The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

ngs (Notochord Granular Surface) Gene Encodes a Novel Type of Intermediate Filament Family Protein Essential for Notochord Maintenance in Zebrafish*

Science.gov (United States)

Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

2013-01-01

The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins. PMID:23132861

ngs (notochord granular surface) gene encodes a novel type of intermediate filament family protein essential for notochord maintenance in zebrafish.

Science.gov (United States)

Tong, Xiangjun; Xia, Zhidan; Zu, Yao; Telfer, Helena; Hu, Jing; Yu, Jingyi; Liu, Huan; Zhang, Quan; Sodmergen; Lin, Shuo; Zhang, Bo

2013-01-25

The notochord is an important organ involved in embryonic patterning and locomotion. In zebrafish, the mature notochord consists of a single stack of fully differentiated, large vacuolated cells called chordocytes, surrounded by a single layer of less differentiated notochordal epithelial cells called chordoblasts. Through genetic analysis of zebrafish lines carrying pseudo-typed retroviral insertions, a mutant exhibiting a defective notochord with a granular appearance was isolated, and the corresponding gene was identified as ngs (notochord granular surface), which was specifically expressed in the notochord. In the mutants, the notochord started to degenerate from 32 hours post-fertilization, and the chordocytes were then gradually replaced by smaller cells derived from chordoblasts. The granular notochord phenotype was alleviated by anesthetizing the mutant embryos with tricaine to prevent muscle contraction and locomotion. Phylogenetic analysis showed that ngs encodes a new type of intermediate filament (IF) family protein, which we named chordostatin based on its function. Under the transmission electron microcopy, bundles of 10-nm-thick IF-like filaments were enriched in the chordocytes of wild-type zebrafish embryos, whereas the chordocytes in ngs mutants lacked IF-like structures. Furthermore, chordostatin-enhanced GFP (EGFP) fusion protein assembled into a filamentous network specifically in chordocytes. Taken together, our work demonstrates that ngs encodes a novel type of IF protein and functions to maintain notochord integrity for larval development and locomotion. Our work sheds light on the mechanisms of notochord structural maintenance, as well as the evolution and biological function of IF family proteins.

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

Science.gov (United States)

Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

2012-08-01

The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

DEFF Research Database (Denmark)

Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

2009-01-01

). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Distribution of non-LEE-encoded type 3 secretion system dependent effectors in enteropathogenic Escherichia coli

Directory of Open Access Journals (Sweden)

Fábia A. Salvador

2014-09-01

Full Text Available Enteropathogenic Escherichia coli (EPEC are important human gastroenteritis agents. The prevalence of six non-LEE genes encoding type 3 translocated effectors was investigated. The nleC, cif and nleB genes were more prevalent in typical than in atypical EPEC, although a higher diversity of genes combinations was observed in atypical EPEC.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

Cloning and analysis of the genes encoding the type IIS restriction-modification system HphI from Haemophilus parahaemolyticus.

Science.gov (United States)

Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A

1996-07-15

The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

DEFF Research Database (Denmark)

Abildgaard, L; Engberg, RM; Pedersen, Karl

2009-01-01

The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

Directory of Open Access Journals (Sweden)

Kouji Shimoda

2002-01-01

Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

DEFF Research Database (Denmark)

Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

2018-01-01

The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

[Therapeutic effect of a novel recombinant vaccine encoding chicken collagen type II procollagen gene on collagen-induced arthritis in rat].

Science.gov (United States)

Song, Xin-qiang; Luo, Yuan; Wang, Dan; Liu, Shu-guang; Liu, Jin-feng; Yuan, Fang; Xue, Hong; Liu, Nan; Liang, Fei; Sun, Yu-ying; Xi, Yong-zhi

2006-08-08

To investigate the therapeutic effect of gene vaccine encoding chicken collagen type II (CC II) on collagen-induced arthritis (CIA) comprehensively. Three groups (CIA) were given a single intravenous injection of plasmid pcDNA-CCOL2A1 (20 microg/kg, 200 microg/kg, 400 microg/kg) respectively and one group (CIA) was injected 200 microg/kg pcDNA3.1 as a control. The effect of gene vaccine (pcDNA-CCOL2A1) was evaluated according to the arthritis score, radiological and histological examinations. The severity of arthritis of CIA rats which were administered 200 microg/kg pcDNA-CCOL2A1 was significantly reduced from the fifth day. According to the radiological and histological examinations, the articular cartilage as well as subchondral bone trabeculae are similar to those of the normal groups, so the bone and articular cartilage structure were protected after treatment with 200 microg/kg pcDNA-CCOL2A1 with a little synovial hyperplasia. The therapeutic effect of 200 microg/kg pcDNA-CCOL2A1 group has significant difference in comparison with that of the pcDNA3.1 group (P 0.05). The new gene vaccine pcDNA-CCOL2A1 has significant therapeutic effect on CIA rats, and the treatment may therefore be an effective strategy for RA patient clinically.

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

Directory of Open Access Journals (Sweden)

Haga Christopher L

2007-09-01

Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Genetic and phylogenetic characterization of the type II cyclobutane pyrimidine dimer photolyases encoded by Leporipoxviruses

International Nuclear Information System (INIS)

Bennett, C. James; Webb, Melissa; Willer, David O.; Evans, David H.

2003-01-01

Shope fibroma virus and myxoma virus encode proteins predicted to be Type II photolyases. These are enzymes that catalyze light-dependent repair of cyclobutane pyrimidine dimers (CPDs). When the Shope fibroma virus S127L gene was expressed in an Escherichia coli strain lacking functional CPD repair pathways, the expressed gene protected the bacteria from 70-75% of the ultraviolet (UV) light-induced cytotoxic DNA damage. This proportion suggests that Leporipoxvirus photolyases can only repair CPDs, which typically comprise ∼70% of the damage caused by short wavelength UV light. To test whether these enzymes can protect virus genomes from UV, we exposed virus suspensions to UV-C light followed by graded exposure to filtered visible light. Viruses encoding a deletion of the putative photolyase gene were unable to photoreactivate UV damage while this treatment again eliminated 70-90% of the lethal photoproducts in wild-type viruses. Western blotting detected photolyase protein in extracts prepared from purified virions and it can be deduced that the poxvirion interior must be fluid enough to permit diffusion of this ∼50-kDa DNA-binding protein to the sites where it catalyzes photoreactivation. Photolyase promoters are difficult to categorize using bioinformatics methods, as they do not obviously resemble any of the known poxvirus promoter motifs. By fusing the SFV promoter to DNA encoding a luciferase open reading frame, the photolyase promoter was found to exhibit very weak late promoter activity. These data show that the genomes of Leporipoxviruses, similar to that of fowlpox virus, encode catalytically active photolyases. Phylogenetic studies also confirmed the monophyletic origin of poxviruses and suggest an ancient origin for these genes and perhaps poxviruses

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

Genetical and functional investigation of fliC genes encoding flagellar serotype H4 in wildtype strains of Escherichia coli and in a laboratory E. coli K-12 strain expressing flagellar antigen type H48

Directory of Open Access Journals (Sweden)

Schaudinn Christoph

2005-01-01

Full Text Available Abstract Background Serotyping of O-(lipopolysaccharide and H-(flagellar antigens is a wideley used method for identification of pathogenic strains and clones of Escherichia coli. At present, 176 O- and 53 H-antigens are described for E. coli which occur in different combinations in the strains. The flagellar antigen H4 is widely present in E. coli strains of different O-serotypes and pathotypes and we have investigated the genetic relationship between H4 encoding fliC genes by PCR, nucleotide sequencing and expression studies. Results The complete nucleotide sequence of fliC genes present in E. coli reference strains U9-41 (O2:K1:H4 and P12b (O15:H17 was determined and both were found 99.3% (1043 of 1050 nucleotides identical in their coding sequence. A PCR/RFLP protocol was developed for typing of fliC-H4 strains and 88 E. coli strains reacting with H4 antiserum were investigated. Nucleotide sequencing of complete fliC genes of six E. coli strains which were selected based on serum agglutination titers, fliC-PCR genotyping and reference data revealed 96.6 to 100% identity on the amino acid level. The functional expression of flagellin encoded by fliC-H4 from strain U9-41 and from our strain P12b which is an H4 expressing variant type was investigated in the E. coli K-12 strain JM109 which encodes flagellar type H48. The fliC recombinant plasmid carrying JM109 strains reacted with both H4 and H48 specific antisera whereas JM109 reacted only with the H48 antiserum. By immunoelectron microscopy, we could show that the flagella made by the fliC-H4 recombinant plasmid carrying strain are constituted of H48 and H4 flagellins which are co-assembled into functional flagella. Conclusion The flagellar serotype H4 is encoded by closely related fliC genes present in serologically different types of E. coli strainswhich were isolated at different time periods and geographical locations. Our expression studies show for the first time, that flagellins of

A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

Directory of Open Access Journals (Sweden)

Ashley L Waldron

Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

Science.gov (United States)

Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

2018-01-01

In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus.

Science.gov (United States)

Scorpio, A; Zhang, Y

1996-06-01

Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.

Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

Science.gov (United States)

Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

2002-05-25

All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Asd+ vector pYA292, and the construct was introduced into the avirulent delta cya delta crp delta asd S. typhimurium chi 3987 for oral immunization of birds. The gene encoding the 21-kDa protein was expressed equivalently in B. avium 197, delta asd E. coli chi 6097, and S. typhimurium chi 3987 and was localized primarily in the cytoplasmic membrane and outer membrane. In preliminary studies on oral inoculation of turkey poults with S. typhimurium chi 3987 expressing the gene encoding the B. avium 21-kDa protein, it was determined that a single dose of the recombinant Salmonella vaccine failed to elicit serum antibodies against the 21-kDa protein and challenge with wild-type B. avium 197 resulted in colonization of the trachea and thymus with B. avium 197. Images PMID:1447140

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

Science.gov (United States)

Hempel, Niels; Görisch, Helmut; Mern, Demissew S

2013-09-01

Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

NARCIS (Netherlands)

L.M. 't Hart (Leen); H.A.P. Pols (Huib); T. Hansen (Torben); I. Rietveld (Ingrid); J.M. Dekker (Jacqueline); J.A. Maassen (Johannes); M.G.A.A.M. Nijpels (Giel); G.M.C. Janssen (George); P.P. Arp (Pascal); R.J. Heine (Robert); A.G. Uitterlinden (André); T. Jorgensen (Torben); C.M. van Duijn (Cornelia); K. Borch-Johnsen; O. Pedersen (Oluf)

2005-01-01

textabstractPreviously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

Science.gov (United States)

Sudagidan, Mert; Aydin, Ali

2010-04-15

In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

Science.gov (United States)

Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2017-03-01

The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

Science.gov (United States)

Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

2005-05-15

Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

Science.gov (United States)

Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

2015-07-01

The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

A young root-specific gene (ArMY2) from horseradish encoding a MYR II myrosinase with kinetic preference for the root-specific glucosinolate gluconasturtiin.

Science.gov (United States)

Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang

2014-03-01

The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.

Mating-Type Genes and MAT Switching in Saccharomyces cerevisiae

Science.gov (United States)

Haber, James E.

2012-01-01

Mating type in Saccharomyces cerevisiae is determined by two nonhomologous alleles, MATa and MATα. These sequences encode regulators of the two different haploid mating types and of the diploids formed by their conjugation. Analysis of the MATa1, MATα1, and MATα2 alleles provided one of the earliest models of cell-type specification by transcriptional activators and repressors. Remarkably, homothallic yeast cells can switch their mating type as often as every generation by a highly choreographed, site-specific homologous recombination event that replaces one MAT allele with different DNA sequences encoding the opposite MAT allele. This replacement process involves the participation of two intact but unexpressed copies of mating-type information at the heterochromatic loci, HMLα and HMRa, which are located at opposite ends of the same chromosome-encoding MAT. The study of MAT switching has yielded important insights into the control of cell lineage, the silencing of gene expression, the formation of heterochromatin, and the regulation of accessibility of the donor sequences. Real-time analysis of MAT switching has provided the most detailed description of the molecular events that occur during the homologous recombinational repair of a programmed double-strand chromosome break. PMID:22555442

A recessive contiguous gene deletion causing infantile hyperinsulinism, enteropathy and deafness identifies the Usher type 1C gene.

Science.gov (United States)

Bitner-Glindzicz, M; Lindley, K J; Rutland, P; Blaydon, D; Smith, V V; Milla, P J; Hussain, K; Furth-Lavi, J; Cosgrove, K E; Shepherd, R M; Barnes, P D; O'Brien, R E; Farndon, P A; Sowden, J; Liu, X Z; Scanlan, M J; Malcolm, S; Dunne, M J; Aynsley-Green, A; Glaser, B

2000-09-01

Usher syndrome type 1 describes the association of profound, congenital sensorineural deafness, vestibular hypofunction and childhood onset retinitis pigmentosa. It is an autosomal recessive condition and is subdivided on the basis of linkage analysis into types 1A through 1E. Usher type 1C maps to the region containing the genes ABCC8 and KCNJ11 (encoding components of ATP-sensitive K + (KATP) channels), which may be mutated in patients with hyperinsulinism. We identified three individuals from two consanguineous families with severe hyperinsulinism, profound congenital sensorineural deafness, enteropathy and renal tubular dysfunction. The molecular basis of the disorder is a homozygous 122-kb deletion of 11p14-15, which includes part of ABCC8 and overlaps with the locus for Usher syndrome type 1C and DFNB18. The centromeric boundary of this deletion includes part of a gene shown to be mutated in families with type 1C Usher syndrome, and is hence assigned the name USH1C. The pattern of expression of the USH1C protein is consistent with the clinical features exhibited by individuals with the contiguous gene deletion and with isolated Usher type 1C.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

An evolutionarily conserved gene family encodes proton-selective ion channels.

Science.gov (United States)

Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

2018-03-02

Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Epigenetic control of virulence gene expression in Pseudomonas aeruginosa by a LysR-type transcription regulator.

