WorldWideScience

Sample records for gene duplication differentially

  1. Differential retention of metabolic genes following whole-genome duplication.

    Science.gov (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel

    2009-05-01

    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  2. A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

    Directory of Open Access Journals (Sweden)

    Taro Tsujimura

    2010-12-01

    Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

  3. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Science.gov (United States)

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  4. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Directory of Open Access Journals (Sweden)

    Philippe Ganot

    2011-07-01

    Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both

  5. Differential transcriptional modulation of duplicated fatty acid-binding protein genes by dietary fatty acids in zebrafish (Danio rerio: evidence for subfunctionalization or neofunctionalization of duplicated genes

    Directory of Open Access Journals (Sweden)

    Denovan-Wright Eileen M

    2009-09-01

    , induction of the steady-state level of fabp mRNAs by dietary FAs correlated with induced levels of hnRNA for a given fabp gene. As such, up-regulation of the steady-state level of fabp mRNAs by FAs occurred at the level of initiation of transcription. None of the sister duplicates of these fabp genes exhibited an increase in their steady-state transcript levels in a specific tissue following feeding zebrafish any of the four experimental diets. Conclusion Differential induction of only one of the sister pair of duplicated fabp genes by FAs provides evidence to support the DDC model for retention of duplicated genes in the zebrafish genome by either subfunctionalization or neofunctionalization.

  6. Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

    Science.gov (United States)

    Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

    2012-11-02

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

  7. Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

    Science.gov (United States)

    Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

    2012-01-01

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

  8. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  9. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Science.gov (United States)

    Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.

    2017-01-01

    The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane

  10. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Directory of Open Access Journals (Sweden)

    Tommy Harding

    2017-05-01

    Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like

  11. Differential contributions to the transcriptome of duplicated genes in response to abiotic stresses in natural and synthetic polyploids.

    Science.gov (United States)

    Dong, Shaowei; Adams, Keith L

    2011-06-01

    Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  12. Functional requirements driving the gene duplication in 12 Drosophila species.

    Science.gov (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

    2013-08-15

    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  13. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  14. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  15. Characterization of the interferon genes in homozygous rainbow trout reveals two novel genes, alternate splicing and differential regulation of duplicated genes

    Science.gov (United States)

    Purcell, M.K.; Laing, K.J.; Woodson, J.C.; Thorgaard, G.H.; Hansen, J.D.

    2009-01-01

    The genes encoding the type I and type II interferons (IFNs) have previously been identified in rainbow trout and their proteins partially characterized. These previous studies reported a single type II IFN (rtIFN-??) and three rainbow trout type I IFN genes that are classified into either group I (rtIFN1, rtIFN2) or group II (rtIFN3). In this present study, we report the identification of a novel IFN-?? gene (rtIFN-??2) and a novel type I group II IFN (rtIFN4) in homozygous rainbow trout and predict that additional IFN genes or pseudogenes exist in the rainbow trout genome. Additionally, we provide evidence that short and long forms of rtIFN1 are actively and differentially transcribed in homozygous trout, and likely arose due to alternate splicing of the first exon. Quantitative reverse transcriptase PCR (qRT-PCR) assays were developed to systematically profile all of the rainbow trout IFN transcripts, with high specificity at an individual gene level, in na??ve fish and after stimulation with virus or viral-related molecules. Cloned PCR products were used to ensure the specificity of the qRT-PCR assays and as absolute standards to assess transcript abundance of each gene. All IFN genes were modulated in response to Infectious hematopoietic necrosis virus (IHNV), a DNA vaccine based on the IHNV glycoprotein, and poly I:C. The most inducible of the type I IFN genes, by all stimuli tested, were rtIFN3 and the short transcript form of rtIFN1. Gene expression of rtIFN-??1 and rtIFN-??2 was highly up-regulated by IHNV infection and DNA vaccination but rtIFN-??2 was induced to a greater magnitude. The specificity of the qRT-PCR assays reported here will be useful for future studies aimed at identifying which cells produce IFNs at early time points after infection. ?? 2008 Elsevier Ltd.

  16. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  17. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  18. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  19. Tissue-specific differential induction of duplicated fatty acid-binding protein genes by the peroxisome proliferator, clofibrate, in zebrafish (Danio rerio

    Directory of Open Access Journals (Sweden)

    Venkatachalam Ananda B

    2012-07-01

    Full Text Available Abstract Background Force, Lynch and Conery proposed the duplication-degeneration-complementation (DDC model in which partitioning of ancestral functions (subfunctionalization and acquisition of novel functions (neofunctionalization were the two primary mechanisms for the retention of duplicated genes. The DDC model was tested by analyzing the transcriptional induction of the duplicated fatty acid-binding protein (fabp genes by clofibrate in zebrafish. Clofibrate is a specific ligand of the peroxisome proliferator-activated receptor (PPAR; it activates PPAR which then binds to a peroxisome proliferator response element (PPRE to induce the transcriptional initiation of genes primarily involved in lipid homeostasis. Zebrafish was chosen as our model organism as it has many duplicated genes owing to a whole genome duplication (WGD event that occurred ~230-400 million years ago in the teleost fish lineage. We assayed the steady-state levels of fabp mRNA and heterogeneous nuclear RNA (hnRNA transcripts in liver, intestine, muscle, brain and heart for four sets of duplicated fabp genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, fabp10a/fabp10b and fabp11a/fabp11b in zebrafish fed different concentrations of clofibrate. Result Electron microscopy showed an increase in the number of peroxisomes and mitochondria in liver and heart, respectively, in zebrafish fed clofibrate. Clofibrate also increased the steady-state level of acox1 mRNA and hnRNA transcripts in different tissues, a gene with a functional PPRE. These results demonstrate that zebrafish is responsive to clofibrate, unlike some other fishes. The levels of fabp mRNA and hnRNA transcripts for the four sets of duplicated fabp genes was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. The level of hnRNA coded by a gene is an indirect estimate of the rate of transcriptional initiation of that gene. Clofibrate increased the steady-state level of fabp mRNAs and hn

  20. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  1. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  2. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su

    2014-01-01

    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  3. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  4. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes.

    Science.gov (United States)

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu

    2011-12-20

    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  5. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  6. Three neuropeptide Y receptor genes in the spiny dogfish, Squalus acanthias, support en bloc duplications in early vertebrate evolution.

    Science.gov (United States)

    Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan

    2003-08-01

    It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.

  7. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    Science.gov (United States)

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  9. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  10. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  11. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  12. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  13. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  14. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  15. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren

    2010-06-01

    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  16. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  17. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  18. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  19. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  20. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  1. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang

    2011-01-01

    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  2. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  3. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  4. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  5. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  6. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  7. On Computing Breakpoint Distances for Genomes with Duplicate Genes.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2017-06-01

    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  8. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  9. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  10. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  11. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett

    2011-02-01

    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  13. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam

    2007-11-01

    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  14. Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

    DEFF Research Database (Denmark)

    Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang

    2008-01-01

    Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

  15. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  16. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  17. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes.

    Science.gov (United States)

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-03-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.

  18. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  19. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  20. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  1. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

    Science.gov (United States)

    Kursel, Lisa E; Malik, Harmit S

    2017-06-01

    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  3. Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates.

    Science.gov (United States)

    Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

    2017-11-01

    The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  4. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L

    2007-07-01

    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  5. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

    Science.gov (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

    2016-11-04

    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  6. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  7. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes

    OpenAIRE

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-01-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...

  8. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  9. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  10. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  11. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  13. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk

    2010-12-01

    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  14. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  15. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  16. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded

    2011-01-01

    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  17. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  18. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

    2006-01-01

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  19. Local synteny and codon usage contribute to asymmetric sequence divergence of Saccharomyces cerevisiae gene duplicates

    Directory of Open Access Journals (Sweden)

    Bergthorsson Ulfar

    2011-09-01

    Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.

  20. Evolution dynamics of a model for gene duplication under adaptive conflict

    Science.gov (United States)

    Ancliff, Mark; Park, Jeong-Man

    2014-06-01

    We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.

  1. XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.

    Science.gov (United States)

    Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David

    2012-07-01

    Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

  2. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A

    2003-04-01

    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  3. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  4. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  5. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  6. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  7. On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-01-01

    Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.

  8. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph

    2006-03-01

    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  9. Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper.

    Science.gov (United States)

    Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris

    2018-01-22

    Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.

    Directory of Open Access Journals (Sweden)

    Hiroyasu Kamei

    2008-08-01

    Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.

  11. Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies.

    Science.gov (United States)

    Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D

    2016-09-02

    Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  13. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development.

    Directory of Open Access Journals (Sweden)

    Shuming Zou

    Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.

  14. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2008-06-01

    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  15. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    ers were developed, and the 1990s, when genome sequenc- ing became ... transposed gene copies have been maintained in the human genome over the past 63 ..... competent artificial chromosome (TAC) libraries as the pri- mary substrates ...

  16. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  17. Segmental Duplication, Microinversion, and Gene Loss Associated with a Complex Inversion Breakpoint Region in Drosophila

    Science.gov (United States)

    Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo

    2012-01-01

    Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714

  18. Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

    Directory of Open Access Journals (Sweden)

    Ge Song

    2010-04-01

    Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

  19. Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-06-01

    Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

  20. Multiplex Ligation-dependent Probe Amplification Identification of Deletions and Duplications of the Duchenne Muscular Dystrophy Gene in Taiwanese Subjects

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2007-05-01

    Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.

  1. Ascorbate peroxidase-related (APx-R) is not a duplicable gene.

    Science.gov (United States)

    Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia

    2011-12-01

    Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

  2. Host Mitochondrial Association Evolved in the Human Parasite Toxoplasma gondii via Neofunctionalization of a Gene Duplicate.

    Science.gov (United States)

    Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P

    2016-05-01

    In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.

  3. Polytomy refinement for the correction of dubious duplications in gene trees.

    Science.gov (United States)

    Lafond, Manuel; Chauve, Cedric; Dondi, Riccardo; El-Mabrouk, Nadia

    2014-09-01

    Large-scale methods for inferring gene trees are error-prone. Correcting gene trees for weakly supported features often results in non-binary trees, i.e. trees with polytomies, thus raising the natural question of refining such polytomies into binary trees. A feature pointing toward potential errors in gene trees are duplications that are not supported by the presence of multiple gene copies. We introduce the problem of refining polytomies in a gene tree while minimizing the number of created non-apparent duplications in the resulting tree. We show that this problem can be described as a graph-theoretical optimization problem. We provide a bounded heuristic with guaranteed optimality for well-characterized instances. We apply our algorithm to a set of ray-finned fish gene trees from the Ensembl database to illustrate its ability to correct dubious duplications. The C++ source code for the algorithms and simulations described in the article are available at http://www-ens.iro.umontreal.ca/~lafonman/software.php. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

  4. Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene

    Directory of Open Access Journals (Sweden)

    Kane L Greer

    2014-01-01

    Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.

  5. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Science.gov (United States)

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  6. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Directory of Open Access Journals (Sweden)

    Olga V Popova

    Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

  7. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  8. Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

    Directory of Open Access Journals (Sweden)

    Görel Sundström

    Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.

  9. Enteric Duplication.

    Science.gov (United States)

    Jeziorczak, Paul M; Warner, Brad W

    2018-03-01

    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  10. Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy.

    Science.gov (United States)

    Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin

    2010-07-27

    The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

  11. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  12. Simulating evolution of protein complexes through gene duplication and co-option.

    Science.gov (United States)

    Haarsma, Loren; Nelesen, Serita; VanAndel, Ethan; Lamine, James; VandeHaar, Peter

    2016-06-21

    We present a model of the evolution of protein complexes with novel functions through gene duplication, mutation, and co-option. Under a wide variety of input parameters, digital organisms evolve complexes of 2-5 bound proteins which have novel functions but whose component proteins are not independently functional. Evolution of complexes with novel functions happens more quickly as gene duplication rates increase, point mutation rates increase, protein complex functional probability increases, protein complex functional strength increases, and protein family size decreases. Evolution of complexity is inhibited when the metabolic costs of making proteins exceeds the fitness gain of having functional proteins, or when point mutation rates get so large the functional proteins undergo deleterious mutations faster than new functional complexes can evolve. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast

    DEFF Research Database (Denmark)

    Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.

    2007-01-01

    and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...

  14. Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion

    Directory of Open Access Journals (Sweden)

    Shao Mingfu

    2012-12-01

    Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.

  15. Hypertension and Biliary Ductopenia in a Patient with Duplication of Exon 6 of the Gene

    Directory of Open Access Journals (Sweden)

    J. Uberos

    2012-01-01

    Full Text Available We describe a neonatal patient with biliary ductopenia featuring duplication of exon 6 of the JAG1 gene. Facial alterations were observed, consisting of a prominent forehead, sunken eyes, upward slanting palpebral fissures, hypertelorism, flat nasal root and prominent chin. From birth, these were accompanied by the development of haematuria and renal failure and by renal Doppler findings indicative of peripheral renal artery stenosis. JAG1 gene mutations on chromosome 20 have been associated with various anomalies, including biliary cholestasis, vertebral abnormalities, eye disorders, heart defects and facial dysmorphia. This syndrome, first described by Alagille, is an infrequent congenital disorder caused by a dominant autosomal inheritance with variable expressivity. Anatomopathological effects include the destruction and disappearance of hepatic bile ducts (ductopenia. The duplication of exon 6 of JAG1 has not previously been described as an alteration related to the Alagille syndrome with peripheral renal artery stenosis.

  16. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  17. Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

    DEFF Research Database (Denmark)

    Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne

    2012-01-01

    with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

  18. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou

    2006-11-01

    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  19. Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Majerfeld, I.H.; Roper, J.A.

    1978-01-01

    Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers

  20. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    Science.gov (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  1. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  2. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  3. Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

    Directory of Open Access Journals (Sweden)

    Xiaoli Jin

    2017-06-01

    Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

  4. GENE-dosage effects on fitness in recent adaptive duplications: ace-1 in the mosquito Culex pipiens.

    Science.gov (United States)

    Labbé, Pierrick; Milesi, Pascal; Yébakima, André; Pasteur, Nicole; Weill, Mylène; Lenormand, Thomas

    2014-07-01

    Gene duplications have long been advocated to contribute to the evolution of new functions. The role of selection in their early spread is more controversial. Unless duplications are favored for a direct benefit of increased expression, they are likely detrimental. In this article, we investigated the case of duplications favored because they combine already functionally divergent alleles. Their gene-dosage/fitness relations are poorly known because selection may operate on both overall expression and duplicates relative dosage. Using the well-documented case of Culex pipiens resistance to insecticides, we compared strains with various ace-1 allele combinations, including two duplicated alleles carrying both susceptible and resistant copies. The overall protein activity was nearly additive, but, surprisingly, fitness correlated better with the relative proportion of susceptible and resistant copies rather than any absolute measure of activity. Gene dosage is thus crucial, duplications stabilizing a "heterozygote" phenotype. It corroborates the view that these were favored because they fix a permanent heterosis, thereby solving the irreducible trade-off between resistance and synaptic transmission. Moreover, we showed that the contrasted successes of the two duplicated alleles in natural populations depend on genetic changes unrelated to ace-1, confirming the probable implication of recessive sublethal mutations linked to structural rearrangements in some duplications. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  5. Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature.

    Science.gov (United States)

    Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert

    2009-07-01

    Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

  6. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  7. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  8. Plasticity and innovation of regulatory mechanisms underlying seed oil content mediated by duplicated genes in the palaeopolyploid soybean.

    Science.gov (United States)

    Zhang, Dajian; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Wang, Weidong; Cai, Chunmei; Dierking, Emily C; Ma, Jianxin

    2017-06-01

    Many plants have undergone whole genome duplication (WGD). However, how regulatory networks underlying a particular trait are reshaped in polyploids has not been experimentally investigated. Here we show that the regulatory pathways modulating seed oil content, which involve WRINKLED1 (WRI1), LEAFY COTYLEDON1 (LEC1), and LEC2 in Arabidopsis, have been modified in the palaeopolyploid soybean. Such modifications include functional reduction of GmWRI1b of the GmWRI1a/GmWRI1b homoeologous pair relevant to WRI1, complementary non-allelic dosage effects of the GmLEC1a/GmLEC1b homoeologous pair relevant to LEC1, pseudogenization of the singleton GmLEC2 relevant to LEC2, and the rise of the LEC2-like function of GmABI3b, contrasting to its homoeolog GmABI3a, which maintains the ABSCISIC ACID INSENSITIVE 3 (ABI3)-like function in modulating seed maturation and dormancy. The function of GmABI3b in modulating seed oil biosynthesis was fulfilled by direct binding to a RY (CATGCA) cis-regulatory element in the GmWRI1a promoter, which was absent in the GmWRI1b promoter, resulting in reduction of the GmWRI1b expression. Nevertheless, the three regulators each exhibited similar intensities of purifying selection to their respective duplicates since these pairs were formed by a WGD event that is proposed to have occurred approximately 13 million years ago (mya), suggesting that the differentiation in spatiotemporal expression between the duplicated genes is more likely to be the outcome of neutral variation in regulatory sequences. This study thus exemplifies the plasticity, dynamics, and novelty of regulatory networks mediated by WGD. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  9. Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

    Science.gov (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

    2010-04-01

    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  10. Differential Gene Expression and Aging

    Directory of Open Access Journals (Sweden)

    Laurent Seroude

    2002-01-01

    Full Text Available It has been established that an intricate program of gene expression controls progression through the different stages in development. The equally complex biological phenomenon known as aging is genetically determined and environmentally modulated. This review focuses on the genetic component of aging, with a special emphasis on differential gene expression. At least two genetic pathways regulating organism longevity act by modifying gene expression. Many genes are also subjected to age-dependent transcriptional regulation. Some age-related gene expression changes are prevented by caloric restriction, the most robust intervention that slows down the aging process. Manipulating the expression of some age-regulated genes can extend an organism's life span. Remarkably, the activity of many transcription regulatory elements is linked to physiological age as opposed to chronological age, indicating that orderly and tightly controlled regulatory pathways are active during aging.

  11. Expression response of duplicated metallothionein 3 gene to copper stress in Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman

    2014-01-01

    Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014

  12. An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito.

    Science.gov (United States)

    Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène

    2015-10-05

    Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

  13. Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

    Directory of Open Access Journals (Sweden)

    Erin S Kelleher

    2007-08-01

    Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

  14. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  15. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  16. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    Directory of Open Access Journals (Sweden)

    Burt David W

    2010-04-01

    Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

  17. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  18. Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.

    Science.gov (United States)

    Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe

    2015-11-01

    A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification

  19. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  20. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  1. Resolution and reconciliation of non-binary gene trees with transfers, duplications and losses.

    Science.gov (United States)

    Jacox, Edwin; Weller, Mathias; Tannier, Eric; Scornavacca, Celine

    2017-04-01

    Gene trees reconstructed from sequence alignments contain poorly supported branches when the phylogenetic signal in the sequences is insufficient to determine them all. When a species tree is available, the signal of gains and losses of genes can be used to correctly resolve the unsupported parts of the gene history. However finding a most parsimonious binary resolution of a non-binary tree obtained by contracting the unsupported branches is NP-hard if transfer events are considered as possible gene scale events, in addition to gene origination, duplication and loss. We propose an exact, parameterized algorithm to solve this problem in single-exponential time, where the parameter is the number of connected branches of the gene tree that show low support from the sequence alignment or, equivalently, the maximum number of children of any node of the gene tree once the low-support branches have been collapsed. This improves on the best known algorithm by an exponential factor. We propose a way to choose among optimal solutions based on the available information. We show the usability of this principle on several simulated and biological datasets. The results are comparable in quality to several other tested methods having similar goals, but our approach provides a lower running time and a guarantee that the produced solution is optimal. Our algorithm has been integrated into the ecceTERA phylogeny package, available at http://mbb.univ-montp2.fr/MBB/download_sources/16__ecceTERA and which can be run online at http://mbb.univ-montp2.fr/MBB/subsection/softExec.php?soft=eccetera . celine.scornavacca@umontpellier.fr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  2. Gene Duplication Leads to Altered Membrane Topology of a Cytochrome P450 Enzyme in Seed Plants.

    Science.gov (United States)

    Renault, Hugues; De Marothy, Minttu; Jonasson, Gabriella; Lara, Patricia; Nelson, David R; Nilsson, IngMarie; André, François; von Heijne, Gunnar; Werck-Reichhart, Danièle

    2017-08-01

    Evolution of the phenolic metabolism was critical for the transition of plants from water to land. A cytochrome P450, CYP73, with cinnamate 4-hydroxylase (C4H) activity, catalyzes the first plant-specific and rate-limiting step in this pathway. The CYP73 gene is absent from green algae, and first detected in bryophytes. A CYP73 duplication occurred in the ancestor of seed plants and was retained in Taxaceae and most angiosperms. In spite of a clear divergence in primary sequence, both paralogs can fulfill comparable cinnamate hydroxylase roles both in vitro and in vivo. One of them seems dedicated to the biosynthesis of lignin precursors. Its N-terminus forms a single membrane spanning helix and its properties and length are highly constrained. The second is characterized by an elongated and variable N-terminus, reminiscent of ancestral CYP73s. Using as proxies the Brachypodium distachyon proteins, we show that the elongation of the N-terminus does not result in an altered subcellular localization, but in a distinct membrane topology. Insertion in the membrane of endoplasmic reticulum via a double-spanning open hairpin structure allows reorientation to the lumen of the catalytic domain of the protein. In agreement with participation to a different functional unit and supramolecular organization, the protein displays modified heme proximal surface. These data suggest the evolution of divergent C4H enzymes feeding different branches of the phenolic network in seed plants. It shows that specialization required for retention of gene duplicates may result from altered protein topology rather than change in enzyme activity. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  4. Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max).

    Science.gov (United States)

    Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M

    2015-03-15

    Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  5. Functional diversification of duplicated CYC2 clade genes in regulation of inflorescence development in Gerbera hybrida (Asteraceae).

    Science.gov (United States)

    Juntheikki-Palovaara, Inka; Tähtiharju, Sari; Lan, Tianying; Broholm, Suvi K; Rijpkema, Anneke S; Ruonala, Raili; Kale, Liga; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula

    2014-09-01

    The complex inflorescences (capitula) of Asteraceae consist of different types of flowers. In Gerbera hybrida (gerbera), the peripheral ray flowers are bilaterally symmetrical and lack functional stamens while the central disc flowers are more radially symmetrical and hermaphroditic. Proteins of the CYC2 subclade of the CYC/TB1-like TCP domain transcription factors have been recruited several times independently for parallel evolution of bilaterally symmetrical flowers in various angiosperm plant lineages, and have also been shown to regulate flower-type identity in Asteraceae. The CYC2 subclade genes in gerbera show largely overlapping gene expression patterns. At the level of single flowers, their expression domain in petals shows a spatial shift from the dorsal pattern known so far in species with bilaterally symmetrical flowers, suggesting that this change in expression may have evolved after the origin of Asteraceae. Functional analysis indicates that GhCYC2, GhCYC3 and GhCYC4 mediate positional information at the proximal-distal axis of the inflorescence, leading to differentiation of ray flowers, but that they also regulate ray flower petal growth by affecting cell proliferation until the final size and shape of the petals is reached. Moreover, our data show functional diversification for the GhCYC5 gene. Ectopic activation of GhCYC5 increases flower density in the inflorescence, suggesting that GhCYC5 may promote the flower initiation rate during expansion of the capitulum. Our data thus indicate that modification of the ancestral network of TCP factors has, through gene duplications, led to the establishment of new expression domains and to functional diversification. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  6. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.

    LENUS (Irish Health Repository)

    Vacic, Vladimir

    2011-03-24

    Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.

  8. Mirror-image duplication of the primary axis and heart in Xenopus embryos by the overexpression of Msx-1 gene.

    Science.gov (United States)

    Chen, Y; Solursh, M

    1995-10-01

    The Msx-1 gene (formerly known as Hox-7) is a member of a discrete subclass of homeobox-containing genes. Examination of the expression pattern of Msx-1 in murine and avian embryos suggests that this gene may be involved in the regionalization of the medio-lateral axis during earlier development. We have examined the possible functions of Xenopus Msx-1 during early Xenopus embryonic development by overexpression of the Msx-1 gene. Overexpression of Msx-1 causes a left-right mirror-image duplication of primary axial structures, including notochord, neural tube, somites, suckers, and foregut. The embryonic developing heart is also mirror-image duplicated, including looping directions and polarity. These results indicate that Msx-1 may be involved in the mesoderm formation as well as left-right patterning in the early Xenopus embryonic development.

  9. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans.

    Science.gov (United States)

    Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard

    2017-03-06

    Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

  10. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  11. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

    Science.gov (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

    2016-12-13

    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

    2009-01-01

    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  13. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

    Science.gov (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

    2016-01-01

    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  14. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  15. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

    Science.gov (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

    2015-07-01

    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  16. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template.

    Science.gov (United States)

    Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya

    2014-01-01

    Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  17. Evolutionary history of glucose-6-phosphatase encoding genes in vertebrate lineages: towards a better understanding of the functions of multiple duplicates.

    Science.gov (United States)

    Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien

    2017-05-02

    Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.

  18. FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset.

    Science.gov (United States)

    Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman

    2016-07-02

    Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

  19. Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

    Science.gov (United States)

    Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

    2018-01-01

    Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

  20. The chimeric gene CHRFAM7A, a partial duplication of the CHRNA7 gene, is a dominant negative regulator of α7*nAChR function.

    Science.gov (United States)

    Araud, Tanguy; Graw, Sharon; Berger, Ralph; Lee, Michael; Neveu, Estele; Bertrand, Daniel; Leonard, Sherry

    2011-10-15

    The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is a candidate gene for schizophrenia and an important drug target for cognitive deficits in the disorder. Activation of the α7*nAChR, results in opening of the channel and entry of mono- and divalent cations, including Ca(2+), that presynaptically participates to neurotransmitter release and postsynaptically to down-stream changes in gene expression. Schizophrenic patients have low levels of α7*nAChR, as measured by binding of the ligand [(125)I]-α-bungarotoxin (I-BTX). The structure of the gene, CHRNA7, is complex. During evolution, CHRNA7 was partially duplicated as a chimeric gene (CHRFAM7A), which is expressed in the human brain and elsewhere in the body. The association between a 2bp deletion in CHRFAM7A and schizophrenia suggested that this duplicate gene might contribute to cognitive impairment. To examine the putative contribution of CHRFAM7A on receptor function, co-expression of α7 and the duplicate genes was carried out in cell lines and Xenopus oocytes. Expression of the duplicate alone yielded protein expression but no functional receptor and co-expression with α7 caused a significant reduction of the amplitude of the ACh-evoked currents. Reduced current amplitude was not correlated with a reduction of I-BTX binding, suggesting the presence of non-functional (ACh-silent) receptors. This hypothesis is supported by a larger increase of the ACh-evoked current by the allosteric modulator 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596) in cells expressing the duplicate than in the control. These results suggest that CHRFAM7A acts as a dominant negative modulator of CHRNA7 function and is critical for receptor regulation in humans. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Positive selection and ancient duplications in the evolution of class B floral homeotic genes of orchids and grasses

    Directory of Open Access Journals (Sweden)

    Koch Marcus A

    2009-04-01

    Full Text Available Abstract Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection

  2. Rapid genome reshaping by multiple-gene loss after whole-genome duplication in teleost fish suggested by mathematical modeling

    Science.gov (United States)

    Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi

    2015-01-01

    Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810

  3. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni

    2013-12-01

    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  4. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Science.gov (United States)

    2012-01-01

    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  5. Duplication of the IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence.

