed with the IL-6 gene located either before or between the P12A and 3C genes, respectively, as a means of determining if the location of the IL-6 gene affected capsid assembly and the subsequent immune response. Guinea pigs and rats were intranasally vaccinated with the respective chitosan-coated PLGA nano/microparticles-loaded FMDV DNA vaccine formulations. Animals immunized with pc-P12AIL3C (followed by animals vaccinated with pc-P12A3C and pc-IL2AP12A3C developed the highest levels of antigen-specific serum IgG and IgA antibody responses and the highest levels of sIgA (secretory IgA present in mucosal tissues. However, the highest levels of neutralizing antibodies were generated in pc-IL2AP12A3C-immunized animals (followed by pc-P12AIL3C- and then in pc-P12A3C-immunized animals. pc-IL2AP12A3C-immunized animals also developed stronger cell mediated immune responses (followed by pc-P12AIL3C- and pc-P12A3C-immunized animals as evidenced by antigen-specific T-cell proliferation and expression levels of IFN-γ by both CD4+ and CD8+ splenic T cells. The percentage of animals protected against FMDV challenge following immunizations with pc-IL2AP12A3C, pc-P12AIL3C or pc-P12A3C were 3/5, 1/5 and 0/5, respectively. These data suggested that intranasal delivery
Embryonic stem-like cells derived from in vitro produced bovine blastocysts
Directory of Open Access Journals (Sweden)
Erika Regina Leal de Freitas
2011-06-01
Full Text Available The aim of this work was to study the derivation of bovine embryonic stem-like (ES-like cells from the inner cell mass (ICM of in vitro produced blastocysts. The ICMs were mechanically isolated and six out of seventeen (35% ICMs could attach to a monolayer of murine embryonic fibroblasts (MEF. Ten days after, primary outgrowths were mechanically dissected into several small clumps and transferred to a new MEF layer. Cells were further propagated and passaged by physical dissociation over a 60 days period. The pluripotency of the bovine ES-like cells was confirmed by RT-PCR of Oct-4 and STAT-3 gene markers. The colonies were weakly stained for alkaline phosphatase and the mesoderm and endoderm differentiation gene markers such as GATA-4 and Flk-1, respectively, were not expressed. Embryoid bodies were spontaneously formed at the seventh passage. Results showed that bovine ES-like cells could be obtained and passaged by mechanical procedures from the fresh in vitro produced blastocysts.
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
2010-01-01
NOVELTY - Determining (m1) resistance to mastitis in a bovine subject, involves detecting in a sample from the bovine subject the presence or absence of at least one genetic marker that is associated with at least one trait indicative of mastitis resistance of the bovine subject and/or off......-spring from it, where the genetic marker is located on the bovine chromosome BTA11 in the region flanked by and including the zeta-chain associated protein 70kD (ZAP70) and CD8B genes, where the presence or absence of the genetic marker is indicative of mastitis resistance. USE - For determining resistance...... to mastitis in a bovine subject for determining mastitis resistance in a bovine subject; for detecting the presence or absence in a bovine subject of at least one genetic marker associated with resistance to mastitis; and for estimating breeding value in respect of susceptibility to mastitis in a bovine...
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Evolution and diversity of secretome genes in the apicomplexan parasite Theileria annulata
Directory of Open Access Journals (Sweden)
Shiels Brian R
2010-01-01
Full Text Available Abstract Background Little is known about how apicomplexan parasites have evolved to infect different host species and cell types. Theileria annulata and Theileria parva invade and transform bovine leukocytes but each species favours a different host cell lineage. Parasite-encoded proteins secreted from the intracellular macroschizont stage within the leukocyte represent a critical interface between host and pathogen systems. Genome sequencing has revealed that several Theileria-specific gene families encoding secreted proteins are positively selected at the inter-species level, indicating diversification between the species. We extend this analysis to the intra-species level, focusing on allelic diversity of two major secretome families. These families represent a well-characterised group of genes implicated in control of the host cell phenotype and a gene family of unknown function. To gain further insight into their evolution and function, this study investigates whether representative genes of these two families are diversifying or constrained within the T. annulata population. Results Strong evidence is provided that the sub-telomerically encoded SVSP family and the host-nucleus targeted TashAT family have evolved under contrasting pressures within natural T. annulata populations. SVSP genes were found to possess atypical codon usage and be evolving neutrally, with high levels of nucleotide substitutions and multiple indels. No evidence of geographical sub-structuring of allelic sequences was found. In contrast, TashAT family genes, implicated in control of host cell gene expression, are strongly conserved at the protein level and geographically sub-structured allelic sequences were identified among Tunisian and Turkish isolates. Although different copy numbers of DNA binding motifs were identified in alleles of TashAT proteins, motif periodicity was strongly maintained, implying conserved functional activity of these sites. Conclusions
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Energy Technology Data Exchange (ETDEWEB)
Haque, Muzammel; Stanfield, Brent; Kousoulas, Konstantin G.
2016-12-15
We have previously shown that the HSV-1 gK and UL20 proteins interact and function in virion envelopment, membrane fusion, and neuronal entry. Alignment of the predicted secondary structures of gKs encoded by BoHV-1, HSV-1, HSV-2, EHV-1 and VZV indicated a high degree of domain conservation. Two BoHV-1 gK-null mutant viruses were created by either gK gene deletion or stop codon insertion. In addition, a V5 epitope-tag was inserted at the carboxyl terminus of gK gene to detect gK. The engineered gK-null mutant viruses failed to replicate and produce viral plaques. Co-immunoprecipitation of gK and UL20 expressed via different methods revealed that gK and UL20 physically interacted in the presence or absence of other viral proteins. Confocal microscopy showed that gK and UL20 colocalized in infected cells. These results indicate that BoHV-1 gK and UL20 may function in a similar manner to other alphaherpesvirus orthologues specified by HSV-1, PRV and EHV-1. -- Highlights: •Glycoprotein K(gK) is conserved among alphaherpesviruses and serves similar functions. •The bovine herpesvirus-1 gK and UL20 proteins physically interact in a similar manner to herpes simplex virus type 1 and equine herpesvirus-1. •The bovine herpesvirus-1 (BoHV-1) gK interacts with UL20 and is essential for virus replication and spread.
International Nuclear Information System (INIS)
Haque, Muzammel; Stanfield, Brent; Kousoulas, Konstantin G.
2016-01-01
We have previously shown that the HSV-1 gK and UL20 proteins interact and function in virion envelopment, membrane fusion, and neuronal entry. Alignment of the predicted secondary structures of gKs encoded by BoHV-1, HSV-1, HSV-2, EHV-1 and VZV indicated a high degree of domain conservation. Two BoHV-1 gK-null mutant viruses were created by either gK gene deletion or stop codon insertion. In addition, a V5 epitope-tag was inserted at the carboxyl terminus of gK gene to detect gK. The engineered gK-null mutant viruses failed to replicate and produce viral plaques. Co-immunoprecipitation of gK and UL20 expressed via different methods revealed that gK and UL20 physically interacted in the presence or absence of other viral proteins. Confocal microscopy showed that gK and UL20 colocalized in infected cells. These results indicate that BoHV-1 gK and UL20 may function in a similar manner to other alphaherpesvirus orthologues specified by HSV-1, PRV and EHV-1. -- Highlights: •Glycoprotein K(gK) is conserved among alphaherpesviruses and serves similar functions. •The bovine herpesvirus-1 gK and UL20 proteins physically interact in a similar manner to herpes simplex virus type 1 and equine herpesvirus-1. •The bovine herpesvirus-1 (BoHV-1) gK interacts with UL20 and is essential for virus replication and spread.
Role of Bovine Adenovirus-3 33K protein in viral replication
International Nuclear Information System (INIS)
Kulshreshtha, Vikas; Babiuk, Lorne A.; Tikoo, Suresh K.
2004-01-01
The L6 region of bovine adenovirus type (BAdV)-3 encodes a nonstructural protein named 33K. To identify and characterize the 33K protein, rabbit polyclonal antiserum was raised against a 33K-GST fusion protein expressed in bacteria. Anti-33K serum immunoprecipitated a protein of 42 kDa in in vitro translated and transcribed mRNA of 33K. However, three proteins of 42, 38, and 33 kDa were detected in BAdV-3 infected cells. To determine the role of this protein in virus replication, a recombinant BAV-33S1 containing insertional inactivation of 33K (a stop codon created at the seventh amino acid of 33K ORF) was constructed. Although BAV-33S1 could be isolated, the mutant showed a severe defect in the production of progeny virus. Inactivation of the 33K gene showed no effect on early and late viral gene expression in cells infected with BAV-33S1. However, formation of mature virions was significantly reduced in cells infected with BAV-33S1. Surprisingly, insertional inactivation of 33K at amino acid 97 (pFBAV-33.KS2) proved lethal for virus production. Although expression of early or late genes was not affected, no capsid formation could be observed in mutant DNA-transfected cells. These results suggest that 33K is required for capsid assembly and efficient DNA capsid interaction
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Expression of bovine herpesvirus 1 glycoproteins gI and gIII in transfected murine cells
International Nuclear Information System (INIS)
Fitzpatrick, D.R.; Zamb, T.; Parker, M.D.; van Drunen Littel-van den Hurk, S.; Babiuk, L.A.; Lawman, M.J.P.