Directory of Open Access Journals (Sweden)

Keith H Turner

2009-12-01

Full Text Available Phenotypic variation within an isogenic bacterial population is thought to ensure the survival of a subset of cells in adverse conditions. The opportunistic pathogen Pseudomonas aeruginosa variably expresses several phenotypes, including antibiotic resistance, biofilm formation, and the production of CupA fimbriae. Here we describe a previously unidentified bistable switch in P. aeruginosa. This switch controls the expression of a diverse set of genes, including aprA, which encodes the secreted virulence factor alkaline protease. We present evidence that bistable expression of PA2432, herein named bexR (bistable expression regulator, which encodes a LysR-type transcription regulator, controls this switch. In particular, using DNA microarrays, quantitative RT-PCR analysis, chromatin immunoprecipitation, and reporter gene fusions, we identify genes directly under the control of BexR and show that these genes are bistably expressed. Furthermore, we show that bexR is itself bistably expressed and positively autoregulated. Finally, using single-cell analyses of a GFP reporter fusion, we present evidence that positive autoregulation of bexR is necessary for bistable expression of the BexR regulon. Our findings suggest that a positive feedback loop involving a LysR-type transcription regulator serves as the basis for an epigenetic switch that controls virulence gene expression in P. aeruginosa.

Identification of novel Clostridium perfringens type E strains that carry an iota toxin plasmid with a functional enterotoxin gene.

Directory of Open Access Journals (Sweden)

Kazuaki Miyamoto

Full Text Available Clostridium perfringens enterotoxin (CPE is a major virulence factor for human gastrointestinal diseases, such as food poisoning and antibiotic associated diarrhea. The CPE-encoding gene (cpe can be chromosomal or plasmid-borne. Recent development of conventional PCR cpe-genotyping assays makes it possible to identify cpe location (chromosomal or plasmid in type A isolates. Initial studies for developing cpe genotyping assays indicated that all cpe-positive strains isolated from sickened patients were typable by cpe-genotypes, but surveys of C. perfringens environmental strains or strains from feces of healthy people suggested that this assay might not be useful for some cpe-carrying type A isolates. In the current study, a pulsed-field gel electrophoresis Southern blot assay showed that four cpe-genotype untypable isolates carried their cpe gene on a plasmid of ∼65 kb. Complete sequence analysis of the ∼65 kb variant cpe-carrying plasmid revealed no intact IS elements and a disrupted cytosine methyltransferase (dcm gene. More importantly, this plasmid contains a conjugative transfer region, a variant cpe gene and variant iota toxin genes. The toxin genes encoded by this plasmid are expressed based upon the results of RT-PCR assays. The ∼65 kb plasmid is closely related to the pCPF4969 cpe plasmid of type A isolates. MLST analyses indicated these isolates belong to a unique cluster of C. perfringens. Overall, these isolates carrying a variant functional cpe gene and iota toxin genes represent unique type E strains.

A single nucleotide polymorphism within the acetyl-coenzyme A carboxylase beta gene is associated with proteinuria in patients with type 2 diabetes

DEFF Research Database (Denmark)

Maeda, Shiro; Kobayashi, Masa-aki; Araki, Shin-ichi

2010-01-01

It has been suggested that genetic susceptibility plays an important role in the pathogenesis of diabetic nephropathy. A large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs) in Japanese patients with type 2 diabetes identified the gene encoding acetyl-coenzyme A ca...

aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

Directory of Open Access Journals (Sweden)

Tuffery Pierre

2009-12-01

Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

DEFF Research Database (Denmark)

hart, Leen M; Hansen, Torben; Rietveld, Ingrid

2005-01-01

Previously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA synthetase...... gene (LARS2), involved in aminoacylation of tRNA(Leu(UUR)), associate with type 2 diabetes. Direct sequencing of LARS2 cDNA from 25 type 2 diabetic subjects revealed eight single nucleotide polymorphisms. Two of the variants were examined in 7,836 subjects from four independent populations...... in the Netherlands and Denmark. A -109 g/a variant was not associated with type 2 diabetes. Allele frequencies for the other variant, H324Q, were 3.5% in type 2 diabetic and 2.7% in control subjects, respectively. The common odds ratio across all four studies was 1.40 (95% CI 1.12-1.76), P = 0.004. There were...

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

Science.gov (United States)

Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

2006-01-24

Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

A case of pseudohypoaldosteronism type 1 with a mutation in the mineralocorticoid receptor gene

Directory of Open Access Journals (Sweden)

Se Eun Lee

2011-02-01

Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare form of mineralocorticoid resistance characterized in newborns by salt wasting with dehydration, hyperkalemia and failure to thrive. This disease is heterogeneous in etiology and includes autosomal dominant PHA1 owing to mutations of the NR3C2 gene encoding the mineralocorticoid receptor, autosomal recessive PHA1 due to mutations of the epithelial sodium channel (ENaC gene, and secondary PHA1 associated with urinary tract diseases. Amongst these diseases, autosomal dominant PHA1 shows has manifestations restricted to renal tubules including a mild salt loss during infancy and that shows a gradual improvement with advancing age. Here, we report a neonatal case of PHA1 with a NR3C2 gene mutation (a heterozygous c.2146_2147insG in exon 5, in which the patient showed failure to thrive, hyponatremia, hyperkalemia, and elevated plasma renin and aldosterone levels. This is the first case of pseudohypoaldosteronism type 1 confirmed by genetic analysis in Korea.

Read-through transcript from NM23-H1 into the neighboring NM23-H2 gene encodes a novel protein, NM23-LV

NARCIS (Netherlands)

Valentijn, Linda J.; Koster, Jan; Versteeg, Rogier

2006-01-01

NM23-H1 and NM23-H2 are neighboring genes on chromosome 17q. They encode nucleoside diphosphate kinases that have additional roles in signal transduction, transcription, and apoptosis. NM23-H1 expression is a strong marker for prognosis and metastatic behavior in many tumor types. A new

The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

Directory of Open Access Journals (Sweden)

Borchardt Stephanie M

2006-07-01

Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

Type II heat-labile enterotoxins from 50 diverse Escherichia coli isolates belong almost exclusively to the LT-IIc family and may be prophage encoded.

Directory of Open Access Journals (Sweden)

Michael G Jobling

Full Text Available Some enterotoxigenic Escherichia coli (ETEC produce a type II heat-labile enterotoxin (LT-II that activates adenylate cyclase in susceptible cells but is not neutralized by antisera against cholera toxin or type I heat-labile enterotoxin (LT-I. LT-I variants encoded by plasmids in ETEC from humans and pigs have amino acid sequences that are ≥ 95% identical. In contrast, LT-II toxins are chromosomally encoded and are much more diverse. Early studies characterized LT-IIa and LT-IIb variants, but a novel LT-IIc was reported recently. Here we characterized the LT-II encoding loci from 48 additional ETEC isolates. Two encoded LT-IIa, none encoded LT-IIb, and 46 encoded highly related variants of LT-IIc. Phylogenetic analysis indicated that the predicted LT-IIc toxins encoded by these loci could be assigned to 6 subgroups. The loci corresponding to individual toxins within each subgroup had DNA sequences that were more than 99% identical. The LT-IIc subgroups appear to have arisen by multiple recombinational events between progenitor loci encoding LT-IIc1- and LT-IIc3-like variants. All loci from representative isolates encoding the LT-IIa, LT-IIb, and each subgroup of LT-IIc enterotoxins are preceded by highly-related genes that are between 80 and 93% identical to predicted phage lysozyme genes. DNA sequences immediately following the B genes differ considerably between toxin subgroups, but all are most closely related to genomic sequences found in predicted prophages. Together these data suggest that the LT-II loci are inserted into lambdoid type prophages that may or may not be infectious. These findings raise the possibility that production of LT-II enterotoxins by ETEC may be determined by phage conversion and may be activated by induction of prophage, in a manner similar to control of production of Shiga-like toxins by converting phages in isolates of enterohemmorhagic E. coli.

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

Science.gov (United States)

Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

2016-06-01

The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Functional characterization of MAT1-1-specific mating-type genes in the homothallic ascomycete Sordaria macrospora provides new insights into essential and nonessential sexual regulators.

Science.gov (United States)

Klix, V; Nowrousian, M; Ringelberg, C; Loros, J J; Dunlap, J C; Pöggeler, S

2010-06-01

Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the alpha domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes.

Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

Science.gov (United States)

Alvarez, Rene; Seal, Bruce S

2005-01-01

Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the

Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

Directory of Open Access Journals (Sweden)

Alvarez Rene

2005-04-01

Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

The AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response

Science.gov (United States)

Asano, Tomoya; Yasuda, Michiko; Nakashita, Hideo; Kimura, Makoto; Yamaguchi1, Kazuo

2008-01-01

Phytopathogenic Fusarium species produce the trichothecene family of phytotoxins, which function as a virulence factor during infection of plants. Trichothecenes are classifiable into four major groups by their chemical structures. Recently, the AtNFXL1 gene was reported as a type A trichothecene T-2 toxin-inducible gene. The AtNFXL1 gene encodes a putative transcription factor with similarity to the human transcription repressor NF-X1. The atnfxl1 mutant exhibited hypersensitivity phenotype to T-2 toxin but not to type B deoxynivalenol (DON) in comparison with wild type when Arabidopsis thaliana grew on agar medium containing trichothecenes. The absence or presence of a carbonyl group at the C8 position distinguishes type A and type B. Growth defect by another type A trichothecene diacetoxyscirpenol (DAS), was weakly enhanced in the atnfxl1 mutant. Diacetoxyscirpenol is distinguishable from T-2 toxin only by the absence of an isovaleryl group at the C8 position. Correspondingly, the AtNFXL1 promoter activity was apparently induced in T-2 toxin-treated and DAS-treated plants. In contrast, DON failed to induce the AtNFXL1 promoter activity. Consequently, the AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response in Arabidopsis. In addition, the C8 position of trichothecenes might be closely related to the function of AtNFXL1 gene. PMID:19704430

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

Directory of Open Access Journals (Sweden)

Jacqueline Schmuckli-Maurer

Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

Functional Characterization of MAT1-1-Specific Mating-Type Genes in the Homothallic Ascomycete Sordaria macrospora Provides New Insights into Essential and Nonessential Sexual Regulators▿†

Science.gov (United States)

Klix, V.; Nowrousian, M.; Ringelberg, C.; Loros, J. J.; Dunlap, J. C.; Pöggeler, S.

2010-01-01

Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the α domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes. PMID:20435701

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

Science.gov (United States)

Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

2015-01-01

For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

DEFF Research Database (Denmark)

Madsen, Jonas Stenlokke; Riber, Leise; Kot, Witold

2016-01-01

Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements...... of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded...... on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed...

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

DEFF Research Database (Denmark)

Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

2016-01-01

genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

Coamplification in tumors of KRAS2, type 2 inositol 1,4,5 triphosphate receptor gene, and a novel human gene, KRAG

Energy Technology Data Exchange (ETDEWEB)

Heighway, J.; Betticher, D.C.; Altermatt, H.J. [Univ. Hospital of Berne (Switzerland)] [and others

1996-07-01

Analysis of a region of DNA, coamplified in tumors with KRAS2, resulted in the identification of the human homologue of the mouse KRAG gene. The gene was widely expressed in range of cell lines, tumors, and normal tissue and demonstrated a high degree of alternate splicing. A human KRAG cDNA sequence, with a structure similar to that encoded by the amplified gene in mouse Y1 adrenal carcinoma cells, was isolated by RT-PCR. The predicted amino acid similarity between the two sequences was 91%, and hydrophobicity plots suggested a structure closely resembling that of transmembrane 4 superfamily members. Identification of a PCR-based restriction fragment length polymorphism allele-specific splicing differences in tumors. Northern analysis of mRNA derived from a range of tissues suggested high level expression in muscle and confirmed alternate splicing. To facilitate the analysis of exon junctions, a YAC clone encoding the genomic sequence was identified. This allowed the localization of KRAG to human chromosome 12p11.2. Isolation of one end of this nonchimeric clone demonstrated a perfect match with a 247-bp sequence within the 3{prime} untranslated region of the type 2 1,4,5-inositol triphosphate receptor gene. Multiplex PCR confirmed the inclusion of both genes. Multiplex PCR confirmed the inclusion of both genes in the KRAS2 amplicon in human malignancy, suggesting that either may contribute to the malignant phenotypes. 35 refs., 6 figs., 1 tab.

Association of single nucleotide polymorphisms in the gene encoding GLUT1 and diabetic nephropathy in Brazilian patients with type 1 diabetes mellitus.

Science.gov (United States)

Marques, T; Patente, T A; Monteiro, M B; Cavaleiro, A M; Queiroz, M S; Nery, M; de Azevedo, M J; Canani, L H; Parisi, M C; Moura-Neto, A; Passarelli, M; Giannella-Neto, D; Machado, U F; Corrêa-Giannella, M L

2015-04-15

Mesangial cells subject to high extracellular glucose concentrations, as occur in hyperglycaemic states, are unable to down regulate glucose influx, resulting in intracellular activation of deleterious biochemical pathways. A high expression of GLUT1 participates in the development of diabetic glomerulopathy. Variants in the gene encoding GLUT1 (SLC2A1) have been associated to this diabetic complication. The aim of this study was to test whether polymorphisms in SLC2A1 confer susceptibility to diabetic nephropathy (DN) in Brazilian type 1 diabetes patients. Four polymorphisms (rs3820589, rs1385129, rs841847 and rs841848) were genotyped in a Brazilian cohort comprised of 452 patients. A prospective analysis was performed in 155 patients. Mean duration of follow-up was 5.6 ± 2.4 years and the incidence of renal events was 18.0%. The rs3820589 presented an inverse association with the prevalence of incipient DN (OR: 0.36, 95% CI: 0.16 - 0.80, p=0.01) and with progression to renal events (HR: 0.20; 95% CI: 0.03 - 0.70; p=0.009). AGGT and AGAC haplotypes were associated with the prevalence of incipient DN and the AGAC haplotype was also associated with the prevalence of established/advanced DN. In conclusion, rs3820589 in the SLC2A1 gene modulates the risk to DN in Brazilian patients with inadequate type 1 diabetes control. Copyright © 2015 Elsevier B.V. All rights reserved.