    Directory of Open Access Journals (Sweden)

    Jianfeng Zhou

    growth and development primarily by binding to and inhibiting IGF actions in vivo. The duplicated IGFBP-2 genes may provide additional flexibility in the regulation of IGF activities.

  6. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  7. Differential gene expression during Trypanosoma cruzi metacyclogenesis

    Directory of Open Access Journals (Sweden)

    Marco Aurelio Krieger

    1999-09-01

    Full Text Available The transformation of epimastigotes into metacyclic trypomastigotes involves changes in the pattern of expressed genes, resulting in important morphological and functional differences between these developmental forms of Trypanosoma cruzi. In order to identify and characterize genes involved in triggering the metacyclogenesis process and in conferring to metacyclic trypomastigotes their stage specific biological properties, we have developed a method allowing the isolation of genes specifically expressed when comparing two close related cell populations (representation of differential expression or RDE. The method is based on the PCR amplification of gene sequences selected by hybridizing and subtracting the populations in such a way that after some cycles of hybridization-amplification genes specific to a given population are highly enriched. The use of this method in the analysis of differential gene expression during T. cruzi metacyclogenesis (6 hr and 24 hr of differentiation and metacyclic trypomastigotes resulted in the isolation of several clones from each time point. Northern blot analysis showed that some genes are transiently expressed (6 hr and 24 hr differentiating cells, while others are present in differentiating cells and in metacyclic trypomastigotes. Nucleotide sequencing of six clones characterized so far showed that they do not display any homology to gene sequences available in the GeneBank.

  8. Gene duplications and losses among vertebrate deoxyribonucleoside kinases of the non-TK1 Family

    DEFF Research Database (Denmark)

    Mutahir, Zeeshan; Christiansen, Louise Slot; Clausen, Anders R.

    2016-01-01

    , among vertebrates only four mammalian dNKs have been studied for their substrate specificity and kinetic properties. However, some vertebrates, such as fish, frogs, and birds, apparently possess a duplicated homolog of deoxycytidine kinase (dCK). In this study, we characterized a family of d...... substrate specificities and subcellular localization are likely the drivers behind the evolution of vertebrate dNKs...

  9. Divergence of the bZIP Gene Family in Strawberry, Peach, and Apple Suggests Multiple Modes of Gene Evolution after Duplication

    Directory of Open Access Journals (Sweden)

    Xiao-Long Wang

    2015-01-01

    Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.

  10. An ancient duplication of exon 5 in the Snap25 gene is required for complex neuronal development/function.

    Directory of Open Access Journals (Sweden)

    Jenny U Johansson

    2008-11-01

    Full Text Available Alternative splicing is an evolutionary innovation to create functionally diverse proteins from a limited number of genes. SNAP-25 plays a central role in neuroexocytosis by bridging synaptic vesicles to the plasma membrane during regulated exocytosis. The SNAP-25 polypeptide is encoded by a single copy gene, but in higher vertebrates a duplication of exon 5 has resulted in two mutually exclusive splice variants, SNAP-25a and SNAP-25b. To address a potential physiological difference between the two SNAP-25 proteins, we generated gene targeted SNAP-25b deficient mouse mutants by replacing the SNAP-25b specific exon with a second SNAP-25a equivalent. Elimination of SNAP-25b expression resulted in developmental defects, spontaneous seizures, and impaired short-term synaptic plasticity. In adult mutants, morphological changes in hippocampus and drastically altered neuropeptide expression were accompanied by severe impairment of spatial learning. We conclude that the ancient exon duplication in the Snap25 gene provides additional SNAP-25-function required for complex neuronal processes in higher eukaryotes.

  11. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  12. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

    Science.gov (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

    2010-12-01

    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  13. Dissecting a Hidden Gene Duplication: The Arabidopsis thaliana SEC10 Locus

    Czech Academy of Sciences Publication Activity Database

    Vukašinović, Nemanja; Cvrčková, F.; Eliáš, M.; Cole, R.; Fowler, J.E.; Žárský, Viktor; Synek, Lukáš

    2014-01-01

    Roč. 9, č. 4 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR GPP501/11/P853; GA ČR(CZ) GAP305/11/1629 Grant - others:GA MŠk ME10033 Institutional support: RVO:61389030 Keywords : WHOLE-GENOME * ARABIDOPSIS-THALIANA * RECENT SEGMENTAL DUPLICATIONS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2014

  14. Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

    Directory of Open Access Journals (Sweden)

    Per Erixon

    Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

  15. RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.

    Science.gov (United States)

    Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya

    2018-04-24

    RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.

  16. Selection shaped the evolution of mouse androgen-binding protein (ABP) function and promoted the duplication of Abp genes.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2014-08-01

    In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.

  17. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria

    2012-10-01

    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  18. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  19. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Science.gov (United States)

    Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva

    2013-01-01

    Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  20. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  1. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

    Science.gov (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

    2016-12-12

    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  2. Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles.

    Science.gov (United States)

    Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai

    2018-04-01

    Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. A case report of two male siblings with autism and duplication of Xq13-q21, a region including three genes predisposing for autism.

    Science.gov (United States)

    Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher

    2014-05-01

    Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.

  4. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  5. Tandem duplication of 11p12-p13 in a child with borderline development delay and eye abnormalities: dose effect of the PAX6 gene product?

    NARCIS (Netherlands)

    Aalfs, C. M.; Fantes, J. A.; Wenniger-Prick, L. J.; Sluijter, S.; Hennekam, R. C.; van Heyningen, V.; Hoovers, J. M.

    1997-01-01

    We report on a girl with a duplication of chromosome band 11p12-->13, which includes the Wilms tumor gene (WT1) and the aniridia gene (PAX6). The girl had borderline developmental delay, mild facial anomalies, and eye abnormalities. Eye findings were also present in most of the 11 other published

  6. Effect of method of deduplication on estimation of differential gene expression using RNA-seq

    Directory of Open Access Journals (Sweden)

    Anna V. Klepikova

    2017-03-01

    Full Text Available Background RNA-seq is a useful tool for analysis of gene expression. However, its robustness is greatly affected by a number of artifacts. One of them is the presence of duplicated reads. Results To infer the influence of different methods of removal of duplicated reads on estimation of gene expression in cancer genomics, we analyzed paired samples of hepatocellular carcinoma (HCC and non-tumor liver tissue. Four protocols of data analysis were applied to each sample: processing without deduplication, deduplication using a method implemented in SAMtools, and deduplication based on one or two molecular indices (MI. We also analyzed the influence of sequencing layout (single read or paired end and read length. We found that deduplication without MI greatly affects estimated expression values; this effect is the most pronounced for highly expressed genes. Conclusion The use of unique molecular identifiers greatly improves accuracy of RNA-seq analysis, especially for highly expressed genes. We developed a set of scripts that enable handling of MI and their incorporation into RNA-seq analysis pipelines. Deduplication without MI affects results of differential gene expression analysis, producing a high proportion of false negative results. The absence of duplicate read removal is biased towards false positives. In those cases where using MI is not possible, we recommend using paired-end sequencing layout.

  7. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes.

    Science.gov (United States)

    Biedler, James K; Tu, Zhijian

    2010-07-08

    codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.

  8. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes

    Directory of Open Access Journals (Sweden)

    Tu Zhijian

    2010-07-01

    1 kb fragment upstream of the AaKLC2.1 start codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Conclusions Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.

  9. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen

    2006-01-01

    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  10. Sox genes in grass carp (Ctenopharyngodon idella) with their implications for genome duplication and evolution

    OpenAIRE

    Zhong , Lei; Yu , Xiaomu; Tong , Jingou

    2006-01-01

    Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...

  11. Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes.

    Science.gov (United States)

    Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R

    2007-01-01

    The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat

  12. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Origin, evolution, and population genetics of the selfish Segregation Distorter gene duplication in European and African populations of Drosophila melanogaster.

    Science.gov (United States)

    Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C

    2015-05-01

    Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  14. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Science.gov (United States)

    Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine

    2014-01-01

    Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  15. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Directory of Open Access Journals (Sweden)

    Florian Jabbour

    Full Text Available Floral bilateral symmetry (zygomorphy has evolved several times independently in angiosperms from radially symmetrical (actinomorphic ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  16. Rooting phylogenies using gene duplications: an empirical example from the bees (Apoidea).

    Science.gov (United States)

    Brady, Seán G; Litman, Jessica R; Danforth, Bryan N

    2011-09-01

    The placement of the root node in a phylogeny is fundamental to characterizing evolutionary relationships. The root node of bee phylogeny remains unclear despite considerable previous attention. In order to test alternative hypotheses for the location of the root node in bees, we used the F1 and F2 paralogs of elongation factor 1-alpha (EF-1α) to compare the tree topologies that result when using outgroup versus paralogous rooting. Fifty-two taxa representing each of the seven bee families were sequenced for both copies of EF-1α. Two datasets were analyzed. In the first (the "concatenated" dataset), the F1 and F2 copies for each species were concatenated and the tree was rooted using appropriate outgroups (sphecid and crabronid wasps). In the second dataset (the "duplicated" dataset), the F1 and F2 copies were aligned to each another and each copy for all taxa were treated as separate terminals. In this dataset, the root was placed between the F1 and F2 copies (e.g., paralog rooting). Bayesian analyses demonstrate that the outgroup rooting approach outperforms paralog rooting, recovering deeper clades and showing stronger support for groups well established by both morphological and other molecular data. Sequence characteristics of the two copies were compared at the amino acid level, but little evidence was found to suggest that one copy is more functionally conserved. Although neither approach yields an unambiguous root to the tree, both approaches strongly indicate that the root of bee phylogeny does not fall near Colletidae, as has been previously proposed. We discuss paralog rooting as a general strategy and why this approach performs relatively poorly with our particular dataset. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. TRPV5 and TRPV6 in transcellular Ca(2+) transport: regulation, gene duplication, and polymorphisms in African populations.

    Science.gov (United States)

    Peng, Ji-Bin

    2011-01-01

    TRPV5 and TRPV6 are unique members of the TRP super family. They are highly selective for Ca(2+) ions with multiple layers of Ca(2+)-dependent inactivation mechanisms, expressed at the apical membrane of Ca(2+) transporting epithelia, and robustly responsive to 1,25-dihydroxivitamin D(3). These features are well suited for their roles as Ca(2+) entry channels in the first step of transcellular Ca(2+) transport pathways, which are involved in intestinal absorption, renal reabsorption of Ca(2+), placental transfer of Ca(2+) to fetus, and many other processes. While TRPV6 is more broadly expressed in a variety of tissues such as esophagus, stomach, small intestine, colon, kidney, placenta, pancreas, prostate, uterus, salivary gland, and sweat gland, TRPV5 expression is relatively restricted to the distal convoluted tubule and connecting tubule of the kidney. There is only one TRPV6-like gene in fish and birds in comparison to both TRPV5 and TRPV6 genes in mammals, indicating TRPV5 gene was likely generated from duplication of TRPV6 gene during the evolution of mammals to meet the needs of complex renal function. TRPV5 and TRPV6 are subjected to vigorous regulations under physiological, pathological, and therapeutic conditions. The elevated TRPV6 level in malignant tumors such as prostate and breast cancers makes it a potential therapeutic target. TRPV6, and to a lesser extent TRPV5, exhibit unusually high levels of single nucleotide polymorphisms (SNPs) in African populations as compared to other populations, indicating TRPV6 gene was under selective pressure during or after humans migrated out of Africa. The SNPs of TRPV6 and TRPV5 likely contribute to the Ca(2+) conservation mechanisms in African populations.

  18. Anterior colorectal duplication presenting as rectal prolapse.

    Science.gov (United States)

    Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo

    2007-09-01

    Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.

  19. Duplicate editorial on duplicate publication.

    Science.gov (United States)

    Corson, Stephen L; Decherney, Alan H

    2005-04-01

    The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.

  20. Duplication of Dio3 genes in teleost fish and their divergent expression in skin during flatfish metamorphosis.

    Science.gov (United States)

    Alves, R N; Cardoso, J C R; Harboe, T; Martins, R S T; Manchado, M; Norberg, B; Power, D M

    2017-05-15

    Deiodinase 3 (Dio3) plays an essential role during early development in vertebrates by controlling tissue thyroid hormone (TH) availability. The Atlantic halibut (Hippoglossus hippoglossus) possesses duplicate dio3 genes (dio3a and dio3b). Expression analysis indicates that dio3b levels change in abocular skin during metamorphosis and this suggests that this enzyme is associated with the divergent development of larval skin to the juvenile phenotype. In larvae exposed to MMI, a chemical that inhibits TH production, expression of dio3b in ocular skin is significantly up-regulated suggesting that THs normally modulate this genes expression during this developmental event. The molecular basis for divergent dio3a and dio3b expression and responsiveness to MMI treatment is explained by the multiple conserved TREs in the proximal promoter region of teleost dio3b and their absence from the promoter of dio3a. We propose that the divergent expression of dio3 in ocular and abocular skin during halibut metamorphosis contributes to the asymmetric pigment development in response to THs. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Gene fusions with lacZ by duplication insertion in the radioresistant bacterium Deinococcus radiodurans

    International Nuclear Information System (INIS)

    Lennon, E.; Minton, K.W.

    1990-01-01

    Deinococcus radiodurans is the most-studied species of a eubacterial family characterized by extreme resistance to DNA damage. We have focused on developing molecular biological techniques to investigate the genetics of this organism. We report construction of lacZ gene fusions by a method involving both in vitro splicing and the natural transformation of D. radiodurans. Numerous fusion strains were identified by expression of beta-galactosidase. Among these fusion strains, several were inducible by exposure to the DNA-damaging agent mitomycin C, and four of the inducible fusion constructs were cloned in Escherichia coli. Hybridization studies indicate that one of the damage-inducible genes contains a sequence reiterated throughout the D. radiodurans chromosome. Survival measurements show that two of the fusion strains have increased sensitivity to mitomycin C, suggesting that the fusions within these strains inactivate repair functions

  2. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

    OpenAIRE

    Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.; Aleoshin, Vladimir V.

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the earl...

  3. Rectal duplication.

    Directory of Open Access Journals (Sweden)

    Kulkarni B

    1995-04-01

    Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.

  4. Identification of Ohnolog Genes Originating from Whole Genome Duplication in Early Vertebrates, Based on Synteny Comparison across Multiple Genomes.

    Science.gov (United States)

    Singh, Param Priya; Arora, Jatin; Isambert, Hervé

    2015-07-01

    Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at http://ohnologs.curie.fr/. In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.

  5. A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

    Directory of Open Access Journals (Sweden)

    V.L. Quadros

    2006-07-01

    Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

  6. Cloning and characterization of two duplicated interleukin-17A/F2 genes in common carp (Cyprinus carpio L.): Transcripts expression and bioactivity of recombinant IL-17A/F2.

    Science.gov (United States)

    Li, Hongxia; Yu, Juhua; Li, Jianlin; Tang, Yongkai; Yu, Fan; Zhou, Jie; Yu, Wenjuan

    2016-04-01

    Interleukin-17 (IL-17) plays an important role in inflammation and host defense in mammals. In this study, we identified two duplicated IL-17A/F2 genes in the common carp (Cyprinus carpio) (ccIL-17A/F2a and ccIL-17A/F2b), putative encoded proteins contain 140 amino acids (aa) with conserved IL-17 family motifs. Expression analysis revealed high constitutive expression of ccIL-17A/F2s in mucosal tissues, including gill, skin and intestine, their expression could be induced by Aeromonas hydrophila, suggesting a potential role in mucosal immunity. Recombinant ccIL-17A/F2a protein (rccIL-17A/F2a) produced in Escherichia coli could induce the expression of proinflammatory cytokines (IL-1β) and the antimicrobial peptides S100A1, S100A10a and S100A10b in the primary kidney in a dose- and time-dependent manner. Above findings suggest that ccIL-17A/F2 plays an important role in both proinflammatory and innate immunity. Two duplicated ccIL-17A/F2s showed different expression level with ccIL-17A/F2a higher than b, comparison of two 5' regulatory regions indicated the length from anticipated promoter to transcriptional start site (TSS) and putative transcription factor binding site (TFBS) were different. Promoter activity of ccIL-17A/F2a was 2.5 times of ccIL-17A/F2b which consistent with expression results of two genes. These suggest mutations in 5'regulatory region contributed to the differentiation of duplicated genes. To our knowledge, this is the first report to analyze 5'regulatory region of piscine IL-17 family genes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. A false single nucleotide polymorphism generated by gene duplication compromises meat traceability.

    Science.gov (United States)

    Sanz, Arianne; Ordovás, Laura; Zaragoza, Pilar; Sanz, Albina; de Blas, Ignacio; Rodellar, Clementina

    2012-07-01

    Controlling meat traceability using SNPs is an effective method of ensuring food safety. We have analyzed several SNPs to create a panel for bovine genetic identification and traceability studies. One of these was the transversion g.329C>T (Genbank accession no. AJ496781) on the cytochrome P450 17A1 gene, which has been included in previously published panels. Using minisequencing reactions, we have tested 701 samples belonging to eight Spanish cattle breeds. Surprisingly, an excess of heterozygotes was detected, implying an extreme departure from Hardy-Weinberg equilibrium (PT SNP is a false positive polymorphism, which allows us to explain the inflated heterozygotic value. We recommend that this ambiguous SNP, as well as other polymorphisms located in this region, should not be used in identification, traceability or disease association studies. Annotation of these false SNPs should improve association studies and avoid misinterpretations. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay

    2015-01-01

    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  9. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    Science.gov (United States)

    2013-01-01

    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  10. Genetic variability of human respiratory syncytial virus A strains circulating in Ontario: a novel genotype with a 72 nucleotide G gene duplication.

    Directory of Open Access Journals (Sweden)

    Alireza Eshaghi

    Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.

  11. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  12. Gene expression analysis of embryonic stem cells expressing VE-cadherin (CD144 during endothelial differentiation

    Directory of Open Access Journals (Sweden)

    Libermann Towia

    2008-05-01

    Full Text Available Abstract Background Endothelial differentiation occurs during normal vascular development in the developing embryo. This process is recapitulated in the adult when endothelial progenitor cells are generated in the bone marrow and can contribute to vascular repair or angiogenesis at sites of vascular injury or ischemia. The molecular mechanisms of endothelial differentiation remain incompletely understood. Novel approaches are needed to identify the factors that regulate endothelial differentiation. Methods Mouse embryonic stem (ES cells were used to further define the molecular mechanisms of endothelial differentiation. By flow cytometry a population of VEGF-R2 positive cells was identified as early as 2.5 days after differentiation of ES cells, and a subset of VEGF-R2+ cells, that were CD41 positive at 3.5 days. A separate population of VEGF-R2+ stem cells expressing the endothelial-specific marker CD144 (VE-cadherin was also identified at this same time point. Channels lined by VE-cadherin positive cells developed within the embryoid bodies (EBs formed by differentiating ES cells. VE-cadherin and CD41 expressing cells differentiate in close proximity to each other within the EBs, supporting the concept of a common origin for cells of hematopoietic and endothelial lineages. Results Microarray analysis of >45,000 transcripts was performed on RNA obtained from cells expressing VEGF-R2+, CD41+, and CD144+ and VEGF-R2-, CD41-, and CD144-. All microarray experiments were performed in duplicate using RNA obtained from independent experiments, for each subset of cells. Expression profiling confirmed the role of several genes involved in hematopoiesis, and identified several putative genes involved in endothelial differentiation. Conclusion The isolation of CD144+ cells during ES cell differentiation from embryoid bodies provides an excellent model system and method for identifying genes that are expressed during endothelial differentiation and that

  13. Comparative genomic analysis reveals occurrence of genetic recombination in virulent Cryptosporidium hominis subtypes and telomeric gene duplications in Cryptosporidium parvum.

    Science.gov (United States)

    Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua

    2015-04-18

    Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to

  14. Differential roles of TGIF family genes in mammalian reproduction

    Directory of Open Access Journals (Sweden)

    Renfree Marilyn B

    2011-09-01

    Full Text Available Abstract Background TG-interacting factors (TGIFs belong to a family of TALE-homeodomain proteins including TGIF1, TGIF2 and TGIFLX/Y in human. Both TGIF1 and TGIF2 act as transcription factors repressing TGF-β signalling. Human TGIFLX and its orthologue, Tex1 in the mouse, are X-linked genes that are only expressed in the adult testis. TGIF2 arose from TGIF1 by duplication, whereas TGIFLX arose by retrotransposition to the X-chromosome. These genes have not been characterised in any non-eutherian mammals. We therefore studied the TGIF family in the tammar wallaby (a marsupial mammal to investigate their roles in reproduction and how and when these genes may have evolved their functions and chromosomal locations. Results Both TGIF1 and TGIF2 were present in the tammar genome on autosomes but TGIFLX was absent. Tammar TGIF1 shared a similar expression pattern during embryogenesis, sexual differentiation and in adult tissues to that of TGIF1 in eutherian mammals, suggesting it has been functionally conserved. Tammar TGIF2 was ubiquitously expressed throughout early development as in the human and mouse, but in the adult, it was expressed only in the gonads and spleen, more like the expression pattern of human TGIFLX and mouse Tex1. Tammar TGIF2 mRNA was specifically detected in round and elongated spermatids. There was no mRNA detected in mature spermatozoa. TGIF2 protein was specifically located in the cytoplasm of spermatids, and in the residual body and the mid-piece of the mature sperm tail. These data suggest that tammar TGIF2 may participate in spermiogenesis, like TGIFLX does in eutherians. TGIF2 was detected for the first time in the ovary with mRNA produced in the granulosa and theca cells, suggesting it may also play a role in folliculogenesis. Conclusions The restricted and very similar expression of tammar TGIF2 to X-linked paralogues in eutherians suggests that the evolution of TGIF1, TGIF2 and TGIFLX in eutherians was accompanied by

  15. Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C

    2016-02-01

    Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.

  16. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  17. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    International Nuclear Information System (INIS)

    Pejcha, Robert; Ludwig, Martha L.

    2005-01-01

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  18. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  19. Genome-wide identification of differentially expressed genes under water deficit stress in upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Park, Wonkeun; Scheffler, Brian E; Bauer, Philip J; Campbell, B Todd

    2012-06-15

    Cotton is the world's primary fiber crop and is a major agricultural commodity in over 30 countries. Like many other global commodities, sustainable cotton production is challenged by restricted natural resources. In response to the anticipated increase of agricultural water demand, a major research direction involves developing crops that use less water or that use water more efficiently. In this study, our objective was to identify differentially expressed genes in response to water deficit stress in cotton. A global expression analysis using cDNA-Amplified Fragment Length Polymorphism was conducted to compare root and leaf gene expression profiles from a putative drought resistant cotton cultivar grown under water deficit stressed and well watered field conditions. We identified a total of 519 differentially expressed transcript derived fragments. Of these, 147 transcript derived fragment sequences were functionally annotated according to their gene ontology. Nearly 70 percent of transcript derived fragments belonged to four major categories: 1) unclassified, 2) stress/defense, 3) metabolism, and 4) gene regulation. We found heat shock protein-related and reactive oxygen species-related transcript derived fragments to be among the major parts of functional pathways induced by water deficit stress. Also, twelve novel transcripts were identified as both water deficit responsive and cotton specific. A subset of differentially expressed transcript derived fragments was verified using reverse transcription-polymerase chain reaction. Differential expression analysis also identified five pairs of duplicated transcript derived fragments in which four pairs responded differentially between each of their two homologues under water deficit stress. In this study, we detected differentially expressed transcript derived fragments from water deficit stressed root and leaf tissues in tetraploid cotton and provided their gene ontology, functional/biological distribution, and

  20. Insertional translocation leading to a 4q13 duplication including the EPHA5 gene in two siblings with attention-deficit hyperactivity disorder.

    Science.gov (United States)

    Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M

    2013-08-01

    An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.

  1. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  2. Assessment and Reconstruction of Novel HSP90 Genes: Duplications, Gains and Losses in Fungal and Animal Lineages

    Czech Academy of Sciences Publication Activity Database

    Pantzartzi, Chrysoula; Drosopoulou, E.; Scouras, Z.

    2013-01-01

    Roč. 8, č. 9 (2013), s. 1-11 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : Hsp90s * Fungi * duplication events Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  3. Delineation of a new chromosome 20q11.2 duplication syndrome including the ASXL1 gene

    DEFF Research Database (Denmark)

    Avila, Magali; Kirchhoff, Eva Maria; Marle, Nathalie

    2013-01-01

    We report on three males with de novo overlapping 7.5, 9.8, and 10 Mb duplication of chromosome 20q11.2. Together with another patient previously published in the literature with overlapping 20q11 microduplication, we show that such patients display common clinical features including metopic ridg...

  4. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

    Science.gov (United States)

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

    2010-10-15

    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  5. Different level of population differentiation among human genes

    Directory of Open Access Journals (Sweden)

    Zhang Ya-Ping

    2011-01-01

    Full Text Available Abstract Background During the colonization of the world, after dispersal out of African, modern humans encountered changeable environments and substantial phenotypic variations that involve diverse behaviors, lifestyles and cultures, were generated among the different modern human populations. Results Here, we study the level of population differentiation among different populations of human genes. Intriguingly, genes involved in osteoblast development were identified as being enriched with higher FST SNPs, a result consistent with the proposed role of the skeletal system in accounting for variation among human populations. Genes involved in the development of hair follicles, where hair is produced, were also found to have higher levels of population differentiation, consistent with hair morphology being a distinctive trait among human populations. Other genes that showed higher levels of population differentiation include those involved in pigmentation, spermatid, nervous system and organ development, and some metabolic pathways, but few involved with the immune system. Disease-related genes demonstrate excessive SNPs with lower levels of population differentiation, probably due to purifying selection. Surprisingly, we find that Mendelian-disease genes appear to have a significant excessive of SNPs with high levels of population differentiation, possibly because the incidence and susceptibility of these diseases show differences among populations. As expected, microRNA regulated genes show lower levels of population differentiation due to purifying selection. Conclusion Our analysis demonstrates different level of population differentiation among human populations for different gene groups.

  6. Different level of population differentiation among human genes.

    Science.gov (United States)

    Wu, Dong-Dong; Zhang, Ya-Ping

    2011-01-14

    During the colonization of the world, after dispersal out of African, modern humans encountered changeable environments and substantial phenotypic variations that involve diverse behaviors, lifestyles and cultures, were generated among the different modern human populations. Here, we study the level of population differentiation among different populations of human genes. Intriguingly, genes involved in osteoblast development were identified as being enriched with higher FST SNPs, a result consistent with the proposed role of the skeletal system in accounting for variation among human populations. Genes involved in the development of hair follicles, where hair is produced, were also found to have higher levels of population differentiation, consistent with hair morphology being a distinctive trait among human populations. Other genes that showed higher levels of population differentiation include those involved in pigmentation, spermatid, nervous system and organ development, and some metabolic pathways, but few involved with the immune system. Disease-related genes demonstrate excessive SNPs with lower levels of population differentiation, probably due to purifying selection. Surprisingly, we find that Mendelian-disease genes appear to have a significant excessive of SNPs with high levels of population differentiation, possibly because the incidence and susceptibility of these diseases show differences among populations. As expected, microRNA regulated genes show lower levels of population differentiation due to purifying selection. Our analysis demonstrates different level of population differentiation among human populations for different gene groups.