1988-01-01
Genes encoding two of the major glycoproteins of bovine herpesvirus 1 (BHV-1), gI and gIII, were cloned into the eucaryotic expression vectors pRSVcat and pSV2neo and transfected into murine LMTK - cells, and cloned cell lines were established. The relative amounts of gI or gIII expressed from the two vectors were similar. Expression of gI was cell associated and localized predominantly in the perinuclear region, but nuclear and plasma membrane staining was also observed. Expression of gI was additionally associated with cell fusion and the formation of polykaryons and giant cells. Expression of gIII was localized predominantly in the nuclear and plasma membranes. Radioimmunoprecipitation in the presence or absence of tunicamycin revealed that the recombinant glycoproteins were proteolytically processed and glycosylated and had molecular weights similar to those of the forms of gI and gIII expressed in BHV-1 infected bovine cells. However, both recombinant glycoproteins were glycosylated to a lesser extent than were the forms found in BHV-1 infected bovine cells. For gI, a deficiency in N-linked glycosylated of the amino-terminal half of the protein was identified; for gIII, a deficiency in O-linked glycosylation was implicated. The reactivity pattern of a panel of gI- and gIII-specific monoclonal antibodies, including six which recognize conformation-dependent epitopes, was found to be unaffected by the glycosylation differences and was identical for transfected of BHV-1-infected murine cells. Use of the transfected cells as targets in immune-mediated cytotoxicity assays demonstrated the functional recognition of recombinant gI and gIII by murine antibody and cytotoxic T lymphocytes
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Characterization of Staphylococcus aureus strains involved in human and bovine mastitis.
Delgado, Susana; García, Pilar; Fernández, Leonides; Jiménez, Esther; Rodríguez-Baños, Mercedes; del Campo, Rosa; Rodríguez, Juan M
2011-07-01
Staphylococcus aureus is one of the main etiological agents of mastitis in different mammalian species. At present, it is unknown whether strains isolated from human mastitis cases share phenotypic properties and genetic background with those obtained from animal mastitis cases. Therefore, the objective of this study was to characterize S. aureus strains isolated from women with lactational mastitis and to compare them with the strains responsible for bovine mastitis and noninfectious strains. All the strains were genotyped by both pulsed field gel electrophoresis and multilocus sequence typing and submitted to a characterization scheme that included diverse assays related to pathogenic potential and antibiotic resistance. Apart from siderophore production, no significant association was observed between the strains from bovine and human mastitis. Statistical differences between human- and bovine-mastitis-associated strains were detected for some traits and virulence determinants, such as the presence of prophages and cna and hlb genes, which were more frequently found within the bovine group. On the contrary, resistance to penicillin was significantly higher among strains isolated from human lactational mastitis, probably related to the common presence of the blaZ gene. A high genetic diversity was found among the strains involved in mastitis in breastfeeding women. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Transcriptome profiling of the theca interna from bovine ovarian follicles during atresia.
Directory of Open Access Journals (Sweden)
Nicholas Hatzirodos
Full Text Available The theca interna is a specialized stromal layer that envelops each growing ovarian follicle. It contains capillaries, fibroblasts, immune cells and the steroidogenic cells that synthesize androgens for conversion to estradiol by the neighboring granulosa cells. During reproductive life only a small number of follicles will grow to a sufficient size to ovulate, whereas the majority of follicles will undergo regression/atresia and phagocytosis by macrophages. To identify genes which are differentially regulated in the theca interna during follicular atresia, we undertook transcriptome profiling of the theca interna from healthy (n = 10 and antral atretic (n = 5 bovine follicles at early antral stages (<5 mm. Principal Component Analyses and hierarchical classification of the signal intensity plots for the arrays showed primary clustering into two groups, healthy and atretic. A total of 543 probe sets were differentially expressed between the atretic and healthy theca interna. Further analyses of these genes by Ingenuity Pathway Analysis and Gene Ontology Enrichment Analysis Toolkit software found most of the genes being expressed were related to cytokines, hormones and receptors as well as the cell cycle and DNA replication. Cell cycle genes which encode components of the replicating chromosome complex and mitotic spindle were down-regulated in atretic theca interna, whereas stress response and inflammation-related genes such as TP53, IKBKB and TGFB1 were up-regulated. In addition to cell cycle regulators, upstream regulators that were predicted to be inhibited included Retinoblastoma 1, E2 transcription factor 1, and hepatocyte growth factor. Our study suggests that during antral atresia of small follicles in the theca interna, arrest of cell cycle and DNA replication occurs rather than up- regulation of apoptosis-associated genes as occurs in granulosa cells.
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Directory of Open Access Journals (Sweden)
Laurent Pascal
2006-03-01
Full Text Available Abstract Background A number of different quantitative trait loci (QTL for various phenotypic traits, including milk production, functional, and conformation traits in dairy cattle as well as growth and body composition traits in meat cattle, have been mapped consistently in the middle region of bovine chromosome 6 (BTA6. Dense genetic and physical maps and, ultimately, a fully annotated genome sequence as well as their mutual connections are required to efficiently identify genes and gene variants responsible for genetic variation of phenotypic traits. A comprehensive high-resolution gene-rich map linking densely spaced bovine markers and genes to the annotated human genome sequence is required as a framework to facilitate this approach for the region on BTA6 carrying the QTL. Results Therefore, we constructed a high-resolution radiation hybrid (RH map for the QTL containing chromosomal region of BTA6. This new RH map with a total of 234 loci including 115 genes and ESTs displays a substantial increase in loci density compared to existing physical BTA6 maps. Screening the available bovine genome sequence resources, a total of 73 loci could be assigned to sequence contigs, which were already identified as specific for BTA6. For 43 loci, corresponding sequence contigs, which were not yet placed on the bovine genome assembly, were identified. In addition, the improved potential of this high-resolution RH map for BTA6 with respect to comparative mapping was demonstrated. Mapping a large number of genes on BTA6 and cross-referencing them with map locations in corresponding syntenic multi-species chromosome segments (human, mouse, rat, dog, chicken achieved a refined accurate alignment of conserved segments and evolutionary breakpoints across the species included. Conclusion The gene-anchored high-resolution RH map (1 locus/300 kb for the targeted region of BTA6 presented here will provide a valuable platform to guide high-quality assembling and
Monecke, Stefan; Kuhnert, Peter; Hotzel, Helmut; Slickers, Peter; Ehricht, Ralf
2007-11-15
Staphylococcus aureus is a common pathogen which can colonise and infect not only man, but also domestic animals. Especially, infection of cattle is of high economic relevance as S. aureus is an important causal agent of bovine mastitis. In the present contribution, a DNA microarray was applied for the study of 144 different gene targets, including resistance genes and genes encoding exotoxins, in S. aureus isolated from cows. One hundred and twenty-eight isolates from Germany and Switzerland were tested. These isolates were assigned to 20 different strains and nine clonal complexes. The majority of isolates belonged either to apparently closely related clonal complexes 8, 25, and 97 (together 34.4%) or were related to the sequenced bovine strain RF122 (48.4%). Notable characteristics of S. aureus of bovine origin are the carriage of intact haemolysin beta (in 82% of isolates tested), the absence of staphylokinase (in 89.1%), the presence of allelic variants of several exotoxins such as toxic shock syndrome toxin and enterotoxin N, and the occurrence of the leukocidin lukF-P83/lukM (in 53.1%). Two isolates were methicillin-resistant S. aureus (MRSA). One of them was a clonal complex 8 MRSA related to the epidemic MRSA strain Irish 01. The other one belonged to ST398/spa-type 34 resembling a newly emerging MRSA strain which has been described to occur in humans as well as in domestic animals. The presence of these two strains highlights the possibility of transfers of S. aureus strains between different host species.
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Bacteriocins of Non-aureus Staphylococci Isolated from Bovine Milk.