A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

Science.gov (United States)

Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

2015-01-01

This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

Science.gov (United States)

Botes, D P; Qobose, M D; Corfield, V A

1991-09-15

A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

The fixABCX genes in Rhodospirillum rubrum encode a putative membrane complex participating in electron transfer to nitrogenase.

Science.gov (United States)

Edgren, Tomas; Nordlund, Stefan

2004-04-01

In our efforts to identify the components participating in electron transport to nitrogenase in Rhodospirillum rubrum, we used mini-Tn5 mutagenesis followed by metronidazole selection. One of the mutants isolated, SNT-1, exhibited a decreased growth rate and about 25% of the in vivo nitrogenase activity compared to the wild-type values. The in vitro nitrogenase activity was essentially wild type, indicating that the mutation affects electron transport to nitrogenase. Sequencing showed that the Tn5 insertion is located in a region with a high level of similarity to fixC, and extended sequencing revealed additional putative fix genes, in the order fixABCX. Complementation of SNT-1 with the whole fix gene cluster in trans restored wild-type nitrogenase activity and growth. Using Western blotting, we demonstrated that expression of fixA and fixB occurs only under conditions under which nitrogenase also is expressed. SNT-1 was further shown to produce larger amounts of both ribulose 1,5-bisphosphate carboxylase/oxygenase and polyhydroxy alkanoates than the wild type, indicating that the redox status is affected in this mutant. Using Western blotting, we found that FixA and FixB are soluble proteins, whereas FixC most likely is a transmembrane protein. We propose that the fixABCX genes encode a membrane protein complex that plays a central role in electron transfer to nitrogenase in R. rubrum. Furthermore, we suggest that FixC is the link between nitrogen fixation and the proton motive force generated in the photosynthetic reactions.

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

International Nuclear Information System (INIS)

Reynolds, P.; Weber, S.; Prakash, L.

1985-01-01

The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Selecting one of several mating types through gene segment joining and deletion in Tetrahymena thermophila.

Directory of Open Access Journals (Sweden)

Marcella D Cervantes

Full Text Available The unicellular eukaryote Tetrahymena thermophila has seven mating types. Cells can mate only when they recognize cells of a different mating type as non-self. As a ciliate, Tetrahymena separates its germline and soma into two nuclei. During growth the somatic nucleus is responsible for all gene transcription while the germline nucleus remains silent. During mating, a new somatic nucleus is differentiated from a germline nucleus and mating type is decided by a stochastic process. We report here that the somatic mating type locus contains a pair of genes arranged head-to-head. Each gene encodes a mating type-specific segment and a transmembrane domain that is shared by all mating types. Somatic gene knockouts showed both genes are required for efficient non-self recognition and successful mating, as assessed by pair formation and progeny production. The germline mating type locus consists of a tandem array of incomplete gene pairs representing each potential mating type. During mating, a complete new gene pair is assembled at the somatic mating type locus; the incomplete genes of one gene pair are completed by joining to gene segments at each end of germline array. All other germline gene pairs are deleted in the process. These programmed DNA rearrangements make this a fascinating system of mating type determination.

Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

Science.gov (United States)

Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

2012-01-01

We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

A Root-Preferential DFR-Like Gene Encoding Dihydrokaempferol Reductase Involved in Anthocyanin Biosynthesis of Purple-Fleshed Sweet Potato.

Science.gov (United States)

Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua

2017-01-01

Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

2017-01-01

The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

Herpes simplex virus type 1 (HSV-1)-derived recombinant vectors for gene transfer and gene therapy.

Science.gov (United States)

Marconi, Peggy; Fraefel, Cornel; Epstein, Alberto L

2015-01-01

Herpes simplex virus type 1 (HSV-1 ) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153-kilobase pair (kbp) double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes the approach most commonly used to prepare recombinant HSV-1 vectors through homologous recombination, either in eukaryotic cells or in bacteria.

The pmr gene, encoding a Ca2+-ATPase, is required for calcium and manganese homeostasis and normal development of hyphae and conidia in Neurospora crassa.

Science.gov (United States)

Bowman, Barry J; Abreu, Stephen; Johl, Jessica K; Bowman, Emma Jean

2012-11-01

The pmr gene is predicted to encode a Ca(2+)-ATPase in the secretory pathway. We examined two strains of Neurospora crassa that lacked PMR: the Δpmr strain, in which pmr was completely deleted, and pmr(RIP), in which the gene was extensively mutated. Both strains had identical, complex phenotypes. Compared to the wild type, these strains required high concentrations of calcium or manganese for optimal growth and had highly branched, slow-growing hyphae. They conidiated poorly, and the shape and size of the conidia were abnormal. Calcium accumulated in the Δpmr strains to only 20% of the wild-type level. High concentrations of MnCl(2) (1 to 5 mM) in growth medium partially suppressed the morphological defects but did not alter the defect in calcium accumulation. The Δpmr Δnca-2 double mutant (nca-2 encodes a Ca(2+)-ATPase in the plasma membrane) accumulated 8-fold more calcium than the wild type, and the morphology of the hyphae was more similar to that of wild-type hyphae. Previous experiments failed to show a function for nca-1, which encodes a SERCA-type Ca(2+)-ATPase in the endoplasmic reticulum (B. J. Bowman, S. Abreu, E. Margolles-Clark, M. Draskovic, and E. J. Bowman, Eukaryot. Cell 10:654-661, 2011). The pmr(RIP) Δnca-1 double mutant accumulated small amounts of calcium, like the Δpmr strain, but exhibited even more extreme morphological defects. Thus, PMR can apparently replace NCA-1 in the endoplasmic reticulum, but NCA-1 cannot replace PMR. The morphological defects in the Δpmr strain are likely caused, in part, by insufficient concentrations of calcium and manganese in the Golgi compartment; however, PMR is also needed to accumulate normal levels of calcium in the whole cell.

Identification and Phylogenetic Analysis of a CC-NBS-LRR Encoding Gene Assigned on Chromosome 7B of Wheat

Directory of Open Access Journals (Sweden)

Xiangqi Zhang

2013-07-01

Full Text Available Hexaploid wheat displays limited genetic variation. As a direct A and B genome donor of hexaploid wheat, tetraploid wheat represents an important gene pool for cultivated bread wheat. Many disease resistant genes express conserved domains of the nucleotide-binding site and leucine-rich repeats (NBS-LRR. In this study, we isolated a CC-NBS-LRR gene locating on chromosome 7B from durum wheat variety Italy 363, and designated it TdRGA-7Ba. Its open reading frame was 4014 bp, encoding a 1337 amino acid protein with a complete NBS domain and 18 LRR repeats, sharing 44.7% identity with the PM3B protein. TdRGA-7Ba expression was continuously seen at low levels and was highest in leaves. TdRGA-7Ba has another allele TdRGA-7Bb with a 4 bp deletion at position +1892 in other cultivars of tetraploid wheat. In Ae. speltoides, as a B genome progenitor, both TdRGA-7Ba and TdRGA-7Bb were detected. In all six species of hexaploid wheats (AABBDD, only TdRGA-7Bb existed. Phylogenic analysis showed that all TdRGA-7Bb type genes were grouped in one sub-branch. We speculate that TdRGA-7Bb was derived from a TdRGA-7Ba mutation, and it happened in Ae. speltoides. Both types of TdRGA-7B participated in tetraploid wheat formation. However, only the TdRGA-7Bb was retained in hexaploid wheat.

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

Science.gov (United States)

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

The Aspergillus uvsH gene encodes a product homologous to yeast RAD18 and Neurospora UVS-2.

Science.gov (United States)

Yoon, J H; Lee, B J; Kang, H S

1995-07-28

The uvsH DNA repair gene of Aspergillus nidulans has been cloned by complementation of the uvsH77 mutation with a cosmid library containing genomic DNA inserts from a wild-type strain. Methylmethane sulfonate (MMS)-resistant transformants were obtained on medium containing 0.01% MMS, to which uvsH mutants exhibit high sensitivity. Retransformation of uvsH77 mutants with the rescued cosmids from the MMS-resistant transformants resulted in restoration of both UV and MMS resistance to wild-type levels. Nucleotide sequence analysis of the genomic DNA and cDNA of the uvsH gene shows that it has an open reading frame (ORF) of 1329 bp, interrupted by two introns of 51 and 61 bp. A 2.4 kb transcript of the uvsH gene was detected by Northern blot analysis. Primer extension analysis revealed that transcription starts at 31 bp upstream from the translation initiation codon. This gene encodes a predicted polypeptide of 443 amino acids, which has two unique zinc finger motifs. The proposed polypeptide displays 39% identity to the Neurospora crassa UVS-2 protein and 24% identity to the Saccharomyces cerevisiae RAD18 protein. The sequence similarity is particularly high in three domains. One zinc finger (RING finger) motif is located in the first domain close to the N-terminus. The other zinc finger motif is in the second domain. In the third domain, the mutation sites in both the uvsH77 and uvsH304 alleles were identified.(ABSTRACT TRUNCATED AT 250 WORDS)

Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

Directory of Open Access Journals (Sweden)

Craxton Molly

2007-07-01

Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

A speculated ribozyme site in the herpes simplex virus type 1 latency-associated transcript gene is not essential for a wild-type reactivation phenotype

Science.gov (United States)

Carpenter, Dale; Singh, Sukhpreet; Osorio, Nelson; Hsiang, Chinhui; Jiang, Xianzhi; Jin, Ling; Jones, Clinton; Wechsler, Steven L

2010-01-01

During herpes simplex virus-1 (HSV-1) latency in sensory neurons, LAT (latency-associated transcript) is the only abundantly expressed viral gene. LAT plays an important role in the HSV-1 latency-reactivation cycle, because LAT deletion mutants have a significantly decreased reactivation phenotype. Based solely on sequence analysis, it was speculated that LAT encodes a ribozyme that plays an important role in how LAT enhances the virus’ reactivation phenotype. Because LAT ribozyme activity has never been reported, we decided to test the converse hypothesis, namely, that this region of LAT does not encode a ribozyme function important for LAT’s ability to enhance the reactivation phenotype. We constructed a viral mutant (LAT-Rz) in which the speculated ribozyme consensus sequence was altered such that no ribozyme was encoded. We report here that LAT-Rz had a wild-type reactivation phenotype in mice, confirming the hypothesis that the speculated LAT ribozyme is not a dominant factor in stimulating the latency-reactivation cycle in mice. PMID:18982533

IQCJ-SCHIP1, a novel fusion transcript encoding a calmodulin-binding IQ motif protein

International Nuclear Information System (INIS)

Kwasnicka-Crawford, Dorota A.; Carson, Andrew R.; Scherer, Stephen W.

2006-01-01

The existence of transcripts that span two adjacent, independent genes is considered rare in the human genome. This study characterizes a novel human fusion gene named IQCJ-SCHIP1. IQCJ-SCHIP1 is the longest isoform of a complex transcriptional unit that bridges two separate genes that encode distinct proteins, IQCJ, a novel IQ motif containing protein and SCHIP1, a schwannomin interacting protein that has been previously shown to interact with the Neurofibromatosis type 2 (NF2) protein. IQCJ-SCHIP1 is located on the chromosome 3q25 and comprises a 1692-bp transcript encompassing 11 exons spanning 828 kb of the genomic DNA. We show that IQCJ-SCHIP1 mRNA is highly expressed in the brain. Protein encoded by the IQCJ-SCHIP1 gene was localized to cytoplasm and actin-rich regions and in differentiated PC12 cells was also seen in neurite extensions

ABNORMAL TYPE-III COLLAGEN PRODUCED BY AN EXON-17-SKIPPING MUTATION OF THE COL3A1 GENE IN EHLERS-DANLOS SYNDROME TYPE-IV IS NOT INCORPORATED INTO THE EXTRACELLULAR-MATRIX

NARCIS (Netherlands)

CHIODO, AA; SILLENCE, DO; COLE, WG; BATEMAN, JF

1995-01-01

A novel heterozygous mutation of the COL3Al gene that encodes the alpha 1(III) chains of type III collagen was identified in a family with the: acrogeric form of Ehlers-Danlos syndrome type IV (EDS-IV). Cultured dermal fibroblasts produced normal and shortened alpha 1(III) chains. The triple helix

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

Science.gov (United States)

Lu, Y P; Li, Z S; Rea, P A

1997-07-22

Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

Identification of the gene encoding a type 1 RNase H with an N-terminal double-stranded RNA binding domain from a psychrotrophic bacterium.

Science.gov (United States)

Tadokoro, Takashi; Chon, Hyongi; Koga, Yuichi; Takano, Kazufumi; Kanaya, Shigenori

2007-07-01

The gene encoding a bacterial type 1 RNase H, termed RBD-RNase HI, was cloned from the psychrotrophic bacterium Shewanella sp. SIB1, overproduced in Escherichia coli, and the recombinant protein was purified and biochemically characterized. SIB1 RBD-RNase HI consists of 262 amino acid residues and shows amino acid sequence identities of 26% to SIB1 RNase HI, 17% to E. coli RNase HI, and 32% to human RNase H1. SIB1 RBD-RNase HI has a double-stranded RNA binding domain (RBD) at the N-terminus, which is commonly present at the N-termini of eukaryotic type 1 RNases H. Gel mobility shift assay indicated that this domain binds to an RNA/DNA hybrid in an isolated form, suggesting that this domain is involved in substrate binding. SIB1 RBD-RNase HI exhibited the enzymatic activity both in vitro and in vivo. Its optimum pH and metal ion requirement were similar to those of SIB1 RNase HI, E. coli RNase HI, and human RNase H1. The specific activity of SIB1 RBD-RNase HI was comparable to that of E. coli RNase HI and was much higher than those of SIB1 RNase HI and human RNase H1. SIB1 RBD-RNase HI showed poor cleavage-site specificity for oligomeric substrates. SIB1 RBD-RNase HI was less stable than E. coli RNase HI but was as stable as human RNase H1. Database searches indicate that several bacteria and archaea contain an RBD-RNase HI. This is the first report on the biochemical characterization of RBD-RNase HI.

Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

Directory of Open Access Journals (Sweden)

Beatriz Moreno

2016-07-01

Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

Cloning, expression and characterization of a gene from earthworm Eisenia fetida encoding a blood-clot dissolving protein.

Directory of Open Access Journals (Sweden)

GangQiang Li

Full Text Available A lumbrokinase gene encoding a blood-clot dissolving protein was cloned from earthworm (Eisenia fetida by RT-PCR amplification. The gene designated as CST1 (GenBank No. AY840996 was sequence analyzed. The cDNA consists of 888 bp with an open reading frame of 729 bp, which encodes 242 amino acid residues. Multiple sequence alignments revealed that CST1 shares similarities and conserved amino acids with other reported lumbrokinases. The amino acid sequence of CST1 exhibits structural features similar to those found in other serine proteases, including human tissue-type (tPA, urokinase (uPA, and vampire bat (DSPAα1 plasminogen activators. CST1 has a conserved catalytic triad, found in the active sites of protease enzymes, which are important residues involved in polypeptide catalysis. CST1 was expressed as inclusion bodies in Escherichia coli BL21(DE3. The molecular mass of recombinant CST1 (rCST was 25 kDa as estimated by SDS-PAGE, and further confirmed by Western Blot analysis. His-tagged rCST1 was purified and renatured using nickel-chelating resin with a recovery rate of 50% and a purity of 95%. The purified, renatured rCST1 showed fibrinolytic activity evaluated by both a fibrin plate and a blood clot lysis assay. rCST1 degraded fibrin on the fibrin plate. A significant percentage (65.7% of blood clot lysis was observed when blood clot was treated with 80 mg/mL of rCST1 in vitro. The antithrombotic activity of rCST1 was 912 units/mg calculated by comparison with the activity of a lumbrokinase standard. These findings indicate that rCST1 has potential as a potent blood-clot treatment. Therefore, the expression and purification of a single lumbrokinase represents an important improvement in the use of lumbrokinases.

Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

Science.gov (United States)

Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

1999-07-01

The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

Type IX Collagen Gene Mutations Can Result in Multiple Epiphyseal Dysplasia That Is Associated With Osteochondritis Dissecans and a Mild Myopathy

NARCIS (Netherlands)

Jackson, Gail C.; Marcus-Soekarman, Dominique; Stolte-Dijkstra, Irene; Verrips, Aad; Taylor, Jacqueline A.; Briggs, Michael D.

Multiple epiphyseal dysplasia (MED) is a clinically variable and genetically heterogeneous disease that is characterized by mild short stature and early onset osteoarthritis. Autosomal dominant forms are caused by mutations in the genes that encode type IX collagen, cartilage oligomeric matrix

Type IX collagen gene mutations can result in multiple epiphyseal dysplasia that is associated with osteochondritis dissecans and a mild myopathy.

NARCIS (Netherlands)

Jackson, G.C.; Marcus-Soekarman, D.; Stolte-Dijkstra, I.; Verrips, A.; Taylor, J.A.; Briggs, M.D.

2010-01-01

Multiple epiphyseal dysplasia (MED) is a clinically variable and genetically heterogeneous disease that is characterized by mild short stature and early onset osteoarthritis. Autosomal dominant forms are caused by mutations in the genes that encode type IX collagen, cartilage oligomeric matrix

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

Prevalence of genes encoding extracellular virulence factors among meticillin-resistant Staphylococcus aureus isolates from the University Hospital, Olomouc, Czech Republic.

Science.gov (United States)

Sauer, P; Síla, J; Stosová, T; Vecerová, R; Hejnar, P; Vágnerová, I; Kolár, M; Raclavsky, V; Petrzelová, J; Lovecková, Y; Koukalová, D

2008-04-01

A rather fast and complicated progression of an infection caused by some strains of Staphylococcus aureus could be associated with the expression and co-action of virulence factor complexes in these strains. This study screened the antibiotic susceptibility and prevalence of virulence markers in isolates of meticillin-resistant S. aureus (MRSA) obtained from patients hospitalized at the University Hospital in Olomouc, Czech Republic. A total of 100 isolates was screened for 13 genes encoding extracellular virulence determinants (tst, pvl, eta, etb, sea, seb, sec, sed, see, seg, seh, sei and sej) and for their distribution in sample types. Eighty-nine isolates were positive for at least one of the genes. Genes for etb, pvl, see and seh were not detected in any of the MRSA isolates. No statistically significant differences in the occurrence of the determinants studied among sample types were found.

Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

Science.gov (United States)

O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

1999-01-01

Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

Primary structure and mapping of the hupA gene of Salmonella typhimurium.

OpenAIRE

Higgins, N P; Hillyard, D

1988-01-01

In bacteria, the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type II DNA-binding proteins, also called histonelike proteins. The most abundant type II DNA-binding protein is HU. Southern blot analysis showed that Salmonella typhimurium contained two HU genes that corresponded to Escherichia coli genes hupA (encoding HU-2 protein) and hupB (encoding HU-1). Salmonella hupA was cloned, and the nucleotide sequence of the gene was determined. C...

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.

Science.gov (United States)

Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M

2001-10-01

Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.

Herpes simplex virus type 1 gene UL14: phenotype of a null mutant and identification of the encoded protein.

Science.gov (United States)

Cunningham, C; Davison, A J; MacLean, A R; Taus, N S; Baines, J D

2000-01-01

Herpes simplex virus type 1 (HSV-1) gene UL14 is located between divergently transcribed genes UL13 and UL15 and overlaps the promoters for both of these genes. UL14 also exhibits a substantial overlap of its coding region with that of UL13. It is one of the few HSV-1 genes for which a phenotype and protein product have not been described. Using mass spectrometric and immunological approaches, we demonstrated that the UL14 protein is a minor component of the virion tegument of 32 kDa which is expressed late in infection. In infected cells, the UL14 protein was detected in the nucleus at discrete sites within electron-dense nuclear bodies and in the cytoplasm initially in a diffuse distribution and then at discrete sites. Some of the UL14 protein was phosphorylated. A mutant with a 4-bp deletion in the central region of UL14 failed to produce the UL14 protein and generated small plaques. The mutant exhibited an extended growth cycle at low multiplicity of infection and appeared to be compromised in efficient transit of virus particles from the infected cell. In mice injected intracranially, the 50% lethal dose of the mutant was reduced more than 30,000-fold. Recovery of the mutant from the latently infected sacral ganglia of mice injected peripherally was significantly less than that of wild-type virus, suggesting a marked defect in the establishment of, or reactivation from, latent infection.

Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

Science.gov (United States)

Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

NARCIS (Netherlands)

Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

2015-01-01

Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Human case of bacteremia caused by Streptococcus canis sequence type 9 harboring the scm gene.

Science.gov (United States)

Taniyama, Daisuke; Abe, Yoshihiko; Sakai, Tetsuya; Kikuchi, Takahide; Takahashi, Takashi

2017-01-01

Streptococcus canis (Sc) is a zoonotic pathogen that is transferred mainly from companion animals to humans. One of the major virulence factors in Sc is the M-like protein encoded by the scm gene, which is involved in anti-phagocytic activities, as well as the recruitment of plasminogen to the bacterial surface in cooperation with enolase, and the consequent enhancement of bacterial transmigration and survival. This is the first reported human case of uncomplicated bacteremia following a dog bite, caused by Streptococcus canis harboring the scm gene. The similarity of the 16S rRNA from the infecting species to that of the Sc type strain, as well as the amplification of the species-specific cfg gene, encoding a co-hemolysin, was used to confirm the species identity. Furthermore, the isolate was confirmed as sequence type 9. The partial scm gene sequence harbored by the isolate was closely related to those of other two Sc strains. While this isolate did not possess the erm (A), erm (B), or mef (A), macrolide/lincosamide resistance genes, it was not susceptible to azithromycin: its susceptibility was intermediate. Even though human Sc bacteremia is rare, clinicians should be aware of this microorganism, as well as Pasteurella sp., Prevotella sp., and Capnocytophaga sp., when examining and treating patients with fever who maintain close contact with companion animals.

Evolution of the C-Type Lectin-Like Receptor Genes of the DECTIN-1 Cluster in the NK Gene Complex

Directory of Open Access Journals (Sweden)

Susanne Sattler

2012-01-01

Full Text Available Pattern recognition receptors are crucial in initiating and shaping innate and adaptive immune responses and often belong to families of structurally and evolutionarily related proteins. The human C-type lectin-like receptors encoded in the DECTIN-1 cluster within the NK gene complex contain prominent receptors with pattern recognition function, such as DECTIN-1 and LOX-1. All members of this cluster share significant homology and are considered to have arisen from subsequent gene duplications. Recent developments in sequencing and the availability of comprehensive sequence data comprising many species showed that the receptors of the DECTIN-1 cluster are not only homologous to each other but also highly conserved between species. Even in Caenorhabditis elegans, genes displaying homology to the mammalian C-type lectin-like receptors have been detected. In this paper, we conduct a comprehensive phylogenetic survey and give an up-to-date overview of the currently available data on the evolutionary emergence of the DECTIN-1 cluster genes.

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

DEFF Research Database (Denmark)

Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

2015-01-01

at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

Placental triglyceride accumulation in maternal type 1 diabetes is associated with increased lipase gene expression

DEFF Research Database (Denmark)

Lindegaard, Marie Louise Skakkebæk; Damm, Peter; Mathiesen, Elisabeth R

2006-01-01

Maternal diabetes can cause fetal macrosomia and increased risk of obesity, diabetes, and cardiovascular disease in adulthood of the offspring. Although increased transplacental lipid transport could be involved, the impact of maternal type 1 diabetes on molecular mechanisms for lipid transport...... in placenta is largely unknown. To examine whether maternal type 1 diabetes affects placental lipid metabolism, we measured lipids and mRNA expression of lipase-encoding genes in placentas from women with type 1 diabetes (n = 27) and a control group (n = 21). The placental triglyceride (TG) concentration....... These results suggest that maternal type 1 diabetes is associated with TG accumulation and increased EL and HSL gene expression in placenta and that optimal metabolic control reduces these effects....

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

Directory of Open Access Journals (Sweden)

Lukasz Michal Szafron

Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

Science.gov (United States)

Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

2006-01-01

Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

Energy Technology Data Exchange (ETDEWEB)

Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

1996-03-05

We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

The milkweed pod1 gene encodes a KANADI protein that is required for abaxial/adaxial patterning in maize leaves.

Science.gov (United States)

Candela, Héctor; Johnston, Robyn; Gerhold, Abigail; Foster, Toshi; Hake, Sarah

2008-08-01

Leaf primordia initiate from the shoot apical meristem with inherent polarity; the adaxial side faces the meristem, while the abaxial side faces away from the meristem. Adaxial/abaxial polarity is thought to be necessary for laminar growth of leaves, as mutants lacking either adaxial or abaxial cell types often develop radially symmetric lateral organs. The milkweed pod1 (mwp1) mutant of maize (Zea mays) has adaxialized sectors in the sheath, the proximal part of the leaf. Ectopic leaf flaps develop where adaxial and abaxial cell types juxtapose. Ectopic expression of the HD-ZIPIII gene rolled leaf1 (rld1) correlates with the adaxialized regions. Cloning of mwp1 showed that it encodes a KANADI transcription factor. Double mutants of mwp1-R with a microRNA-resistant allele of rld1, Rld1-N1990, show a synergistic phenotype with polarity defects in sheath and blade and a failure to differentiate vascular and photosynthetic cell types in the adaxialized sectors. The sectored phenotype and timing of the defect suggest that mwp1 is required late in leaf development to maintain abaxial cell fate. The phenotype of mwp1; Rld1 double mutants shows that both genes are also required early in leaf development to delineate leaf margins as well as to initiate vascular and photosynthetic tissues.

Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

Science.gov (United States)

Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

2016-07-01

A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Novel mutations in the SCNN1A gene causing Pseudohypoaldosteronism type 1.

Directory of Open Access Journals (Sweden)

Jian Wang

Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare inherited disease characterized by resistance to the actions of aldosterone. Mutations in the subunit genes (SCNN1A, SCNN1B, SCNN1G of the epithelial sodium channel (ENaC and the NR3C2 gene encoding the mineralocorticoid receptor, result in systemic PHA1 and renal PHA1 respectively. Common clinical manifestations of PHA1 include salt wasting, hyperkalaemia, metabolic acidosis and elevated plasma aldosterone levels in the neonatal period. In this study, we describe the clinical and biochemical manifestations in two Chinese patients with systemic PHA1. Sequence analysis of the SCNN1A gene revealed a compound heterozygous mutation (c.1311delG and c.1439+1G>C in one patient and a homozygous mutation (c.814_815insG in another patient, all three variants are novel. Further analysis of the splicing pattern in a minigene construct showed that the c.1439+1G>C mutation can lead to the retainment of intron 9 as the 5'-donor splice site disappears during post-transcriptional processing of mRNA. In conclusion, our study identified three novel SCNN1A gene mutations in two Chinese patients with systemic PHA1.

A novel polymorphism in the coding region of the vasopressin type 2 receptor gene

Directory of Open Access Journals (Sweden)

J.L. Rocha

1997-04-01

Full Text Available Nephrogenic diabetes insipidus (NDI is a rare disease characterized by renal inability to respond properly to arginine vasopressin due to mutations in the vasopressin type 2 receptor (V2(R gene in affected kindreds. In most kindreds thus far reported, the mode of inheritance follows an X chromosome-linked recessive pattern although autosomal-dominant and autosomal-recessive modes of inheritance have also been described. Studies demonstrating mutations in the V2(R gene in affected kindreds that modify the receptor structure, resulting in a dys- or nonfunctional receptor have been described, but phenotypically indistinguishable NDI patients with a structurally normal V2(R gene have also been reported. In the present study, we analyzed exon 3 of the V2(R gene in 20 unrelated individuals by direct sequencing. A C®T alteration in the third position of codon 331 (AGC®AGT, which did not alter the encoded amino acid, was found in nine individuals, including two unrelated patients with NDI. Taken together, these observations emphasize the molecular heterogeneity of a phenotypically homogeneous syndrome

Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

Science.gov (United States)

Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

2016-03-01

The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

Concurrent Codes: A Holographic-Type Encoding Robust against Noise and Loss.