  7. Differentially expressed genes in the midgut of Silkworm infected ...

    African Journals Online (AJOL)

    In this report, we employed suppression subtractive hybridization to compare differentially expressed genes in the midguts of CPV-infected and normal silkworm larvae. 36 genes and 20 novel ESTs were obtained from 2 reciprocal subtractive libraries. Three up-regulated genes (ferritin, rpL11 and alkaline nuclease) and 3 ...

  8. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

    1990-08-28

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  9. Differential evolution of members of the rhomboid gene family with conservative and divergent patterns.

    Science.gov (United States)

    Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong

    2015-04-01

    Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  10. Long SAGE analysis of genes differentially expressed in the midgut ...

    African Journals Online (AJOL)

    Long SAGE analysis of genes differentially expressed in the midgut and silk gland between the sexes of the silkwormBombyx mori. Liping Gan, Ying Wang, Jian Xi, Yanshan Niu, Hongyou Qin, Yanghu Sima, Shiqing Xu ...

  11. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  12. Expression profiles for six zebrafish genes during gonadal sex differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Morthorst, Jane Ebsen; Andersen, Ole

    2008-01-01

    BACKGROUND: The mechanism of sex determination in zebrafish is largely unknown and neither sex chromosomes nor a sex-determining gene have been identified. This indicates that sex determination in zebrafish is mediated by genetic signals from autosomal genes. The aim of this study was to determine...... the precise timing of expression of six genes previously suggested to be associated with sex differentiation in zebrafish. The current study investigates the expression of all six genes in the same individual fish with extensive sampling dates during sex determination and -differentiation. RESULTS......: In the present study, we have used quantitative real-time PCR to investigate the expression of ar, sox9a, dmrt1, fig alpha, cyp19a1a and cyp19a1b during the expected sex determination and gonadal sex differentiation period. The expression of the genes expected to be high in males (ar, sox9a and dmrt1a) and high...

  13. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  14. Identification of genes showing differential expression profile ...

    Indian Academy of Sciences (India)

    3Department of Natural Sciences, International Christian University, Mitaka, Tokyo 181-8585, Japan ... the changes of expression predicted from gene function suggested association ... ate School of Science and Technology, Niigata University.

  15. Differentially expressed genes in iron-induced prion protein conversion

    International Nuclear Information System (INIS)

    Kim, Minsun; Kim, Eun-hee; Choi, Bo-Ran; Woo, Hee-Jong

    2016-01-01

    The conversion of the cellular prion protein (PrP C ) to the protease-resistant isoform is the key event in chronic neurodegenerative diseases, including transmissible spongiform encephalopathies (TSEs). Increased iron in prion-related disease has been observed due to the prion protein-ferritin complex. Additionally, the accumulation and conversion of recombinant PrP (rPrP) is specifically derived from Fe(III) but not Fe(II). Fe(III)-mediated PK-resistant PrP (PrP res ) conversion occurs within a complex cellular environment rather than via direct contact between rPrP and Fe(III). In this study, differentially expressed genes correlated with prion degeneration by Fe(III) were identified using Affymetrix microarrays. Following Fe(III) treatment, 97 genes were differentially expressed, including 85 upregulated genes and 12 downregulated genes (≥1.5-fold change in expression). However, Fe(II) treatment produced moderate alterations in gene expression without inducing dramatic alterations in gene expression profiles. Moreover, functional grouping of identified genes indicated that the differentially regulated genes were highly associated with cell growth, cell maintenance, and intra- and extracellular transport. These findings showed that Fe(III) may influence the expression of genes involved in PrP folding by redox mechanisms. The identification of genes with altered expression patterns in neural cells may provide insights into PrP conversion mechanisms during the development and progression of prion-related diseases. - Highlights: • Differential genes correlated with prion degeneration by Fe(III) were identified. • Genes were identified in cell proliferation and intra- and extracellular transport. • In PrP degeneration, redox related genes were suggested. • Cbr2, Rsad2, Slc40a1, Amph and Mvd were expressed significantly.

  16. ANALYSES ON DIFFERENTIALLY EXPRESSED GENES ASSOCIATED WITH HUMAN BREAST CANCER

    Institute of Scientific and Technical Information of China (English)

    MENG Xu-li; DING Xiao-wen; XU Xiao-hong

    2006-01-01

    Objective: To investigate the molecular etiology of breast cancer by way of studying the differential expression and initial function of the related genes in the occurrence and development of breast cancer. Methods: Two hundred and eighty-eight human tumor related genes were chosen for preparation of the oligochips probe. mRNA was extracted from 16 breast cancer tissues and the corresponding normal breast tissues, and cDNA probe was prepared through reverse-transcription and hybridized with the gene chip. A laser focused fluorescent scanner was used to scan the chip. The different gene expressions were thereafter automatically compared and analyzed between the two sample groups. Cy3/Cy5>3.5 meant significant up-regulation. Cy3/Cy5<0.25 meant significant down-regulation. Results: The comparison between the breast cancer tissues and their corresponding normal tissues showed that 84 genes had differential expression in the Chip. Among the differently expressed genes, there were 4 genes with significant down-regulation and 6 with significant up-regulation. Compared with normal breast tissues, differentially expressed genes did partially exist in the breast cancer tissues. Conclusion: Changes in multi-gene expression regulations take place during the occurrence and development of breast cancer; and the research on related genes can help understanding the mechanism of tumor occurrence.

  17. Identification of salt-stress induced differentially expressed genes in ...

    African Journals Online (AJOL)

    Identification of salt-stress induced differentially expressed genes in barley leaves using the annealingcontrol- primer-based GeneFishing technique. S Lee, K Lee, K Kim, GJ Choi, SH Yoon, HC Ji, S Seo, YC Lim, N Ahsan ...

  18. Differential expressions of putative genes in various floral organs of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-03

    Jun 3, 2009 ... Full Length Research Paper. Differential expressions of putative genes in various floral organs of the Pigeon orchid (Dendrobium crumenatum) using GeneFishing. Faridah, Q. Z.1, 2, Ng, B. Z.3, Raha, A. R.4, Umi, K. A. B.5 and Khosravi, A. R.2*. 1Department of Biology, Faculty Science, University Putra ...

  19. The evolution and appearance of C3 duplications in fish originate an exclusive teleost c3 gene form with anti-inflammatory activity.

    Directory of Open Access Journals (Sweden)

    Gabriel Forn-Cuní

    Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.

  20. Evolutionary history and functional divergence of the cytochrome P450 gene superfamily between Arabidopsis thaliana and Brassica species uncover effects of whole genome and tandem duplications.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Wang, Linhai; Dossa, Komivi; Zhang, Xiurong; Ke, Tao; Liao, Boshou

    2017-09-18

    The cytochrome P450 monooxygenase (P450) superfamily is involved in the biosynthesis of various primary and secondary metabolites. However, little is known about the effects of whole genome duplication (WGD) and tandem duplication (TD) events on the evolutionary history and functional divergence of P450s in Brassica after splitting from a common ancestor with Arabidopsis thaliana. Using Hidden Markov Model search and manual curation, we detected that Brassica species have nearly 1.4-fold as many P450 members as A. thaliana. Most P450s in A. thaliana and Brassica species were located on pseudo-chromosomes. The inferred phylogeny indicated that all P450s were clustered into two different subgroups. Analysis of WGD event revealed that different P450 gene families had appeared after evolutionary events of species. For the TD event analyses, the P450s from TD events in Brassica species can be divided into ancient and recent parts. Our comparison of influence of WGD and TD events on the P450 gene superfamily between A. thaliana and Brassica species indicated that the family-specific evolution in the Brassica lineage can be attributed to both WGD and TD, whereas WGD was recognized as the major mechanism for the recent evolution of the P450 super gene family. Expression analysis of P450s from A. thaliana and Brassica species indicated that WGD-type P450s showed the same expression pattern but completely different expression with TD-type P450s across different tissues in Brassica species. Selection force analysis suggested that P450 orthologous gene pairs between A. thaliana and Brassica species underwent negative selection, but no significant differences were found between P450 orthologous gene pairs in A. thaliana-B. rapa and A. thaliana-B. oleracea lineages, as well as in different subgenomes in B. rapa or B. oleracea compared with A. thaliana. This study is the first to investigate the effects of WGD and TD on the evolutionary history and functional divergence of P450

  1. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  2. Gene function in early mouse embryonic stem cell differentiation

    Directory of Open Access Journals (Sweden)

    Campbell Pearl A

    2007-03-01

    Full Text Available Abstract Background Little is known about the genes that drive embryonic stem cell differentiation. However, such knowledge is necessary if we are to exploit the therapeutic potential of stem cells. To uncover the genetic determinants of mouse embryonic stem cell (mESC differentiation, we have generated and analyzed 11-point time-series of DNA microarray data for three biologically equivalent but genetically distinct mESC lines (R1, J1, and V6.5 undergoing undirected differentiation into embryoid bodies (EBs over a period of two weeks. Results We identified the initial 12 hour period as reflecting the early stages of mESC differentiation and studied probe sets showing consistent changes of gene expression in that period. Gene function analysis indicated significant up-regulation of genes related to regulation of transcription and mRNA splicing, and down-regulation of genes related to intracellular signaling. Phylogenetic analysis indicated that the genes showing the largest expression changes were more likely to have originated in metazoans. The probe sets with the most consistent gene changes in the three cell lines represented 24 down-regulated and 12 up-regulated genes, all with closely related human homologues. Whereas some of these genes are known to be involved in embryonic developmental processes (e.g. Klf4, Otx2, Smn1, Socs3, Tagln, Tdgf1, our analysis points to others (such as transcription factor Phf21a, extracellular matrix related Lama1 and Cyr61, or endoplasmic reticulum related Sc4mol and Scd2 that have not been previously related to mESC function. The majority of identified functions were related to transcriptional regulation, intracellular signaling, and cytoskeleton. Genes involved in other cellular functions important in ESC differentiation such as chromatin remodeling and transmembrane receptors were not observed in this set. Conclusion Our analysis profiles for the first time gene expression at a very early stage of m

  3. Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

    International Nuclear Information System (INIS)

    Popp, R.A.; Marsh, C.L.; Skow, L.C.

    1981-01-01

    Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

  4. Life-threatening Arrhythmias in a Becker Muscular Dystrophy Family due to the Duplication of Exons 3-4 of the Dystrophin Gene.

    Science.gov (United States)

    Ishizaki, Masatoshi; Fujimoto, Akiko; Ueyama, Hidetsugu; Nishida, Yasuto; Imamura, Shigehiro; Uchino, Makoto; Ando, Yukio

    2015-01-01

    We herein present a report of three patients with Becker muscular dystrophy in the same family who developed complete atrioventricular block or ventricular tachycardia with severe cardiomyopathy. Our cases became unable to walk in their teens, and were introduced to mechanical ventilation due to respiratory muscle weakness in their twenties and thirties. In all three cases, a medical device such as a permanent cardiac pacemaker or an implantable cardiac defibrillator was considered to be necessary. The duplication of exons 3-4 in the dystrophin gene was detected in two of the patients. In patients with Becker muscular dystrophy, complete atrioventricular block or ventricular tachycardia within a family has rarely been reported. Thus attention should be paid to the possibility of severe arrhythmias in the severe phenotype of Becker muscular dystrophy.

  5. Differential expression of cell adhesion genes

    DEFF Research Database (Denmark)

    Stein, Wilfred D; Litman, Thomas; Fojo, Tito

    2005-01-01

    that compare cells grown in suspension to similar cells grown attached to one another as aggregates have suggested that it is adhesion to the extracellular matrix of the basal membrane that confers resistance to apoptosis and, hence, resistance to cytotoxins. The genes whose expression correlates with poor...... in cell adhesion and the cytoskeleton. If the proteins involved in tethering cells to the extracellular matrix are important in conferring drug resistance, it may be possible to improve chemotherapy by designing drugs that target these proteins....

  6. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang

    2011-08-01

    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  7. AffyMiner: mining differentially expressed genes and biological knowledge in GeneChip microarray data

    Directory of Open Access Journals (Sweden)

    Xia Yuannan

    2006-12-01

    Full Text Available Abstract Background DNA microarrays are a powerful tool for monitoring the expression of tens of thousands of genes simultaneously. With the advance of microarray technology, the challenge issue becomes how to analyze a large amount of microarray data and make biological sense of them. Affymetrix GeneChips are widely used microarrays, where a variety of statistical algorithms have been explored and used for detecting significant genes in the experiment. These methods rely solely on the quantitative data, i.e., signal intensity; however, qualitative data are also important parameters in detecting differentially expressed genes. Results AffyMiner is a tool developed for detecting differentially expressed genes in Affymetrix GeneChip microarray data and for associating gene annotation and gene ontology information with the genes detected. AffyMiner consists of the functional modules, GeneFinder for detecting significant genes in a treatment versus control experiment and GOTree for mapping genes of interest onto the Gene Ontology (GO space; and interfaces to run Cluster, a program for clustering analysis, and GenMAPP, a program for pathway analysis. AffyMiner has been used for analyzing the GeneChip data and the results were presented in several publications. Conclusion AffyMiner fills an important gap in finding differentially expressed genes in Affymetrix GeneChip microarray data. AffyMiner effectively deals with multiple replicates in the experiment and takes into account both quantitative and qualitative data in identifying significant genes. AffyMiner reduces the time and effort needed to compare data from multiple arrays and to interpret the possible biological implications associated with significant changes in a gene's expression.

  8. Identification of differentially expressed genes in childhood asthma.

    Science.gov (United States)

    Zhang, Nian-Zhen; Chen, Xiu-Juan; Mu, Yu-Hua; Wang, Hewen

    2018-05-01

    Asthma has been the most common chronic disease in children that places a major burden for affected people and their families.An integrated analysis of microarrays studies was performed to identify differentially expressed genes (DEGs) in childhood asthma compared with normal control. We also obtained the differentially methylated genes (DMGs) in childhood asthma according to GEO. The genes that were both differentially expressed and differentially methylated were identified. Functional annotation and protein-protein interaction network construction were performed to interpret biological functions of DEGs. We performed q-RT-PCR to verify the expression of selected DEGs.One DNA methylation and 3 gene expression datasets were obtained. Four hundred forty-one DEGs and 1209 DMGs in childhood asthma were identified. Among which, 16 genes were both differentially expressed and differentially methylated in childhood asthma. Natural killer cell mediated cytotoxicity pathway, Jak-STAT signaling pathway, and Wnt signaling pathway were 3 significantly enriched pathways in childhood asthma according to our KEGG enrichment analysis. The PPI network of top 20 up- and downregulated DEGs consisted of 822 nodes and 904 edges and 2 hub proteins (UBQLN4 and MID2) were identified. The expression of 8 DEGs (GZMB, FGFBP2, CLC, TBX21, ALOX15, IL12RB2, UBQLN4) was verified by qRT-PCR and only the expression of GZMB and FGFBP2 was inconsistent with our integrated analysis.Our finding was helpful to elucidate the underlying mechanism of childhood asthma and develop new potential diagnostic biomarker and provide clues for drug design.

  9. Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

    NARCIS (Netherlands)

    A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)

    1996-01-01

    textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

  10. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  11. Thirty-seven transcription factor genes differentially respond to a ...

    Indian Academy of Sciences (India)

    Plant transcription factors and insect defence si. Thirty-seven transcription factor genes differentially respond to a harpin protein and affect resistance to the green peach aphid in Arabidopsis. HUNLIN. PIN. RUOXUE LIŲ, BEIBEI LÜ, XIAOMENG WANG, CHUNLING ZHANG, SHUPING ZHANG, JUN QIAN, LEI CHEN,.

  12. Differential expression of ozone-induced gene during exposures to ...

    African Journals Online (AJOL)

    Differential expression of ozone-induced gene during exposures to salt stress in Polygonum sibiricum Laxm leaves, stem and underground stem. ... PcOZI-1 mRNA in untreated plants was detected at low levels in underground stem, leaves and at higher levels in stem. PcOZI-1 mRNA accumulation was transiently induced ...

  13. Differential Gene Expression of Fibroblasts: Keloid versus Normal

    Directory of Open Access Journals (Sweden)

    Michael F. Angel

    2002-11-01

    Full Text Available Abstract: This study investigated gene regulation and unique gene products in both keloid (KDF and normal (NDF dermal fibroblasts in established cell lines. For gene regulation, NDF versus KDF were compared using Clontech's Atlas™ Human cDNA Expression Array while unique gene products were studied using RNA Fingerprinting Kit. RNA from each sample was converted to cDNA using oligo-dT primers. Down-regulated genes using Atlas Array in KDF were 1 60 S ribosomal protein, 2 Thioredoxin dependent peroxidase, 3 Nuclease sensitive element DNA binding protein, 4 c-myc purine-binding transcription factor, 5 c-AMP dependent protein kinase, and, 6 Heat Shock Protein 90 kDa. Genes that are up regulated in KDF were 1 Tubulin and 2 Heat Shock Protein 27 kDa. With the differential display, we found 17 bands unique to both KDF and NDF. The specific gene and the manner in which they were differentially regulated have direct implications to understanding keloid fibroblast proliferation.

  14. Gene profile analysis of osteoblast genes differentially regulated by histone deacetylase inhibitors

    Directory of Open Access Journals (Sweden)

    Lamblin Anne-Francoise

    2007-10-01

    Full Text Available Abstract Background Osteoblast differentiation requires the coordinated stepwise expression of multiple genes. Histone deacetylase inhibitors (HDIs accelerate the osteoblast differentiation process by blocking the activity of histone deacetylases (HDACs, which alter gene expression by modifying chromatin structure. We previously demonstrated that HDIs and HDAC3 shRNAs accelerate matrix mineralization and the expression of osteoblast maturation genes (e.g. alkaline phosphatase, osteocalcin. Identifying other genes that are differentially regulated by HDIs might identify new pathways that contribute to osteoblast differentiation. Results To identify other osteoblast genes that are altered early by HDIs, we incubated MC3T3-E1 preosteoblasts with HDIs (trichostatin A, MS-275, or valproic acid for 18 hours in osteogenic conditions. The promotion of osteoblast differentiation by HDIs in this experiment was confirmed by osteogenic assays. Gene expression profiles relative to vehicle-treated cells were assessed by microarray analysis with Affymetrix GeneChip 430 2.0 arrays. The regulation of several genes by HDIs in MC3T3-E1 cells and primary osteoblasts was verified by quantitative real-time PCR. Nine genes were differentially regulated by at least two-fold after exposure to each of the three HDIs and six were verified by PCR in osteoblasts. Four of the verified genes (solute carrier family 9 isoform 3 regulator 1 (Slc9a3r1, sorbitol dehydrogenase 1, a kinase anchor protein, and glutathione S-transferase alpha 4 were induced. Two genes (proteasome subunit, beta type 10 and adaptor-related protein complex AP-4 sigma 1 were suppressed. We also identified eight growth factors and growth factor receptor genes that are significantly altered by each of the HDIs, including Frizzled related proteins 1 and 4, which modulate the Wnt signaling pathway. Conclusion This study identifies osteoblast genes that are regulated early by HDIs and indicates pathways that

  15. [Analysis of tissue-specific differentially methylated genes with differential gene expression in non-small cell lung cancer].

    Science.gov (United States)

    Yin, L G; Zou, Z Q; Zhao, H Y; Zhang, C L; Shen, J G; Qi, L; Qi, M; Xue, Z Q

    2014-01-01

    Adenocarcinoma (ADC) and squamous cell carcinomas (SCC) are two subtypes of non-small cell lung carcinomas which are regarded as the leading cause of cancer-related malignancy worldwide. The aim of this study is to detect the differentially methylated loci (DMLs) and differentially methylated genes (DMGs) of these two tumor sets, and then to illustrate the different expression level of specific methylated genes. Using TCGA database and Illumina HumanMethylation 27 arrays, we first screened the DMGs and DMLs in tumor samples. Then, we explored the BiologicalProcess terms of hypermethylated and hypomethylated genes using Functional Gene Ontology (GO) catalogues. Hypermethylation intensively occurred in CpG-island, whereas hypomethylation was located in non-CpG-island. Most SCC and ADC hypermethylated genes involved GO function of DNA dependenit regulation of transcription, and hypomethylated genes mainly 'enriched in the term of immune responses. Additionally, the expression level of specific differentially methylated genesis distinctbetween ADC and SCC. It is concluded that ADC and SCC have different methylated status that might play an important role in carcinogenesis.

  16. Disease association with two Helicobacter pylori duplicate outer membrane protein genes, homB and homA.

    Science.gov (United States)

    Oleastro, Monica; Cordeiro, Rita; Yamaoka, Yoshio; Queiroz, Dulciene; Mégraud, Francis; Monteiro, Lurdes; Ménard, Armelle

    2009-06-22

    homB encodes a Helicobacter pylori outer membrane protein. This gene was previously associated with peptic ulcer disease (PUD) and was shown to induce activation of interleukin-8 secretion in vitro, as well as contributing to bacterial adherence. Its 90%-similar gene, homA, was previously correlated with gastritis. The present study aimed to evaluate the gastric disease association with homB and homA, as well as with the H. pylori virulence factors cagA, babA and vacA, in 415 H. pylori strains isolated from patients from East Asian and Western countries. The correlation among these genotypes was also evaluated. Both homB and homA genes were heterogeneously distributed worldwide, with a marked difference between East Asian and Western strains. In Western strains (n = 234, 124 PUD and 110 non-ulcer dyspepsia (NUD), homB, cagA and vacA s1 were all significantly associated with PUD (p = 0.025, p = 0.014, p = 0.039, respectively), and homA was closely correlated with NUD (p = 0.072). In East Asian strains (n = 138, 73 PUD and 65 NUD), homB was found more frequently than homA, and none of these genes was associated with the clinical outcome. Overall, homB was associated with the presence of cagA (p = 0.043) and vacA s1 (p homA was found more frequently in cagA-negative (p = 0.062) and vacA s2 (p homA copy number were observed, with a clear geographical specificity, suggesting an involvement of these genes in host adaptation. A correlation between the homB two-copy genotype and PUD was also observed, emphasizing the role of homB in the virulence of the strain. The global results suggest that homB and homA contribute to the determination of clinical outcome.

  17. Duodenal duplication cyst extending into the posterior mediastinum

    Directory of Open Access Journals (Sweden)

    Tuzun Sefa

    2015-01-01

    Conclusion: Duodenal and the other intestinal duplication cysts should be considered in the differential diagnosis of oral contrast enhanced intrathoracic lesions in thorocoabdominal computerised tomography imaging.

  18. Startling mosaicism of the Y-chromosome and tandem duplication of the SRY and DAZ genes in patients with Turner Syndrome.

    Directory of Open Access Journals (Sweden)

    Sanjay Premi

    Full Text Available Presence of the human Y-chromosome in females with Turner Syndrome (TS enhances the risk of development of gonadoblastoma besides causing several other phenotypic abnormalities. In the present study, we have analyzed the Y chromosome in 15 clinically diagnosed Turner Syndrome (TS patients and detected high level of mosaicisms ranging from 45,XO:46,XY = 100:0% in 4; 45,XO:46,XY:46XX = 4:94:2 in 8; and 45,XO:46,XY:46XX = 50:30:20 cells in 3 TS patients, unlike previous reports showing 5-8% cells with Y- material. Also, no ring, marker or di-centric Y was observed in any of the cases. Of the two TS patients having intact Y chromosome in >85% cells, one was exceptionally tall. Both the patients were positive for SRY, DAZ, CDY1, DBY, UTY and AZFa, b and c specific STSs. Real Time PCR and FISH demonstrated tandem duplication/multiplication of the SRY and DAZ genes. At sequence level, the SRY was normal in 8 TS patients while the remaining 7 showed either absence of this gene or known and novel mutations within and outside of the HMG box. SNV/SFV analysis showed normal four copies of the DAZ genes in these 8 patients. All the TS patients showed aplastic uterus with no ovaries and no symptom of gonadoblastoma. Present study demonstrates new types of polymorphisms indicating that no two TS patients have identical genotype-phenotype. Thus, a comprehensive analysis of more number of samples is warranted to uncover consensus on the loci affected, to be able to use them as potential diagnostic markers.

  19. Duplicated Gephyrin Genes Showing Distinct Tissue Distribution and Alternative Splicing Patterns Mediate Molybdenum Cofactor Biosynthesis, Glycine Receptor Clustering, and Escape Behavior in Zebrafish*

    Science.gov (United States)

    Ogino, Kazutoyo; Ramsden, Sarah L.; Keib, Natalie; Schwarz, Günter; Harvey, Robert J.; Hirata, Hiromi

    2011-01-01

    Gephyrin mediates the postsynaptic clustering of glycine receptors (GlyRs) and GABAA receptors at inhibitory synapses and molybdenum-dependent enzyme (molybdoenzyme) activity in non-neuronal tissues. Gephyrin knock-out mice show a phenotype resembling both defective glycinergic transmission and molybdenum cofactor (Moco) deficiency and die within 1 day of birth due to starvation and dyspnea resulting from deficits in motor and respiratory networks, respectively. To address whether gephyrin function is conserved among vertebrates and whether gephyrin deficiency affects molybdoenzyme activity and motor development, we cloned and characterized zebrafish gephyrin genes. We report here that zebrafish have two gephyrin genes, gphna and gphnb. The former is expressed in all tissues and has both C3 and C4 cassette exons, and the latter is expressed predominantly in the brain and spinal cord and harbors only C4 cassette exons. We confirmed that all of the gphna and gphnb splicing isoforms have Moco synthetic activity. Antisense morpholino knockdown of either gphna or gphnb alone did not disturb synaptic clusters of GlyRs in the spinal cord and did not affect touch-evoked escape behaviors. However, on knockdown of both gphna and gphnb, embryos showed impairments in GlyR clustering in the spinal cord and, as a consequence, demonstrated touch-evoked startle response behavior by contracting antagonistic muscles simultaneously, instead of displaying early coiling and late swimming behaviors, which are executed by side-to-side muscle contractions. These data indicate that duplicated gephyrin genes mediate Moco biosynthesis and control postsynaptic clustering of GlyRs, thereby mediating key escape behaviors in zebrafish. PMID:20843816

  20. Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

    Directory of Open Access Journals (Sweden)

    Yue-zhong Li

    2017-04-01

    Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

  1. Differential endometrial gene expression in pregnant and nonpregnant sows

    DEFF Research Database (Denmark)

    Østrup, Esben; Bauersachs, Stefan; Blum, Helmut

    2010-01-01

    obtained from the endometrium of pregnant sows and sows inseminated with inactivated semen. Analysis of the microarray data revealed 263 genes to be significantly differentially expressed between the pregnant and nonpregnant sows. Most gene ontology terms significantly enriched at pregnancy had allocated...... more up-regulated genes than down-regulated genes. These terms included developmental process, transporter activity, calcium ion binding, apoptosis, cell motility, enzyme-linked receptor protein signaling pathway, positive regulation of cell proliferation, ion homeostasis, and hormone activity. Only...... in the process of placentation. Pregnancy-specific localization of IL11RA to the surface epithelium of the endometrium suggests a role of interleukin 11 signaling in formation of the porcine epitheliochorial placenta. Furthermore, up-regulation of FGF9 mRNA in pregnant endometrium and localization of FGF9...

  2. Ancestral genomic duplication of the insulin gene in tilapia: An analysis of possible implications for clinical islet xenotransplantation using donor islets from transgenic tilapia expressing a humanized insulin gene.