Carson, Domonique A; Barkema, Herman W; Naushad, Sohail; De Buck, Jeroen
2017-09-01
Non- aureus staphylococci (NAS), the bacteria most commonly isolated from the bovine udder, potentially protect the udder against infection by major mastitis pathogens due to bacteriocin production. In this study, we determined the inhibitory capability of 441 bovine NAS isolates (comprising 26 species) against bovine Staphylococcus aureus Furthermore, inhibiting isolates were tested against a human methicillin-resistant S. aureus (MRSA) isolate using a cross-streaking method. We determined the presence of bacteriocin clusters in NAS whole genomes using genome mining tools, BLAST, and comparison of genomes of closely related inhibiting and noninhibiting isolates and determined the genetic organization of any identified bacteriocin biosynthetic gene clusters. Forty isolates from 9 species ( S. capitis , S. chromogenes , S. epidermidis , S. pasteuri , S. saprophyticus , S. sciuri , S. simulans , S. warneri , and S. xylosus ) inhibited growth of S. aureus in vitro , 23 isolates of which, from S. capitis , S. chromogenes , S. epidermidis , S. pasteuri , S. simulans , and S. xylosus , also inhibited MRSA. One hundred five putative bacteriocin gene clusters encompassing 6 different classes (lanthipeptides, sactipeptides, lasso peptides, class IIa, class IIc, and class IId) in 95 whole genomes from 16 species were identified. A total of 25 novel bacteriocin precursors were described. In conclusion, NAS from bovine mammary glands are a source of potential bacteriocins, with >21% being possible producers, representing potential for future characterization and prospective clinical applications. IMPORTANCE Mastitis (particularly infections caused by Staphylococcus aureus ) costs Canadian dairy producers $400 million/year and is the leading cause of antibiotic use on dairy farms. With increasing antibiotic resistance and regulations regarding use, there is impetus to explore bacteriocins (bacterially produced antimicrobial peptides) for treatment and prevention of bacterial
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Directory of Open Access Journals (Sweden)
Russell Christopher D
2012-03-01
Full Text Available Abstract Bovine mastitis remains the most common and costly disease of dairy cattle worldwide. A complementary control measure to herd hygiene and vaccine development would be to selectively breed cattle with greater resistance to mammary infection. Toll-like receptor 1 (TLR1 has an integral role for the initiation and regulation of the immune response to microbial pathogens, and has been linked to numerous inflammatory diseases. The objective of this study was to investigate whether single nucleotide polymorphisms (SNPs within the bovine TLR1 gene (boTLR1 are associated with clinical mastitis (CM. Selected boTLR1 SNPs were analysed within a Holstein Friesian herd. Significant associations were found for the tagging SNP -79 T > G and the 3'UTR SNP +2463 C > T. We observed favourable linkage of reduced CM with increased milk fat and protein, indicating selection for these markers would not be detrimental to milk quality. Furthermore, we present evidence that some of these boTLR1 SNPs underpin functional variation in bovine TLR1. Animals with the GG genotype (from the tag SNP -79 T > G had significantly lower boTLR1 expression in milk somatic cells when compared with TT or TG animals. In addition, stimulation of leucocytes from GG animals with the TLR1-ligand Pam3csk4 resulted in significantly lower levels of CXCL8 mRNA and protein. SNPs in boTLR1 were significantly associated with CM. In addition we have identified a bovine population with impaired boTLR1 expression and function. This may have additional implications for animal health and warrants further investigation to determine the suitability of identified SNPs as markers for disease susceptibility.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
Antimicrobial susceptibility of coagulase-negative Staphylococcus species isolated from bovine milk.
Sawant, A A; Gillespie, B E; Oliver, S P
2009-02-16
Coagulase-negative Staphylococcus (CNS) isolates (n=168) obtained from milk from heifers and dairy cows were screened for minimum inhibitory concentration (MIC) to antimicrobials used commonly for mastitis therapy. Of the 10 CNS species included in the study, the predominant species were Staphylococcus chromogenes (n=61), Staphylococcus epidermidis (n=37), Staphylococcus hyicus (n=37), and Staphylococcus simulans (n=16). The majority of CNS was susceptible to ampicillin, oxacillin, cephalothin, and ceftiofur. Erythromycin and pirlimycin were also very effective in vitro inhibitors of CNS. The only exception was observed with S. epidermidis. Of 37 S. epidermidis evaluated, 13 (35%) exhibited efflux-based resistance to erythromycin (> or =16 microg/ml) encoded by msrA and one isolate carried ermC encoding ribosomal methylase-based resistance to both erythromycin (> or =64 microg/ml) and pirlimycin (> or =64 microg/ml). A total of 17 S. epidermidis, 11 S. chromogenes, and one S. hyicus exhibited phenotypic resistance to ampicillin (> or =0.5 microg/ml). Constitutive beta-lactamase production was observed in all ampicillin resistant isolates except 4 S. epidermidis that exhibited inducible beta-lactamase production. Induced beta-lactamase production was also observed in 13 S. epidermidis that were phenotypically susceptible to the entire MIC panel. All isolates that produced beta-lactamase either constitutively or by induction carried blaZ. S. epidermidis (n=12, 32%) that were resistant to methicillin (oxacillin > or =0.5 microg/ml) carried low affinity penicillin-binding protein encoded by mecA. Most multi-drug resistant (MDR) S. epidermidis (> or =2 resistance genes) were resistant to ampicillin, erythromycin and methicillin. All except one MDR S. epidermidis had icaAB, which encodes for polysaccharide intercellular adhesion. Based on pulsed field gel electrophoresis, MDR S. epidermidis were closely related genotypically, and were isolated from different cows on the
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
Effect of triiodothyronine on developmental competence of bovine oocytes.
Costa, N N; Cordeiro, M S; Silva, T V G; Sastre, D; Santana, P P B; Sá, A L A; Sampaio, R V; Santos, S S D; Adona, P R; Miranda, M S; Ohashi, O M
2013-09-01
Developmental competence of in vitro-matured bovine oocytes is a limiting factor in production of embryos in vitro. Several studies have suggested a potential positive effect of thyroid hormones on cultured oocytes and/or their supporting cells. Therefore, the aim of the present study was to ascertain whether medium supplementation with triiodothyronine (T3) improved subsequent developmental competence of in vitro-matured bovine oocytes. For this purpose, we first documented (using reverse transcription PCR) that whereas bovine cumulus cells expressed both thyroid hormone receptor (TR)-α and TRβ, immature bovine oocytes expressed TRα only. Thereafter, to test the effects of TH on developmental competence, abattoir-derived oocytes were matured in vitro in a medium containing 0, 25, 50, or 100 nM T3 and subjected to in vitro fertilization. Embryo quality was evaluated by assessing cleavage and blastocyst rates, morphological quality, development kinetics, and total cell number on Day 8 of culture. Notably, addition of 50 or 100 nM T3 to the in vitro maturation medium increased (P 0.05) on gene expression. We concluded that supplementation of bovine oocyte in vitro maturation medium with T3 may have a beneficial effect on the kinetics of embryo development. Copyright © 2013 Elsevier Inc. All rights reserved.
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two
International Nuclear Information System (INIS)
Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.
1990-01-01
Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm
2015-05-01
Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Alene Kast
2015-05-01
Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Girolami, Flavia; Spalenza, Veronica; Carletti, Monica; Perona, Giovanni; Sacchi, Paola; Rasero, Roberto; Nebbia, Carlo
2011-10-10
The exposure to dioxin-like (DL) compounds, an important class of persistent environmental pollutants, results in the altered expression of target genes. This occurs through the binding to the aryl hydrocarbon receptor (AhR), the subsequent dimerization with the AhR nuclear translocator (ARNT), and the binding of the complex to DNA responsive elements. A number of genes are up-regulated, including, among others, the AhR repressor (AHRR) and several biotransformation enzymes, such as the members of CYP1 family and NAD(P)H-quinone oxidoreductase (NOQ1). The expression and the inducibility of the above genes were investigated in mitogen-stimulated cultured blood lymphocytes from cattle, which represent a notable source of DL-compound human exposure through dairy products and meat. As assessed by real-time PCR, all the examined genes except CYP1A2 and NQO1 were detected under basal conditions. Cell exposure to the DL-compounds PCB126 or PCB77 in the 10(-6)-10(-9)M concentration range resulted in a 2-4-fold induction of CYPIA1 and CYP1B1, which was antagonized by α-naphthoflavone or PCB153. This study demonstrates for the first time the presence and inducibility of the AhR pathway in easily accessible cells like bovine peripheral lymphocytes and prompts further investigations to verify whether similar changes could occur under in vivo conditions. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Jones, Clinton
2013-01-01
α-Herpesvirinae subfamily members, including herpes simplex virus type 1 (HSV-1) and bovine herpes virus 1 (BHV-1), initiate infection in mucosal surfaces. BHV-1 and HSV-1 enter sensory neurons by cell-cell spread where a burst of viral gene expression occurs. When compared to non-neuronal cells, viral gene expression is quickly extinguished in sensory neurons resulting in neuronal survival and latency. The HSV-1 latency associated transcript (LAT), which is abundantly expressed in latently infected neurons, inhibits apoptosis, viral transcription, and productive infection, and directly or indirectly enhances reactivation from latency in small animal models. Three anti-apoptosis genes can be substituted for LAT, which will restore wild type levels of reactivation from latency to a LAT null mutant virus. Two small non-coding RNAs encoded by LAT possess anti-apoptosis functions in transfected cells. The BHV-1 latency related RNA (LR-RNA), like LAT, is abundantly expressed during latency. The LR-RNA encodes a protein (ORF2) and two microRNAs that are expressed in certain latently infected neurons. Wild-type expression of LR gene products is required for stress-induced reactivation from latency in cattle. ORF2 has anti-apoptosis functions and interacts with certain cellular transcription factors that stimulate viral transcription and productive infection. ORF2 is predicted to promote survival of infected neurons by inhibiting apoptosis and sequestering cellular transcription factors which stimulate productive infection. In addition, the LR encoded microRNAs inhibit viral transcription and apoptosis. In summary, the ability of BHV-1 and HSV-1 to interfere with apoptosis and productive infection in sensory neurons is crucial for the life-long latency-reactivation cycle in their respective hosts. PMID:25278776
Gene prioritization for livestock diseases by data integration
DEFF Research Database (Denmark)
Jiang, Li; Sørensen, Peter; Thomsen, Bo Stjerne
2012-01-01
in bovine mastitis. Gene-associated phenome profile and transcriptome profile in response to Escherichia coli infection in the mammary gland were integrated to make a global inference of bovine genes involved in mastitis. The top ranked genes were highly enriched for pathways and biological processes...... underlying inflammation and immune responses, which supports the validity of our approach for identifying genes that are relevant to animal health and disease. These gene-associated phenotypes were used for a local prioritization of candidate genes located in a QTL affecting the susceptibility to mastitis...