Directory of Open Access Journals (Sweden)

David M Benton

Full Text Available Concurrent coding is an encoding scheme with 'holographic' type properties that are shown here to be robust against a significant amount of noise and signal loss. This single encoding scheme is able to correct for random errors and burst errors simultaneously, but does not rely on cyclic codes. A simple and practical scheme has been tested that displays perfect decoding when the signal to noise ratio is of order -18dB. The same scheme also displays perfect reconstruction when a contiguous block of 40% of the transmission is missing. In addition this scheme is 50% more efficient in terms of transmitted power requirements than equivalent cyclic codes. A simple model is presented that describes the process of decoding and can determine the computational load that would be expected, as well as describing the critical levels of noise and missing data at which false messages begin to be generated.

Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

DEFF Research Database (Denmark)

Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

2004-01-01

Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

IL6 gene promoter polymorphisms and type 2 diabetes

DEFF Research Database (Denmark)

Huth, Cornelia; Heid, Iris M; Vollmert, Caren

2006-01-01

Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...

Leu72Met and Other Intronic Polymorphisms in the and Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population

OpenAIRE

Faris Elbahi Joatar; Ali Ahmed Al Qarni; Muhalab E. Ali; Abdulaziz Al Masaud; Abdirashid M. Shire; Nagalla Das; Khalid Gumaa; Hayder A. Giha

2017-01-01

Background Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associatio...

NFκB-mediated activation of the cellular FUT3, 5 and 6 gene cluster by herpes simplex virus type 1.

Science.gov (United States)

Nordén, Rickard; Samuelsson, Ebba; Nyström, Kristina

2017-11-01

Herpes simplex virus type 1 has the ability to induce expression of a human gene cluster located on chromosome 19 upon infection. This gene cluster contains three fucosyltransferases (encoded by FUT3, FUT5 and FUT6) with the ability to add a fucose to an N-acetylglucosamine residue. Little is known regarding the transcriptional activation of these three genes in human cells. Intriguingly, herpes simplex virus type 1 activates all three genes simultaneously during infection, a situation not observed in uninfected tissue, pointing towards a virus specific mechanism for transcriptional activation. The aim of this study was to define the underlying mechanism for the herpes simplex virus type 1 activation of FUT3, FUT5 and FUT6 transcription. The transcriptional activation of the FUT-gene cluster on chromosome 19 in fibroblasts was specific, not involving adjacent genes. Moreover, inhibition of NFκB signaling through panepoxydone treatment significantly decreased the induction of FUT3, FUT5 and FUT6 transcriptional activation, as did siRNA targeting of p65, in herpes simplex virus type 1 infected fibroblasts. NFκB and p65 signaling appears to play an important role in the regulation of FUT3, FUT5 and FUT6 transcriptional activation by herpes simplex virus type 1 although additional, unidentified, viral factors might account for part of the mechanism as direct interferon mediated stimulation of NFκB was not sufficient to induce the fucosyltransferase encoding gene cluster in uninfected cells. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A Ti plasmid-encoded enzyme required for degradation of mannopine is functionally homologous to the T-region-encoded enzyme required for synthesis of this opine in crown gall tumors.

OpenAIRE

Kim, K S; Chilton, W S; Farrand, S K

1996-01-01

The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasm...

Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

Science.gov (United States)

Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

2016-06-01

The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

Science.gov (United States)

Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

2002-07-01

Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

Directory of Open Access Journals (Sweden)

Ian G Woods

2005-03-01

Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

Science.gov (United States)

Santiago, Margarita; Gardner, Richard C

2015-07-01

Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

Molecular Cloning and Characterization of a New C-type Lysozyme Gene from Yak Mammary Tissue

Directory of Open Access Journals (Sweden)

Ming Feng Jiang

2015-12-01

Full Text Available Milk lysozyme is the ubiquitous enzyme in milk of mammals. In this study, the cDNA sequence of a new chicken-type (c-type milk lysozyme gene (YML, was cloned from yak mammary gland tissue. A 444 bp open reading frames, which encodes 148 amino acids (16.54 kDa with a signal peptide of 18 amino acids, was sequenced. Further analysis indicated that the nucleic acid and amino acid sequences identities between yak and cow milk lysozyme were 89.04% and 80.41%, respectively. Recombinant yak milk lysozyme (rYML was produced by Escherichia coli BL21 and Pichia pastoris X33. The highest lysozyme activity was detected for heterologous protein rYML5 (M = 1,864.24 U/mg, SD = 25.75 which was expressed in P. pastoris with expression vector pPICZαA and it clearly inhibited growth of Staphylococcus aureus. Result of the YML gene expression using quantitative polymerase chain reaction showed that the YML gene was up-regulated to maximum at 30 day postpartum, that is, comparatively high YML can be found in initial milk production. The phylogenetic tree indicated that the amino acid sequence was similar to cow kidney lysozyme, which implied that the YML may have diverged from a different ancestor gene such as cow mammary glands. In our study, we suggest that YML be a new c-type lysozyme expressed in yak mammary glands that plays a role as host immunity.

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

Science.gov (United States)

Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

2014-06-01

Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

The pat1 protein kinase controls transcription of the mating-type genes in fission yeast

DEFF Research Database (Denmark)

Nielsen, O; Egel, R; Nielsen, Olaf

1990-01-01

. This differentiation process is characterized by a transcriptional induction of the mating-type genes. Conjugation can also be induced in pat1-ts mutants by a shift to a semi-permissive temperature. The pat1 gene encodes a protein kinase, which also functions further downstream in the developmental pathway controlling...... of the mating-type genes in the zygote leads to complete loss of pat1 protein kinase activity causing entry into meiosis. Thus, pat1 can promote its own inactivation. We suggest a model according to which a stepwise inactivation of pat1 leads to sequential derepression of the processes of conjugation......The developmental programme of fission yeast brings about a transition from mitotic cell division to the dormant state of ascospores. In response to nitrogen starvation, two cells of opposite mating type conjugate to form a diploid zygote, which then undergoes meiosis and sporulation...

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

Topological and organizational properties of the products of house-keeping and tissue-specific genes in protein-protein interaction networks.

Science.gov (United States)

Lin, Wen-Hsien; Liu, Wei-Chung; Hwang, Ming-Jing

2009-03-11

Human cells of various tissue types differ greatly in morphology despite having the same set of genetic information. Some genes are expressed in all cell types to perform house-keeping functions, while some are selectively expressed to perform tissue-specific functions. In this study, we wished to elucidate how proteins encoded by human house-keeping genes and tissue-specific genes are organized in human protein-protein interaction networks. We constructed protein-protein interaction networks for different tissue types using two gene expression datasets and one protein-protein interaction database. We then calculated three network indices of topological importance, the degree, closeness, and betweenness centralities, to measure the network position of proteins encoded by house-keeping and tissue-specific genes, and quantified their local connectivity structure. Compared to a random selection of proteins, house-keeping gene-encoded proteins tended to have a greater number of directly interacting neighbors and occupy network positions in several shortest paths of interaction between protein pairs, whereas tissue-specific gene-encoded proteins did not. In addition, house-keeping gene-encoded proteins tended to connect with other house-keeping gene-encoded proteins in all tissue types, whereas tissue-specific gene-encoded proteins also tended to connect with other tissue-specific gene-encoded proteins, but only in approximately half of the tissue types examined. Our analysis showed that house-keeping gene-encoded proteins tend to occupy important network positions, while those encoded by tissue-specific genes do not. The biological implications of our findings were discussed and we proposed a hypothesis regarding how cells organize their protein tools in protein-protein interaction networks. Our results led us to speculate that house-keeping gene-encoded proteins might form a core in human protein-protein interaction networks, while clusters of tissue-specific gene-encoded

Functional characterization of the gene FoOCH1 encoding a putative α-1,6-mannosyltransferase in Fusarium oxysporum f. sp. cubense.

Science.gov (United States)

Li, Min-Hui; Xie, Xiao-Ling; Lin, Xian-Feng; Shi, Jin-Xiu; Ding, Zhao-Jian; Ling, Jin-Feng; Xi, Ping-Gen; Zhou, Jia-Nuan; Leng, Yueqiang; Zhong, Shaobin; Jiang, Zi-De

2014-04-01

Fusarium oxysporum f. sp. cubense (FOC) is the causal agent of banana Fusarium wilt and has become one of the most destructive pathogens threatening the banana production worldwide. However, few genes related to morphogenesis and pathogenicity of this fungal pathogen have been functionally characterized. In this study, we identified and characterized the disrupted gene in a T-DNA insertional mutant (L953) of FOC with significantly reduced virulence on banana plants. The gene disrupted by T-DNA insertion in L953 harbors an open reading frame, which encodes a protein with homology to α-1,6-mannosyltransferase (OCH1) in fungi. The deletion mutants (ΔFoOCH1) of the OCH1 orthologue (FoOCH1) in FOC were impaired in fungal growth, exhibited brighter staining with fluorescein isothiocyanate (FITC)-Concanavalin A, had less cell wall proteins and secreted more proteins into liquid media than the wild type. Furthermore, the mutation or deletion of FoOCH1 led to loss of ability to penetrate cellophane membrane and decline in hyphal attachment and colonization as well as virulence to the banana host. The mutant phenotypes were fully restored by complementation with the wild type FoOCH1 gene. Our data provide a first evidence for the critical role of FoOCH1 in maintenance of cell wall integrity and virulence of F. oxysporum f. sp. cubense. Copyright © 2014 Elsevier Inc. All rights reserved.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Estimating immunoregulatory gene networks in human herpesvirus type 6-infected T cells

International Nuclear Information System (INIS)

Takaku, Tomoiku; Ohyashiki, Junko H.; Zhang, Yu; Ohyashiki, Kazuma

2005-01-01

The immune response to viral infection involves complex network of dynamic gene and protein interactions. We present here the dynamic gene network of the host immune response during human herpesvirus type 6 (HHV-6) infection in an adult T-cell leukemia cell line. Using a pathway-focused oligonucleotide DNA microarray, we found a possible association between chemokine genes regulating Th1/Th2 balance and genes regulating T-cell proliferation during HHV-6B infection. Gene network analysis using an integrated comprehensive workbench, VoyaGene, revealed that a gene encoding a TEC-family kinase, ITK, might be a putative modulator in the host immune response against HHV-6B infection. We conclude that Th2-dominated inflammatory reaction in host cells may play an important role in HHV-6B-infected T cells, thereby suggesting the possibility that ITK might be a therapeutic target in diseases related to dysregulation of Th1/Th2 balance. This study describes a novel approach to find genes related with the complex host-virus interaction using microarray data employing the Bayesian statistical framework

Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

OpenAIRE

Hahn, F M; Baker, J A; Poulter, C D

1996-01-01

Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

The milkweed pod1 Gene Encodes a KANADI Protein That Is Required for Abaxial/Adaxial Patterning in Maize Leaves[W

Science.gov (United States)

Candela, Héctor; Johnston, Robyn; Gerhold, Abigail; Foster, Toshi; Hake, Sarah

2008-01-01

Leaf primordia initiate from the shoot apical meristem with inherent polarity; the adaxial side faces the meristem, while the abaxial side faces away from the meristem. Adaxial/abaxial polarity is thought to be necessary for laminar growth of leaves, as mutants lacking either adaxial or abaxial cell types often develop radially symmetric lateral organs. The milkweed pod1 (mwp1) mutant of maize (Zea mays) has adaxialized sectors in the sheath, the proximal part of the leaf. Ectopic leaf flaps develop where adaxial and abaxial cell types juxtapose. Ectopic expression of the HD-ZIPIII gene rolled leaf1 (rld1) correlates with the adaxialized regions. Cloning of mwp1 showed that it encodes a KANADI transcription factor. Double mutants of mwp1-R with a microRNA-resistant allele of rld1, Rld1-N1990, show a synergistic phenotype with polarity defects in sheath and blade and a failure to differentiate vascular and photosynthetic cell types in the adaxialized sectors. The sectored phenotype and timing of the defect suggest that mwp1 is required late in leaf development to maintain abaxial cell fate. The phenotype of mwp1; Rld1 double mutants shows that both genes are also required early in leaf development to delineate leaf margins as well as to initiate vascular and photosynthetic tissues. PMID:18757553

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Word form Encoding in Chinese Word Naming and Word Typing

Science.gov (United States)

Chen, Jenn-Yeu; Li, Cheng-Yi

2011-01-01

The process of word form encoding was investigated in primed word naming and word typing with Chinese monosyllabic words. The target words shared or did not share the onset consonants with the prime words. The stimulus onset asynchrony (SOA) was 100 ms or 300 ms. Typing required the participants to enter the phonetic letters of the target word,…

Cell-Type-Specific Transcriptome Analysis in the Drosophila Mushroom Body Reveals Memory-Related Changes in Gene Expression.

Science.gov (United States)

Crocker, Amanda; Guan, Xiao-Juan; Murphy, Coleen T; Murthy, Mala

2016-05-17

Learning and memory formation in Drosophila rely on a network of neurons in the mushroom bodies (MBs). Whereas numerous studies have delineated roles for individual cell types within this network in aspects of learning or memory, whether or not these cells can also be distinguished by the genes they express remains unresolved. In addition, the changes in gene expression that accompany long-term memory formation within the MBs have not yet been studied by neuron type. Here, we address both issues by performing RNA sequencing on single cell types (harvested via patch pipets) within the MB. We discover that the expression of genes that encode cell surface receptors is sufficient to identify cell types and that a subset of these genes, required for sensory transduction in peripheral sensory neurons, is not only expressed within individual neurons of the MB in the central brain, but is also critical for memory formation. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

Directory of Open Access Journals (Sweden)

Moysés Elias-Neto

2013-06-01

Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

Science.gov (United States)

Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

2012-02-01

In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

NARCIS (Netherlands)

Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

2002-01-01

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

Practical Programming with Higher-Order Encodings and Dependent Types

DEFF Research Database (Denmark)

Poswolsky, Adam; Schürmann, Carsten

2008-01-01

, tedious, and error-prone. In this paper, we describe the underlying calculus of Delphin. Delphin is a fully implemented functional-programming language supporting reasoning over higher-order encodings and dependent types, while maintaining the benefits of HOAS. More specifically, just as representations...... for instantiation from those that will remain uninstantiated, utilizing a variation of Miller and Tiu’s ∇-quantifier [1]....