    Science.gov (United States)

    Hrytsenko, Olga; Pohajdak, Bill; Wright, James R

    2016-07-03

    Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.

  3. Parental Origin of Interstitial Duplications at 15q11.2-q13.3 in Schizophrenia and Neurodevelopmental Disorders

    Science.gov (United States)

    Isles, Anthony R.; Ingason, Andrés; Lowther, Chelsea; Gawlick, Micha; Stöber, Gerald; Potter, Harry; Georgieva, Lyudmila; Pizzo, Lucilla; Ozaki, Norio; Kushima, Itaru; Ikeda, Masashi; Iwata, Nakao; Levinson, Douglas F.; Gejman, Pablo V.; Shi, Jianxin; Sanders, Alan R.; Duan, Jubao; Sisodiya, Sanjay; Costain, Gregory; Degenhardt, Franziska; Giegling, Ina; Rujescu, Dan; Hreidarsson, Stefan J.; Saemundsen, Evald; Ahn, Joo Wook; Ogilvie, Caroline; Stefansson, Hreinn; Stefansson, Kari; O’Donovan, Michael C.; Owen, Michael J.; Bassett, Anne; Kirov, George

    2016-01-01

    Duplications at 15q11.2-q13.3 overlapping the Prader-Willi/Angelman syndrome (PWS/AS) region have been associated with developmental delay (DD), autism spectrum disorder (ASD) and schizophrenia (SZ). Due to presence of imprinted genes within the region, the parental origin of these duplications may be key to the pathogenicity. Duplications of maternal origin are associated with disease, whereas the pathogenicity of paternal ones is unclear. To clarify the role of maternal and paternal duplications, we conducted the largest and most detailed study to date of parental origin of 15q11.2-q13.3 interstitial duplications in DD, ASD and SZ cohorts. We show, for the first time, that paternal duplications lead to an increased risk of developing DD/ASD/multiple congenital anomalies (MCA), but do not appear to increase risk for SZ. The importance of the epigenetic status of 15q11.2-q13.3 duplications was further underlined by analysis of a number of families, in which the duplication was paternally derived in the mother, who was unaffected, whereas her offspring, who inherited a maternally derived duplication, suffered from psychotic illness. Interestingly, the most consistent clinical characteristics of SZ patients with 15q11.2-q13.3 duplications were learning or developmental problems, found in 76% of carriers. Despite their lower pathogenicity, paternal duplications are less frequent in the general population with a general population prevalence of 0.0033% compared to 0.0069% for maternal duplications. This may be due to lower fecundity of male carriers and differential survival of embryos, something echoed in the findings that both types of duplications are de novo in just over 50% of cases. Isodicentric chromosome 15 (idic15) or interstitial triplications were not observed in SZ patients or in controls. Overall, this study refines the distinct roles of maternal and paternal interstitial duplications at 15q11.2-q13.3, underlining the critical importance of maternally

  4. Parental Origin of Interstitial Duplications at 15q11.2-q13.3 in Schizophrenia and Neurodevelopmental Disorders.

    Directory of Open Access Journals (Sweden)

    Anthony R Isles

    2016-05-01

    Full Text Available Duplications at 15q11.2-q13.3 overlapping the Prader-Willi/Angelman syndrome (PWS/AS region have been associated with developmental delay (DD, autism spectrum disorder (ASD and schizophrenia (SZ. Due to presence of imprinted genes within the region, the parental origin of these duplications may be key to the pathogenicity. Duplications of maternal origin are associated with disease, whereas the pathogenicity of paternal ones is unclear. To clarify the role of maternal and paternal duplications, we conducted the largest and most detailed study to date of parental origin of 15q11.2-q13.3 interstitial duplications in DD, ASD and SZ cohorts. We show, for the first time, that paternal duplications lead to an increased risk of developing DD/ASD/multiple congenital anomalies (MCA, but do not appear to increase risk for SZ. The importance of the epigenetic status of 15q11.2-q13.3 duplications was further underlined by analysis of a number of families, in which the duplication was paternally derived in the mother, who was unaffected, whereas her offspring, who inherited a maternally derived duplication, suffered from psychotic illness. Interestingly, the most consistent clinical characteristics of SZ patients with 15q11.2-q13.3 duplications were learning or developmental problems, found in 76% of carriers. Despite their lower pathogenicity, paternal duplications are less frequent in the general population with a general population prevalence of 0.0033% compared to 0.0069% for maternal duplications. This may be due to lower fecundity of male carriers and differential survival of embryos, something echoed in the findings that both types of duplications are de novo in just over 50% of cases. Isodicentric chromosome 15 (idic15 or interstitial triplications were not observed in SZ patients or in controls. Overall, this study refines the distinct roles of maternal and paternal interstitial duplications at 15q11.2-q13.3, underlining the critical importance of

  5. Differential Retention of Gene Functions in a Secondary Metabolite Cluster.

    Science.gov (United States)

    Reynolds, Hannah T; Slot, Jason C; Divon, Hege H; Lysøe, Erik; Proctor, Robert H; Brown, Daren W

    2017-08-01

    In fungi, distribution of secondary metabolite (SM) gene clusters is often associated with host- or environment-specific benefits provided by SMs. In the plant pathogen Alternaria brassicicola (Dothideomycetes), the DEP cluster confers an ability to synthesize the SM depudecin, a histone deacetylase inhibitor that contributes weakly to virulence. The DEP cluster includes genes encoding enzymes, a transporter, and a transcription regulator. We investigated the distribution and evolution of the DEP cluster in 585 fungal genomes and found a wide but sporadic distribution among Dothideomycetes, Sordariomycetes, and Eurotiomycetes. We confirmed DEP gene expression and depudecin production in one fungus, Fusarium langsethiae. Phylogenetic analyses suggested 6-10 horizontal gene transfers (HGTs) of the cluster, including a transfer that led to the presence of closely related cluster homologs in Alternaria and Fusarium. The analyses also indicated that HGTs were frequently followed by loss/pseudogenization of one or more DEP genes. Independent cluster inactivation was inferred in at least four fungal classes. Analyses of transitions among functional, pseudogenized, and absent states of DEP genes among Fusarium species suggest enzyme-encoding genes are lost at higher rates than the transporter (DEP3) and regulatory (DEP6) genes. The phenotype of an experimentally-induced DEP3 mutant of Fusarium did not support the hypothesis that selective retention of DEP3 and DEP6 protects fungi from exogenous depudecin. Together, the results suggest that HGT and gene loss have contributed significantly to DEP cluster distribution, and that some DEP genes provide a greater fitness benefit possibly due to a differential tendency to form network connections. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution 2017. This work is written by US Government employees and is in the public domain in the US.

  6. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    Science.gov (United States)

    2016-08-01

    levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential

  7. Patterns of population differentiation of candidate genes for cardiovascular disease

    Directory of Open Access Journals (Sweden)

    Ding Keyue

    2007-07-01

    Full Text Available Abstract Background The basis for ethnic differences in cardiovascular disease (CVD susceptibility is not fully understood. We investigated patterns of population differentiation (FST of a set of genes in etiologic pathways of CVD among 3 ethnic groups: Yoruba in Nigeria (YRI, Utah residents with European ancestry (CEU, and Han Chinese (CHB + Japanese (JPT. We identified 37 pathways implicated in CVD based on the PANTHER classification and 416 genes in these pathways were further studied; these genes belonged to 6 biological processes (apoptosis, blood circulation and gas exchange, blood clotting, homeostasis, immune response, and lipoprotein metabolism. Genotype data were obtained from the HapMap database. Results We calculated FST for 15,559 common SNPs (minor allele frequency ≥ 0.10 in at least one population in genes that co-segregated among the populations, as well as an average-weighted FST for each gene. SNPs were classified as putatively functional (non-synonymous and untranslated regions or non-functional (intronic and synonymous sites. Mean FST values for common putatively functional variants were significantly higher than FST values for nonfunctional variants. A significant variation in FST was also seen based on biological processes; the processes of 'apoptosis' and 'lipoprotein metabolism' showed an excess of genes with high FST. Thus, putative functional SNPs in genes in etiologic pathways for CVD show greater population differentiation than non-functional SNPs and a significant variance of FST values was noted among pairwise population comparisons for different biological processes. Conclusion These results suggest a possible basis for varying susceptibility to CVD among ethnic groups.

  8. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    Science.gov (United States)

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-05-01

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  9. Identification of genes differentially expressed during ripening of banana.

    Science.gov (United States)

    Manrique-Trujillo, Sandra Mabel; Ramírez-López, Ana Cecilia; Ibarra-Laclette, Enrique; Gómez-Lim, Miguel Angel

    2007-08-01

    The banana (Musa acuminata, subgroup Cavendish 'Grand Nain') is a climacteric fruit of economic importance. A better understanding of the banana ripening process is needed to improve fruit quality and to extend shelf life. Eighty-four up-regulated unigenes were identified by differential screening of a banana fruit cDNA subtraction library at a late ripening stage. The ripening stages in this study were defined according to the peel color index (PCI). Unigene sequences were analyzed with different databases to assign a putative identification. The expression patterns of 36 transcripts confirmed as positive by differential screening were analyzed comparing the PCI 1, PCI 5 and PCI 7 ripening stages. Expression profiles were obtained for unigenes annotated as orcinol O-methyltransferase, putative alcohol dehydrogenase, ubiquitin-protein ligase, chorismate mutase and two unigenes with non-significant matches with any reported sequence. Similar expression profiles were observed in banana pulp and peel. Our results show differential expression of a group of genes involved in processes associated with fruit ripening, such as stress, detoxification, cytoskeleton and biosynthesis of volatile compounds. Some of the identified genes had not been characterized in banana fruit. Besides providing an overview of gene expression programs and metabolic pathways at late stages of banana fruit ripening, this study contributes to increasing the information available on banana fruit ESTs.

  10. Duplication and concerted evolution of MiSp-encoding genes underlie the material properties of minor ampullate silks of cobweb weaving spiders.

    Science.gov (United States)

    Vienneau-Hathaway, Jannelle M; Brassfield, Elizabeth R; Lane, Amanda Kelly; Collin, Matthew A; Correa-Garhwal, Sandra M; Clarke, Thomas H; Schwager, Evelyn E; Garb, Jessica E; Hayashi, Cheryl Y; Ayoub, Nadia A

    2017-03-14

    Orb-web weaving spiders and their relatives use multiple types of task-specific silks. The majority of spider silk studies have focused on the ultra-tough dragline silk synthesized in major ampullate glands, but other silk types have impressive material properties. For instance, minor ampullate silks of orb-web weaving spiders are as tough as draglines, due to their higher extensibility despite lower strength. Differences in material properties between silk types result from differences in their component proteins, particularly members of the spidroin (spider fibroin) gene family. However, the extent to which variation in material properties within a single silk type can be explained by variation in spidroin sequences is unknown. Here, we compare the minor ampullate spidroins (MiSp) of orb-weavers and cobweb weavers. Orb-web weavers use minor ampullate silk to form the auxiliary spiral of the orb-web while cobweb weavers use it to wrap prey, suggesting that selection pressures on minor ampullate spidroins (MiSp) may differ between the two groups. We report complete or nearly complete MiSp sequences from five cobweb weaving spider species and measure material properties of minor ampullate silks in a subset of these species. We also compare MiSp sequences and silk properties of our cobweb weavers to published data for orb-web weavers. We demonstrate that all our cobweb weavers possess multiple MiSp loci and that one locus is more highly expressed in at least two species. We also find that the proportion of β-spiral-forming amino acid motifs in MiSp positively correlates with minor ampullate silk extensibility across orb-web and cobweb weavers. MiSp sequences vary dramatically within and among spider species, and have likely been subject to multiple rounds of gene duplication and concerted evolution, which have contributed to the diverse material properties of minor ampullate silks. Our sequences also provide templates for recombinant silk proteins with tailored

  11. Molecular cytogenetic differentiation of paralogs of Hox paralogs in duplicated and re-diploidized genome of the North American paddlefish (Polyodon spathula)

    Czech Academy of Sciences Publication Activity Database

    Symonová, Radka; Havelka, M.; Amemiya, C. T.; Howell, M. W.; Kořínková, Tereza; Flajšhans, M.; Gela, D.; Ráb, Petr

    2017-01-01

    Roč. 18, č. 1 (2017), č. článku 19. ISSN 1471-2156 R&D Projects: GA ČR GA14-02940S; GA MŠk EF15_003/0000460 Institutional support: RVO:67985904 Keywords : hoxA/D paralogs mapping * sturgeon whole genome duplication * ancient fish genome * rediploidization Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 2.266, year: 2016

  12. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia) gene family: tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes.

    Science.gov (United States)

    Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael

    2008-09-23

    initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD) R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  13. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia gene family: Tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes

    Directory of Open Access Journals (Sweden)

    Petit Jean-Michel

    2008-09-01

    activities, in both invertebrates and vertebrates. The initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  14. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template [v1; ref status: indexed, http://f1000r.es/48i

    Directory of Open Access Journals (Sweden)

    Hossein Gouran

    2014-09-01

    Full Text Available Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC, implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF. In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  15. Our experience with unusual gastrointestinal tract duplications in infants

    Directory of Open Access Journals (Sweden)

    Bilal Mirza

    2014-01-01

    Full Text Available Background: Classical duplications may present along any part of gastrointestinal tract (GIT from mouth to anus. Atypical or unusual rare varieties of GIT duplications may also occur, but with different anatomical features. Materials and Methods: We reviewed our 5-year record (February 2008-January 2013 to describe clinical profile of unusual GIT duplications in neonates and small infants. Results: Three patients with atypical variety of GIT duplications were managed in our department during this tenure. Two were females and one male. Age was ranged between 11 days and 2 months. All patients presented with massive abdominal distension causing respiratory embarrassment in two of them. In all patients, the pre-operative differential diagnoses also included GIT duplication cysts. Computerized tomography (CT scan showed single huge cyst in one and multiple cysts in two patients. In one patient the CT scan also depicted a thoracic cyst in relation to posterior mediastinum. At operation, one patient had colonic tubular duplication cyst along with another isolated duplication cyst, the second case had a tubular duplication cyst of ileum with its segmental dilatation, and in the third case two isolated duplications were found. Duplication cysts were excised along with mucosal stripping in one patient, cyst excision and intestinal resection and anastomosis in one patient, and only cysts excision in one. All patients did well post-operatively. Conclusion: We presented unusual GIT duplications. These duplications are managed on similar lines as classical duplications with good prognosis when dealt early.

  16. Mutations in c10orf11, a melanocyte-differentiation gene, cause autosomal-recessive albinism.

    Science.gov (United States)

    Grønskov, Karen; Dooley, Christopher M; Østergaard, Elsebet; Kelsh, Robert N; Hansen, Lars; Levesque, Mitchell P; Vilhelmsen, Kaj; Møllgård, Kjeld; Stemple, Derek L; Rosenberg, Thomas

    2013-03-07

    Autosomal-recessive albinism is a hypopigmentation disorder with a broad phenotypic range. A substantial fraction of individuals with albinism remain genetically unresolved, and it has been hypothesized that more genes are to be identified. By using homozygosity mapping of an inbred Faroese family, we identified a 3.5 Mb homozygous region (10q22.2-q22.3) on chromosome 10. The region contains five protein-coding genes, and sequencing of one of these, C10orf11, revealed a nonsense mutation that segregated with the disease and showed a recessive inheritance pattern. Investigation of additional albinism-affected individuals from the Faroe Islands revealed that five out of eight unrelated affected persons had the nonsense mutation in C10orf11. Screening of a cohort of autosomal-recessive-albinism-affected individuals residing in Denmark showed a homozygous 1 bp duplication in C10orf11 in an individual originating from Lithuania. Immunohistochemistry showed localization of C10orf11 in melanoblasts and melanocytes in human fetal tissue, but no localization was seen in retinal pigment epithelial cells. Knockdown of the zebrafish (Danio rerio) homolog with the use of morpholinos resulted in substantially decreased pigmentation and a reduction of the apparent number of pigmented melanocytes. The morphant phenotype was rescued by wild-type C10orf11, but not by mutant C10orf11. In conclusion, we have identified a melanocyte-differentiation gene, C10orf11, which when mutated causes autosomal-recessive albinism in humans. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  17. Duplication of the oesophagus

    International Nuclear Information System (INIS)

    Lingg, G.; Nebel, G.

    1981-01-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de

  18. Duplication of the oesophagus

    Energy Technology Data Exchange (ETDEWEB)

    Lingg, G; Nebel, G

    1981-08-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.

  19. Integrating mean and variance heterogeneities to identify differentially expressed genes.

    Science.gov (United States)

    Ouyang, Weiwei; An, Qiang; Zhao, Jinying; Qin, Huaizhen

    2016-12-06

    In functional genomics studies, tests on mean heterogeneity have been widely employed to identify differentially expressed genes with distinct mean expression levels under different experimental conditions. Variance heterogeneity (aka, the difference between condition-specific variances) of gene expression levels is simply neglected or calibrated for as an impediment. The mean heterogeneity in the expression level of a gene reflects one aspect of its distribution alteration; and variance heterogeneity induced by condition change may reflect another aspect. Change in condition may alter both mean and some higher-order characteristics of the distributions of expression levels of susceptible genes. In this report, we put forth a conception of mean-variance differentially expressed (MVDE) genes, whose expression means and variances are sensitive to the change in experimental condition. We mathematically proved the null independence of existent mean heterogeneity tests and variance heterogeneity tests. Based on the independence, we proposed an integrative mean-variance test (IMVT) to combine gene-wise mean heterogeneity and variance heterogeneity induced by condition change. The IMVT outperformed its competitors under comprehensive simulations of normality and Laplace settings. For moderate samples, the IMVT well controlled type I error rates, and so did existent mean heterogeneity test (i.e., the Welch t test (WT), the moderated Welch t test (MWT)) and the procedure of separate tests on mean and variance heterogeneities (SMVT), but the likelihood ratio test (LRT) severely inflated type I error rates. In presence of variance heterogeneity, the IMVT appeared noticeably more powerful than all the valid mean heterogeneity tests. Application to the gene profiles of peripheral circulating B raised solid evidence of informative variance heterogeneity. After adjusting for background data structure, the IMVT replicated previous discoveries and identified novel experiment

  20. Simple Comparative Analyses of Differentially Expressed Gene Lists May Overestimate Gene Overlap.

    Science.gov (United States)

    Lawhorn, Chelsea M; Schomaker, Rachel; Rowell, Jonathan T; Rueppell, Olav

    2018-04-16

    Comparing the overlap between sets of differentially expressed genes (DEGs) within or between transcriptome studies is regularly used to infer similarities between biological processes. Significant overlap between two sets of DEGs is usually determined by a simple test. The number of potentially overlapping genes is compared to the number of genes that actually occur in both lists, treating every gene as equal. However, gene expression is controlled by transcription factors that bind to a variable number of transcription factor binding sites, leading to variation among genes in general variability of their expression. Neglecting this variability could therefore lead to inflated estimates of significant overlap between DEG lists. With computer simulations, we demonstrate that such biases arise from variation in the control of gene expression. Significant overlap commonly arises between two lists of DEGs that are randomly generated, assuming that the control of gene expression is variable among genes but consistent between corresponding experiments. More overlap is observed when transcription factors are specific to their binding sites and when the number of genes is considerably higher than the number of different transcription factors. In contrast, overlap between two DEG lists is always lower than expected when the genetic architecture of expression is independent between the two experiments. Thus, the current methods for determining significant overlap between DEGs are potentially confounding biologically meaningful overlap with overlap that arises due to variability in control of expression among genes, and more sophisticated approaches are needed.

  1. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  2. Duplication of SOX9 associated with 46,XX ovotesticular disorder of sex development.

    Science.gov (United States)

    López-Hernández, Berenice; Méndez, Juan Pablo; Coral-Vázquez, Ramón Mauricio; Benítez-Granados, Jesús; Zenteno, Juan Carlos; Villegas-Ruiz, Vanessa; Calzada-León, Raúl; Soderlund, Daniela; Canto, Patricia

    2018-04-04

    The purpose of the present study was to investigate whether ten unrelated SRY-negative individuals with this sex differentiation disorder presented a double dose of SOX9 as the cause of their disease. Ten unrelated SRY-negative 46,XX ovotesticular disorder of sexual development (DSD) subjects were molecularly studied. Multiplex-ligation dependent probe amplification (MLPA) and quantitative real-time PCR analysis (qRT-PCR) for SOX9 were performed. The MLPA analysis demonstrated that one patient presented a heterozygous duplication of the entire SOX9 coding region (above 1.3 value of peak ratio), as well as at least a ~ 483 kb upstream duplication. Moreover, no duplication of other SOX9 probes was observed corresponding to the region between -1007 and -1500 kb upstream. A qRT-PCR analysis showed a duplication of at least -581 kb upstream and ~1.63 kb of the coding region that encompasses exon 3. The limits of the duplication were mapped approximately from ~71539762 to 72122741 of Chr17. No molecular abnormalities were found in the remaining nine patients. This study is thought to be the first report regarding a duplication of SOX9 that is associated with the presence of 46,XX ovotesticular DSD, encompassing at least -581 kb upstream, and the almost entire coding region of the gene. Copyright © 2018 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  3. Neofunctionalization of Duplicated Tic40 Genes Caused a Gain-of-Function Variation Related to Male Fertility in Brassica oleracea Lineages1[W][OPEN

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-01-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. PMID:25185122

  4. Neofunctionalization of duplicated Tic40 genes caused a gain-of-function variation related to male fertility in Brassica oleracea lineages.

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-11-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. © 2014 American Society of Plant Biologists. All Rights Reserved.

  5. Gene duplication and neo-functionalization in the evolutionary and functional divergence of the metazoan copper transporters Ctr1 and Ctr2.

    Science.gov (United States)

    Logeman, Brandon L; Wood, L Kent; Lee, Jaekwon; Thiele, Dennis J

    2017-07-07

    Copper is an essential element for proper organismal development and is involved in a range of processes, including oxidative phosphorylation, neuropeptide biogenesis, and connective tissue maturation. The copper transporter (Ctr) family of integral membrane proteins is ubiquitously found in eukaryotes and mediates the high-affinity transport of Cu + across both the plasma membrane and endomembranes. Although mammalian Ctr1 functions as a Cu + transporter for Cu acquisition and is essential for embryonic development, a homologous protein, Ctr2, has been proposed to function as a low-affinity Cu transporter, a lysosomal Cu exporter, or a regulator of Ctr1 activity, but its functional and evolutionary relationship to Ctr1 is unclear. Here we report a biochemical, genetic, and phylogenetic comparison of metazoan Ctr1 and Ctr2, suggesting that Ctr2 arose over 550 million years ago as a result of a gene duplication event followed by loss of Cu + transport activity. Using a random mutagenesis and growth selection approach, we identified amino acid substitutions in human and mouse Ctr2 proteins that support copper-dependent growth in yeast and enhance copper accumulation in Ctr1 -/- mouse embryonic fibroblasts. These mutations revert Ctr2 to a more ancestral Ctr1-like state while maintaining endogenous functions, such as stimulating Ctr1 cleavage. We suggest key structural aspects of metazoan Ctr1 and Ctr2 that discriminate between their biological roles, providing mechanistic insights into the evolutionary, biochemical, and functional relationships between these two related proteins. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Differentially expressed regulatory genes in honey bee caste development

    Science.gov (United States)

    Hepperle, C.; Hartfelder, K.

    2001-03-01

    In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

  7. Analyzing kernel matrices for the identification of differentially expressed genes.

    Directory of Open Access Journals (Sweden)

    Xiao-Lei Xia

    Full Text Available One of the most important applications of microarray data is the class prediction of biological samples. For this purpose, statistical tests have often been applied to identify the differentially expressed genes (DEGs, followed by the employment of the state-of-the-art learning machines including the Support Vector Machines (SVM in particular. The SVM is a typical sample-based classifier whose performance comes down to how discriminant samples are. However, DEGs identified by statistical tests are not guaranteed to result in a training dataset composed of discriminant samples. To tackle this problem, a novel gene ranking method namely the Kernel Matrix Gene Selection (KMGS is proposed. The rationale of the method, which roots in the fundamental ideas of the SVM algorithm, is described. The notion of ''the separability of a sample'' which is estimated by performing [Formula: see text]-like statistics on each column of the kernel matrix, is first introduced. The separability of a classification problem is then measured, from which the significance of a specific gene is deduced. Also described is a method of Kernel Matrix Sequential Forward Selection (KMSFS which shares the KMGS method's essential ideas but proceeds in a greedy manner. On three public microarray datasets, our proposed algorithms achieved noticeably competitive performance in terms of the B.632+ error rate.

  8. Density based pruning for identification of differentially expressed genes from microarray data

    Directory of Open Access Journals (Sweden)

    Xu Jia

    2010-11-01

    Full Text Available Abstract Motivation Identification of differentially expressed genes from microarray datasets is one of the most important analyses for microarray data mining. Popular algorithms such as statistical t-test rank genes based on a single statistics. The false positive rate of these methods can be improved by considering other features of differentially expressed genes. Results We proposed a pattern recognition strategy for identifying differentially expressed genes. Genes are mapped to a two dimension feature space composed of average difference of gene expression and average expression levels. A density based pruning algorithm (DB Pruning is developed to screen out potential differentially expressed genes usually located in the sparse boundary region. Biases of popular algorithms for identifying differentially expressed genes are visually characterized. Experiments on 17 datasets from Gene Omnibus Database (GEO with experimentally verified differentially expressed genes showed that DB pruning can significantly improve the prediction accuracy of popular identification algorithms such as t-test, rank product, and fold change. Conclusions Density based pruning of non-differentially expressed genes is an effective method for enhancing statistical testing based algorithms for identifying differentially expressed genes. It improves t-test, rank product, and fold change by 11% to 50% in the numbers of identified true differentially expressed genes. The source code of DB pruning is freely available on our website http://mleg.cse.sc.edu/degprune

  9. Differential hexosamine biosynthetic pathway gene expression with type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Megan Coomer

    2014-01-01

    Full Text Available The hexosamine biosynthetic pathway (HBP culminates in the attachment of O-linked β-N-acetylglucosamine (O-GlcNAc onto serine/threonine residues of target proteins. The HBP is regulated by several modulators, i.e. O-linked β-N-acetylglucosaminyl transferase (OGT and β-N-acetylglucosaminidase (OGA catalyze the addition and removal of O-GlcNAc moieties, respectively; while flux is controlled by the rate-limiting enzyme glutamine:fructose-6-phosphate amidotransferase (GFPT, transcribed by two genes, GFPT1 and GFPT2. Since increased HBP flux is glucose-responsive and linked to insulin resistance/type 2 diabetes onset, we hypothesized that diabetic individuals exhibit differential expression of HBP regulatory genes. Volunteers (n = 60; n = 20 Mixed Ancestry, n = 40 Caucasian were recruited from Stellenbosch and Paarl (Western Cape, South Africa and classified as control, pre- or diabetic according to fasting plasma glucose and HbA1c levels, respectively. RNA was purified from leukocytes isolated from collected blood samples and OGT, OGA, GFPT1 and GFPT2 expressions determined by quantitative real-time PCR. The data reveal lower OGA expression in diabetic individuals (P < 0.01, while pre- and diabetic subjects displayed attenuated OGT expression vs. controls (P < 0.01 and P < 0.001, respectively. Moreover, GFPT2 expression decreased in pre- and diabetic Caucasians vs. controls (P < 0.05 and P < 0.01, respectively. We also found ethnic differences, i.e. Mixed Ancestry individuals exhibited a 2.4-fold increase in GFPT2 expression vs. Caucasians, despite diagnosis (P < 0.01. Gene expression of HBP regulators differs between diabetic and non-diabetic individuals, together with distinct ethnic-specific gene profiles. Thus differential HBP gene regulation may offer diagnostic utility and provide candidate susceptibility genes for different ethnic groupings.