Transcriptional profiling of the bovine hepatic response to experimentally induced E. coli mastitis
DEFF Research Database (Denmark)
Jørgensen, Hanne Birgitte Hede; Buitenhuis, Bart; Røntved, Christine Maria
2012-01-01
The mammalian liver works to keep the body in a state of homeostasis and plays an important role in systemic acute phase response to infections. In this study we investigated the bovine hepatic acute phase response at the gene transcription level in dairy cows with experimentally E. coli-induced ......The mammalian liver works to keep the body in a state of homeostasis and plays an important role in systemic acute phase response to infections. In this study we investigated the bovine hepatic acute phase response at the gene transcription level in dairy cows with experimentally E. coli......-induced mastitis. At time = 0, each of 16 periparturient dairy cows received 20-40 CFU of live E. coli in one front quarter of the udder. A time series of liver biopsies was collected at -144, 12, 24 and 192 hours relative to time of inoculation. Changes in transcription levels in response to E. coli inoculation...... were analyzed using the Bovine Genome Array and tested significant for 408 transcripts over the time series (adjusted p0.05; abs(fold-change)>2). After 2-D clustering, transcripts represented three distinct transcription profiles: 1) regulation of gene transcription and apoptosis, 2) responses...
Target genes of myostatin loss-of-function in muscles of late bovine fetuses
Directory of Open Access Journals (Sweden)
Hocquette Jean-François
2007-03-01
Full Text Available Abstract Background Myostatin, a muscle-specific member of the Transforming Growth Factor beta family, negatively regulates muscle development. Double-muscled (DM cattle have a loss-of-function mutation in their myostatin gene responsible for the hypermuscular phenotype. Thus, these animals are a good model for understanding the mechanisms underpinning muscular hypertrophy. In order to identify individual genes or networks that may be myostatin targets, we looked for genes that were differentially expressed between DM and normal (NM animals (n = 3 per group in the semitendinosus muscle (hypertrophied in DM animals at 260 days of fetal development (when the biochemical differentiation of muscle is intensive. A heterologous microarray (human and murine oligonucleotide sequences of around 6,000 genes expressed in muscle was used. Results Many genes were found to be differentially expressed according to genetic type (some with a more than 5-fold change, and according to the presence of one or two functional myostatin allele(s. They belonged to various functional categories. The genes down-regulated in DM fetuses were mainly those encoding extracellular matrix proteins, slow contractile proteins and ribosomal proteins. The genes up-regulated in DM fetuses were mainly involved in the regulation of transcription, cell cycle/apoptosis, translation or DNA metabolism. These data highlight features indicating that DM muscle is shifted towards a more glycolytic metabolism, and has an altered extracellular matrix composition (e.g. down-regulation of COL1A1 and COL1A2, and up-regulation of COL4A2 and decreased adipocyte differentiation (down-regulation of C1QTNF3. The altered gene expression in the three major muscle compartments (fibers, connective tissue and intramuscular adipose tissue is consistent with the well-known characteristics of DM cattle. In addition, novel potential targets of the myostatin gene were identified (MB, PLN, troponins, ZFHX1B
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
Gene expression profiling of liver from dairy cows treated intra-mammary with lipopolysaccharide
Directory of Open Access Journals (Sweden)
Vels Lotte
2008-09-01
Full Text Available Abstract Background Liver plays a profound role in the acute phase response (APR observed in the early phase of acute bovine mastitis caused by Escherichia coli (E. coli. To gain an insight into the genes and pathways involved in hepatic APR of dairy cows we performed a global gene expression analysis of liver tissue sampled at different time points before and after intra-mammary (IM exposure to E. coli lipopolysaccharide (LPS treatment. Results Approximately 20% target transcripts were differentially expressed and eight co-expression clusters were identified. Each cluster had a unique time-dependent expression profile and consisted of genes involved in different biological processes. Our findings suggest that APR in the liver is triggered by the activation of signaling pathways that are involved with common and hepatic-specific transcription factors and pro-inflammatory cytokines. These mediators in turn stimulated or repressed the expression of genes encoding acute phase proteins (APP, collectins, complement components, chemokines, cell adhesion molecules and key metabolic enzymes during the APR. Hormones, anti-inflammatory and other hypothalamus-pituitary-adrenal axis (HPAA linked mediators also seemed to participate in APR. Conclusion Performing global gene expression analysis on liver tissue from IM LPS treated cows verified that the liver plays a major role in the APR of E. coli mastitis, and that the bovine hepatic APR follows the same pattern as other mammals when they are challenged with LPS. Our work presents the first insight into the dynamic changes in gene expression in the liver that influences the induction, kinetics and clinical outcome of the APR in dairy cows.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap
2002-04-15
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.
Directory of Open Access Journals (Sweden)
Hongle Xu
Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.
Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor
2015-12-01
In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Royah Vaezi
2013-12-01
Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.
Directory of Open Access Journals (Sweden)
Wang Zhiquan
2007-07-01
Full Text Available Abstract Background Radiation hybrid (RH maps are considered to be a tool of choice for fine mapping closely linked loci, considering that the resolution of linkage maps is determined by the number of informative meiosis and recombination events which may require very large mapping populations. Accurately defining the marker order on chromosomes is crucial for correct identification of quantitative trait loci (QTL, haplotype map construction and refinement of candidate gene searches. Results A 12 k Radiation hybrid map of bovine chromosome 14 was constructed using 843 single nucleotide polymorphism markers. The resulting map was aligned with the latest version of the bovine assembly (Btau_3.1 as well as other previously published RH maps. The resulting map identified distinct regions on Bovine chromosome 14 where discrepancies between this RH map and the bovine assembly occur. A major region of discrepancy was found near the centromere involving the arrangement and order of the scaffolds from the assembly. The map further confirms previously published conserved synteny blocks with human chromosome 8. As well, it identifies an extra breakpoint and conserved synteny block previously undetected due to lower marker density. This conserved synteny block is in a region where markers between the RH map presented here and the latest sequence assembly are in very good agreement. Conclusion The increase of publicly available markers shifts the rate limiting step from marker discovery to the correct identification of their order for further use by the research community. This high resolution map of bovine chromosome 14 will facilitate identification of regions in the sequence assembly where additional information is required to resolve marker ordering.
DEFF Research Database (Denmark)
Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H
2012-01-01
OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
DEFF Research Database (Denmark)
Støy, Ann Cathrine Findal; Heegaard, Peter M. H.; Thymann, Thomas
2014-01-01
Background & aims Only few hours of formula feeding may induce proinflammatory responses and predispose to necrotizing enterocolitis (NEC) in preterm pigs. We hypothesized that bovine colostrum, rich in bioactive factors, would improve intestinal function in preterm pigs following an initial...... exposure to formula feeding after some days of total parenteral nutrition (TPN). Methods After receiving TPN for 2 days, preterm pigs were fed formula (FORM, n = 14), bovine colostrum (COLOS, n = 6), or formula (6 h) followed by bovine colostrum (FCOLOS, n = 14). Intestinal lesions, function, and structure...... and FCOLOS pigs, relative to FORM pigs. Intestinal gene expression of serum amyloid A, IL-1β, -6 and -8, and bacterial abundance, correlated positively with NEC severity of the distal small intestine. Conclusions Bovine colostrum restores intestinal function after initial formula-induced inflammation...
Directory of Open Access Journals (Sweden)
Magee David A
2010-11-01
Full Text Available Abstract Background Mastitis, an inflammation of the mammary gland, is a major source of economic loss on dairy farms. The aim of this study was to quantify the associations between two previously identified polymorphisms in the bovine toll-like receptor 2 (TLR2 and chemokine receptor 1 (CXCR1 genes and mammary health indictor traits in (a 246 lactating dairy cow contemporaries representing five breeds from one research farm and (b 848 Holstein-Friesian bulls that represent a large proportion of the Irish dairy germplasm. To expand the study, a further 14 polymorphisms in immune genes were included for association studies in the bull population. Results TLR4-2021 associated (P SERPINA1 haplotype with superior genetic merit for milk protein yield and milk fat percentage (P Conclusion Of the sixteen polymorphisms in seven immune genes genotyped, just CXCR1-777 tended to associate with SCS, albeit only in the on-farm study. The lack of an association between the polymorphisms with SCS in the Holstein-Friesian data set would question the potential importance of these variants in selection for improved mastitis resistance in the Holstein-Friesian cow.