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

Science.gov (United States)

Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

2017-03-01

The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Organization of Genes Required for the Oxidation of Methanol to Formaldehyde in Three Type II Methylotrophs

Science.gov (United States)

Bastien, C.; Machlin, S.; Zhang, Y.; Donaldson, K.; Hanson, R. S.

1989-01-01

Restriction maps of genes required for the synthesis of active methanol dehydrogenase in Methylobacterium organophilum XX and Methylobacterium sp. strain AM1 have been completed and compared. In these two species of pink-pigmented, type II methylotrophs, 15 genes were identified that were required for the expression of methanol dehydrogenase activity. None of these genes were required for the synthesis of the prosthetic group of methanol dehydrogenase, pyrroloquinoline quinone. The structural gene required for the synthesis of cytochrome cL, an electron acceptor uniquely required for methanol dehydrogenase, and the genes encoding small basic peptides that copurified with methanol dehydrogenases were closely linked to the methanol dehydrogenase structural genes. A cloned 22-kilobase DNA insert from Methylsporovibrio methanica 81Z, an obligate type II methanotroph, complemented mutants that contained lesions in four genes closely linked to the methanol dehydrogenase structural genes. The methanol dehydrogenase and cytochrome cL structural genes were found to be transcribed independently in M. organophilum XX. Only two of the genes required for methanol dehydrogenase synthesis in this bacterium were found to be cotranscribed. PMID:16348074

Herpes simplex virus type 1 strain KOS carries a defective US9 and a mutated US8A gene.

Science.gov (United States)

Negatsch, Alexandra; Mettenleiter, Thomas C; Fuchs, Walter

2011-01-01

The membrane protein encoded by the US9 gene of alphaherpesviruses plays an important role during virion assembly and transport in neurons. Here, we demonstrate that in herpes simplex virus type 1 (HSV-1) strain KOS, due to base substitutions, the predicted TATA-box of US9 is mutated, and a premature stop is present at codon 58 of US9, which contains 91 codons in other HSV-1 strains. The TATA-box mutation also removes the native stop codon of the adjacent US8A gene, leading to extension of the coding region from 160 to 191 codons. Northern blot analyses revealed reduced transcription of US9 in cells infected with HSV-1 KOS. Moreover, a US9-specific antiserum did not detect any gene products in Western blot and immunofluorescence analyses of KOS-infected cells, indicating that the truncated protein is not stable. In contrast, Western blot reactions of a pUS8A-specific antiserum confirmed enlargement of this protein in HSV-1 KOS.

Mutation of a Rice Gene Encoding a Phenylalanine Biosynthetic Enzyme Results in Accumulation of Phenylalanine and Tryptophan[W

Science.gov (United States)

Yamada, Tetsuya; Matsuda, Fumio; Kasai, Koji; Fukuoka, Shuichi; Kitamura, Keisuke; Tozawa, Yuzuru; Miyagawa, Hisashi; Wakasa, Kyo

2008-01-01

Two distinct biosynthetic pathways for Phe in plants have been proposed: conversion of prephenate to Phe via phenylpyruvate or arogenate. The reactions catalyzed by prephenate dehydratase (PDT) and arogenate dehydratase (ADT) contribute to these respective pathways. The Mtr1 mutant of rice (Oryza sativa) manifests accumulation of Phe, Trp, and several phenylpropanoids, suggesting a link between the synthesis of Phe and Trp. Here, we show that the Mtr1 mutant gene (mtr1-D) encodes a form of rice PDT with a point mutation in the putative allosteric regulatory region of the protein. Transformed callus lines expressing mtr1-D exhibited all the characteristics of Mtr1 callus tissue. Biochemical analysis revealed that rice PDT possesses both PDT and ADT activities, with a preference for arogenate as substrate, suggesting that it functions primarily as an ADT. The wild-type enzyme is feedback regulated by Phe, whereas the mutant enzyme showed a reduced feedback sensitivity, resulting in Phe accumulation. In addition, these observations indicate that rice PDT is critical for regulating the size of the Phe pool in plant cells. Feeding external Phe to wild-type callus tissue and seedlings resulted in Trp accumulation, demonstrating a connection between Phe accumulation and Trp pool size. PMID:18487352

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

Directory of Open Access Journals (Sweden)

DEWI FITRIANI

2010-06-01

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

Science.gov (United States)

Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

2017-10-01

Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

Science.gov (United States)

Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

2007-07-01

Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

Molecular cloning of complementary DNAs encoding the heavy chain of the human 4F2 cell-surface antigen: a type II membrane glycoprotein involved in normal and neoplastic cell growth

International Nuclear Information System (INIS)

Quackenbush, E.; Clabby, M.; Gottesdiener, K.M.; Barbosa, J.; Jones, N.H.; Strominger, J.L.; Speck, S.; Leiden, J.M.

1987-01-01

Complementary DNA (cDNA) clones encoding the heavy chain of the heterodimeric human membrane glycoprotein 4F2 have been isolated by immunoscreening of a λgt11 expression library. The identity of these clones has been confirmed by hybridization to RNA and DNA prepared from mouse L-cell transfectants, which were produced by whole cell gene transfer and selected for cell-surface expression of the human 4F2 heavy chain. DNA sequence analysis suggest that the 4F2 heavy-chain cDNAs encode an approximately 526-amino acid type II membrane glycoprotein, which is composed of a large C-terminal extracellular domain, a single potential transmembrane region, and a 50-81 amino acid N-terminal intracytoplasmic domain. Southern blotting experiments have shown that the 4F2 heavy-chain cDNAs are derived from a single-copy gene that has been highly conserved during mammalian evolution

Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

Science.gov (United States)

Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

2014-12-13

The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

A negative regulator encoded by a rice WRKY gene represses both abscisic acid and gibberellins signaling in aleurone cells.

Science.gov (United States)

Zhang, Zhong-Lin; Shin, Margaret; Zou, Xiaolu; Huang, Jianzhi; Ho, Tun-hua David; Shen, Qingxi J

2009-05-01

Abscisic acid (ABA) and gibberellins (GAs) control several developmental processes including seed maturation, dormancy, and germination. The antagonism of these two hormones is well-documented. However, recent data from transcription profiling studies indicate that they can function as agonists in regulating the expression of many genes although the underlying mechanism is unclear. Here we report a rice WRKY gene, OsWRKY24, which encodes a protein that functions as a negative regulator of both GA and ABA signaling. Overexpression of OsWRKY24 via particle bombardment-mediated transient expression in aleurone cells represses the expression of two reporter constructs: the beta-glucuronidase gene driven by the GA-inducible Amy32b alpha-amylase promoter (Amy32b-GUS) and the ABA-inducible HVA22 promoter (HVA22-GUS). OsWRKY24 is unlikely a general repressor because it has little effect on the expression of the luciferase reporter gene driven by a constitutive ubiquitin promoter (UBI-Luciferase). As to the GA signaling, OsWRKY24 differs from OsWRKY51 and -71, two negative regulators specifically function in the GA signaling pathway, in several ways. First, OsWRKY24 contains two WRKY domains while OsWRKY51 and -71 have only one; both WRKY domains are essential for the full repressing activity of OsWRKY24. Second, binding of OsWRKY24 to the Amy32b promoter appears to involve sequences in addition to the TGAC cores of the W-boxes. Third, unlike OsWRKY71, OsWRKY24 is stable upon GA treatment. Together, these data demonstrate that OsWRKY24 is a novel type of transcriptional repressor that inhibits both GA and ABA signaling.

Centromere pairing by a plasmid-encoded type I ParB protein

DEFF Research Database (Denmark)

Ringgaard, Simon; Löwe, Jan; Gerdes, Kenn

2007-01-01

The par2 locus of Escherichia coli plasmid pB171 encodes two trans-acting proteins, ParA and ParB, and two cis-acting sites, parC1 and parC2, to which ParB binds cooperatively. ParA is related to MinD and oscillates in helical structures and thereby positions ParB/parC-carrying plasmids regularly......, hence identifying the N terminus of ParB as a requirement for ParB-mediated centromere pairing. These observations suggest that centromere pairing is an important intermediate step in plasmid partitioning mediated by the common type I loci....

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

LENUS (Irish Health Repository)

Martin, Ronny

2011-04-01

The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

Vibrio Phage KVP40 Encodes a Functional NAD+ Salvage Pathway.

Science.gov (United States)

Lee, Jae Yun; Li, Zhiqun; Miller, Eric S

2017-05-01

The genome of T4-type Vibrio bacteriophage KVP40 has five genes predicted to encode proteins of pyridine nucleotide metabolism, of which two, nadV and natV , would suffice for an NAD + salvage pathway. NadV is an apparent nicotinamide phosphoribosyltransferase (NAmPRTase), and NatV is an apparent bifunctional nicotinamide mononucleotide adenylyltransferase (NMNATase) and nicotinamide-adenine dinucleotide pyrophosphatase (Nudix hydrolase). Genes encoding the predicted salvage pathway were cloned and expressed in Escherichia coli , the proteins were purified, and their enzymatic properties were examined. KVP40 NadV NAmPRTase is active in vitro , and a clone complements a Salmonella mutant defective in both the bacterial de novo and salvage pathways. Similar to other NAmPRTases, the KVP40 enzyme displayed ATPase activity indicative of energy coupling in the reaction mechanism. The NatV NMNATase activity was measured in a coupled reaction system demonstrating NAD + biosynthesis from nicotinamide, phosphoribosyl pyrophosphate, and ATP. The NatV Nudix hydrolase domain was also shown to be active, with preferred substrates of ADP-ribose, NAD + , and NADH. Expression analysis using reverse transcription-quantitative PCR (qRT-PCR) and enzyme assays of infected Vibrio parahaemolyticus cells demonstrated nadV and natV transcription during the early and delayed-early periods of infection when other KVP40 genes of nucleotide precursor metabolism are expressed. The distribution and phylogeny of NadV and NatV proteins among several large double-stranded DNA (dsDNA) myophages, and also those from some very large siphophages, suggest broad relevance of pyridine nucleotide scavenging in virus-infected cells. NAD + biosynthesis presents another important metabolic resource control point by large, rapidly replicating dsDNA bacteriophages. IMPORTANCE T4-type bacteriophages enhance DNA precursor synthesis through reductive reactions that use NADH/NADPH as the electron donor and NAD

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

Science.gov (United States)

Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

2015-11-14

FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

Science.gov (United States)

Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

2017-09-01

Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

CORTICAL ENCODING OF SIGNALS IN NOISE: EFFECTS OF STIMULUS TYPE AND RECORDING PARADIGM

Science.gov (United States)

Billings, Curtis J.; Bennett, Keri O.; Molis, Michelle R.; Leek, Marjorie R.

2010-01-01

Objectives Perception-in-noise deficits have been demonstrated across many populations and listening conditions. Many factors contribute to successful perception of auditory stimuli in noise, including neural encoding in the central auditory system. Physiological measures such as cortical auditory evoked potentials can provide a view of neural encoding at the level of the cortex that may inform our understanding of listeners’ abilities to perceive signals in the presence of background noise. In order to understand signal-in-noise neural encoding better, we set out to determine the effect of signal type, noise type, and evoking paradigm on the P1-N1-P2 complex. Design Tones and speech stimuli were presented to nine individuals in quiet, and in three background noise types: continuous speech spectrum noise, interrupted speech spectrum noise, and four-talker babble at a signal-to-noise ratio of −3 dB. In separate sessions, cortical auditory evoked potentials were evoked by a passive homogenous paradigm (single repeating stimulus) and an active oddball paradigm. Results The results for the N1 component indicated significant effects of signal type, noise type, and evoking paradigm. While components P1 and P2 also had significant main effects of these variables, only P2 demonstrated significant interactions among these variables. Conclusions Signal type, noise type, and evoking paradigm all must be carefully considered when interpreting signal-in-noise evoked potentials. Furthermore, these data confirm the possible usefulness of CAEPs as an aid to understanding perception-in-noise deficits. PMID:20890206

A novel homozygous no-stop mutation in G6PC gene from a Chinese patient with glycogen storage disease type Ia.

Science.gov (United States)

Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin

2014-02-25

Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.

Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

Science.gov (United States)

Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

2015-05-01

Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

Directory of Open Access Journals (Sweden)

Alene Kast

2015-05-01

Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

International Nuclear Information System (INIS)

Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

1987-01-01

A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

A member of a new plant gene family encoding a meprin and TRAF homology (MATH) domain-containing protein is involved in restriction of long distance movement of plant viruses

Science.gov (United States)

Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie

2010-01-01

Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558

Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

Science.gov (United States)

Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

2013-12-01

The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

Properties of virion transactivator proteins encoded by primate cytomegaloviruses

Directory of Open Access Journals (Sweden)

Barry Peter A

2009-05-01

Full Text Available Abstract Background Human cytomegalovirus (HCMV is a betaherpesvirus that causes severe disease in situations where the immune system is immature or compromised. HCMV immediate early (IE gene expression is stimulated by the virion phosphoprotein pp71, encoded by open reading frame (ORF UL82, and this transactivation activity is important for the efficient initiation of viral replication. It is currently recognized that pp71 acts to overcome cellular intrinsic defences that otherwise block viral IE gene expression, and that interactions of pp71 with the cell proteins Daxx and ATRX are important for this function. A further property of pp71 is the ability to enable prolonged gene expression from quiescent herpes simplex virus type 1 (HSV-1 genomes. Non-human primate cytomegaloviruses encode homologs of pp71, but there is currently no published information that addresses their effects on gene expression and modes of action. Results The UL82 homolog encoded by simian cytomegalovirus (SCMV, strain Colburn, was identified and cloned. This ORF, named S82, was cloned into an HSV-1 vector, as were those from baboon, rhesus monkey and chimpanzee cytomegaloviruses. The use of an HSV-1 vector enabled expression of the UL82 homologs in a range of cell types, and permitted investigation of their abilities to direct prolonged gene expression from quiescent genomes. The results show that all UL82 homologs activate gene expression, and that neither host cell type nor promoter target sequence has major effects on these activities. Surprisingly, the UL82 proteins specified by non-human primate cytomegaloviruses, unlike pp71, did not direct long term expression from quiescent HSV-1 genomes. In addition, significant differences were observed in the intranuclear localization of the UL82 homologs, and in their effects on Daxx. Strikingly, S82 mediated the release of Daxx from nuclear domain 10 substructures much more rapidly than pp71 or the other proteins tested. All

Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae

Directory of Open Access Journals (Sweden)

Dunham Stephen

2009-11-01

Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.