  10. Typewriting: Toward Duplicating Success

    Science.gov (United States)

    Orsborn, Karen J.

    1977-01-01

    A description of two projects (secretarial handbook and memo pad and personalized stationery) for use in teaching the duplication process that will capture the interests of students in an advanced typewriting class. (HD)

  11. Enteric and rectal duplications and duplication cysts in the adult.

    Science.gov (United States)

    Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin

    2005-03-01

    Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

  12. The zebrafish maternal-effect gene cellular atoll encodes the centriolar component sas-6 and defects in its paternal function promote whole genome duplication.

    Science.gov (United States)

    Yabe, Taijiro; Ge, Xiaoyan; Pelegri, Francisco

    2007-12-01

    A female-sterile zebrafish maternal-effect mutation in cellular atoll (cea) results in defects in the initiation of cell division starting at the second cell division cycle. This phenomenon is caused by defects in centrosome duplication, which in turn affect the formation of a bipolar spindle. We show that cea encodes the centriolar coiled-coil protein Sas-6, and that zebrafish Cea/Sas-6 protein localizes to centrosomes. cea also has a genetic paternal contribution, which when mutated results in an arrested first cell division followed by normal cleavage. Our data supports the idea that, in zebrafish, paternally inherited centrosomes are required for the first cell division while maternally derived factors are required for centrosomal duplication and cell divisions in subsequent cell cycles. DNA synthesis ensues in the absence of centrosome duplication, and the one-cycle delay in the first cell division caused by cea mutant sperm leads to whole genome duplication. We discuss the potential implications of these findings with regards to the origin of polyploidization in animal species. In addition, the uncoupling of developmental time and cell division count caused by the cea mutation suggests the presence of a time window, normally corresponding to the first two cell cycles, which is permissive for germ plasm recruitment.

  13. Differential expression of catalase genes in Nicotiana plumbaginifolia (L.).

    Science.gov (United States)

    Willekens, H; Langebartels, C; Tiré, C; Van Montagu, M; Inzé, D; Van Camp, W

    1994-10-25

    We have analyzed the expression of three catalase (Cat; EC 1.11.1.6) genes from Nicotiana plumbaginifolia by means of RNA blot and in situ hybridizations. Our data demonstrate that the expression of each catalase is associated with a particular H2O2-producing process. Cat1 appears to be specifically involved in the scavenging of photorespiratory H2O2 and is under control of a circadian rhythm, Cat2 is uniformly expressed in different organs with a cellular preference for vascular tissues, and the expression profile of Cat3 points to a role in glyoxysomal processes. Differential expression of these catalases is also manifested in response to temperature changes. DNA sequence comparison with other dicotyledonous catalases led to the identification of at least three distinct classes, which indicates that the functional organization of catalases is generally conserved in dicotyledonous plants.

  14. Zfp206 regulates ES cell gene expression and differentiation.

    Science.gov (United States)

    Zhang, Wen; Walker, Emily; Tamplin, Owen J; Rossant, Janet; Stanford, William L; Hughes, Timothy R

    2006-01-01

    Understanding transcriptional regulation in early developmental stages is fundamental to understanding mammalian development and embryonic stem (ES) cell properties. Expression surveys suggest that the putative SCAN-Zinc finger transcription factor Zfp206 is expressed specifically in ES cells [Zhang,W., Morris,Q.D., Chang,R., Shai,O., Bakowski,M.A., Mitsakakis,N., Mohammad,N., Robinson,M.D., Zirngibl,R., Somogyi,E. et al., (2004) J. Biol., 3, 21; Brandenberger,R., Wei,H., Zhang,S., Lei,S., Murage,J., Fisk,G.J., Li,Y., Xu,C., Fang,R., Guegler,K. et al., (2004) Nat. Biotechnol., 22, 707-716]. Here, we confirm this observation, and we show that ZFP206 expression decreases rapidly upon differentiation of cultured mouse ES cells, and during development of mouse embryos. We find that there are at least six isoforms of the ZFP206 transcript, the longest being predominant. Overexpression and depletion experiments show that Zfp206 promotes formation of undifferentiated ES cell clones, and positively regulates abundance of a very small set of transcripts whose expression is also specific to ES cells and the two- to four-cell stages of preimplantation embryos. This set includes members of the Zscan4, Thoc4, Tcstv1 and eIF-1A gene families, none of which have been functionally characterized in vivo but whose members include apparent transcription factors, RNA-binding proteins and translation factors. Together, these data indicate that Zfp206 is a regulator of ES cell differentiation that controls a set of genes expressed very early in development, most of which themselves appear to be regulators.

  15. A conserved segmental duplication within ELA.

    Science.gov (United States)

    Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C

    2010-12-01

    The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  16. Comparative transcriptomic analyses of differentially expressed genes in transgenic melatonin biosynthesis ovine HIOMT gene in switchgrass

    Directory of Open Access Journals (Sweden)

    Shan Yuan

    2016-11-01

    Full Text Available Melatonin serves pleiotropic functions in prompting plant growth and resistance to various stresses. The accurate biosynthetic pathway of melatonin remains elusive in plant species, while the N-acetyltransferase and O-methyltransferase were considered to be the last two key enzymes during its biosynthesis. To investigate the biosynthesis and metabolic pathway of melatonin in plants, the RNA-seq profile of overexpression of the ovine HIOMT was analyzed and compared with the previous transcriptome of transgenic oAANAT gene in switchgrass, a model plant for cellulosic ethanol production. A total of 946, 405 and 807 differentially expressed unigenes were observed in AANAT vs. control, HIOMT vs. control, and AANAT vs. HIOMT, respectively. The significantly upregulated (F-box/kelch-repeat protein, zinc finger BED domain-containing protein-3 genes were consistent with enhanced phenotypes of shoot, stem and root growth in transgenic oHIOMT switchgrass. Early flowering in overexpression of oHIOMT switchgrass involved in the regulation of flowering-time genes (APETALA2. Several stress resistant related genes (SPX domain-containing membrane protein, copper transporter 1, late blight resistance protein homolog R1A-6 OS etc. were specifically and significantly upregulated in transgenic oHIOMT only, while metabolism-related genes (phenylalanine-4-hydroxylase, tyrosine decarboxylase 1, protein disulfide-isomerase and galactinol synthase 2 etc. were significantly upregulated in transgenic oAANAT only. These results provide new sights into the biosynthetic and physiological functional networks of melatonin in plants.

  17. The centriole duplication cycle

    Science.gov (United States)

    Fırat-Karalar, Elif Nur; Stearns, Tim

    2014-01-01

    Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614

  18. [Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

    Science.gov (United States)

    Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

    2007-02-01

    To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

  19. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  20. Endorectal magnetic resonance imaging of a rectal duplication cyst.

    Science.gov (United States)

    Beattie, C H; Garvey, C J; Hershman, M J

    1999-09-01

    A case of a duplication cyst of the rectum is presented. This case highlights the potential role of endoluminal magnetic resonance imaging in the diagnosis of this uncommon condition. Alternative imaging modalities and differential diagnoses are discussed.

  1. Sorting by Cuts, Joins, and Whole Chromosome Duplications.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2017-02-01

    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  2. The effect of alcohol on the differential expression of cluster of differentiation 14 gene, associated pathways, and genetic network.

    Directory of Open Access Journals (Sweden)

    Diana X Zhou

    Full Text Available Alcohol consumption affects human health in part by compromising the immune system. In this study, we examined the expression of the Cd14 (cluster of differentiation 14 gene, which is involved in the immune system through a proinflammatory cascade. Expression was evaluated in BXD mice treated with saline or acute 1.8 g/kg i.p. ethanol (12.5% v/v. Hippocampal gene expression data were generated to examine differential expression and to perform systems genetics analyses. The Cd14 gene expression showed significant changes among the BXD strains after ethanol treatment, and eQTL mapping revealed that Cd14 is a cis-regulated gene. We also identified eighteen ethanol-related phenotypes correlated with Cd14 expression related to either ethanol responses or ethanol consumption. Pathway analysis was performed to identify possible biological pathways involved in the response to ethanol and Cd14. We also constructed a genetic network for Cd14 using the top 20 correlated genes and present several genes possibly involved in Cd14 and ethanol responses based on differential gene expression. In conclusion, we found Cd14, along with several other genes and pathways, to be involved in ethanol responses in the hippocampus, such as increased susceptibility to lipopolysaccharides and neuroinflammation.

  3. Craniofacial duplication (diprosopus).

    Science.gov (United States)

    Turpin, I M; Furnas, D W; Amlie, R N

    1981-02-01

    No congenital malformation in infants is more profound than anterior craniofacial duplication. The precise term for this rare anomaly is diprosopus, referring to a fetus with a single trunk, normal limbs, and varying degrees of facial duplication. A search of the world literature produced only 16 cases of diprosopus since 1864. Despite the rarity of this anomaly, three such infants were born in the Southern California area during the past year, making this the largest reported series to date. The three infants were born with two distinctly formed faces. Each had four separate eyes, two mouths, two noses, and two ears with a primitive ear or sinus tract at the plane of fusion. In addition, multiple congenital aberrations existed which involved a variety of internal organs. The pathogenesis of diprosopus is not well understood, but environmental stress early in embryologic development has been suggested as a possible factor. The apparent mechanism is a slowing of pregastrulation oxidation with resultant focal developmental arrests.

  4. Centrioles: duplicating precariously.

    Science.gov (United States)

    Pelletier, Laurence

    2007-09-04

    To assemble a mitotic spindle and accurately segregate chromosomes to progeny, a cell needs to precisely regulate its centrosome number, a feat largely accomplished through the tight control of centriole duplication. Recent work showing that the overexpression of centriolar proteins can lead to the formation of multiple centrioles in the absence of pre-existing centrioles challenges the idea that it is a self-replicating organelle.

  5. Rectal duplication: a case report.

    Science.gov (United States)

    Didden, K; Masereel, B; Geyskens, P

    2013-01-01

    Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.

  6. A Model-Based Joint Identification of Differentially Expressed Genes and Phenotype-Associated Genes.

    Directory of Open Access Journals (Sweden)

    Samuel Sunghwan Cho

    Full Text Available Over the last decade, many analytical methods and tools have been developed for microarray data. The detection of differentially expressed genes (DEGs among different treatment groups is often a primary purpose of microarray data analysis. In addition, association studies investigating the relationship between genes and a phenotype of interest such as survival time are also popular in microarray data analysis. Phenotype association analysis provides a list of phenotype-associated genes (PAGs. However, it is sometimes necessary to identify genes that are both DEGs and PAGs. We consider the joint identification of DEGs and PAGs in microarray data analyses. The first approach we used was a naïve approach that detects DEGs and PAGs separately and then identifies the genes in an intersection of the list of PAGs and DEGs. The second approach we considered was a hierarchical approach that detects DEGs first and then chooses PAGs from among the DEGs or vice versa. In this study, we propose a new model-based approach for the joint identification of DEGs and PAGs. Unlike the previous two-step approaches, the proposed method identifies genes simultaneously that are DEGs and PAGs. This method uses standard regression models but adopts different null hypothesis from ordinary regression models, which allows us to perform joint identification in one-step. The proposed model-based methods were evaluated using experimental data and simulation studies. The proposed methods were used to analyze a microarray experiment in which the main interest lies in detecting genes that are both DEGs and PAGs, where DEGs are identified between two diet groups and PAGs are associated with four phenotypes reflecting the expression of leptin, adiponectin, insulin-like growth factor 1, and insulin. Model-based approaches provided a larger number of genes, which are both DEGs and PAGs, than other methods. Simulation studies showed that they have more power than other methods

  7. A Model-Based Joint Identification of Differentially Expressed Genes and Phenotype-Associated Genes

    Science.gov (United States)

    Seo, Minseok; Shin, Su-kyung; Kwon, Eun-Young; Kim, Sung-Eun; Bae, Yun-Jung; Lee, Seungyeoun; Sung, Mi-Kyung; Choi, Myung-Sook; Park, Taesung

    2016-01-01

    Over the last decade, many analytical methods and tools have been developed for microarray data. The detection of differentially expressed genes (DEGs) among different treatment groups is often a primary purpose of microarray data analysis. In addition, association studies investigating the relationship between genes and a phenotype of interest such as survival time are also popular in microarray data analysis. Phenotype association analysis provides a list of phenotype-associated genes (PAGs). However, it is sometimes necessary to identify genes that are both DEGs and PAGs. We consider the joint identification of DEGs and PAGs in microarray data analyses. The first approach we used was a naïve approach that detects DEGs and PAGs separately and then identifies the genes in an intersection of the list of PAGs and DEGs. The second approach we considered was a hierarchical approach that detects DEGs first and then chooses PAGs from among the DEGs or vice versa. In this study, we propose a new model-based approach for the joint identification of DEGs and PAGs. Unlike the previous two-step approaches, the proposed method identifies genes simultaneously that are DEGs and PAGs. This method uses standard regression models but adopts different null hypothesis from ordinary regression models, which allows us to perform joint identification in one-step. The proposed model-based methods were evaluated using experimental data and simulation studies. The proposed methods were used to analyze a microarray experiment in which the main interest lies in detecting genes that are both DEGs and PAGs, where DEGs are identified between two diet groups and PAGs are associated with four phenotypes reflecting the expression of leptin, adiponectin, insulin-like growth factor 1, and insulin. Model-based approaches provided a larger number of genes, which are both DEGs and PAGs, than other methods. Simulation studies showed that they have more power than other methods. Through analysis of

  8. Characterization of differentially expressed genes involved in pathways associated with gastric cancer.

    Directory of Open Access Journals (Sweden)

    Hao Li

    Full Text Available To explore the patterns of gene expression in gastric cancer, a total of 26 paired gastric cancer and noncancerous tissues from patients were enrolled for gene expression microarray analyses. Limma methods were applied to analyze the data, and genes were considered to be significantly differentially expressed if the False Discovery Rate (FDR value was 2. Subsequently, Gene Ontology (GO categories were used to analyze the main functions of the differentially expressed genes. According to the Kyoto Encyclopedia of Genes and Genomes (KEGG database, we found pathways significantly associated with the differential genes. Gene-Act network and co-expression network were built respectively based on the relationships among the genes, proteins and compounds in the database. 2371 mRNAs and 350 lncRNAs considered as significantly differentially expressed genes were selected for the further analysis. The GO categories, pathway analyses and the Gene-Act network showed a consistent result that up-regulated genes were responsible for tumorigenesis, migration, angiogenesis and microenvironment formation, while down-regulated genes were involved in metabolism. These results of this study provide some novel findings on coding RNAs, lncRNAs, pathways and the co-expression network in gastric cancer which will be useful to guide further investigation and target therapy for this disease.

  9. Embryonic duplications in sheep.

    Science.gov (United States)

    Dennis, S M

    1975-02-01

    Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.

  10. Two duplicated chicken-type lysozyme genes in disc abalone Haliotis discus discus: molecular aspects in relevance to structure, genomic organization, mRNA expression and bacteriolytic function.

    Science.gov (United States)

    Umasuthan, Navaneethaiyer; Bathige, S D N K; Kasthuri, Saranya Revathy; Wan, Qiang; Whang, Ilson; Lee, Jehee

    2013-08-01

    Lysozymes are crucial antibacterial proteins that are associated with catalytic cleavage of peptidoglycan and subsequent bacteriolysis. The present study describes the identification of two lysozyme genes from disc abalone Haliotis discus discus and their characterization at sequence-, genomic-, transcriptional- and functional-levels. Two cDNAs and BAC clones bearing lysozyme genes were isolated from abalone transcriptome and BAC genomic libraries, respectively and sequences were determined. Corresponding deduced amino acid sequences harbored a chicken-type lysozyme (LysC) family profile and exhibited conserved characteristics of LysC family members including active residues (Glu and Asp) and GS(S/T)DYGIFQINS motif suggested that they are LysC counterparts in disc abalone and designated as abLysC1 and abLysC2. While abLysC1 represented the homolog recently reported in Ezo abalone [1], abLysC2 shared significant identity with LysC homologs. Unlike other vertebrate LysCs, coding sequence of abLysCs were distributed within five exons interrupted by four introns. Both abLysCs revealed a broader mRNA distribution with highest levels in mantle (abLysC1) and hepatopancreas (abLysC2) suggesting their likely main role in defense and digestion, respectively. Investigation of temporal transcriptional profiles post-LPS and -pathogen challenges revealed induced-responses of abLysCs in gills and hemocytes. The in vitro muramidase activity of purified recombinant (r) abLysCs proteins was evaluated, and findings indicated that they are active in acidic pH range (3.5-6.5) and over a broad temperature range (20-60 °C) and influenced by ionic strength. When the antibacterial spectra of (r)abLysCs were examined, they displayed differential activities against both Gram positive and Gram negative strains providing evidence for their involvement in bacteriolytic function in abalone physiology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  12. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  13. The large soybean (Glycine max) WRKY TF family expanded by segmental duplication events and subsequent divergent selection among subgroups.

    Science.gov (United States)

    Yin, Guangjun; Xu, Hongliang; Xiao, Shuyang; Qin, Yajuan; Li, Yaxuan; Yan, Yueming; Hu, Yingkao

    2013-10-03

    WRKY genes encode one of the most abundant groups of transcription factors in higher plants, and its members regulate important biological process such as growth, development, and responses to biotic and abiotic stresses. Although the soybean genome sequence has been published, functional studies on soybean genes still lag behind those of other species. We identified a total of 133 WRKY members in the soybean genome. According to structural features of their encoded proteins and to the phylogenetic tree, the soybean WRKY family could be classified into three groups (groups I, II, and III). A majority of WRKY genes (76.7%; 102 of 133) were segmentally duplicated and 13.5% (18 of 133) of the genes were tandemly duplicated. This pattern was not apparent in Arabidopsis or rice. The transcriptome atlas revealed notable differential expression in either transcript abundance or in expression patterns under normal growth conditions, which indicated wide functional divergence in this family. Furthermore, some critical amino acids were detected using DIVERGE v2.0 in specific comparisons, suggesting that these sites have contributed to functional divergence among groups or subgroups. In addition, site model and branch-site model analyses of positive Darwinian selection (PDS) showed that different selection regimes could have affected the evolution of these groups. Sites with high probabilities of having been under PDS were found in groups I, II c, II e, and III. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean. In this work, all the WRKY genes, which were generated mainly through segmental duplication, were identified in the soybean genome. Moreover, differential expression and functional divergence of the duplicated WRKY genes were two major features of this family throughout their evolutionary history. Positive selection analysis revealed that the different groups have different evolutionary rates

  14. Gene selection for the reconstruction of stem cell differentiation trees: a linear programming approach.

    Science.gov (United States)

    Ghadie, Mohamed A; Japkowicz, Nathalie; Perkins, Theodore J

    2015-08-15

    Stem cell differentiation is largely guided by master transcriptional regulators, but it also depends on the expression of other types of genes, such as cell cycle genes, signaling genes, metabolic genes, trafficking genes, etc. Traditional approaches to understanding gene expression patterns across multiple conditions, such as principal components analysis or K-means clustering, can group cell types based on gene expression, but they do so without knowledge of the differentiation hierarchy. Hierarchical clustering can organize cell types into a tree, but in general this tree is different from the differentiation hierarchy itself. Given the differentiation hierarchy and gene expression data at each node, we construct a weighted Euclidean distance metric such that the minimum spanning tree with respect to that metric is precisely the given differentiation hierarchy. We provide a set of linear constraints that are provably sufficient for the desired construction and a linear programming approach to identify sparse sets of weights, effectively identifying genes that are most relevant for discriminating different parts of the tree. We apply our method to microarray gene expression data describing 38 cell types in the hematopoiesis hierarchy, constructing a weighted Euclidean metric that uses just 175 genes. However, we find that there are many alternative sets of weights that satisfy the linear constraints. Thus, in the style of random-forest training, we also construct metrics based on random subsets of the genes and compare them to the metric of 175 genes. We then report on the selected genes and their biological functions. Our approach offers a new way to identify genes that may have important roles in stem cell differentiation. tperkins@ohri.ca Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. Differential gene expression in dentate granule cells in mesial temporal lobe epilepsy with and without hippocampal sclerosis.

    Science.gov (United States)

    Griffin, Nicole G; Wang, Yu; Hulette, Christine M; Halvorsen, Matt; Cronin, Kenneth D; Walley, Nicole M; Haglund, Michael M; Radtke, Rodney A; Skene, J H Pate; Sinha, Saurabh R; Heinzen, Erin L

    2016-03-01

    Hippocampal sclerosis is the most common neuropathologic finding in cases of medically intractable mesial temporal lobe epilepsy. In this study, we analyzed the gene expression profiles of dentate granule cells of patients with mesial temporal lobe epilepsy with and without hippocampal sclerosis to show that next-generation sequencing methods can produce interpretable genomic data from RNA collected from small homogenous cell populations, and to shed light on the transcriptional changes associated with hippocampal sclerosis. RNA was extracted, and complementary DNA (cDNA) was prepared and amplified from dentate granule cells that had been harvested by laser capture microdissection from surgically resected hippocampi from patients with mesial temporal lobe epilepsy with and without hippocampal sclerosis. Sequencing libraries were sequenced, and the resulting sequencing reads were aligned to the reference genome. Differential expression analysis was used to ascertain expression differences between patients with and without hippocampal sclerosis. Greater than 90% of the RNA-Seq reads aligned to the reference. There was high concordance between transcriptional profiles obtained for duplicate samples. Principal component analysis revealed that the presence or absence of hippocampal sclerosis was the main determinant of the variance within the data. Among the genes up-regulated in the hippocampal sclerosis samples, there was significant enrichment for genes involved in oxidative phosphorylation. By analyzing the gene expression profiles of dentate granule cells from surgically resected hippocampal specimens from patients with mesial temporal lobe epilepsy with and without hippocampal sclerosis, we have demonstrated the utility of next-generation sequencing methods for producing biologically relevant results from small populations of homogeneous cells, and have provided insight on the transcriptional changes associated with this pathology. Wiley Periodicals, Inc. © 2016

  16. Differential expression gene profiling in human lymphocyte after 6 h irradiated

    International Nuclear Information System (INIS)

    Li Jianguo; Qin Xiujun; Zhang Wei; Xu Chaoqi; Li Weibin; Dang Xuhong; Zuo Yahui

    2011-01-01

    Objective: To provide the evidence of health damage for the staff irradiated from the gene level. Methods: The study analyzed the differential transcriptional profile of normal human lymphocyte and human lymphocyte irradiated with 0.1 Gy, 0.2 Gy, 0.5 Gy, 1.0 Gy by whole genome chip after 6 h irradiated. Results: The results showed that there were 1177 differentially expressed genes with 0.1 Gy after 6 h irradiation, and there were 1922 differentially expressed genes with 0.2 Gy after 6 h irradiation, and there were 492 differentially expressed genes with 0.5 Gy after 6 h irradiation, 2615 differentially expressed genes with 1.0 Gy after 6 h irradiation, 114 differentially expressed genes in 4 dose points after 6 h irradiation. RT-PCR results indicated that the relative quantity's result of EGR1, HLA-DMB and TAIAP1 was consistent with gene chip data. Conclusion: The study found many significant different genes in human lymphocyte with different doses after 6 h irradiation, which will provide a basis for the further radiation-different-genes and the mechanism of radiation damage. (authors)

  17. Suppression subtractive hybridization identified differentially expressed genes in lung adenocarcinoma: ERGIC3 as a novel lung cancer-related gene

    International Nuclear Information System (INIS)

    Wu, Mingsong; Tu, Tao; Huang, Yunchao; Cao, Yi

    2013-01-01

    To understand the carcinogenesis caused by accumulated genetic and epigenetic alterations and seek novel biomarkers for various cancers, studying differentially expressed genes between cancerous and normal tissues is crucial. In the study, two cDNA libraries of lung cancer were constructed and screened for identification of differentially expressed genes. Two cDNA libraries of differentially expressed genes were constructed using lung adenocarcinoma tissue and adjacent nonmalignant lung tissue by suppression subtractive hybridization. The data of the cDNA libraries were then analyzed and compared using bioinformatics analysis. Levels of mRNA and protein were measured by quantitative real-time polymerase chain reaction (q-RT-PCR) and western blot respectively, as well as expression and localization of proteins were determined by immunostaining. Gene functions were investigated using proliferation and migration assays after gene silencing and gene over-expression. Two libraries of differentially expressed genes were obtained. The forward-subtracted library (FSL) and the reverse-subtracted library (RSL) contained 177 and 59 genes, respectively. Bioinformatic analysis demonstrated that these genes were involved in a wide range of cellular functions. The vast majority of these genes were newly identified to be abnormally expressed in lung cancer. In the first stage of the screening for 16 genes, we compared lung cancer tissues with their adjacent non-malignant tissues at the mRNA level, and found six genes (ERGIC3, DDR1, HSP90B1, SDC1, RPSA, and LPCAT1) from the FSL were significantly up-regulated while two genes (GPX3 and TIMP3) from the RSL were significantly down-regulated (P < 0.05). The ERGIC3 protein was also over-expressed in lung cancer tissues and cultured cells, and expression of ERGIC3 was correlated with the differentiated degree and histological type of lung cancer. The up-regulation of ERGIC3 could promote cellular migration and proliferation in vitro. The

  18. Study of differential gene expression in human hepatocyte exposed to 50 cGy γ ray

    International Nuclear Information System (INIS)

    Wen Jianhua; Li Jianguo; Tian Huancheng; Li Yanling; Wang Xiaoli; Zuo Yanhui

    2008-01-01

    The study analyzed the differential transcriptional profile of the normal human hepatic cell and the human hepatic cell radiated with 50 cGy γ ray by gene chip technique. The results showed that there were 614 differentially expressed genes among 14 112 human genes analyzed, in which 521 genes were up-regulated and 93 genes down-regulated. These genes are associated with mitochondrial regulation, homo sapiens hepatitis A virus cellular receptor, tumor necrosis factor, cell cycle regulation, kinase and zinc finger protein etc. RT-PCR results indicated that up-regulated expression of gene HAVcr-1, HAVcr-2, MFTC, MOAP1 and down-regulated expression of gene TRIP12, DCN were consistent with gene chip data. (authors)

  19. Genetics Home Reference: 7q11.23 duplication syndrome

    Science.gov (United States)

    ... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  20. Craniofacial duplication: a case report.

    Science.gov (United States)

    Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya

    2013-09-01

    A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.

  1. Rectal duplication with sciatic hernia.

    Science.gov (United States)

    Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł

    2015-07-01

    Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.

  2. Long SAGE analysis of genes differentially expressed in the midgut ...

    African Journals Online (AJOL)

    USER

    identification of genes related to sexual disparity in silk protein production efficiency. ... Ysh, a yellow cocoon color sex-limited strain of the silkworm B. mori, ...... alternative splicing of human genes. ... Structure, function and evolution of.