Huang, J M; Wang, Z Y; Ju, Z H; Wang, C F; Li, Q L; Sun, T; Hou, Q L; Hang, S Q; Hou, M H; Zhong, J F
2011-12-21
Bovine lactoferrin (bLF) is a member of the transferrin family; it plays an important role in the innate immune response. We identified novel splice variants of the bLF gene in mastitis-infected and healthy cows. Reverse transcription-polymerase chain reaction (RT-PCR) and clone sequencing analysis were used to screen the splice variants of the bLF gene in the mammary gland, spleen and liver tissues. One main transcript corresponding to the bLF reference sequence was found in three tissues in both healthy and mastitis-infected cows. Quantitative real-time PCR analysis showed that the expression levels of the LF gene's main transcript were not significantly different in tissues from healthy versus mastitis-infected cows. However, the new splice variant, LF-AS2, which has the exon-skipping alternative splicing pattern, was only identified in mammary glands infected with Staphylococcus aureus. Sequencing analysis showed that the new splice variant was 251 bp in length, including exon 1, part of exon 2, part of exon 16, and exon 17. We conclude that bLF may play a role in resistance to mastitis through alternative splicing mechanisms.
Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.
2015-01-01
In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472
Directory of Open Access Journals (Sweden)
Vera S Bogdanova
Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.
Effects of different feeder layers on culture of bovine embryonic stem cell-like cells in vitro
Cong, Shan; Cao, Guifang; Liu, Dongjun
2014-01-01
To find a suitable feeder layer is important for successful culture conditions of bovine embryonic stem cell-like cells. In this study, expression of pluripotency-related genes OCT4, SOX2 and NANOG in bovine embryonic stem cell-like cells on mouse embryonic fibroblast feeder layers at 1–5 passages were monitored in order to identify the possible reason that bovine embryonic stem cell-like cells could not continue growth and passage. Here, we developed two novel feeder layers, mixed embryonic ...
Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.
Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang
2012-02-01
In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sweeney Torres
2010-12-01
Full Text Available Abstract Background Recent QTL and gene expression studies have highlighted ankyrins as positional and functional candidate genes for meat quality. Our objective was to characterise the promoter region of the bovine ankyrin 1 gene and to test polymorphisms for association with sensory and technological meat quality measures. Results Seven novel promoter SNPs were identified in a 1.11 kb region of the ankyrin 1 promoter in Angus, Charolais and Limousin bulls (n = 15 per breed as well as 141 crossbred beef animals for which meat quality data was available. Eighteen haplotypes were inferred with significant breed variation in haplotype frequencies. The five most frequent SNPs and the four most frequent haplotypes were subsequently tested for association with sensory and technological measures of meat quality in the crossbred population. SNP1, SNP3 and SNP4 (which were subsequently designated regulatory SNPs and SNP5 were associated with traits that contribute to sensorial and technological measurements of tenderness and texture; Haplotype 1 and haplotype 4 were oppositely correlated with traits contributing to tenderness (P Conclusion The conclusion from this study is that alleles defining haplotypes 2 and 4 could usefully contribute to marker SNP panels used to select individuals with improved IMF/juiciness or tenderness in a genome-assisted selection framework.
Energy Technology Data Exchange (ETDEWEB)
Henrique Barreta, Marcos [Universidade Federal de Santa Catarina, Campus Universitario de Curitibanos, Curitibanos, SC (Brazil); Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Ferreira, Rogerio [Centro de Educacao Superior do Oeste-Universidade do Estado de Santa Catarina, Chapeco, SC (Brazil); Oliveira, Joao Francisco de; Goncalves, Paulo Bayard Dias [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Bordignon, Vilceu, E-mail: vilceu.bordignon@mcgill.ca [Department of Animal Science, McGill University, Ste-Anne-De-Bellevue, QC (Canada)
2012-10-01
This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.
International Nuclear Information System (INIS)
Henrique Barreta, Marcos; Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de; Ferreira, Rogério; Oliveira, João Francisco de; Gonçalves, Paulo Bayard Dias; Bordignon, Vilceu
2012-01-01
This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István
2016-07-01
A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
DEFF Research Database (Denmark)
Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M
2017-01-01
these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...
Directory of Open Access Journals (Sweden)
Heyman Yvan
2005-11-01
Full Text Available Abstract Background Recent work has shown that mitochondrial biogenesis and mitochondrial functions are critical determinants of embryonic development. However, the expression of the factors controlling mitochondrial biogenesis in early embryogenesis has received little attention so far. Methods We used real-time quantitative PCR to quantify mitochondrial DNA (mtDNA in bovine oocytes and in various stages of in vitro produced embryos. To investigate the molecular mechanisms responsible for the replication and the transcriptional activation of mtDNA, we quantified the mRNA corresponding to the mtDNA-encoded cytochrome oxidase 1 (COX1, and two nuclear-encoded factors, i.e. the Nuclear Respiratory Factor 1 (NRF1, and the nuclear-encoded Mitochondrial Transcription Factor A (mtTFA. Results Unlike findings reported in mouse embryos, the mtDNA content was not constant during early bovine embryogenesis. We found a sharp, 60% decrease in mtDNA content between the 2-cell and the 4/8-cell stages. COX1 mRNA was constant until the morula stage after which it increased dramatically. mtTFA mRNA was undetectable in oocytes and remained so until the 8/16-cell stage; it began to appear only at the morula stage, suggesting de novo synthesis. In contrast, NRF1 mRNA was detectable in oocytes and the quantity remained constant until the morula stage. Conclusion Our results revealed a reduction of mtDNA content in early bovine embryos suggesting an active process of mitochondrial DNA degradation. In addition, de novo mtTFA expression associated with mitochondrial biogenesis activation and high levels of NRF1 mRNA from the oocyte stage onwards argue for the essential function of these factors during the first steps of bovine embryogenesis.
Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA
2012-06-19
Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.
Tang, Zhiru; Zhang, Youming; Stewart, Adrian Francis; Geng, Meimei; Tang, Xiangsha; Tu, Qiang; Yin, Yulong
2010-10-01
Bovine lactoferricin (LFC) and bovine lactoferrampin (LFA) are two active fragments located in the N(1)-domain of bovine lactoferrin. Recent studies suggested that LFC and LFA have broad-spectrum activity against Gram-positive and Gram-negative bacteria. To date, LFC and LFA have usually been produced from milk. We report here the high-level expression, purification and characterization of LFC and LFA using the Photorhabdus luminescens expression system. After the cipA and cipB genes were deleted by ET recombination, the expression host P. luminescens TZR(001) was constructed. A synthetic LFC-LFA gene containing LFC and LFA was fused with the cipB gene to form a cipB-LFC-LFA gene. To obtain the expression vector pBAD-cipB-LFC-LFA, the cipB-LFC-LFA gene was cloned on the L-arabinose-inducible expression vector pBAD24. pBAD-cipB-LFC-LFA was transformed into P. luminescens TZR(001). The cipB-LFC-LFA fusion protein was expressed under the induction of L-arabinose and its yield reached 12 mg L(-1) bacterial culture. Recombinant LFC-LFA was released from cipB by pepsin. The MIC of recombinant LFC-LFA toward E. coli 0149, 0141 and 020 was 6.25, 12.5 and 3.175 microg ml(-1), respectively. Copyright 2010 Elsevier Inc. All rights reserved.
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-01-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing
2002-07-01
Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.
Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine
2011-01-01
Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.
Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis
Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon
2013-01-01
The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
International Nuclear Information System (INIS)
Khan, A.; Javed, M.T.; Mahmood, F.; Hussain, R.