Candidate gene association study in type 2 diabetes indicates a role for genes involved in beta-cell function as well as insulin action.

Directory of Open Access Journals (Sweden)

Inês Barroso

2003-10-01

Full Text Available Type 2 diabetes is an increasingly common, serious metabolic disorder with a substantial inherited component. It is characterised by defects in both insulin secretion and action. Progress in identification of specific genetic variants predisposing to the disease has been limited. To complement ongoing positional cloning efforts, we have undertaken a large-scale candidate gene association study. We examined 152 SNPs in 71 candidate genes for association with diabetes status and related phenotypes in 2,134 Caucasians in a case-control study and an independent quantitative trait (QT cohort in the United Kingdom. Polymorphisms in five of 15 genes (33% encoding molecules known to primarily influence pancreatic beta-cell function-ABCC8 (sulphonylurea receptor, KCNJ11 (KIR6.2, SLC2A2 (GLUT2, HNF4A (HNF4alpha, and INS (insulin-significantly altered disease risk, and in three genes, the risk allele, haplotype, or both had a biologically consistent effect on a relevant physiological trait in the QT study. We examined 35 genes predicted to have their major influence on insulin action, and three (9%-INSR, PIK3R1, and SOS1-showed significant associations with diabetes. These results confirm the genetic complexity of Type 2 diabetes and provide evidence that common variants in genes influencing pancreatic beta-cell function may make a significant contribution to the inherited component of this disease. This study additionally demonstrates that the systematic examination of panels of biological candidate genes in large, well-characterised populations can be an effective complement to positional cloning approaches. The absence of large single-gene effects and the detection of multiple small effects accentuate the need for the study of larger populations in order to reliably identify the size of effect we now expect for complex diseases.

Construction of a genetically modified wine yeast strain expressing the Aspergillus aculeatus rhaA gene, encoding an -L-Rhamnosidase of enological interest

NARCIS (Netherlands)

Manzanares, P.; Orejas, M.; Vicente Gil, J.; Graaff, de L.H.; Visser, J.; Ramon, D.

2003-01-01

The Aspergillus aculeatus rhaA gene encoding an alpha-L-rhamnosidase has been expressed in both laboratory and industrial wine yeast strains. Wines produced in microvinifications, conducted using a combination of the genetically modified industrial strain expressing rhaA and another strain

The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

Directory of Open Access Journals (Sweden)

Ghaffari Novin M.

2015-06-01

Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

Directory of Open Access Journals (Sweden)

Hongle Xu

Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

The pbrB gene encodes a laccase required for DHN-melanin synthesis in conidia of Talaromyces (Penicillium) marneffei.

Science.gov (United States)

Sapmak, Ariya; Boyce, Kylie J; Andrianopoulos, Alex; Vanittanakom, Nongnuch

2015-01-01

Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type.

An Investigation of the Relationship between PPP1R3 Gene Polymorphism and Type 2 Diabetes

Directory of Open Access Journals (Sweden)

Soyar Sari

2017-07-01

Full Text Available Background and Objectives: PPP1R3 is one of the genes confirmed to be associated with type 2 diabetes. This gene is located on the long arm of chromosome 7 and encodes protein phosphatase 1 (PP1, which has serine/threonine phosphatase activity. There is a polymorphic region in the 3'UTR region of this gene, which creates ARE1 and ARE2 alleles. The aim of this study was to determine the relationship between PPP1R3 gene polymorphism and type 2 diabetes. Methods: In this case-control study, 100 patients with type 2 diabetes and 100 healthy individuals, were randomly selected from the study population. PPP1R3 gene polymorphism was analyzed using PCR-RFLP method. Comparison of variables between healthy and patient groups, was performed by t-test, allele frequency by counting, and calculation of their ratio by chi-square test, and the population was confirmed to be in Hardy-Weinberg equilibrium. Distribution of genotypes and alleles was compared between healthy and patient groups. Results: In this study, there was no significant difference between the frequency of genotypes and frequency of alleles in subjects with type 2 diabetes and healthy control subjects. Conclusion: The findings of this study indicated that polymorphisms in the 3'UTR region of PPP1R3 gene is not associated with type 2 diabetes.

Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

Science.gov (United States)

Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

2018-02-01

Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

International Nuclear Information System (INIS)

Hayat, S.; Cheng, Z.; Chen, X.

2016-01-01

The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1

Directory of Open Access Journals (Sweden)

Wang Yu

2011-04-01

Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15

Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1.

Science.gov (United States)

Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang

2011-04-06

In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and

Mutation Profile of the CDH23 Gene in 56 Probands with Usher Syndrome Type I

Science.gov (United States)

Oshima, A.; Jaijo, T.; Aller, E.; Millan, J.M.; Carney, C.; Usami, S.; Moller, C.; Kimberling, W.J.

2008-01-01

Mutations in the human gene encoding cadherin 23 (CDH23) cause Usher syndrome type 1D (USH1D) and nonsyndromic hearing loss. Individuals with Usher syndrome type I have profound congenital deafness, vestibular areflexia and usually begin to exhibit signs of RP in early adolescence. In the present study, we carried out the mutation analysis in all 69 exons of the CDH23 gene in 56 Usher type 1 probands already screened for mutations in MYO7A. A total of 18 of 56 subjects (32.1%) were observed to have one or two CDH23 variants that are presumed to be pathologic. Twenty one different pathologic genome variants were observed of which 15 were novel. Out of a total of 112 alleles, 31 (27.7%) were considered pathologic. Based on our results it is estimated that about 20% of patients with Usher syndrome type I have CDH23 mutations. PMID:18429043

Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

Science.gov (United States)

Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

Science.gov (United States)

Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

2007-01-01

Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

Involvement of SPI-2-encoded SpiC in flagellum synthesis in Salmonella enterica serovar Typhimurium

Directory of Open Access Journals (Sweden)

Sugita Asami

2009-08-01

Full Text Available Abstract Background SpiC encoded within Salmonella pathogenicity island 2 on the Salmonella enterica serovar Typhimurium chromosome is required for survival within macrophages and systemic infection in mice. Additionally, SpiC contributes to Salmonella-induced activation of the signal transduction pathways in macrophages by affecting the expression of FliC, a component of flagella filaments. Here, we show the contribution of SpiC in flagellum synthesis. Results Quantitative RT-PCR shows that the expression levels of the class 3 fliD and motA genes that encode for the flagella cap and motor torque proteins, respectively, were lower for a spiC mutant strain than for the wild-type Salmonella. Further, this mutant had lower expression levels of the class 2 genes including the fliA gene encoding the flagellar-specific alternative sigma factor. We also found differences in flagella assembly between the wild-type strain and the spiC mutant. Many flagella filaments were observed on the bacterial surface of the wild-type strain, whereas the spiC mutant had only few flagella. The absence of spiC led to reduced expression of the FlhD protein, which functions as the master regulator in flagella gene expression, although no significant difference at the transcription level of the flhDC operon was observed between the wild-type strain and the spiC mutant. Conclusion The data show that SpiC is involved in flagella assembly by affecting the post-transcription expression of flhDC.

[Abnormal floral meristem development in transgenic tomato plants do not depend on the expression of genes encoding defense-related PR-proteins and antimicrobial peptides].

Science.gov (United States)

Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu

2014-01-01

In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial

Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

DEFF Research Database (Denmark)

Durkin, M E; Jäger, A C; Khurana, T S

1999-01-01

The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

Science.gov (United States)

Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

2017-12-26

The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

The effect of feeding a commercial essential oil product on Clostridium perfringens numbers in the intestine of broiler chickens measured by real-time PCR targeting the α-toxin-encoding gene (plc)

DEFF Research Database (Denmark)

Abildgaard, Lone; Højberg, Ole; Schramm, Andreas

2010-01-01

Proliferation of Clostridium perfringens type A in the broiler intestinal tract is related to poor growth and litter quality, and can under certain conditions lead to the development of necrotic enteritis (NE), a severe gastrointestinal disease in broilers. The aim of the present study was to inv...... quantification of C. perfringens type A in broilers, a real-time PCR assay, targeting the α-toxin-encoding plc gene, was developed for use in ileal and caecal samples and was shown to be a fast and reliable alternative to conventional plate counting....

Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

Science.gov (United States)

Pyne, C; Bognar, A L

1992-03-01

The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

Patterns of MADS-box gene expression mark flower-type development in Gerbera hybrida (Asteraceae

Directory of Open Access Journals (Sweden)

Teeri Teemu H

2006-06-01

Full Text Available Abstract Background The inflorescence of the cut-flower crop Gerbera hybrida (Asteraceae consists of two principal flower types, ray and disc, which form a tightly packed head, or capitulum. Despite great interest in plant morphological evolution and the tractability of the gerbera system, very little is known regarding genetic mechanisms involved in flower type specification. Here, we provide comparative staging of ray and disc flower development and microarray screening for differentially expressed genes, accomplished via microdissection of hundreds of coordinately developing flower primordia. Results Using a 9K gerbera cDNA microarray we identified a number of genes with putative specificity to individual flower types. Intrestingly, several of these encode homologs of MADS-box transcription factors otherwise known to regulate flower organ development. From these and previously obtained data, we hypothesize the functions and protein-protein interactions of several gerbera MADS-box factors. Conclusion Our RNA expression results suggest that flower-type specific MADS protein complexes may play a central role in differential development of ray and disc flowers across the gerbera capitulum, and that some commonality is shared with known protein functions in floral organ determination. These findings support the intriguing conjecture that the gerbera flowering head is more than a mere floral analog at the level of gene regulation.

Identification of a single‐copy gene encoding a Type I chlorophyll a/b‐binding polypeptide of photosystem I in Arabidopsis thaliana

DEFF Research Database (Denmark)

Jensen, Poul E; Kristensen, Michael; Hoff, Tine

1992-01-01

We have isolated and sequenced cDNA and genomic clones from Arabidopsis thaliana which specify a 241 residue protein with 84% sequence identity to a photosystem I Type I chlorophyll a/b-binding (CAB) protein from tomato. The open reading frame is interrupted by three introns which are found...... at equivalent positions as the corresponding introns in the tomato gene. Comparison to the amino acid sequence of other CAB proteins confirms that all CAB proteins share two regions of very high similarity. However, near the N-terminus and between the conserved regions this light-harvesting complex I (LHCI...

A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

Science.gov (United States)

Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

1994-02-01

We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

The gene encoding the melanin-concentrating hormone receptor 1 is associated with schizophrenia in a Danish case-control sample

DEFF Research Database (Denmark)

Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H

2012-01-01

OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...

Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

Science.gov (United States)

Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

2005-01-01

Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

Science.gov (United States)

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Science.gov (United States)

Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

2013-01-01

The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Directory of Open Access Journals (Sweden)

Linda J Savage

Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

NARCIS (Netherlands)

Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

Science.gov (United States)

Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

1999-04-16

A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds.

Science.gov (United States)

de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap

2002-04-15

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.

Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

Science.gov (United States)

Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

2015-01-01

In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

Nuclear-cytoplasmic conflict in pea (Pisum sativum L. is associated with nuclear and plastidic candidate genes encoding acetyl-CoA carboxylase subunits.

Directory of Open Access Journals (Sweden)

Vera S Bogdanova

Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

OpenAIRE

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-01-01

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

A plasmid-encoded nicotinamidase (PncA) is essential for infectivity of Borrelia burgdorferi in a mammalian host.

Science.gov (United States)

Purser, Joye E; Lawrenz, Matthew B; Caimano, Melissa J; Howell, Jerrilyn K; Radolf, Justin D; Norris, Steven J

2003-05-01

Borrelia burgdorferi, a spirochaete that causes Lyme borreliosis, contains 21 linear and circular plasmids thought to be important for survival in mammals or ticks. Our results demonstrate that the gene BBE22 encoding a nicotinamidase is capable of replacing the requirement for the 25 kb linear plasmid lp25 during mammalian infection. Transformation of B. burgdorferi lacking lp25 with a shuttle vector containing the lp25 gene BBE22 (pBBE22) restored infectivity in mice to a level comparable to that of wild-type Borrelia. This complementation also restored the growth and host adaptation of lp25-B. burgdorferi in dialysis membrane chambers (DMCs) implanted in rats. A single Cys to Ala conversion at the putative active site of BBE22 abrogated the ability of pBBE22 to re-establish infectivity or growth in DMCs. Additional Salmonella typhimurium complementation studies and enzymatic analysis demonstrated that the BBE22 gene product has nicotinamidase activity and is most probably required for the biosynthesis of NAD. These results indicate that some plasmid-encoded products fulfil physiological functions required in the enzootic cycle of pathogenic Borrelia.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Diabetic microvascular complications are not associated with two polymorphisms in the GLUT-1 and PC-1 genes regulating glucose metabolism in Caucasian type 1 diabetic patients

DEFF Research Database (Denmark)

Tarnow, L; Grarup, N; Hansen, T

2001-01-01

BACKGROUND: An XbaI polymorphism in the gene encoding the glucose transporter, GLUT-1, is associated with development of diabetic nephropathy in Chinese type 2 diabetic patients. In addition, an amino acid variant (K121Q) in the gene encoding the glycoprotein plasma cell differentiating antigen (PC...... men/77 women, age 40.9+/-9.6 years, diabetes duration 27+/-8 years) and type 1 diabetic patients with persistent normoalbuminuria (118 men/74 women, age 42.7+/-10.2 years, diabetes duration 26+/-9 years). Proliferative retinopathy was present in 156 patients (40%), while 67 patients (17%) had....... CONCLUSIONS: Neither the PC-1 K121Q nor the GLUT-1 XbaI polymorphism contribute to the genetic susceptibility of diabetic microvascular complications in Danish type 1 diabetic patients....