  3. Isolation and identification of differentially expressed genes between ...

    African Journals Online (AJOL)

    Plants have evolved sophisticated molecular defense mechanisms in order to survive disease conditions. So far, a number of pathogen resistance (R) genes have been reported in plants. These R genes are thought to be involved in activating the signals that lead to disease resistance. The structural specificity of R genes ...

  4. A Cbx8-containing polycomb complex facilitates the transition to gene activation during ES cell differentiation.

    Directory of Open Access Journals (Sweden)

    Catherine Creppe

    2014-12-01

    Full Text Available Polycomb proteins play an essential role in maintaining the repression of developmental genes in self-renewing embryonic stem cells. The exact mechanism allowing the derepression of polycomb target genes during cell differentiation remains unclear. Our project aimed to identify Cbx8 binding sites in differentiating mouse embryonic stem cells. Therefore, we used a genome-wide chromatin immunoprecipitation of endogenous Cbx8 coupled to direct massive parallel sequencing (ChIP-Seq. Our analysis identified 171 high confidence peaks. By crossing our data with previously published microarray analysis, we show that several differentiation genes transiently recruit Cbx8 during their early activation. Depletion of Cbx8 partially impairs the transcriptional activation of these genes. Both interaction analysis, as well as chromatin immunoprecipitation experiments support the idea that activating Cbx8 acts in the context of an intact PRC1 complex. Prolonged gene activation results in eviction of PRC1 despite persisting H3K27me3 and H2A ubiquitination. The composition of PRC1 is highly modular and changes when embryonic stem cells commit to differentiation. We further demonstrate that the exchange of Cbx7 for Cbx8 is required for the effective activation of differentiation genes. Taken together, our results establish a function for a Cbx8-containing complex in facilitating the transition from a Polycomb-repressed chromatin state to an active state. As this affects several key regulatory differentiation genes this mechanism is likely to contribute to the robust execution of differentiation programs.

  5. Robust Nonnegative Matrix Factorization via Joint Graph Laplacian and Discriminative Information for Identifying Differentially Expressed Genes

    Directory of Open Access Journals (Sweden)

    Ling-Yun Dai

    2017-01-01

    Full Text Available Differential expression plays an important role in cancer diagnosis and classification. In recent years, many methods have been used to identify differentially expressed genes. However, the recognition rate and reliability of gene selection still need to be improved. In this paper, a novel constrained method named robust nonnegative matrix factorization via joint graph Laplacian and discriminative information (GLD-RNMF is proposed for identifying differentially expressed genes, in which manifold learning and the discriminative label information are incorporated into the traditional nonnegative matrix factorization model to train the objective matrix. Specifically, L2,1-norm minimization is enforced on both the error function and the regularization term which is robust to outliers and noise in gene data. Furthermore, the multiplicative update rules and the details of convergence proof are shown for the new model. The experimental results on two publicly available cancer datasets demonstrate that GLD-RNMF is an effective method for identifying differentially expressed genes.

  6. Gene expression profiling of bone marrow mesenchymal stem cells from Osteogenesis Imperfecta patients during osteoblast differentiation.

    Science.gov (United States)

    Kaneto, Carla Martins; Pereira Lima, Patrícia S; Prata, Karen Lima; Dos Santos, Jane Lima; de Pina Neto, João Monteiro; Panepucci, Rodrigo Alexandre; Noushmehr, Houtan; Covas, Dimas Tadeu; de Paula, Francisco José Alburquerque; Silva, Wilson Araújo

    2017-06-01

    Mesenchymal stem cells (MSCs) are precursors present in adult bone marrow that are able to differentiate into osteoblasts, adipocytes and chondroblasts that have gained great importance as a source for cell therapy. Recently, a number of studies involving the analysis of gene expression of undifferentiated MSCs and of MSCs in the differentiation into multiple lineage processes were observed but there is no information concerning the gene expression of MSCs from Osteogenesis Imperfecta (OI) patients. Osteogenesis Imperfecta is characterized as a genetic disorder in which a generalized osteopenia leads to excessive bone fragility and severe bone deformities. The aim of this study was to analyze gene expression profile during osteogenic differentiation from BMMSCs (Bone Marrow Mesenchymal Stem Cells) obtained from patients with Osteogenesis Imperfecta and from control subjects. Bone marrow samples were collected from three normal subjects and five patients with OI. Mononuclear cells were isolated for obtaining mesenchymal cells that had been expanded until osteogenic differentiation was induced. RNA was harvested at seven time points during the osteogenic differentiation period (D0, D+1, D+2, D+7, D+12, D+17 and D+21). Gene expression analysis was performed by the microarray technique and identified several differentially expressed genes. Some important genes for osteoblast differentiation had lower expression in OI patients, suggesting a smaller commitment of these patient's MSCs with the osteogenic lineage. Other genes also had their differential expression confirmed by RT-qPCR. An increase in the expression of genes related to adipocytes was observed, suggesting an increase of adipogenic differentiation at the expense osteogenic differentiation. Copyright © 2017. Published by Elsevier Masson SAS.

  7. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  8. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  9. Anterior rectal duplication: a diagnostic challenge.

    Science.gov (United States)

    Amjadi, K; Poenaru, D; Soboleski, D; Hurlbut, D; Kamal, I

    2000-04-01

    The authors present an anterior rectal cyst in a 14-month-old girl. This rare variant of rectal duplications presented with recurrent urinary infections. The diagnosis was challenging in view of the multiple differential diagnoses to be considered. Magnetic resonance imaging appeared to be the most accurate preoperative investigation. The cyst was removed uneventfully by partial excision and mucosal ablation. An awareness of this variant can lead to early diagnosis and curative resection.

  10. Structure and vascular tissue expression of duplicated TERMINAL EAR1-like paralogues in poplar.

    Science.gov (United States)

    Charon, Céline; Vivancos, Julien; Mazubert, Christelle; Paquet, Nicolas; Pilate, Gilles; Dron, Michel

    2010-02-01

    TERMINAL EAR1-like (TEL) genes encode putative RNA-binding proteins only found in land plants. Previous studies suggested that they may regulate tissue and organ initiation in Poaceae. Two TEL genes were identified in both Populus trichocarpa and the hybrid aspen Populus tremula x P. alba, named, respectively, PoptrTEL1-2 and PtaTEL1-2. The analysis of the organisation around the PoptrTEL genes in the P. trichocarpa genome and the estimation of the synonymous substitution rate for PtaTEL1-2 genes indicate that the paralogous link between these two Populus TEL genes probably results from the Salicoid large-scale gene-duplication event. Phylogenetic analyses confirmed their orthology link with the other TEL genes. The expression pattern of both PtaTEL genes appeared to be restricted to the mother cells of the plant body: leaf founder cells, leaf primordia, axillary buds and root differentiating tissues, as well as to mother cells of vascular tissues. Most interestingly, PtaTEL1-2 transcripts were found in differentiating cells of secondary xylem and phloem, but probably not in the cambium itself. Taken together, these results indicate specific expression of the TEL genes in differentiating cells controlling tissue and organ development in Populus (and other Angiosperm species).

  11. Identification of differentially expressed genes in cutaneous squamous cell carcinoma by microarray expression profiling

    Directory of Open Access Journals (Sweden)

    Sterry Wolfram

    2006-08-01

    Full Text Available Abstract Background Carcinogenesis is a multi-step process indicated by several genes up- or down-regulated during tumor progression. This study examined and identified differentially expressed genes in cutaneous squamous cell carcinoma (SCC. Results Three different biopsies of 5 immunosuppressed organ-transplanted recipients each normal skin (all were pooled, actinic keratosis (AK (two were pooled, and invasive SCC and additionally 5 normal skin tissues from immunocompetent patients were analyzed. Thus, total RNA of 15 specimens were used for hybridization with Affymetrix HG-U133A microarray technology containing 22,283 genes. Data analyses were performed by prediction analysis of microarrays using nearest shrunken centroids with the threshold 3.5 and ANOVA analysis was independently performed in order to identify differentially expressed genes (p vs. AK and SCC were observed for 118 genes. Conclusion The majority of identified differentially expressed genes in cutaneous SCC were previously not described.

  12. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia

    2011-08-01

    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  13. Differential gene expression patterns between smokers and non‐smokers: cause or consequence?

    Science.gov (United States)

    Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H.; Penninx, Brenda W.; Boomsma, Dorret I.

    2015-01-01

    Abstract The molecular mechanisms causing smoking‐induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome‐wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex‐smokers were available from two population‐based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty‐two genes were differentially expressed between current smokers and never smokers (P smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis‐expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome‐wide association meta‐analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene expression. PMID:26594007

  14. A Korean boy with 46,XX testicular disorder of sex development caused by SOX9 duplication.

    Science.gov (United States)

    Lee, Gyung Min; Ko, Jung Min; Shin, Choong Ho; Yang, Sei Won

    2014-06-01

    The 46,XX testicular disorder of sex development (DSD), also known as 46,XX male syndrome, is a rare form of DSD and clinical phenotype shows complete sex reversal from female to male. The sex-determining region Y (SRY) gene can be identified in most 46,XX testicular DSD patients; however, approximately 20% of patients with 46,XX testicular DSD are SRY-negative. The SRY-box 9 (SOX9) gene has several important functions during testis development and differentiation in males, and overexpression of SOX9 leads to the male development of 46,XX gonads in the absence of SRY. In addition, SOX9 duplication has been found to be a rare cause of 46,XX testicular DSD in humans. Here, we report a 4.2-year-old SRY-negative 46,XX boy with complete sex reversal caused by SOX9 duplication for the first time in Korea. He showed normal external and internal male genitalia except for small testes. Fluorescence in situ hybridization and polymerase chain reaction (PCR) analyses failed to detect the presence of SRY, and SOX9 intragenic mutation was not identified by direct sequencing analysis. Therefore, we performed real-time PCR analyses with specific primer pairs, and duplication of the SOX9 gene was revealed. Although SRY-negative 46,XX testicular DSD is a rare condition, an effort to make an accurate diagnosis is important for the provision of proper genetic counseling and for guiding patients in their long-term management.

  15. High-throughput gene expression profiling of memory differentiation in primary human T cells

    Directory of Open Access Journals (Sweden)

    Russell Kate

    2008-08-01

    Full Text Available Abstract Background The differentiation of naive T and B cells into memory lymphocytes is essential for immunity to pathogens. Therapeutic manipulation of this cellular differentiation program could improve vaccine efficacy and the in vitro expansion of memory cells. However, chemical screens to identify compounds that induce memory differentiation have been limited by 1 the lack of reporter-gene or functional assays that can distinguish naive and memory-phenotype T cells at high throughput and 2 a suitable cell-line representative of naive T cells. Results Here, we describe a method for gene-expression based screening that allows primary naive and memory-phenotype lymphocytes to be discriminated based on complex genes signatures corresponding to these differentiation states. We used ligation-mediated amplification and a fluorescent, bead-based detection system to quantify simultaneously 55 transcripts representing naive and memory-phenotype signatures in purified populations of human T cells. The use of a multi-gene panel allowed better resolution than any constituent single gene. The method was precise, correlated well with Affymetrix microarray data, and could be easily scaled up for high-throughput. Conclusion This method provides a generic solution for high-throughput differentiation screens in primary human T cells where no single-gene or functional assay is available. This screening platform will allow the identification of small molecules, genes or soluble factors that direct memory differentiation in naive human lymphocytes.

  16. Application of disease-associated differentially expressed genes – Mining for functional candidate genes for mastitis resistance in cattle

    Directory of Open Access Journals (Sweden)

    Schwerin Manfred

    2003-06-01

    Full Text Available Abstract In this study the mRNA differential display method was applied to identify mastitis-associated expressed DNA sequences based on different expression patterns in mammary gland samples of non-infected and infected udder quarters of a cow. In total, 704 different cDNA bands were displayed in both udder samples. Five hundred-and-thirty two bands, (75.6% were differentially displayed. Ninety prominent cDNA bands were isolated, re-amplified, cloned and sequenced resulting in 87 different sequences. Amongst the 19 expressed sequence tags showing a similarity with previously described genes, the majority of these sequences exhibited homology to protein kinase encoding genes (26.3%, to genes involved in the regulation of gene expression (26.3%, to growth and differentiation factor encoding genes (21.0% and to immune response or inflammation marker encoding genes (21.0%. These sequences were shown to have mastitis-associated expression in the udder samples of animals with and without clinical mastitis by quantitative RT-PCR. They were mapped physically using a bovine-hamster somatic cell hybrid panel and a 5000 rad bovine whole genome radiation hybrid panel. According to their localization in QTL regions based on an established integrated marker/gene-map and their disease-associated expression, four genes (AHCY, PRKDC, HNRPU, OSTF1 were suggested as potentially involved in mastitis defense.

  17. Isolation and characterization of differentially expressed genes in ...

    African Journals Online (AJOL)

    USER

    Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.

  18. Genes differentially expressed in medulloblastoma and fetal brain

    NARCIS (Netherlands)

    Michiels, E. M.; Oussoren, E.; van Groenigen, M.; Pauws, E.; Bossuyt, P. M.; Voûte, P. A.; Baas, F.

    1999-01-01

    Serial analysis of gene expression (SAGE) was used to identify genes that might be involved in the development or growth of medulloblastoma, a childhood brain tumor. Sequence tags from medulloblastoma (10229) and fetal brain (10692) were determined. The distributions of sequence tags in each

  19. Network analysis of differential expression for the identification of disease-causing genes.

    Directory of Open Access Journals (Sweden)

    Daniela Nitsch

    Full Text Available Genetic studies (in particular linkage and association studies identify chromosomal regions involved in a disease or phenotype of interest, but those regions often contain many candidate genes, only a few of which can be followed-up for biological validation. Recently, computational methods to identify (prioritize the most promising candidates within a region have been proposed, but they are usually not applicable to cases where little is known about the phenotype (no or few confirmed disease genes, fragmentary understanding of the biological cascades involved. We seek to overcome this limitation by replacing knowledge about the biological process by experimental data on differential gene expression between affected and healthy individuals. Considering the problem from the perspective of a gene/protein network, we assess a candidate gene by considering the level of differential expression in its neighborhood under the assumption that strong candidates will tend to be surrounded by differentially expressed neighbors. We define a notion of soft neighborhood where each gene is given a contributing weight, which decreases with the distance from the candidate gene on the protein network. To account for multiple paths between genes, we define the distance using the Laplacian exponential diffusion kernel. We score candidates by aggregating the differential expression of neighbors weighted as a function of distance. Through a randomization procedure, we rank candidates by p-values. We illustrate our approach on four monogenic diseases and successfully prioritize the known disease causing genes.

  20. Statistical modelling of transcript profiles of differentially regulated genes

    Directory of Open Access Journals (Sweden)

    Sergeant Martin J

    2008-07-01

    Full Text Available Abstract Background The vast quantities of gene expression profiling data produced in microarray studies, and the more precise quantitative PCR, are often not statistically analysed to their full potential. Previous studies have summarised gene expression profiles using simple descriptive statistics, basic analysis of variance (ANOVA and the clustering of genes based on simple models fitted to their expression profiles over time. We report the novel application of statistical non-linear regression modelling techniques to describe the shapes of expression profiles for the fungus Agaricus bisporus, quantified by PCR, and for E. coli and Rattus norvegicus, using microarray technology. The use of parametric non-linear regression models provides a more precise description of expression profiles, reducing the "noise" of the raw data to produce a clear "signal" given by the fitted curve, and describing each profile with a small number of biologically interpretable parameters. This approach then allows the direct comparison and clustering of the shapes of response patterns between genes and potentially enables a greater exploration and interpretation of the biological processes driving gene expression. Results Quantitative reverse transcriptase PCR-derived time-course data of genes were modelled. "Split-line" or "broken-stick" regression identified the initial time of gene up-regulation, enabling the classification of genes into those with primary and secondary responses. Five-day profiles were modelled using the biologically-oriented, critical exponential curve, y(t = A + (B + CtRt + ε. This non-linear regression approach allowed the expression patterns for different genes to be compared in terms of curve shape, time of maximal transcript level and the decline and asymptotic response levels. Three distinct regulatory patterns were identified for the five genes studied. Applying the regression modelling approach to microarray-derived time course data

  1. Differential Gene Expression in Colon Tissue Associated With Diet, Lifestyle, and Related Oxidative Stress.

    Directory of Open Access Journals (Sweden)

    Martha L Slattery

    Full Text Available Several diet and lifestyle factors may impact health by influencing oxidative stress levels. We hypothesize that level of cigarette smoking, alcohol, anti-inflammatory drugs, and diet alter gene expression. We analyzed RNA-seq data from 144 colon cancer patients who had information on recent cigarette smoking, recent alcohol consumption, diet, and recent aspirin/non-steroidal anti-inflammatory use. Using a false discovery rate of 0.1, we evaluated gene differential expression between high and low levels of exposure using DESeq2. Ingenuity Pathway Analysis (IPA was used to determine networks associated with de-regulated genes in our data. We identified 46 deregulated genes associated with recent cigarette use; these genes enriched causal networks regulated by TEK and MAP2K3. Different differentially expressed genes were associated with type of alcohol intake; five genes were associated with total alcohol, six were associated with beer intake, six were associated with wine intake, and four were associated with liquor consumption. Recent use of aspirin and/or ibuprofen was associated with differential expression of TMC06, ST8SIA4, and STEAP3 while a summary oxidative balance score (OBS was associated with SYCP3, HDX, and NRG4 (all up-regulated with greater oxidative balance. Of the dietary antioxidants and carotenoids evaluated only intake of beta carotene (1 gene, Lutein/Zeaxanthine (5 genes, and Vitamin E (4 genes were associated with differential gene expression. There were similarities in biological function of de-regulated genes associated with various dietary and lifestyle factors. Our data support the hypothesis that diet and lifestyle factors associated with oxidative stress can alter gene expression. However genes altered were unique to type of alcohol and type of antioxidant. Because of potential differences in associations observed between platforms these findings need replication in other populations.

  2. Expressed sequence tags of differential genes in the radioresistant mice and their parental mice

    International Nuclear Information System (INIS)

    Wang Qin; Yue Jingyin; Li Jin; Song Li; Liu Qiang; Mu Chuanjie; Wu Hongying

    2009-01-01

    Objective: To explore radioresistance correlative genes in IRM-2 inbred mouse. Methods: The total RNA was extracted from spleen cells of IRM-2 and their parent 615 and ICR/JCL mouse. The mRNA differential display technique was used to analyze gene expression differences. Each differential bands were amplified by PCR, cloned and sequenced. Results: There were 75 differential expression bands appearing in IRM-2 mouse but not in 615 and ICR/JCL mouse. Fifty-two pieces of cDNA sequences were got by sequencing. Twenty-one expressed sequence tags (EST) that were not the same as known mice genes were found and registered by comparing with GenBank database. Conclusion: Twenty-one EST denote that radioresistance correlative genes may be in IRM-2 mouse, which have laid a foundation for isolating and identifying radioresistance correlative genes in further study. (authors)

  3. Characterization of differentially expressed genes using high-dimensional co-expression networks

    DEFF Research Database (Denmark)

    Coelho Goncalves de Abreu, Gabriel; Labouriau, Rodrigo S.

    2010-01-01

    We present a technique to characterize differentially expressed genes in terms of their position in a high-dimensional co-expression network. The set-up of Gaussian graphical models is used to construct representations of the co-expression network in such a way that redundancy and the propagation...... that allow to make effective inference in problems with high degree of complexity (e.g. several thousands of genes) and small number of observations (e.g. 10-100) as typically occurs in high throughput gene expression studies. Taking advantage of the internal structure of decomposable graphical models, we...... construct a compact representation of the co-expression network that allows to identify the regions with high concentration of differentially expressed genes. It is argued that differentially expressed genes located in highly interconnected regions of the co-expression network are less informative than...

  4. Acute hypoxia stress induced abundant differential expression genes and alternative splicing events in heart of tilapia.

    Science.gov (United States)

    Xia, Jun Hong; Li, Hong Lian; Li, Bi Jun; Gu, Xiao Hui; Lin, Hao Ran

    2018-01-10

    Hypoxia is one of the critical environmental stressors for fish in aquatic environments. Although accumulating evidences indicate that gene expression is regulated by hypoxia stress in fish, how genes undergoing differential gene expression and/or alternative splicing (AS) in response to hypoxia stress in heart are not well understood. Using RNA-seq, we surveyed and detected 289 differential expressed genes (DEG) and 103 genes that undergo differential usage of exons and splice junctions events (DUES) in heart of a hypoxia tolerant fish, Nile tilapia, Oreochromis niloticus following 12h hypoxic treatment. The spatio-temporal expression analysis validated the significant association of differential exon usages in two randomly selected DUES genes (fam162a and ndrg2) in 5 tissues (heart, liver, brain, gill and spleen) sampled at three time points (6h, 12h, and 24h) under acute hypoxia treatment. Functional analysis significantly associated the differential expressed genes with the categories related to energy conservation, protein synthesis and immune response. Different enrichment categories were found between the DEG and DUES dataset. The Isomerase activity, Oxidoreductase activity, Glycolysis and Oxidative stress process were significantly enriched for the DEG gene dataset, but the Structural constituent of ribosome and Structural molecule activity, Ribosomal protein and RNA binding protein were significantly enriched only for the DUES genes. Our comparative transcriptomic analysis reveals abundant stress responsive genes and their differential regulation function in the heart tissues of Nile tilapia under acute hypoxia stress. Our findings will facilitate future investigation on transcriptome complexity and AS regulation during hypoxia stress in fish. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Duplicated middle cerebral artery

    Science.gov (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel

    2009-01-01

    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  6. Changes in the expression of collagen genes show two stages in chondrocyte differentiation in vitro

    OpenAIRE

    1988-01-01

    This report deals with the quantitation of both mRNA and transcription activity of type I collagen gene and of three cartilage-specific collagens (types II, IX, and X) during in vitro differentiation of chick chondrocytes. Differentiation was obtained by transferal to suspension culture of dedifferentiated cells passaged for 3 wk as adherent cells. The type I collagen mRNA, highly represented in the dedifferentiated cells, rapidly decreased during chondrocyte differentiation. On the contrary,...

  7. Duplication at Xq28 involving IKBKG is associated with progressive macrocephaly, recurrent infections, ectodermal dysplasia, benign tumors, and neuropathy

    NARCIS (Netherlands)

    Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.

    2014-01-01

    Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety

  8. Global analysis of differential expressed genes in ECV304 ...

    African Journals Online (AJOL)

    EB

    Abstract. Background: Human cytomegalovirus (HCMV) is a virus which has the potential to alter cellular gene expression through .... and (reverse: 5'-CAG CAC CAT CCT CCT CTT. CCT CT ..... acute respiratory syndrome (SARS) coronavirus.

  9. Molecular analysis of expansion, differentiation, and growth factor treatment of human chondrocytes identifies differentiation markers and growth-related genes.

    Science.gov (United States)

    Benz, Karin; Breit, Stephen; Lukoschek, Martin; Mau, Hans; Richter, Wiltrud

    2002-04-26

    This study is intended to optimise expansion and differentiation of cultured human chondrocytes by growth factor application and to identify molecular markers to monitor their differentiation state. We dissected the molecular consequences of matrix release, monolayer, and 3D-alginate culture, growth factor optimised expansion, and re-differentiation protocols by gene expression analysis. Among 19 common cartilage molecules assessed by cDNA array, six proved best to monitor differentiation. Instant down-regulation at release of cells from the matrix was strongest for COL 2A1, fibromodulin, and PRELP while LUM, CHI3L1, and CHI3L2 were expansion-related. Both gene sets reflected the physiologic effects of the most potent growth-inducing (PDGF-BB) and proteoglycan-inducing (BMP-4) factors. Only CRTAC1 expression correlated with 2D/3D switches while the molecular phenotype of native chondrocytes was not restored. The markers and optimised protocols we suggest can help to improve cell therapy of cartilage defects and chondrocyte differentiation from stem cell sources.

  10. Differential neutrophil gene expression in early bovine pregnancy

    Directory of Open Access Journals (Sweden)

    Kizaki Keiichiro

    2013-02-01

    Full Text Available Abstract Background In food production animals, especially cattle, the diagnosis of gestation is important because the timing of gestation directly affects the running of farms. Various methods have been used to detect gestation, but none of them are ideal because of problems with the timing of detection or the accuracy, simplicity, or cost of the method. A new method for detecting gestation, which involves assessing interferon-tau (IFNT-stimulated gene expression in peripheral blood leukocytes (PBL, was recently proposed. PBL fractionation methods were used to examine whether the expression profiles of various PBL populations could be used as reliable diagnostic markers of bovine gestation. Methods PBL were collected on days 0 (just before artificial insemination, 7, 14, 17, 21, and 28 of gestation. The gene expression levels of the PBL were assessed with microarray analysis and/or quantitative real-time reverse transcription (q PCR. PBL fractions were collected by flow cytometry or density gradient cell separation using Histopaque 1083 or Ficoll-Conray solutions. The expression levels of four IFNT-stimulated genes, interferon-stimulated protein 15 kDa (ISG15, myxovirus-resistance (MX 1 and 2, and 2′-5′-oligoadenylate synthetase (OAS1, were then analyzed in each fraction through day 28 of gestation using qPCR. Results Microarray analysis detected 72 and 28 genes in whole PBL that were significantly higher on days 14 and 21 of gestation, respectively, than on day 0. The upregulated genes included IFNT-stimulated genes. The expression levels of these genes increased with the progression of gestation until day 21. In flow cytometry experiments, on day 14 the expression levels of all of the genes were significantly higher in the granulocyte fraction than in the other fractions. Their expression gradually decreased through day 28 of gestation. Strong correlations were observed between the expression levels of the four genes in the granulocyte

  11. Differentially expressed genes associated with dormancy or germination of Arabidopsis thaliana seeds

    NARCIS (Netherlands)

    Toorop, P.E.; Barroco, R.M.; Engler, G.; Groot, S.P.C.; Hilhorst, H.W.M.

    2005-01-01

    Differential display analysis using dormant and non-dormant Arabidopsis thaliana (L.) Heynh seeds resulted in a set of genes that were associated with either dormancy or germination. Expression of the germination-associated genes AtRPL36B and AtRPL27B, encoding two ribosomal proteins, was

  12. Differential expression of immune and stress genes in the skin of Atlantic cod (Gadus morhua)

    NARCIS (Netherlands)

    Caipang, C.M.A.; Lazado, C.C.; Brinchmann, M.; Rombout, J.H.W.M.; Kiron, V.

    2011-01-01

    The present study describes the transcriptional profiles of selected immune and stress genes with putative important roles in the cutaneous immune defense of Atlantic cod (Gadus morhua). In addition it shows differential expression of many genes at the dorsal and ventral sides of fish, in general

  13. Evaluation of new biomarker genes for differentiating Haemophilus influenzae from Haemophilus haemolyticus.

    Science.gov (United States)

    Theodore, M Jordan; Anderson, Raydel D; Wang, Xin; Katz, Lee S; Vuong, Jeni T; Bell, Melissa E; Juni, Billie A; Lowther, Sara A; Lynfield, Ruth; MacNeil, Jessica R; Mayer, Leonard W

    2012-04-01

    PCR detecting the protein D (hpd) and fuculose kinase (fucK) genes showed high sensitivity and specificity for identifying Haemophilus influenzae and differentiating it from H. haemolyticus. Phylogenetic analysis using the 16S rRNA gene demonstrated two distinct groups for H. influenzae and H. haemolyticus.