2013-01-01
The present study was undertaken to determine the distribution and genotypic characteristics of Staphylococcus aureus isolates recovered from naturally occurring mastitis in cattle and buffaloes. For this purpose a total of 1445 lactating cattle (653) and buffaloes (792) present at two experimental livestock farms Okara (Bahadarnagar) and Sahiwal (Qadiarabad), in and around district Faisalabad and slaughtered at an abattoir due to low milk yield and were screened for mastitis. California Mastitis Test (CMT) was used to detect sub clinical mastitis. The positive quarter milk samples were collected for culturing of S. aureus isolates. taphylococcus aureus isolates were identified on the basis of growth features, biochemical characteristics, coagulase test and as well as amplification of coagulase (coa) and spa (spa-X) genes specific to its virulence. S. aureus isolates (n=265) were characterized by Polymerase chain reaction to determine the frequency of coagulase (coa) and spa (spa-X) genes. From these isolates the amplification of the coagulase (coa) gene yielded three different PCR products approximately 204bp to 490bp while spa (spa-X) gene produced five different products ranging in size from 190bp to 320bp. PCR revealed that from all the coagulase positive S. aureus isolates 261(98.5%) had spa (spa-X) gene. The results of the present study indicated that S. aureus isolates recovered from bovine mastitis were genetically different within and among the various herds which may provide essential and valuable strategies to control staphylococcal infections in future. (author)
Energy Technology Data Exchange (ETDEWEB)
Khan, A.; Javed, M. T.; Mahmood, F. [University of Agriculture, Faisalabad (Pakistan). Dept. of Pathology; Hussain, R. [The Islamia Univ. of Bahawalpur, Pakistan (Pakistan). Dept. of Veterinary and Animal Sciences
2013-12-15
The present study was undertaken to determine the distribution and genotypic characteristics of Staphylococcus aureus isolates recovered from naturally occurring mastitis in cattle and buffaloes. For this purpose a total of 1445 lactating cattle (653) and buffaloes (792) present at two experimental livestock farms Okara (Bahadarnagar) and Sahiwal (Qadiarabad), in and around district Faisalabad and slaughtered at an abattoir due to low milk yield and were screened for mastitis. California Mastitis Test (CMT) was used to detect sub clinical mastitis. The positive quarter milk samples were collected for culturing of S. aureus isolates. taphylococcus aureus isolates were identified on the basis of growth features, biochemical characteristics, coagulase test and as well as amplification of coagulase (coa) and spa (spa-X) genes specific to its virulence. S. aureus isolates (n=265) were characterized by Polymerase chain reaction to determine the frequency of coagulase (coa) and spa (spa-X) genes. From these isolates the amplification of the coagulase (coa) gene yielded three different PCR products approximately 204bp to 490bp while spa (spa-X) gene produced five different products ranging in size from 190bp to 320bp. PCR revealed that from all the coagulase positive S. aureus isolates 261(98.5%) had spa (spa-X) gene. The results of the present study indicated that S. aureus isolates recovered from bovine mastitis were genetically different within and among the various herds which may provide essential and valuable strategies to control staphylococcal infections in future. (author)
DEFF Research Database (Denmark)
Huebner, K; Kastury, K; Druck, T
1994-01-01
"adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...
Protective effect of bovine milk against HCl and ethanol-induced gastric ulcer in mice.
Yoo, Jeong-Hyun; Lee, Jeong-Sang; Lee, You-Suk; Ku, SaeKwang; Lee, Hae-Jeung
2018-05-01
The purpose of this study was to investigate the gastroprotective effects of bovine milk on an acidified ethanol (HCl-ethanol) mixture that induced gastric ulcers in a mouse model. Mice received different doses of commercial fresh bovine milk (5, 10, and 20 mL/kg of body weight) by oral gavage once a day for 14 d. One hour after the last oral administration of bovine milk, the HCl-ethanol mixture was orally intubated to provoke severe gastric damage. Our results showed that pretreatment with bovine milk significantly suppressed the formation of gastric mucosa lesions. Pretreatment lowered gastric myeloperoxidase and increased gastric mucus contents and antioxidant enzymes catalase and superoxide dismutase. Administration of bovine milk increased nitrate/nitrite levels and decreased the malondialdehyde levels and the expression of proinflammatory genes, including transcription factor nuclear factor-κB, cyclooxygenase-2, and inducible nitric oxide synthase in the stomach of mice. These results suggest that bovine milk can prevent the development of gastric ulcer caused by acid and alcohol in mice. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Sakurai, Toshihiro; Nakagawa, So; Bai, Hanako; Bai, Rulan; Kusama, Kazuya; Ideta, Atsushi; Aoyagi, Yoshito; Kaneko, Kazuyuki; Iga, Kosuke; Yasuda, Jiro; Miyazawa, Takayuki; Imakawa, Kazuhiko
2017-10-10
Endogenous retroviruses (ERVs) are involved in placentation; perhaps, the most well-known ERV s are the syncytins, actively transcribed env genes involved in cell-cell fusion and possible morphological variations. However, ERVs other than syncytins that play an important role in placental development have not been well characterized. To identify ERV genes expressed during the onset of placentation in the bovine species, we characterized the expression profiles of bovine conceptus transcripts during the peri-attachment period using RNA-seq analysis, and confirming some candidates through real-time PCR. Using in silico and PCR analyses, we identified a novel ERV proviral sequence derived from a gag region, designated bovine endogenous retroviruses (BERV)-K3, containing Gag _p10 and Gag _p24, zinc finger domain. Initial expression of this ERV in bovine conceptuses was on day 20 (day 0 = day of estrus), soon after conceptus attachment to the endometrial epithelium, and its high placental expression was maintained up to the middle of pregnancy. The BERV-K3 transcript was also found in the uterine luminal and glandular epithelia, liver, kidney, intestine, and skin. BERV-K3 is located on chromosome 7 and integrated within LOC100848658 , from which noncoding RNA could be transcribed. Furthermore, the expression of endogenous BERV-K3 in bovine trophoblast cell lines was induced by a WNT agonist, a signaling system common to genes expressed in placentas. These data support the argument that during the evolutionary process, mammals incorporated not only similar ERV sequences, but also ERV s unique to individual species. BERV-K3 is in the latter case, likely providing functions unique to ruminant gestation. © 2017 The Author(s).
Keebaugh, Alaine C; Thomas, James W
2010-06-01
Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.
Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A
2014-12-13
The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.
Directory of Open Access Journals (Sweden)
A. Ghanizadeh
2015-10-01
Full Text Available Pasteurella multocida (P. multocida, A Gram-negative facultative anaerobic bacterium, is a causative animal pathogen in porcine atrophic rhinitis and avian fowl cholera. The outer membrane of Gram-negative bacteria contains of many different protein in very high copy numbers. One of the major outer membrane, the H proteins have functional as high immunogenicity and antigenicity. In this study to increase information about epidemiology of ovine and bovine P. multocida, the 24 isolates from sheep and nine isolates from cattle were investigated by PCR-RFLP analysis of the ompH gene. In all 33 isolates, digestion of the amplified fragment of ompH gene by using EcoRI, cfoI and HindIII produced 3, 5 and 3 different restriction patterns respectively. Sixteen RFLP patterns were found among 33 investigated P.multocida isolates. This study showed that, the PCR RFLP based on ompH gene is potentially a useful method for typing of P. multocida isolates from sheep and cattle. The RFLP patterns of this gene exhibited extensive restriction site heterogeneity, which may be particularly suitable for fingerprinting of P. multocida isolates.Considering ompH protein as a protective immunogenic moiety of P.ultocida, the results of this study showed a heterogenic bacteria and this means the possibility to produce a multivalent vaccine to be protective against diseases caused by this organism in sheep and cattle in Iran.
Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.
Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A
1993-09-15
Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.
Distinct forms of the β subunit of GTP-binding regulatory proteins identified by molecular cloning
International Nuclear Information System (INIS)
Fong, H.K.W.; Amatruda, T.T. III; Birren, B.W.; Simon, M.I.
1987-01-01
Two distinct β subunits of guanine nucleotide-binding regulatory proteins have been identified by cDNA cloning and are referred to as β 1 and β 1 subunits. The bovine transducin β subunit (β 1 ) has been cloned previously. The author now isolated and analyzed cDNA clones that encode the β 2 subunit from bovine adrenal, bovine brain, and a human myeloid leukemia cell line, HL-60. The 340-residue M/sub r/ 37,329 Β 2 protein is 90% identical with β 1 in predicted amino acid sequence, and it is also organized as a series of repetitive homologous segments. The major mRNA that encodes the bovine β 2 subunit is 1.7 kilobases in length. It is expressed at lower levels than β 1 subunit mRNA in all tissues examined. The β 1 and β 2 messages are expressed in cloned human cell lines. Hybridization of cDNA probes to bovine DNA showed that β 1 and β 2 are encoded by separate genes. The amino acid sequences for the bovine and human β 2 subunit are identical, as are the amino acid sequences for the bovine and human β 1 subunit. This evolutionary conservation suggests that the two β subunits have different roles in the signal transduction process
DEFF Research Database (Denmark)
Pallesen, Lone Tjener; Andersen, Mikkel Holmen; Nielsen, Rune
2001-01-01
acid sequences obtained by peptide mapping. The complete amino acid sequence of MUC1 was determined by cloning and sequencing the corresponding bovine mammary gland cDNA, which was shown to encode a protein of 580 amino acid residues comprising a cleavable signal peptide of 22 residues. The deduced...
Directory of Open Access Journals (Sweden)
David H. Dreyfus
2017-01-01
Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.
Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G
2014-08-28
The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.
Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A
2017-01-01
Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.
Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang
2014-03-01
The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Takahashi Toru
2010-02-01
Full Text Available Abstract Background Bovine follicular development is regulated by numerous molecular mechanisms and biological pathways. In this study, we tried to identify differentially expressed genes between largest (F1 and second-largest follicles (F2, and classify them by global gene expression profiling using a combination of microarray and quantitative real-time PCR (QPCR analysis. The follicular status of F1 and F2 were further evaluated in terms of healthy and atretic conditions by investigating mRNA localization of identified genes. Methods Global gene expression profiles of F1 (10.7 +/- 0.7 mm and F2 (7.8 +/- 0.2 mm were analyzed by hierarchical cluster analysis and expression profiles of 16 representative genes were confirmed by QPCR analysis. In addition, localization of six identified transcripts was investigated in healthy and atretic follicles using in situ hybridization. The healthy or atretic condition of examined follicles was classified by progesterone and estradiol concentrations in follicular fluid. Results Hierarchical cluster analysis of microarray data classified the follicles into two clusters. Cluster A was composed of only F2 and was characterized by high expression of 31 genes including IGFBP5, whereas cluster B contained only F1 and predominantly expressed 45 genes including CYP19 and FSHR. QPCR analysis confirmed AMH, CYP19, FSHR, GPX3, PlGF, PLA2G1B, SCD and TRB2 were greater in F1 than F2, while CCL2, GADD45A, IGFBP5, PLAUR, SELP, SPP1, TIMP1 and TSP2 were greater in F2 than in F1. In situ hybridization showed that AMH and CYP19 were detected in granulosa cells (GC of healthy as well as atretic follicles. PlGF was localized in GC and in the theca layer (TL of healthy follicles. IGFBP5 was detected in both GC and TL of atretic follicles. GADD45A and TSP2 were localized in both GC and TL of atretic follicles, whereas healthy follicles expressed them only in GC. Conclusion We demonstrated that global gene expression profiling of F
International Nuclear Information System (INIS)
Franco, A.C.; Spilki, F.R.; Roehe, P.M.; Rijsewijk, F.A.M.
2005-01-01
Aiming at the development of a differential vaccine (DIVA) against infectious bovine rhinotracheitis (IBR), a Brazilian strain of bovine herpesvirus type 1 (BHV1) with a deletion of the glycoprotein E (gE) gene was constructed (265gE - ). Here we present the experiments performed with this strain in order to evaluate its safety and efficacy as a vaccine virus in cattle. In the first experiment, a group of calves was inoculated with 265gE - and challenged with wild type virus 21 days post-inoculation. Calves immunized with 265gE - virus and challenged with wild type virus developed very mild clinical disease with a significant reduction in the amount of virus excretion and duration. The safety of the 265gE - during pregnancy was assessed using 22 pregnant cows, at different stages of gestation, that were inoculated with the 265gE - virus intramuscularly, with 15 pregnant cows kept as non-vaccinated controls. No abortions, stillbirths or foetal abnormalities were seen after vaccination. The results show that the 265gE - recombinant is attenuated and able to prevent clinical disease upon challenge. This recombinant will be further evaluated as a candidate virus for a BHV1 differential vaccine. (author)
Directory of Open Access Journals (Sweden)
Yi-Li Li
2017-11-01
Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.
A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.
Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C
1994-02-01
We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.
Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T
1999-04-16
A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.
125I-labeling and purification of peptide hormones and bovine serum albumin
International Nuclear Information System (INIS)
Nemeth, J; Jakab, B.; Szilvassy, Z.; Oroszi, G.; Roeth, E.; Magyarlaki, M.; Farkas, B.
2002-01-01
The iodination and separation of various diagnostically and/or experimentally important peptides including (Tyr 1 )-somatostatin-14, rat Tyr-α-calcitonin gene-related peptide (23-37), motilin and vasoactive intestinal peptide, furthermore bovine serum albumin are described. All species were iodinated by the iodogen method. The 125 I-labeled peptide products were separated by reversed-phase HPLC, the specific activities of mono-iodinated forms are near identical with the theoretical value. The labeled bovine serum albumin was separated by Sephadex G-100 gel filtration. (author)
Grimm, Frauke; Dobler, Nadine; Dahl, Christiane
2010-03-01
Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.
Ajitkumar, Praseeda; Barkema, Herman W; Zadoks, Ruth N; Morck, Douglas W; van der Meer, Frank J U M; De Buck, Jeroen
2013-03-01
Coagulase-negative staphylococci (CNS) are the most frequently isolated pathogens isolated from bovine milk. In this study, we report a rapid assay for species identification of CNS using high-resolution melt analysis (HRMA) of 16S rDNA sequences. Real-time polymerase chain reaction amplification of 16S rRNA gene fragment, spanning the variable region V1 and V2, was performed with a resulting amplicon of 215 bp. A library of distinct melt curves of reference strains of 13 common CNS species was created using HRMA. Sequencing of 16S rRNA and rpoB genes, and, when needed, tuf gene, of 100 CNS isolates obtained from Canadian Bovine Mastitis Research Network was done to determine their species identity, allowing for subsequent evaluation of the performance of HRMA for field isolates of bovine CNS. A combination of HRMA and sequencing revealed that Staphylococcus chromogenes, S. xylosus, S. simulans, and S. sciuri had multiple genotypes, complicating their resolution by HRMA. As the 3 genotypes of S. chromogenes had distinct melt curves, the 3 distinct genotypes were employed as reference strains in a blinded trial of 156 CNS isolates to identify S. chromogenes. HRMA correctly identified all S. chromogenes isolates which were later confirmed by sequencing. Staphylococcus chromogenes (68%) was most frequently found among the CNS isolates, followed by S. haemolyticus (10%) and S. xylosus (6%). The present study revealed that HRMA of 16S rRNA gene (V1-V2) could be used as a rapid, efficient, low-cost, and minimally cumbersome technique for S. chromogenes identification, the most common CNS derived from bovine milk. Copyright © 2013 Elsevier Inc. All rights reserved.
Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas
2013-09-01
GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.
Directory of Open Access Journals (Sweden)
Mohsen Heidary
2017-03-01
Full Text Available Abstract Background and Objectives: Increasing emergence of fluoroquinolone resistance among clinical isolates of Klebsiella pneumoniae (K. pneumoniae, has limited the treatment options for treatment of infections caused by these bacteria. The aim of this study was to investigate the dissemination of genes encoding AcrAB and QepA efflux pumps among K. pneumoniae strains. Methods: This study was carried out on 117 K. pneumoniae strains isolated from patients hospitalized in selected hospitals in Tehran city, 2015-2016, Iran. Antimicrobial susceptibility tests were performed using disk diffusion method (based on CLSI guidelines and identification of acr A, acr B and qep A genes using PCR assay. Results: In this study, colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. According to PCR results, 110 (94% isolates had acrA gene and 102 (87% isolates had acrB gene, respectively. The qepA gene was not found in any of the K. pneumoniae strains. Conclusion: According to the results of the present study, dissemination of the genes encoding AcrAB efflux pumps among K. pneumoniae strains, which cause resistance to fluoroquinolones, is a matter of concern. Therefore, infection control and prevention of the spread of drug-resistant bacteria requires careful management in drug prescription and identification of resistant isolates.
A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle
Directory of Open Access Journals (Sweden)
Beever Jonathan E
2010-05-01
Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Directory of Open Access Journals (Sweden)
Mishra Mukti N
2010-07-01
Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)
Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi
2013-03-01
Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).
Scorpio, A; Zhang, Y
1996-06-01
Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.
Rall, V L M; Vieira, F P; Rall, R; Vieitis, R L; Fernandes, A; Candeias, J M G; Cardoso, K F G; Araújo, J P
2008-12-10
Milk is considered a nutritious food because it contains several important nutrients including proteins and vitamins. Conversely, it can be a vehicle for several pathogenic bacteria such as Staphylococcus aureus. This study aimed to analyze the frequency of genes encoding the staphylococcal enterotoxins (SEs) SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI and SEJ in S. aureus strains isolated from raw or pasteurized bovine milk. S. aureus was found in 38 (70.4%) out of 54 raw milk samples at concentrations of up to 8.9 x 10(5) CFU/ml. This microorganism was present in eight samples of pasteurized milk before the expiration date and in 11 samples analyzed on the expiration date. Of the 57 strains studied, 68.4% were positive for one or more genes encoding the enterotoxins, and 12 different genotypes were identified. The gene coding for enterotoxin A, sea, was the most frequent (16 strains, 41%), followed by sec (8 strains, 20.5%), sed (5 strains, 12.8%), seb (3 strains, 7.7%) and see (2 strains, 5.1%). Among the genes encoding the other enterotoxins, seg was the most frequently observed (11 strains, 28.2%), followed by sei (10 strains) and seh and sej (3 strains each). With the recent identification of new SEs, the perceived frequency of enterotoxigenic strains has increased, suggesting that the pathogenic potential of staphylococci may be higher than previously thought; however, further studies are required to assess the expression of these new SEs by S. aureus, and their impact in foodborne disease. The quality of Brazilian milk is still low, and efforts from the government and the entire productive chain are required to attain consumer safety.
Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...
DEFF Research Database (Denmark)
Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner
2014-01-01
. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...
Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava
2014-04-03
Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.
Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka
2005-01-01
We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.
QTL global meta-analysis: are trait determining genes clustered?