Glutathione S-transferase genes and the risk of type 2 diabetes mellitus: Role of sexual dimorphism, gene-gene and gene-smoking interactions in disease susceptibility.

Science.gov (United States)

Azarova, Iuliia; Bushueva, Olga; Konoplya, Alexander; Polonikov, Alexey

2018-05-01

Compromised defense against reactive oxygen species (ROS) is considered important in the pathogenesis of type 2 diabetes mellitus (T2DM); therefore, genes encoding antioxidant defense enzymes may contribute to disease susceptibility. This study investigated whether polymorphisms in genes encoding glutathione S-transferase M1 (GSTM1), T1 (GSTT1), and P1 (GSTP1) jointly contribute to the risk of T2DM. In all, 1120 unrelated Russian subjects (600 T2DM patients, 520 age- and sex-matched healthy subjects), were recruited to the study. Genotyping was performed by multiplex polymerase chain reaction (PCR; del/del polymorphisms of GSTM1 and GSTT1) and TaqMan-based PCR (polymorphisms I105V and A114V of GSTP1). Plasma ROS and glutathione levels in study subjects were analyzed by fluorometric and colorimetric assays, respectively. Genotype del/del GSTT1 was significantly associated with the risk of T2DM (odds ratio [OR] 1.60, 95% confidence interval [CI] 1.17-2.21, P = 0.003). Gender-stratified analysis showed that the deletion genotypes of GSTM1 (OR 1.99, 95% CI 1.30-3.05; P = 0.0002, Q = 0.016) and GSTT1 (OR 2.23, 95% CI 1.22-4.09; P = 0.008, Q = 0.0216), as well as genotype 114A/V of GSTP1 (OR 2.85, 95% CI 1.44-5.62; P = 0.005, Q = 0.02) were associated with an increased risk of T2DM exclusively in males. Three genotype combinations (i.e. GSTM1+ × GSTT1+, GSTM1+ × GSTP1 114A/A and GSTT1+ × GSTP1 114A/A) showed significant associations with a decreased risk of T2DM in males. This study demonstrates, for the first time, that genes encoding glutathione S-transferases jointly contribute to the risk of T2DM, and that their effects on disease susceptibility are gender specific. © 2017 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.

Identification of a basic helix-loop-helix-type transcription regulator gene in Aspergillus oryzae by systematically deleting large chromosomal segments.

Science.gov (United States)

Jin, Feng Jie; Takahashi, Tadashi; Machida, Masayuki; Koyama, Yasuji

2009-09-01

We previously developed two methods (loop-out and replacement-type recombination) for generating large-scale chromosomal deletions that can be applied to more effective chromosomal engineering in Aspergillus oryzae. In this study, the replacement-type method is used to systematically delete large chromosomal DNA segments to identify essential and nonessential regions in chromosome 7 (2.93 Mb), which is the smallest A. oryzae chromosome and contains a large number of nonsyntenic blocks. We constructed 12 mutants harboring deletions that spanned 16- to 150-kb segments of chromosome 7 and scored phenotypic changes in the resulting mutants. Among the deletion mutants, strains designated Delta5 and Delta7 displayed clear phenotypic changes involving growth and conidiation. In particular, the Delta5 mutant exhibited vigorous growth and conidiation, potentially beneficial characteristics for certain industrial applications. Further deletion analysis allowed identification of the AO090011000215 gene as the gene responsible for the Delta5 mutant phenotype. The AO090011000215 gene was predicted to encode a helix-loop-helix binding protein belonging to the bHLH family of transcription factors. These results illustrate the potential of the approach for identifying novel functional genes.

Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

Science.gov (United States)

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-12-12

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Meng Sun

2014-12-01

Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

A previously uncharacterized gene stm0551 plays a repressive role in the regulation of type 1 fimbriae in Salmonella enterica serotype Typhimurium

Directory of Open Access Journals (Sweden)

Wang Ke-Chuan

2012-06-01

Full Text Available Abstract Background Salmonella enterica serotype Typhimurium produces surface-associated fimbriae that facilitate adherence of the bacteria to a variety of cells and tissues. Type 1 fimbriae with binding specificity to mannose residues are the most commonly found fimbrial type. In vitro, static-broth culture favors the growth of S. Typhimurium with type 1 fimbriae, whereas non-type 1 fimbriate bacteria are obtained by culture on solid-agar media. Previous studies demonstrated that the phenotypic expression of type 1 fimbriae is the result of the interaction and cooperation of the regulatory genes fimZ, fimY, fimW, and fimU within the fim gene cluster. Genome sequencing revealed a novel gene, stm0551, located between fimY and fimW that encodes an 11.4-kDa putative phosphodiesterase specific for the bacterial second messenger cyclic-diguanylate monophosphate (c-di-GMP. The role of stm0551 in the regulation of type 1 fimbriae in S. Typhimurium remains unclear. Results A stm0551-deleted stain constructed by allelic exchange constitutively produced type 1 fimbriae in both static-broth and solid-agar medium conditions. Quantative RT-PCR revealed that expression of the fimbrial major subunit gene, fimA, and one of the regulatory genes, fimZ, were comparably increased in the stm0551-deleted strain compared with those of the parental strain when grown on the solid-agar medium, a condition that normally inhibits expression of type 1 fimbriae. Following transformation with a plasmid possessing the coding sequence of stm0551, expression of fimA and fimZ decreased in the stm0551 mutant strain in both culture conditions, whereas transformation with the control vector pACYC184 relieved this repression. A purified STM0551 protein exhibited a phosphodiesterase activity in vitro while a point mutation in the putative EAL domain, substituting glutamic acid (E with alanine (A, of STM0551 or a FimY protein abolished this activity. Conclusions The finding that the

High diversity of genes and plasmids encoding resistance to third-generation cephalosporins and quinolones in clinical Escherichia coli from commercial poultry flocks in Italy

DEFF Research Database (Denmark)

Niero, Giulia; Bortolaia, Valeria; Vanni, Michele

2018-01-01

= 98) and layers (n = 22) between 2008 and 2012. 3GC-resistant isolates were screened for extended-spectrum and AmpC β-lactamase (ESBL/AmpC), while all isolates were tested for plasmid-mediated quinolone resistance (PMQR) genes. ESBL/AmpC- and PMQR-positive isolates were typed by pulsed-field gel......% of isolates from turkeys, broilers and layers, respectively. We identified seven ESBL/AmpC-encoding plasmid types, usually conjugative (78%), with a marked prevalence of IncI1/pST3 plasmids carrying blaCTX-M-1. PMQR occurred less frequently among isolates from turkeys (0.9%) compared to those from broilers (5......%) and layers (4%). The PMQR genes qnrS, qnrB19 and oqxA/B were located on three plasmid types and two non-typeable plasmids, mostly (85%) conjugative. ESBL/AmpC- and PMQR-positive isolates were genetically unrelated and 64% of them were additionally resistant to aminoglycosides, sulfonamides and tetracyclines...

Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination.

Science.gov (United States)

Revaud, Julien; Unterfinger, Yves; Rol, Nicolas; Suleman, Muhammad; Shaw, Julia; Galea, Sandra; Gavard, Françoise; Lacour, Sandrine A; Coulpier, Muriel; Versillé, Nicolas; Havenga, Menzo; Klonjkowski, Bernard; Zanella, Gina; Biacchesi, Stéphane; Cordonnier, Nathalie; Corthésy, Blaise; Ben Arous, Juliette; Richardson, Jennifer P

2018-01-01

To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches.

Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination

Directory of Open Access Journals (Sweden)

Julien Revaud

2018-01-01

Full Text Available To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches.

Safety profile, efficacy, and biodistribution of a bicistronic high-capacity adenovirus vector encoding a combined immunostimulation and cytotoxic gene therapy as a prelude to a phase I clinical trial for glioblastoma

Energy Technology Data Exchange (ETDEWEB)

Puntel, Mariana [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Ghulam, Muhammad A.K.M. [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Farrokhi, Catherine [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); VanderVeen, Nathan; Paran, Christopher; Appelhans, Ashley [Department of Neurosurgery, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689 (United States); Kroeger, Kurt M.; Salem, Alireza [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Lacayo, Liliana [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Pechnick, Robert N. [Department of Psychiatry and Behavioral Neurosciences, Cedars Sinai Medical Center, Los Angeles, CA 90048 (United States); Department of Psychiatry and Behavioral Neurosciences, David Geffen School of Medicine, University of California, Los Angeles, CA (United States); Kelson, Kyle R.; Kaur, Sukhpreet; Kennedy, Sean [Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048 (United States); Palmer, Donna; Ng, Philip [Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030 (United States); and others

2013-05-01

Adenoviral vectors (Ads) are promising gene delivery vehicles due to their high transduction efficiency; however, their clinical usefulness has been hampered by their immunogenicity and the presence of anti-Ad immunity in humans. We reported the efficacy of a gene therapy approach for glioma consisting of intratumoral injection of Ads encoding conditionally cytotoxic herpes simplex type 1 thymidine kinase (Ad-TK) and the immunostimulatory cytokine fms-like tyrosine kinase ligand 3 (Ad-Flt3L). Herein, we report the biodistribution, efficacy, and neurological and systemic effects of a bicistronic high-capacity Ad, i.e., HC-Ad-TK/TetOn-Flt3L. HC-Ads elicit sustained transgene expression, even in the presence of anti-Ad immunity, and can encode large therapeutic cassettes, including regulatory elements to enable turning gene expression “on” or “off” according to clinical need. The inclusion of two therapeutic transgenes within a single vector enables a reduction of the total vector load without adversely impacting efficacy. Because clinically the vectors will be delivered into the surgical cavity, normal regions of the brain parenchyma are likely to be transduced. Thus, we assessed any potential toxicities elicited by escalating doses of HC-Ad-TK/TetOn-Flt3L (1 × 10{sup 8}, 1 × 10{sup 9}, or 1 × 10{sup 10} viral particles [vp]) delivered into the rat brain parenchyma. We assessed neuropathology, biodistribution, transgene expression, systemic toxicity, and behavioral impact at acute and chronic time points. The results indicate that doses up to 1 × 10{sup 9} vp of HC-Ad-TK/TetOn-Flt3L can be safely delivered into the normal rat brain and underpin further developments for its implementation in a phase I clinical trial for glioma. - Highlights: ► High capacity Ad vectors elicit sustained therapeutic gene expression in the brain. ► HC-Ad-TK/TetOn-Flt3L encodes two therapeutic genes and a transcriptional switch. ► We performed a dose escalation study at

Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

Science.gov (United States)

Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

2009-01-01

There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

Enhanced anti-tumor effect of a gene gun-delivered DNA vaccine encoding the human papillomavirus type 16 oncoproteins genetically fused to the herpes simplex virus glycoprotein D

Directory of Open Access Journals (Sweden)

M.O. Diniz

2011-05-01

Full Text Available Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements in both vaccine composition and administration routes are still required. In the present study, we report the immune responses and anti-tumor effects of a DNA vaccine (pgD-E7E6E5 expressing three proteins (E7, E6, and E5 of the human papillomavirus type 16 genetically fused to the glycoprotein D of the human herpes simplex virus type 1, which was administered to mice by the intradermal (id route using a gene gun. A single id dose of pgD-E7E6E5 (2 µg/dose induced a strong activation of E7-specific interferon-γ (INF-γ-producing CD8+ T cells and full prophylactic anti-tumor effects in the vaccinated mice. Three vaccine doses inhibited tumor growth in 70% of the mice with established tumors. In addition, a single vaccine dose consisting of the co-administration of pgD-E7E6E5 and the vector encoding interleukin-12 or granulocyte-macrophage colony-stimulating factor further enhanced the therapeutic anti-tumor effects and conferred protection to 60 and 50% of the vaccinated mice, respectively. In conclusion, id administration of pgD-E7E6E5 significantly enhanced the immunogenicity and anti-tumor effects of the DNA vaccine, representing a promising administration route for future clinical trials.

A study on association of SNP-43 polymorphism in Calpain-10 gene with type 2 diabetes mellitus in the population of Eastern Azerbaijan province

Directory of Open Access Journals (Sweden)

Fatemeh Bahreini

2012-04-01

Full Text Available Background: Genome – wide analysis of genetic predisposition to type 2 diabetes mellitus in different populations have yielded variable results. Calpain10, a gene that encodes a non-lysosomal cysteine protease, has been recently proposed as a type 2 diabetes susceptibility genes in the non-insulin-dependent diabetes mellitus NIDDM1 region. Aim of the study is to evaluate the relation between SNP43 and type2 diabetes. Methods: A total of 102 diabetic subjects and 100 undiabetic controls enrolled in a case-control study in Eastern Azerbaijan Azerbaijan Province. The polymerase chain reaction restriction fragment length polymorphism technique (PCR–RFLP was applied. We use X2 test and logistic regression to analysis of data. Results: Genotypes distribution of calpain10 gene in control group were 11(11%, 86(86% and 3(3% with respected to A/G, G/G and A/A genotypes, respectively. In diabetic group genotypes distribution were 7(6.9%, 95(93.1% and zero, respectively. The G allele frequency was significant difference in case and control groups. Conclusion: Since G allele is a risk factor to affect type 2 diabetes disease hence SNP43 of calpain10 gene had significant association with type 2 diabetes in Eastern Azerbaijan.

Different patterns of gene expression in rice varieties undergoing a ...

African Journals Online (AJOL)

Some genes specifically up-regulated in infected 9804-Rxo1 were defenserelated, including the genes encoding pathogenesis-related protein, terpene synthase family, transcription factors (TFs) AP2 domain containing protein, myb-like deoxyribonucleic acid (DNA)- binding domain containing protein, and C2H2-type ...

The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

Directory of Open Access Journals (Sweden)

Elías Trujillo-Esquivel

2017-09-01

Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100