  14. Differentially expressed genes in the pre-eclamptic placenta: a systematic review and meta-analysis

    NARCIS (Netherlands)

    Kleinrouweler, C. Emily; van Uitert, Miranda; Moerland, Perry D.; Ris-Stalpers, Carrie; van der Post, Joris A. M.; Afink, Gijs B.

    2013-01-01

    To systematically review the literature on human gene expression data of placental tissue in pre-eclampsia and to characterize a meta-signature of differentially expressed genes in order to identify novel putative diagnostic markers. Medline through 11 February 2011 using MeSH terms and keywords

  15. Genetic differentiation and gene flow between the Tunisian ovine ...

    African Journals Online (AJOL)

    Haifa

    Sheep is an important livestock species of Tunisia. They contribute greatly ... Genetic differentiation coefficient (Gst) over all loci was 0.1922, the fixation index [Fst by Analysis of molecular variance ..... their first cross with the D'Man. Anim. Res.

  16. Meta-analysis of differentiating mouse embryonic stem cell gene expression kinetics reveals early change of a small gene set.

    Directory of Open Access Journals (Sweden)

    Clive H Glover

    2006-11-01

    Full Text Available Stem cell differentiation involves critical changes in gene expression. Identification of these should provide endpoints useful for optimizing stem cell propagation as well as potential clues about mechanisms governing stem cell maintenance. Here we describe the results of a new meta-analysis methodology applied to multiple gene expression datasets from three mouse embryonic stem cell (ESC lines obtained at specific time points during the course of their differentiation into various lineages. We developed methods to identify genes with expression changes that correlated with the altered frequency of functionally defined, undifferentiated ESC in culture. In each dataset, we computed a novel statistical confidence measure for every gene which captured the certainty that a particular gene exhibited an expression pattern of interest within that dataset. This permitted a joint analysis of the datasets, despite the different experimental designs. Using a ranking scheme that favored genes exhibiting patterns of interest, we focused on the top 88 genes whose expression was consistently changed when ESC were induced to differentiate. Seven of these (103728_at, 8430410A17Rik, Klf2, Nr0b1, Sox2, Tcl1, and Zfp42 showed a rapid decrease in expression concurrent with a decrease in frequency of undifferentiated cells and remained predictive when evaluated in additional maintenance and differentiating protocols. Through a novel meta-analysis, this study identifies a small set of genes whose expression is useful for identifying changes in stem cell frequencies in cultures of mouse ESC. The methods and findings have broader applicability to understanding the regulation of self-renewal of other stem cell types.

  17. Identification of stable reference genes in differentiating human pluripotent stem cells.

    Science.gov (United States)

    Holmgren, Gustav; Ghosheh, Nidal; Zeng, Xianmin; Bogestål, Yalda; Sartipy, Peter; Synnergren, Jane

    2015-06-01

    Reference genes, often referred to as housekeeping genes (HKGs), are frequently used to normalize gene expression data based on the assumption that they are expressed at a constant level in the cells. However, several studies have shown that there may be a large variability in the gene expression levels of HKGs in various cell types. In a previous study, employing human embryonic stem cells (hESCs) subjected to spontaneous differentiation, we observed that the expression of commonly used HKG varied to a degree that rendered them inappropriate to use as reference genes under those experimental settings. Here we present a substantially extended study of the HKG signature in human pluripotent stem cells (hPSC), including nine global gene expression datasets from both hESC and human induced pluripotent stem cells, obtained during directed differentiation toward endoderm-, mesoderm-, and ectoderm derivatives. Sets of stably expressed genes were compiled, and a handful of genes (e.g., EID2, ZNF324B, CAPN10, and RABEP2) were identified as generally applicable reference genes in hPSCs across all cell lines and experimental conditions. The stability in gene expression profiles was confirmed by reverse transcription quantitative PCR analysis. Taken together, the current results suggest that differentiating hPSCs have a distinct HKG signature, which in some aspects is different from somatic cell types, and underscore the necessity to validate the stability of reference genes under the actual experimental setup used. In addition, the novel putative HKGs identified in this study can preferentially be used for normalization of gene expression data obtained from differentiating hPSCs. Copyright © 2015 the American Physiological Society.

  18. Roles of Breast Cancer Susceptibility Genes BRCA’s in Mammary Epithelial Cell Differentiation

    Science.gov (United States)

    2006-03-01

    FANCA . Hum. Mol. Genet. 11, 2591-2597 (2002). 13. Tessari, M.A. et al. Transcriptional activation of the cyclin A gene by the architectural...caretakercancer susceptibility gene FANCA (24), as well several IFN- or caspase- associated proteins, were down-regulated. Concomitantly, in these cells...a mammary differentiation factor STAT5B and a caretaker cancer susceptibility gene FANCA were down-regulated. Nev- ertheless, it has yet to be

  19. Differential reconstructed gene interaction networks for deriving toxicity threshold in chemical risk assessment.

    Science.gov (United States)

    Yang, Yi; Maxwell, Andrew; Zhang, Xiaowei; Wang, Nan; Perkins, Edward J; Zhang, Chaoyang; Gong, Ping

    2013-01-01

    Pathway alterations reflected as changes in gene expression regulation and gene interaction can result from cellular exposure to toxicants. Such information is often used to elucidate toxicological modes of action. From a risk assessment perspective, alterations in biological pathways are a rich resource for setting toxicant thresholds, which may be more sensitive and mechanism-informed than traditional toxicity endpoints. Here we developed a novel differential networks (DNs) approach to connect pathway perturbation with toxicity threshold setting. Our DNs approach consists of 6 steps: time-series gene expression data collection, identification of altered genes, gene interaction network reconstruction, differential edge inference, mapping of genes with differential edges to pathways, and establishment of causal relationships between chemical concentration and perturbed pathways. A one-sample Gaussian process model and a linear regression model were used to identify genes that exhibited significant profile changes across an entire time course and between treatments, respectively. Interaction networks of differentially expressed (DE) genes were reconstructed for different treatments using a state space model and then compared to infer differential edges/interactions. DE genes possessing differential edges were mapped to biological pathways in databases such as KEGG pathways. Using the DNs approach, we analyzed a time-series Escherichia coli live cell gene expression dataset consisting of 4 treatments (control, 10, 100, 1000 mg/L naphthenic acids, NAs) and 18 time points. Through comparison of reconstructed networks and construction of differential networks, 80 genes were identified as DE genes with a significant number of differential edges, and 22 KEGG pathways were altered in a concentration-dependent manner. Some of these pathways were perturbed to a degree as high as 70% even at the lowest exposure concentration, implying a high sensitivity of our DNs approach

  20. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.

    1988-01-01

    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  1. Complete colonic duplication in children.

    Science.gov (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh

    2012-01-01

    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  2. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  3. Differential gene expression of two extreme honey bee (Apis mellifera) colonies showing varroa tolerance and susceptibility.

    Science.gov (United States)

    Jiang, S; Robertson, T; Mostajeran, M; Robertson, A J; Qiu, X

    2016-06-01

    Varroa destructor, an ectoparasitic mite of honey bees (Apis mellifera), is the most serious pest threatening the apiculture industry. In our honey bee breeding programme, two honey bee colonies showing extreme phenotypes for varroa tolerance/resistance (S88) and susceptibility (G4) were identified by natural selection from a large gene pool over a 6-year period. To investigate potential defence mechanisms for honey bee tolerance to varroa infestation, we employed DNA microarray and real time quantitative (PCR) analyses to identify differentially expressed genes in the tolerant and susceptible colonies at pupa and adult stages. Our results showed that more differentially expressed genes were identified in the tolerant bees than in bees from the susceptible colony, indicating that the tolerant colony showed an increased genetic capacity to respond to varroa mite infestation. In both colonies, there were more differentially expressed genes identified at the pupa stage than at the adult stage, indicating that pupa bees are more responsive to varroa infestation than adult bees. Genes showing differential expression in the colony phenotypes were categorized into several groups based on their molecular functions, such as olfactory signalling, detoxification processes, exoskeleton formation, protein degradation and long-chain fatty acid metabolism, suggesting that these biological processes play roles in conferring varroa tolerance to naturally selected colonies. Identification of differentially expressed genes between the two colony phenotypes provides potential molecular markers for selecting and breeding varroa-tolerant honey bees. © 2016 The Royal Entomological Society.

  4. Characterization of six small HSP genes from Chironomus riparius (Diptera, Chironomidae): Differential expression under conditions of normal growth and heat-induced stress.

    Science.gov (United States)

    Martín-Folgar, Raquel; de la Fuente, Mercedes; Morcillo, Gloria; Martínez-Guitarte, José-Luis

    2015-10-01

    Small heat shock proteins (sHSPs) comprise the most numerous, structurally diverse, and functionally uncharacterized family of heat shock proteins. Several Hsp genes (Hsp 90, 70, 40, and 27) from the insect Chironomus riparius are widely used in aquatic toxicology as biomarkers for environmental toxins. Here, we conducted a comparative study and characterized secondary structure of the six newly identified sHsp genes Hsp17, Hsp21, Hsp22, Hsp23, Hsp24, and Hsp34. A characteristic α-crystallin domain is predicted in all the new proteins. Phylogenetic analysis suggests a strong relation to other sHSPs from insects and interesting evidence regarding evolutionary origin and duplication events. Comparative analysis of transcription profiles for Hsp27, Hsp70, and the six newly identified genes revealed that Hsp17, Hsp21, and Hsp22 are constitutively expressed under normal conditions, while under two different heat shock conditions these genes are either not activated or are even repressed (Hsp22). In contrast, Hsp23, Hsp24, and Hsp34 are significantly activated along with Hsp27 and Hsp70 during heat stress. These results strongly suggest functional differentiation within the small HSP subfamily and provide new data to help understand the coping mechanisms induced by stressful environmental stimuli. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. CHD1 regulates cell fate determination by activation of differentiation-induced genes

    DEFF Research Database (Denmark)

    Baumgart, Simon J; Najafova, Zeynab; Hossan, Tareq

    2017-01-01

    The coordinated temporal and spatial activation of gene expression is essential for proper stem cell differentiation. The Chromodomain Helicase DNA-binding protein 1 (CHD1) is a chromatin remodeler closely associated with transcription and nucleosome turnover downstream of the transcriptional start...... site (TSS). In this study, we show that CHD1 is required for the induction of osteoblast-specific gene expression, extracellular-matrix mineralization and ectopic bone formation in vivo. Genome-wide occupancy analyses revealed increased CHD1 occupancy around the TSS of differentiation-activated genes....... Furthermore, we observed that CHD1-dependent genes are mainly induced during osteoblast differentiation and are characterized by higher levels of CHD1 occupancy around the TSS. Interestingly, CHD1 depletion resulted in increased pausing of RNA Polymerase II (RNAPII) and decreased H2A.Z occupancy close...

  6. GCN5 Regulates FGF Signaling and Activates Selective MYC Target Genes during Early Embryoid Body Differentiation

    Directory of Open Access Journals (Sweden)

    Li Wang

    2018-01-01

    Full Text Available Precise control of gene expression during development is orchestrated by transcription factors and co-regulators including chromatin modifiers. How particular chromatin-modifying enzymes affect specific developmental processes is not well defined. Here, we report that GCN5, a histone acetyltransferase essential for embryonic development, is required for proper expression of multiple genes encoding components of the fibroblast growth factor (FGF signaling pathway in early embryoid bodies (EBs. Gcn5−/− EBs display deficient activation of ERK and p38, mislocalization of cytoskeletal components, and compromised capacity to differentiate toward mesodermal lineage. Genomic analyses identified seven genes as putative direct targets of GCN5 during early differentiation, four of which are cMYC targets. These findings established a link between GCN5 and the FGF signaling pathway and highlighted specific GCN5-MYC partnerships in gene regulation during early differentiation.

  7. The Him gene reveals a balance of inputs controlling muscle differentiation in Drosophila.

    Science.gov (United States)

    Liotta, David; Han, Jun; Elgar, Stuart; Garvey, Clare; Han, Zhe; Taylor, Michael V

    2007-08-21

    Tissue development requires the controlled regulation of cell-differentiation programs. In muscle, the Mef2 transcription factor binds to and activates the expression of many genes and has a major positive role in the orchestration of differentiation. However, little is known about how Mef2 activity is regulated in vivo during development. Here, we characterize a gene, Holes in muscle (Him), which our results indicate is part of this control in Drosophila. Him expression rapidly declines as embryonic muscle differentiates, and consistent with this, Him overexpression inhibits muscle differentiation. This inhibitory effect is suppressed by mef2, implicating Him in the mef2 pathway. We then found that Him downregulates the transcriptional activity of Mef2 in both cell culture and in vivo. Furthermore, Him protein binds Groucho, a conserved, transcriptional corepressor, through a WRPW motif and requires this motif and groucho function to inhibit both muscle differentiation and Mef2 activity during development. Together, our results identify a mechanism that can inhibit muscle differentiation in vivo. We conclude that a balance of positive and negative inputs, including Mef2, Him, and Groucho, controls muscle differentiation during Drosophila development and suggest that one outcome is to hold developing muscle cells in a state with differentiation genes poised to be expressed.

  8. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi

    2007-01-01

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated

  9. Identification and isolation of gene differentially expressed on scrotal ...

    African Journals Online (AJOL)

    Results of BLAST with GenBank show that three genes or expressed sequence tag (ESTs) were unknown, and there were eight sequences highly identified to be Bos taurus mRNA for proline-rich protein P-B and other sequences were B. taurus ebd-P2 pseudogene, B. taurus similar to F-box only protein 21 isoform 2, ...

  10. Differentially expressed genes in white egg 2 mutant of silkworm ...

    African Journals Online (AJOL)

    use

    2011-12-21

    Dec 21, 2011 ... In order to obtain an overall view on gene expression profiles at early embryo ... existed multi-allelic mutations. As of other insects, the color of the eggs of silkworm ..... Acid-sensitive two pore domain K+ channel dTASK-6.

  11. Identification of genes differentially expressed in ectomycorrhizal roots during the Pinus pinaster-Laccaria bicolor interaction.

    Science.gov (United States)

    Flores-Monterroso, Aranzazu; Canales, Javier; de la Torre, Fernando; Ávila, Concepción; Cánovas, Francisco M

    2013-06-01

    Ectomycorrhizal associations are of major ecological importance in temperate and boreal forests. The development of a functional ectomycorrhiza requires many genetic and biochemical changes. In this study, suppressive subtraction hybridization was used to identify differentially expressed genes in the roots of maritime pine (Pinus pinaster Aiton) inoculated with Laccaria bicolor, a mycorrhizal fungus. A total number of 200 unigenes were identified as being differentially regulated in maritime pine roots during the development of mycorrhiza. These unigenes were classified into 10 categories according to the function of their homologues in the GenBank database. Approximately, 40 % of the differentially expressed transcripts were genes that coded for unknown proteins in the databases or that had no homology to known genes. A group of these differentially expressed genes was selected to validate the results using quantitative real-time PCR. The transcript levels of the representative genes were compared between the non-inoculated and inoculated plants at 1, 5, 15 and 30 days after inoculation. The observed expression patterns indicate (1) changes in the composition of the wall cell, (2) tight regulation of defence genes during the development of mycorrhiza and (3) changes in carbon and nitrogen metabolism. Ammonium excess or deficiency dramatically affected the stability of ectomycorrhiza and altered gene expression in maritime pine roots.

  12. Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters

    Science.gov (United States)

    2017-08-01

    Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author(s) and should not be...Research and Materiel Command Fort Detrick, Maryland 21702-5012 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT...recognition, we performed a high -throughput screen for compounds eliciting differential AR activity on cARE vs. sARE reporters. Of 10,000 compounds

  13. Functional dissection of HOXD cluster genes in regulation of neuroblastoma cell proliferation and differentiation.

    Directory of Open Access Journals (Sweden)

    Yunhong Zha

    Full Text Available Retinoic acid (RA can induce growth arrest and neuronal differentiation of neuroblastoma cells and has been used in clinic for treatment of neuroblastoma. It has been reported that RA induces the expression of several HOXD genes in human neuroblastoma cell lines, but their roles in RA action are largely unknown. The HOXD cluster contains nine genes (HOXD1, HOXD3, HOXD4, and HOXD8-13 that are positioned sequentially from 3' to 5', with HOXD1 at the 3' end and HOXD13 the 5' end. Here we show that all HOXD genes are induced by RA in the human neuroblastoma BE(2-C cells, with the genes located at the 3' end being activated generally earlier than those positioned more 5' within the cluster. Individual induction of HOXD8, HOXD9, HOXD10 or HOXD12 is sufficient to induce both growth arrest and neuronal differentiation, which is associated with downregulation of cell cycle-promoting genes and upregulation of neuronal differentiation genes. However, induction of other HOXD genes either has no effect (HOXD1 or has partial effects (HOXD3, HOXD4, HOXD11 and HOXD13 on BE(2-C cell proliferation or differentiation. We further show that knockdown of HOXD8 expression, but not that of HOXD9 expression, significantly inhibits the differentiation-inducing activity of RA. HOXD8 directly activates the transcription of HOXC9, a key effector of RA action in neuroblastoma cells. These findings highlight the distinct functions of HOXD genes in RA induction of neuroblastoma cell differentiation.

  14. Differentiation of Spermatogonia Stem Cells into Functional Mature Neurons Characterized with Differential Gene Expression.

    Science.gov (United States)

    Bojnordi, Maryam Nazm; Azizi, Hossein; Skutella, Thomas; Movahedin, Mansoureh; Pourabdolhossein, Fereshteh; Shojaei, Amir; Hamidabadi, Hatef Ghasemi

    2017-09-01

    Transplantation of embryonic stem cells (ESCs) is a promising therapeutic approach for the treatment of neurodegenerative diseases. However, ESCs are not usable clinically due to immunological and ethical limitations. The identification of an alternative safe cell source opens novel options via autologous transplantation in neuro-regeneration circumventing these problems. Here, we examined the neurogenic capacity of embryonic stem-like cells (ES-like cells) derived from the testis using neural growth factor inducers and utilized them to generate functional mature neurons. The neuronal differentiation of ES-like cells is induced in three stages. Stage 1 is related to embryoid body (EB) formation. To induce neuroprogenitor cells, EBs were cultured in the presence of retinoic acid, N 2 supplement and fibroblast growth factor followed by culturing in a neurobasal medium containing B 27 , N 2 supplements for additional 10 days, to allow the maturation and development of neuronal progenitor cells. The neurogenic differentiation was confirmed by immunostaining for markers of mature neurons. The differentiated neurons were positive for Tuj1 and Tau1. Real-time PCR dates indicated the expression of Nestin and Neuro D (neuroprogenitor markers) in induced cells at the second stage of the differentiation protocol. The differentiated mature neurons exhibited the specific neuron markers Map2 and β-tubulin. The functional maturity of neurons was confirmed by an electrophysiological analysis of passive and active neural membrane properties. These findings indicated a differentiation capacity of ES-like cells derived from the testis to functionally mature neurons, which proposes them as a novel cell source for neuroregenerative medicine.

  15. Functional network analysis of genes differentially expressed during xylogenesis in soc1ful woody Arabidopsis plants.

    Science.gov (United States)

    Davin, Nicolas; Edger, Patrick P; Hefer, Charles A; Mizrachi, Eshchar; Schuetz, Mathias; Smets, Erik; Myburg, Alexander A; Douglas, Carl J; Schranz, Michael E; Lens, Frederic

    2016-06-01

    Many plant genes are known to be involved in the development of cambium and wood, but how the expression and functional interaction of these genes determine the unique biology of wood remains largely unknown. We used the soc1ful loss of function mutant - the woodiest genotype known in the otherwise herbaceous model plant Arabidopsis - to investigate the expression and interactions of genes involved in secondary growth (wood formation). Detailed anatomical observations of the stem in combination with mRNA sequencing were used to assess transcriptome remodeling during xylogenesis in wild-type and woody soc1ful plants. To interpret the transcriptome changes, we constructed functional gene association networks of differentially expressed genes using the STRING database. This analysis revealed functionally enriched gene association hubs that are differentially expressed in herbaceous and woody tissues. In particular, we observed the differential expression of genes related to mechanical stress and jasmonate biosynthesis/signaling during wood formation in soc1ful plants that may be an effect of greater tension within woody tissues. Our results suggest that habit shifts from herbaceous to woody life forms observed in many angiosperm lineages could have evolved convergently by genetic changes that modulate the gene expression and interaction network, and thereby redeploy the conserved wood developmental program. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

  16. A method to identify differential expression profiles of time-course gene data with Fourier transformation.

    Science.gov (United States)

    Kim, Jaehee; Ogden, Robert Todd; Kim, Haseong

    2013-10-18

    Time course gene expression experiments are an increasingly popular method for exploring biological processes. Temporal gene expression profiles provide an important characterization of gene function, as biological systems are both developmental and dynamic. With such data it is possible to study gene expression changes over time and thereby to detect differential genes. Much of the early work on analyzing time series expression data relied on methods developed originally for static data and thus there is a need for improved methodology. Since time series expression is a temporal process, its unique features such as autocorrelation between successive points should be incorporated into the analysis. This work aims to identify genes that show different gene expression profiles across time. We propose a statistical procedure to discover gene groups with similar profiles using a nonparametric representation that accounts for the autocorrelation in the data. In particular, we first represent each profile in terms of a Fourier basis, and then we screen out genes that are not differentially expressed based on the Fourier coefficients. Finally, we cluster the remaining gene profiles using a model-based approach in the Fourier domain. We evaluate the screening results in terms of sensitivity, specificity, FDR and FNR, compare with the Gaussian process regression screening in a simulation study and illustrate the results by application to yeast cell-cycle microarray expression data with alpha-factor synchronization.The key elements of the proposed methodology: (i) representation of gene profiles in the Fourier domain; (ii) automatic screening of genes based on the Fourier coefficients and taking into account autocorrelation in the data, while controlling the false discovery rate (FDR); (iii) model-based clustering of the remaining gene profiles. Using this method, we identified a set of cell-cycle-regulated time-course yeast genes. The proposed method is general and can be

  17. Identification of differentially expressed genes in flax (Linum usitatissimum L.) under saline-alkaline stress by digital gene expression.

    Science.gov (United States)

    Yu, Ying; Huang, Wengong; Chen, Hongyu; Wu, Guangwen; Yuan, Hongmei; Song, Xixia; Kang, Qinghua; Zhao, Dongsheng; Jiang, Weidong; Liu, Yan; Wu, Jianzhong; Cheng, Lili; Yao, Yubo; Guan, Fengzhi

    2014-10-01

    The salinization and alkalization of soil are widespread environmental problems, and alkaline salt stress is more destructive than neutral salt stress. Therefore, understanding the mechanism of plant tolerance to saline-alkaline stress has become a major challenge. However, little attention has been paid to the mechanism of plant alkaline salt tolerance. In this study, gene expression profiling of flax was analyzed under alkaline-salt stress (AS2), neutral salt stress (NSS) and alkaline stress (AS) by digital gene expression. Three-week-old flax seedlings were placed in 25 mM Na2CO3 (pH11.6) (AS2), 50mM NaCl (NSS) and NaOH (pH11.6) (AS) for 18 h. There were 7736, 1566 and 454 differentially expressed genes in AS2, NSS and AS compared to CK, respectively. The GO category gene enrichment analysis revealed that photosynthesis was particularly affected in AS2, carbohydrate metabolism was particularly affected in NSS, and the response to biotic stimulus was particularly affected in AS. We also analyzed the expression pattern of five categories of genes including transcription factors, signaling transduction proteins, phytohormones, reactive oxygen species proteins and transporters under these three stresses. Some key regulatory gene families involved in abiotic stress, such as WRKY, MAPKKK, ABA, PrxR and ion channels, were differentially expressed. Compared with NSS and AS, AS2 triggered more differentially expressed genes and special pathways, indicating that the mechanism of AS2 was more complex than NSS and AS. To the best of our knowledge, this was the first transcriptome analysis of flax in response to saline-alkaline stress. These data indicate that common and diverse features of saline-alkaline stress provide novel insights into the molecular mechanisms of plant saline-alkaline tolerance and offer a number of candidate genes as potential markers of tolerance to saline-alkaline stress. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Msx homeobox genes inhibit differentiation through upregulation of cyclin D1.

    Science.gov (United States)

    Hu, G; Lee, H; Price, S M; Shen, M M; Abate-Shen, C

    2001-06-01

    During development, patterning and morphogenesis of tissues are intimately coordinated through control of cellular proliferation and differentiation. We describe a mechanism by which vertebrate Msx homeobox genes inhibit cellular differentiation by regulation of the cell cycle. We show that misexpression of Msx1 via retroviral gene transfer inhibits differentiation of multiple mesenchymal and epithelial progenitor cell types in culture. This activity of Msx1 is associated with its ability to upregulate cyclin D1 expression and Cdk4 activity, while Msx1 has minimal effects on cellular proliferation. Transgenic mice that express Msx1 under the control of the mouse mammary tumor virus long terminal repeat (MMTV LTR) display impaired differentiation of the mammary epithelium during pregnancy, which is accompanied by elevated levels of cyclin D1 expression. We propose that Msx1 gene expression maintains cyclin D1 expression and prevents exit from the cell cycle, thereby inhibiting terminal differentiation of progenitor cells. Our model provides a framework for reconciling the mutant phenotypes of Msx and other homeobox genes with their functions as regulators of cellular proliferation and differentiation during embryogenesis.

  19. Differentiation of Xylella fastidiosa strains via multilocus sequence analysis of environmentally mediated genes (MLSA-E).

    Science.gov (United States)

    Parker, Jennifer K; Havird, Justin C; De La Fuente, Leonardo

    2012-03-01

    Isolates of the plant pathogen Xylella fastidiosa are genetically very similar, but studies on their biological traits have indicated differences in virulence and infection symptomatology. Taxonomic analyses have identified several subspecies, and phylogenetic analyses of housekeeping genes have shown broad host-based genetic differences; however, results are still inconclusive for genetic differentiation of isolates within subspecies. This study employs multilocus sequence analysis of environmentally mediated genes (MLSA-E; genes influenced by environmental factors) to investigate X. fastidiosa relationships and differentiate isolates with low genetic variability. Potential environmentally mediated genes, including host colonization and survival genes related to infection establishment, were identified a priori. The ratio of the rate of nonsynonymous substitutions to the rate of synonymous substitutions (dN/dS) was calculated to select genes that may be under increased positive selection compared to previously studied housekeeping genes. Nine genes were sequenced from 54 X. fastidiosa isolates infecting different host plants across the United States. Results of maximum likelihood (ML) and Bayesian phylogenetic (BP) analyses are in agreement with known X. fastidiosa subspecies clades but show novel within-subspecies differentiation, including geographic differentiation, and provide additional information regarding host-based isolate variation and specificity. dN/dS ratios of environmentally mediated genes, though gene dN/dS ratios and correlate with increased sequence variability. MLSA-E can more precisely resolve relationships between closely related bacterial strains with low genetic variability, such as X. fastidiosa isolates. Discovering the genetic relationships between X. fastidiosa isolates will provide new insights into the epidemiology of populations of X. fastidiosa, allowing improved disease management in economically important crops.