Directory of Open Access Journals (Sweden)
Adelson David L
2009-04-01
Full Text Available Abstract Background A key open question in biology is if genes are physically clustered with respect to their known functions or phenotypic effects. This is of particular interest for Quantitative Trait Loci (QTL where a QTL region could contain a number of genes that contribute to the trait being measured. Results We observed a significant increase in gene density within QTL regions compared to non-QTL regions and/or the entire bovine genome. By grouping QTL from the Bovine QTL Viewer database into 8 categories of non-redundant regions, we have been able to analyze gene density and gene function distribution, based on Gene Ontology (GO with relation to their location within QTL regions, outside of QTL regions and across the entire bovine genome. We identified a number of GO terms that were significantly over represented within particular QTL categories. Furthermore, select GO terms expected to be associated with the QTL category based on common biological knowledge have also proved to be significantly over represented in QTL regions. Conclusion Our analysis provides evidence of over represented GO terms in QTL regions. This increased GO term density indicates possible clustering of gene functions within QTL regions of the bovine genome. Genes with similar functions may be grouped in specific locales and could be contributing to QTL traits. Moreover, we have identified over-represented GO terminology that from a biological standpoint, makes sense with respect to QTL category type.
Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu
2014-01-01
In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial
Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B
2012-08-01
The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Manzanares, P.; Orejas, M.; Vicente Gil, J.; Graaff, de L.H.; Visser, J.; Ramon, D.
2003-01-01
The Aspergillus aculeatus rhaA gene encoding an alpha-L-rhamnosidase has been expressed in both laboratory and industrial wine yeast strains. Wines produced in microvinifications, conducted using a combination of the genetically modified industrial strain expressing rhaA and another strain
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
Gastrointestinal nematodes of the genus Cooperia are arguably the most important parasites of cattle. We characterized the bovine jejunal transcriptome in response to C. oncophora infection using RNA-seq technology. Approximately 71% of the 25,670 bovine genes were detected in the jejunal transcript...
Directory of Open Access Journals (Sweden)
Sandro Roselli
Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of
Genome-wide association study for host response to bovine leukemia virus in Holstein cows.
Brym, P; Bojarojć-Nosowicz, B; Oleński, K; Hering, D M; Ruść, A; Kaczmarczyk, E; Kamiński, S
2016-07-01
The mechanisms of leukemogenesis induced by bovine leukemia virus (BLV) and the processes underlying the phenomenon of differential host response to BLV infection still remain poorly understood. The aim of the study was to screen the entire cattle genome to identify markers and candidate genes that might be involved in host response to bovine leukemia virus infection. A genome-wide association study was performed using Holstein cows naturally infected by BLV. A data set included 43 cows (BLV positive) and 30 cows (BLV negative) genotyped for 54,609 SNP markers (Illumina Bovine SNP50 BeadChip). The BLV status of cows was determined by serum ELISA, nested-PCR and hematological counts. Linear Regression Analysis with a False Discovery Rate and kinship matrix (computed on the autosomal SNPs) was calculated to find out which SNP markers significantly differentiate BLV-positive and BLV-negative cows. Nine markers reached genome-wide significance. The most significant SNPs were located on chromosomes 23 (rs41583098), 3 (rs109405425, rs110785500) and 8 (rs43564499) in close vicinity of a patatin-like phospholipase domain containing 1 (PNPLA1); adaptor-related protein complex 4, beta 1 subunit (AP4B1); tripartite motif-containing 45 (TRIM45) and cell division cycle associated 2 (CDCA2) genes, respectively. Furthermore, a list of 41 candidate genes was composed based on their proximity to significant markers (within a distance of ca. 1 Mb) and functional involvement in processes potentially underlying BLV-induced pathogenesis. In conclusion, it was demonstrated that host response to BLV infection involves nine sub-regions of the cattle genome (represented by 9 SNP markers), containing many genes which, based on the literature, could be involved to enzootic bovine leukemia progression. New group of promising candidate genes associated with the host response to BLV infection were identified and could therefore be a target for future studies. The functions of candidate genes
Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter
2017-09-01
Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.
DEFF Research Database (Denmark)
Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven
2017-01-01
The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...
Directory of Open Access Journals (Sweden)
Wang Yu
2011-04-01
Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15
Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang
2011-04-06
In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and
Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua
2017-01-01
Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.
Girolami, Flavia; Spalenza, Veronica; Manzini, Livio; Carletti, Monica; Nebbia, Carlo
2015-01-05
Environmental pollutants, such as dioxin-like (DL) PCBs, benzo(a) pyrene (B[a]P), and flavonoids are aryl hydrocarbon receptor (AHR) ligands and may be excreted in dairy milk. The expression of AHR-target genes, particularly those involved in xenobiotic biotransformation, and their modulation by two DL-PCBs, B[a]P, and β-naphthoflavone was investigated in a bovine mammary epithelial cell line (BME-UV). As assessed by quantitative PCR, BME-UV cells expressed a functional AHR signaling pathway. All the AHR ligands induced a concentration-related increase in the transcription of cytochrome P450 1A1 and 1B1, known to be implicated in the bioactivation of several xenobiotics. Conversely, genes encoding for antioxidant and detoxifying enzymes, like quinone oxidoreductase or glutathione S-transferase A2, were not affected or even depressed. This study demonstrates the occurrence and the modulation by different AHR-ligands of genes involved in xenobiotic metabolism in BME-UV cells, with the potential generation of (re) active metabolites that may damage mammary tissue and/or affect animal or human health via the contaminated milk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.
1987-01-01
A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene
Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-06-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.
Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.
A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,
Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B
1995-09-01
Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.
Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.
Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe
2016-11-15
Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide
Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie
2010-01-01
Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558
Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael
2009-08-01
Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.
Two novel SNPs in the coding region of bovine VDR gene and their ...
Indian Academy of Sciences (India)
Xuzhou, Jiangsu 221116, People's Republic of China. [Gao Y. .... on a corn–corn silage diet. The traits .... 2); poly- morphism information content (PIC) was calculated accord- .... body measurement in bovine's each developmental phase. In.
ENGEL, H; KAZEMIER, B; KECK, W
The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or
Koppers-Lalic, D.; Rychlowski, M.; Leeuwen, D.; Rijsewijk, F.A.M.; Ressing, M.E.; Neefjes, J.J.; Bienkowska-Szewczyk, K.; Wiertz, E.
2003-01-01
Bovine herpesvirus 1 (BoHV-1), the cause of infectious bovine rhinotracheitis and infectious pustular vulvovaginitis in cattle, establishes a lifelong infection, despite the presence of antiviral immunity in the host. BoHV-1 has been shown to elude the host immune system, but the viral gene products
Energy Technology Data Exchange (ETDEWEB)
Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))
1988-11-01
The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.
DEFF Research Database (Denmark)
Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels
particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...
Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.
Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya
2013-02-01
This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.
DEFF Research Database (Denmark)
Rosenkilde, M M; Waldhoer, M; Lüttichau, H R
2001-01-01
expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...
International Nuclear Information System (INIS)
Menaa, F.
2003-12-01
Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)
Pande, Hari Om; Tesfaye, Dawit; Hoelker, Michael; Gebremedhn, Samuel; Held, Eva; Neuhoff, Christiane; Tholen, Ernst; Schellander, Karl; Wondim, Dessie Salilew
2018-05-01
The granulosa cells are indispensable for follicular development and its function is orchestrated by several genes, which in turn posttranscriptionally regulated by microRNAs (miRNA). In our previous study, the miRRNA-424/503 cluster was found to be highly abundant in bovine granulosa cells (bGCs) of preovulatory dominant follicle compared to subordinate counterpart at day 19 of the bovine estrous cycle. Other study also indicated the involvement of miR-424/503 cluster in tumour cell resistance to apoptosis suggesting this miRNA cluster may involve in cell survival. However, the role of miR-424/503 cluster in granulosa cell function remains elusive Therefore, this study aimed to investigate the role of miRNA-424/503 cluster in bGCs function using microRNA gain- and loss-of-function approaches. The role of miR-424/503 cluster members in granulosa cell function was investigated by overexpressing or inhibiting its activity in vitro cultured granulosa cells using miR-424/503 mimic or inhibitor, respectively. Luciferase reporter assay showed that SMAD7 and ACVR2A are the direct targets of the miRNA-424/503 cluster members. In line with this, overexpression of miRNA-424/503 cluster members using its mimic and inhibition of its activity by its inhibitor reduced and increased, respectively the expression of SMAD7 and ACVR2A. Furthermore, flow cytometric analysis indicated that overexpression of miRNA-424/503 cluster members enhanced bGCs proliferation by promoting G1- to S- phase cell cycle transition. Modulation of miRNA-424/503 cluster members tended to increase phosphorylation of SMAD2/3 in the Activin signalling pathway. Moreover, sequence specific knockdown of SMAD7, the target gene of miRNA-424/503 cluster members, using small interfering RNA also revealed similar phenotypic and molecular alterations observed when miRNA-424/503 cluster members were overexpressed. Similarly, to get more insight about the role of miRNA-424/503 cluster members in activin signalling
O’Keeffe, Triona; Hill, Colin; Ross, R. Paul
1999-01-01
Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the
Gene Discovery through Genomic Sequencing of Brucella abortus
Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.
2001-01-01
Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979
Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O
1998-01-01
All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309
Directory of Open Access Journals (Sweden)
Nandagopal Murugan
2018-02-01
Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.