  20. Listeria arpJ gene modifies T helper type 2 subset differentiation.

    Science.gov (United States)

    Kanoh, Makoto; Maruyama, Saho; Shen, Hua; Matsumoto, Akira; Shinomiya, Hiroto; Przybilla, Karin; Gouin, Edith; Cossart, Pascale; Goebel, Werner; Asano, Yoshihiro

    2015-07-15

    Although the T-cell subset differentiation pathway has been characterized extensively from the view of host gene regulation, the effects of genes of the pathogen on T-cell subset differentiation during infection have yet to be elucidated. Especially, the bacterial genes that are responsible for this shift have not yet been determined. Utilizing a single-gene-mutation Listeria panel, we investigated genes involved in the host-pathogen interaction that are required for the initiation of T-cell subset differentiation in the early phase of pathogen infection. We demonstrate that the induction of T helper types 1 and 2 (Th1 and Th2) subsets are separate phenomena and are mediated by distinct Listeria genes. We identified several candidate Listeria genes that appear to be involved in the host-Listeria interaction. Among them, arpJ is the strongest candidate gene for inhibiting Th2 subset induction. Furthermore, the analysis utilizing arpJ-deficient Listeria monocytogenes (Lm) revealed that the tumor necrosis factor (TNF) superfamily (Tnfsf) 9-TNF receptor superfamily (Tnfrsf) 9 interaction inhibits the Th2 response during Lm infection. arpJ is the candidate gene for inhibiting Th2 T-cell subset induction. The arpJ gene product influences the expression of Tnfsf/Tnfrsf on antigen-presenting cells and inhibits the Th2 T-cell subset differentiation during Listeria infection. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Replicon-dependent differentiation of symbiosis-related genes in Sinorhizobium strains nodulating Glycine max.

    Science.gov (United States)

    Guo, Hui Juan; Wang, En Tao; Zhang, Xing Xing; Li, Qin Qin; Zhang, Yan Ming; Tian, Chang Fu; Chen, Wen Xin

    2014-02-01

    In order to investigate the genetic differentiation of Sinorhizobium strains nodulating Glycine max and related microevolutionary mechanisms, three housekeeping genes (SMc00019, truA, and thrA) and 16 symbiosis-related genes on the chromosome (7 genes), pSymA (6 genes), and pSymB (3 genes) were analyzed. Five distinct species were identified among the test strains by calculating the average nucleotide identity (ANI) of SMc00019-truA-thrA: Sinorhizobium fredii, Sinorhizobium sojae, Sinorhizobium sp. I, Sinorhizobium sp. II, and Sinorhizobium sp. III. These species assignments were also supported by population genetics and phylogenetic analyses of housekeeping genes and symbiosis-related genes on the chromosome and pSymB. Different levels of genetic differentiation were observed among these species or different replicons. S. sojae was the most divergent from the other test species and was characterized by its low intraspecies diversity and limited geographic distribution. Intergenic recombination dominated the evolution of 19 genes from different replicons. Intraspecies recombination happened frequently in housekeeping genes and symbiosis-related genes on the chromosome and pSymB, whereas pSymA genes showed a clear pattern of lateral-transfer events between different species. Moreover, pSymA genes were characterized by a lower level of polymorphism and recombination than those on the chromosome and pSymB. Taken together, genes from different replicons of rhizobia might be involved in the establishment of symbiosis with legumes, but these symbiosis-related genes might have evolved differently according to their corresponding replicons.

  2. Immunohistochemical findings in rectal duplication mimicking rectal prolapse.

    Science.gov (United States)

    Cortese, M G; Pucci, A; Macchieraldo, R; Sacco Casamassima, M G; Canavese, F

    2008-08-01

    Alimentary tract duplications represent rare anomalies, with only 5 % occurring in the rectum. The variety in clinical presentation may lead to a delay in diagnosis or to incorrect and multiple surgical procedures. We report the clinical, histological and immunohistochemical characteristics of a rectal duplication occurring in a 3-month-old male with an unusual clinical presentation. Using routine histology and immunohistochemistry, the rectal duplication showed the diffuse presence of gastric mucosa with a characteristic immunophenotype (i.e., diffuse cytokeratin 7 positivity and scattered chromogranin immunoreactivity). As far as we know, this is the first report showing an immunohistochemical differentiation pattern of gastric lining in a rectal duplication. Our results, showing the presence of gastric mucosa, are suggestive of a possible origin from the embryonic foregut.

  3. Differential muscle regulatory factor gene expression between larval and adult myogenesis in the frog Xenopus laevis: adult myogenic cell-specific myf5 upregulation and its relation to the notochord suppression of adult muscle differentiation.

    Science.gov (United States)

    Yamane, Hitomi; Nishikawa, Akio

    2013-08-01

    During Xenopus laevis metamorphosis, larval-to-adult muscle conversion depends on the differential responses of adult and larval myogenic cells to thyroid hormone. Essential differences in cell growth, differentiation, and hormone-dependent life-or-death fate have been reported between cultured larval (tail) and adult (hindlimb) myogenic cells. A previous study revealed that tail notochord cells suppress terminal differentiation in adult (but not larval) myogenic cells. However, little is known about the differences in expression patterns of myogenic regulatory factors (MRF) and the satellite cell marker Pax7 between adult and larval myogenic cells. In the present study, we compared mRNA expression of these factors between the two types. At first, reverse transcription polymerase chain reaction analysis of hindlimb buds showed sequential upregulation of myf5, myogenin, myod, and mrf4 during stages 50-54, when limb buds elongate and muscles begin to form. By contrast, in the tail, there was no such increase during the same period. Secondary, these results were duplicated in vitro: adult myogenic cells upregulated myf5, myod, and pax7 in the early culture period, followed by myogenin upregulation and myotube differentiation, while larval myogenic cells did not upregulate these genes and precociously started myotube differentiation. Thirdly, myf5 upregulation and early-phase proliferation in adult myogenic cells were potently inhibited by the presence of notochord cells, suggesting that notochord cells suppress adult myogenesis through inhibiting the transition from Myf5(-) stem cells to Myf5(+) committed myoblasts. All of the data presented here suggest that myf5 upregulation can be a good criterion for the activation of adult myogenesis during X. laevis metamorphosis.

  4. Differential gene expression and Hog1 interaction with osmoresponsive genes in the extremely halotolerant black yeast Hortaea werneckii

    Directory of Open Access Journals (Sweden)

    Plemenitaš Ana

    2007-08-01

    Full Text Available Abstract Background Fluctuations in external salinity force eukaryotic cells to respond by changes in the gene expression of proteins acting in protective biochemical processes, thus counteracting the changing osmotic pressure. The high-osmolarity glycerol (HOG signaling pathway is essential for the efficient up-regulation of the osmoresponsive genes. In this study, the differential gene expression of the extremely halotolerant black yeast Hortaea werneckii was explored. Furthermore, the interaction of mitogen-activated protein kinase HwHog1 and RNA polymerase II with the chromatin in cells adapted to an extremely hypersaline environment was analyzed. Results A cDNA subtraction library was constructed for H. werneckii, adapted to moderate salinity or an extremely hypersaline environment of 4.5 M NaCl. An uncommon osmoresponsive set of 95 differentially expressed genes was identified. The majority of these had not previously been connected with the adaptation of salt-sensitive S. cerevisiae to hypersaline conditions. The transcriptional response in hypersaline-adapted and hypersaline-stressed cells showed that only a subset of the identified genes responded to acute salt-stress, whereas all were differentially expressed in adapted cells. Interaction with HwHog1 was shown for 36 of the 95 differentially expressed genes. The majority of the identified osmoresponsive and HwHog1-dependent genes in H. werneckii have not been previously reported as Hog1-dependent genes in the salt-sensitive S. cerevisiae. The study further demonstrated the co-occupancy of HwHog1 and RNA polymerase II on the chromatin of 17 up-regulated and 2 down-regulated genes in 4.5 M NaCl-adapted H. werneckii cells. Conclusion Extremely halotolerant H. werneckii represents a suitable and highly relevant organism to study cellular responses to environmental salinity. In comparison with the salt-sensitive S. cerevisiae, this yeast shows a different set of genes being expressed at

  5. Deciphering the transcriptional circuitry of microRNA genes expressed during human monocytic differentiation

    KAUST Repository

    Schmeier, Sebastian; MacPherson, Cameron R; Essack, Magbubah; Kaur, Mandeep; Schaefer, Ulf; Suzuki, Harukazu; Hayashizaki, Yoshihide; Bajic, Vladimir B.

    2009-01-01

    Background: Macrophages are immune cells involved in various biological processes including host defence, homeostasis, differentiation, and organogenesis. Disruption of macrophage biology has been linked to increased pathogen infection, inflammation and malignant diseases. Differential gene expression observed in monocytic differentiation is primarily regulated by interacting transcription factors (TFs). Current research suggests that microRNAs (miRNAs) degrade and repress translation of mRNA, but also may target genes involved in differentiation. We focus on getting insights into the transcriptional circuitry regulating miRNA genes expressed during monocytic differentiation. Results: We computationally analysed the transcriptional circuitry of miRNA genes during monocytic differentiation using in vitro time-course expression data for TFs and miRNAs. A set of TF?miRNA associations was derived from predicted TF binding sites in promoter regions of miRNA genes. Time-lagged expression correlation analysis was utilised to evaluate the TF?miRNA associations. Our analysis identified 12 TFs that potentially play a central role in regulating miRNAs throughout the differentiation process. Six of these 12 TFs (ATF2, E2F3, HOXA4, NFE2L1, SP3, and YY1) have not previously been described to be important for monocytic differentiation. The remaining six TFs are CEBPB, CREB1, ELK1, NFE2L2, RUNX1, and USF2. For several miRNAs (miR-21, miR-155, miR-424, and miR-17-92), we show how their inferred transcriptional regulation impacts monocytic differentiation. Conclusions: The study demonstrates that miRNAs and their transcriptional regulatory control are integral molecular mechanisms during differentiation. Furthermore, it is the first study to decipher on a large-scale, how miRNAs are controlled by TFs during human monocytic differentiation. Subsequently, we have identified 12 candidate key controllers of miRNAs during this differentiation process. 2009 Schmeier et al; licensee Bio

  6. Deciphering the transcriptional circuitry of microRNA genes expressed during human monocytic differentiation

    KAUST Repository

    Schmeier, Sebastian

    2009-12-10

    Background: Macrophages are immune cells involved in various biological processes including host defence, homeostasis, differentiation, and organogenesis. Disruption of macrophage biology has been linked to increased pathogen infection, inflammation and malignant diseases. Differential gene expression observed in monocytic differentiation is primarily regulated by interacting transcription factors (TFs). Current research suggests that microRNAs (miRNAs) degrade and repress translation of mRNA, but also may target genes involved in differentiation. We focus on getting insights into the transcriptional circuitry regulating miRNA genes expressed during monocytic differentiation. Results: We computationally analysed the transcriptional circuitry of miRNA genes during monocytic differentiation using in vitro time-course expression data for TFs and miRNAs. A set of TF?miRNA associations was derived from predicted TF binding sites in promoter regions of miRNA genes. Time-lagged expression correlation analysis was utilised to evaluate the TF?miRNA associations. Our analysis identified 12 TFs that potentially play a central role in regulating miRNAs throughout the differentiation process. Six of these 12 TFs (ATF2, E2F3, HOXA4, NFE2L1, SP3, and YY1) have not previously been described to be important for monocytic differentiation. The remaining six TFs are CEBPB, CREB1, ELK1, NFE2L2, RUNX1, and USF2. For several miRNAs (miR-21, miR-155, miR-424, and miR-17-92), we show how their inferred transcriptional regulation impacts monocytic differentiation. Conclusions: The study demonstrates that miRNAs and their transcriptional regulatory control are integral molecular mechanisms during differentiation. Furthermore, it is the first study to decipher on a large-scale, how miRNAs are controlled by TFs during human monocytic differentiation. Subsequently, we have identified 12 candidate key controllers of miRNAs during this differentiation process. 2009 Schmeier et al; licensee Bio

  7. Myeloid translocation genes differentially regulate colorectal cancer programs

    Science.gov (United States)

    Parang, Bobak; Bradley, Amber M.; Mittal, Mukul K.; Short, Sarah P.; Thompson, Joshua J.; Barrett, Caitlyn W.; Naik, Rishi D.; Bilotta, Anthony J.; Washington, Mary K.; Revetta, Frank L.; Smith, Jesse J.; Chen, Xi; Wilson, Keith T.; Hiebert, Scott W.; Williams, Christopher S.

    2016-01-01

    Myeloid translocation genes (MTGs), originally identified as chromosomal translocations in acute myelogenous leukemia, are transcriptional corepressors that regulate hematopoietic stem cell programs. Analysis of The Cancer Genome Atlas (TCGA) database revealed that MTGs were mutated in epithelial malignancy and suggested that loss of function might promote tumorigenesis. Genetic deletion of MTGR1 and MTG16 in the mouse has revealed unexpected and unique roles within the intestinal epithelium. Mtgr1−/− mice have progressive depletion of all intestinal secretory cells, and Mtg16−/− mice have a decrease in goblet cells. Furthermore, both Mtgr1−/− and Mtg16−/− mice have increased intestinal epithelial cell proliferation. We thus hypothesized that loss of MTGR1 or MTG16 would modify Apc1638/+-dependent intestinal tumorigenesis. Mtgr1−/− mice, but not Mtg16−/− mice, had a 10-fold increase in tumor multiplicity. This was associated with more advanced dysplasia, including progression to invasive adenocarcinoma, and augmented intratumoral proliferation. Analysis of ChIP-seq datasets for MTGR1 and MTG16 targets indicated that MTGR1 can regulate Wnt and Notch signaling. In support of this, immunohistochemistry and gene expression analysis revealed that both Wnt and Notch signaling pathways were hyperactive in Mtgr1−/− tumors. Furthermore, in human colorectal cancer (CRC) samples MTGR1 was downregulated at both the transcript and protein level. Overall our data indicates that MTGR1 has a context dependent effect on intestinal tumorigenesis. PMID:27270437

  8. Morphological differentiation despite gene flow in an endangered grasshopper.

    Science.gov (United States)

    Dowle, Eddy J; Morgan-Richards, Mary; Trewick, Steven A

    2014-10-16

    Gene flow is traditionally considered a limitation to speciation because selection is required to counter the homogenising effect of allele exchange. Here we report on two sympatric short-horned grasshoppers species in the South Island of New Zealand; one (Sigaus australis) widespread and the other (Sigaus childi) a narrow endemic. Of the 79 putatively neutral markers (mtDNA, microsatellite loci, ITS sequences and RAD-seq SNPs) all but one marker we examined showed extensive allele sharing, and similar or identical allele frequencies in the two species where they co-occur. We found no genetic evidence of deviation from random mating in the region of sympatry. However, analysis of morphological and geometric traits revealed no evidence of morphological introgression. Based on phenotype the two species are clearly distinct, but their genotypes thus far reveal no divergence. The best explanation for this is that some loci associated with the distinguishing morphological characters are under strong selection, but exchange of neutral loci is occurring freely between the two species. Although it is easier to define species as requiring a barrier between them, a dynamic model that accommodates gene flow is a biologically more reasonable explanation for these grasshoppers.

  9. Differential gene expression of wheat progeny with contrasting levels of transpiration efficiency.

    Science.gov (United States)

    Xue, Gang-Ping; McIntyre, C Lynne; Chapman, Scott; Bower, Neil I; Way, Heather; Reverter, Antonio; Clarke, Bryan; Shorter, Ray

    2006-08-01

    High water use efficiency or transpiration efficiency (TE) in wheat is a desirable physiological trait for increasing grain yield under water-limited environments. The identification of genes associated with this trait would facilitate the selection for genotypes with higher TE using molecular markers. We performed an expression profiling (microarray) analysis of approximately 16,000 unique wheat ESTs to identify genes that were differentially expressed between wheat progeny lines with contrasting TE levels from a cross between Quarrion (high TE) and Genaro 81 (low TE). We also conducted a second microarray analysis to identify genes responsive to drought stress in wheat leaves. Ninety-three genes that were differentially expressed between high and low TE progeny lines were identified. One fifth of these genes were markedly responsive to drought stress. Several potential growth-related regulatory genes, which were down-regulated by drought, were expressed at a higher level in the high TE lines than the low TE lines and are potentially associated with a biomass production component of the Quarrion-derived high TE trait. Eighteen of the TE differentially expressed genes were further analysed using quantitative RT-PCR on a separate set of plant samples from those used for microarray analysis. The expression levels of 11 of the 18 genes were positively correlated with the high TE trait, measured as carbon isotope discrimination (Delta(13)C). These data indicate that some of these TE differentially expressed genes are candidates for investigating processes that underlie the high TE trait or for use as expression quantitative trait loci (eQTLs) for TE.

  10. Clustering based gene expression feature selection method: A computational approach to enrich the classifier efficiency of differentially expressed genes

    KAUST Repository

    Abusamra, Heba

    2016-07-20

    The native nature of high dimension low sample size of gene expression data make the classification task more challenging. Therefore, feature (gene) selection become an apparent need. Selecting a meaningful and relevant genes for classifier not only decrease the computational time and cost, but also improve the classification performance. Among different approaches of feature selection methods, however most of them suffer from several problems such as lack of robustness, validation issues etc. Here, we present a new feature selection technique that takes advantage of clustering both samples and genes. Materials and methods We used leukemia gene expression dataset [1]. The effectiveness of the selected features were evaluated by four different classification methods; support vector machines, k-nearest neighbor, random forest, and linear discriminate analysis. The method evaluate the importance and relevance of each gene cluster by summing the expression level for each gene belongs to this cluster. The gene cluster consider important, if it satisfies conditions depend on thresholds and percentage otherwise eliminated. Results Initial analysis identified 7120 differentially expressed genes of leukemia (Fig. 15a), after applying our feature selection methodology we end up with specific 1117 genes discriminating two classes of leukemia (Fig. 15b). Further applying the same method with more stringent higher positive and lower negative threshold condition, number reduced to 58 genes have be tested to evaluate the effectiveness of the method (Fig. 15c). The results of the four classification methods are summarized in Table 11. Conclusions The feature selection method gave good results with minimum classification error. Our heat-map result shows distinct pattern of refines genes discriminating between two classes of leukemia.

  11. Transcriptome analysis reveals key differentially expressed genes involved in wheat grain development

    Directory of Open Access Journals (Sweden)

    Yonglong Yu

    2016-04-01

    Full Text Available Wheat seed development is an important physiological process of seed maturation and directly affects wheat yield and quality. In this study, we performed dynamic transcriptome microarray analysis of an elite Chinese bread wheat cultivar (Jimai 20 during grain development using the GeneChip Wheat Genome Array. Grain morphology and scanning electron microscope observations showed that the period of 11–15 days post-anthesis (DPA was a key stage for the synthesis and accumulation of seed starch. Genome-wide transcriptional profiling and significance analysis of microarrays revealed that the period from 11 to 15 DPA was more important than the 15–20 DPA stage for the synthesis and accumulation of nutritive reserves. Series test of cluster analysis of differential genes revealed five statistically significant gene expression profiles. Gene ontology annotation and enrichment analysis gave further information about differentially expressed genes, and MapMan analysis revealed expression changes within functional groups during seed development. Metabolic pathway network analysis showed that major and minor metabolic pathways regulate one another to ensure regular seed development and nutritive reserve accumulation. We performed gene co-expression network analysis to identify genes that play vital roles in seed development and identified several key genes involved in important metabolic pathways. The transcriptional expression of eight key genes involved in starch and protein synthesis and stress defense was further validated by qRT-PCR. Our results provide new insight into the molecular mechanisms of wheat seed development and the determinants of yield and quality.

  12. Analysis of mammary specific gene locus regulation in differentiated cells derived by somatic cell fusion

    International Nuclear Information System (INIS)

    Robinson, Claire; Kolb, Andreas F.

    2009-01-01

    The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A β-galactosidase reporter gene was inserted in place of the β-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the β-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal β-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the β-casein gene

  13. Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

    Directory of Open Access Journals (Sweden)

    Sateesh Krishnamurthy

    2012-01-01

    Full Text Available The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE or human airway epithelia (HAE grown at the air–liquid interface (ALI, the delivery of a Dicer-substrate small-interfering RNA (DsiRNA duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF, a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi responses.

  14. Comparative transcriptome analysis reveals differentially expressed genes associated with sex expression in garden asparagus (Asparagus officinalis).

    Science.gov (United States)

    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gao, Wu-Jun

    2017-08-22

    Garden asparagus (Asparagus officinalis) is a highly valuable vegetable crop of commercial and nutritional interest. It is also commonly used to investigate the mechanisms of sex determination and differentiation in plants. However, the sex expression mechanisms in asparagus remain poorly understood. De novo transcriptome sequencing via Illumina paired-end sequencing revealed more than 26 billion bases of high-quality sequence data from male and female asparagus flower buds. A total of 72,626 unigenes with an average length of 979 bp were assembled. In comparative transcriptome analysis, 4876 differentially expressed genes (DEGs) were identified in the possible sex-determining stage of female and male/supermale flower buds. Of these DEGs, 433, including 285 male/supermale-biased and 149 female-biased genes, were annotated as flower related. Of the male/supermale-biased flower-related genes, 102 were probably involved in anther development. In addition, 43 DEGs implicated in hormone response and biosynthesis putatively associated with sex expression and reproduction were discovered. Moreover, 128 transcription factor (TF)-related genes belonging to various families were found to be differentially expressed, and this finding implied the essential roles of TF in sex determination or differentiation in asparagus. Correlation analysis indicated that miRNA-DEG pairs were also implicated in asparagus sexual development. Our study identified a large number of DEGs involved in the sex expression and reproduction of asparagus, including known genes participating in plant reproduction, plant hormone signaling, TF encoding, and genes with unclear functions. We also found that miRNAs might be involved in the sex differentiation process. Our study could provide a valuable basis for further investigations on the regulatory networks of sex determination and differentiation in asparagus and facilitate further genetic and genomic studies on this dioecious species.

  15. Differential expression of diacylglycerol acyltransferase (DGAT) genes in olive tissues.

    Science.gov (United States)

    Giannoulia, K; Haralampidis, K; Poghosyan, Z; Murphy, D J; Hatzopoulos, P

    2000-12-01

    Fatty acids are accumulated in triacylglycerols (TAGs), in specialized organelles of seeds named oil bodies. The major site of TAG accumulation is detected in developing seed and mesocarp of certain species. We have isolated two cDNAs encoding DGAT enzymes from olives. The deduced polypeptides differ by 26 amino acids in size. However, they have high homology and almost identical hydropathy profiles. The DGAT gene is expressed in all tissues that synthesize TAGs. However, higher levels of DGAT transcripts have been detected in seed tissues of developing olive drupe. DGAT expression and mRNA accumulation in drupe tissues is developmentally regulated. Each DGAT transcript shows a distinct profile of accumulation. The existence of two different DGAT transcripts might reflect two different enzymes with discrete function and/or localization.

  16. Osteoblast Differentiation and Bone Formation Gene Expression in Strontium-inducing Bone Marrow Mesenchymal Stem Cell

    OpenAIRE

    SILA-ASNA, MONNIPHA; BUNYARATVEJ, AHNOND; Maeda, Sakan; Kitaguchi, Hiromichi; BUNYARATAVEJ, NARONG

    2007-01-01

    Osteoblastic differentiation from human mesenchymal stem cell (hMSCs) is animportant step of bone formation. We studied the in vitro induction of hMSCs byusing strontium ranelate, a natural trace amount in water, food and human skeleton.The mRNA synthesis of various osteoblast specific genes was assessed by means ofreverse transcription polymerase chain reaction (RT-PCR). In the hMSCs culture,strontium ranelate could enhance the induction of hMSCs to differentiate intoosteoblasts. Cbfa1 gene ...

  17. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  18. Differential Expression of Hox and Notch Genes in Larval and Adult Stages of Echinococcus granulosus.

    Science.gov (United States)

    Dezaki, Ebrahim Saedi; Yaghoobi, Mohammad Mehdi; Taheri, Elham; Almani, Pooya Ghaseminejad; Tohidi, Farideh; Gottstein, Bruno; Harandi, Majid Fasihi

    2016-10-01

    This investigation aimed to evaluate the differential expression of HoxB7 and notch genes in different developmental stages of Echinococcus granulosus sensu stricto. The expression of HoxB7 gene was observed at all developmental stages. Nevertheless, significant fold differences in the expression level was documented in the juvenile worm with 3 or more proglottids, the germinal layer from infected sheep, and the adult worm from an experimentally infected dog. The notch gene was expressed at all developmental stages of E. granulosus ; however, the fold difference was significantly increased at the microcysts in monophasic culture medium and the germinal layer of infected sheep in comparison with other stages. The findings demonstrated that the 2 aforementioned genes evaluated in the present study were differentially expressed at different developmental stages of the parasite and may contribute to some important biological processes of E. granulosus .

  19. Global Analysis of Differentially Expressed Genes and Proteins in the Wheat Callus Infected by Agrobacterium tumefaciens

    Science.gov (United States)

    Zhou, Xiaohong; Wang, Ke; Lv, Dongwen; Wu, Chengjun; Li, Jiarui; Zhao, Pei; Lin, Zhishan; Du, Lipu; Yan, Yueming; Ye, Xingguo

    2013-01-01

    Agrobacterium-mediated plant transformation is an extremely complex and evolved process involving genetic determinants of both the bacteria and the host plant cells. However, the mechanism of the determinants remains obscure, especially in some cereal crops such as wheat, which is recalcitrant for Agrobacterium-mediated transformation. In this study, differentially expressed genes (DEGs) and differentially expressed proteins (DEPs) were analyzed in wheat callus cells co-cultured with Agrobacterium by using RNA sequencing (RNA-seq) and two-dimensional electrophoresis (2-DE) in conjunction with mass spectrometry (MS). A set of 4,889 DEGs and 90 DEPs were identified, respectively. Most of them are related to metabolism, chromatin assembly or disassembly and immune defense. After comparative analysis, 24 of the 90 DEPs were detected in RNA-seq and proteomics datasets simultaneously. In addition, real-time RT-PCR experiments were performed to check the differential expression of the 24 genes, and the results were consistent with the RNA-seq data. According to gene ontology (GO) analysis, we found that a big part of these differentially expressed genes were related to the process of stress or immunity response. Several putative determinants and candidate effectors responsive to Agrobacterium mediated transformation of wheat cells were discussed. We speculate that some of these genes are possibly related to Agrobacterium infection. Our results will help to understand the interaction between Agrobacterium and host cells, and may facilitate developing efficient transformation strategies in cereal crops. PMID:24278131

  20. Global analysis of differentially expressed genes and proteins in the wheat callus infected by Agrobacterium tumefaciens.

    Directory of Open Access Journals (Sweden)

    Xiaohong Zhou

    Full Text Available Agrobacterium-mediated plant transformation is an extremely complex and evolved process involving genetic determinants of both the bacteria and the host plant cells. However, the mechanism of the determinants remains obscure, especially in some cereal crops such as wheat, which is recalcitrant for Agrobacterium-mediated transformation. In this study, differentially expressed genes (DEGs and differentially expressed proteins (DEPs were analyzed in wheat callus cells co-cultured with Agrobacterium by using RNA sequencing (RNA-seq and two-dimensional electrophoresis (2-DE in conjunction with mass spectrometry (MS. A set of 4,889 DEGs and 90 DEPs were identified, respectively. Most of them are related to metabolism, chromatin assembly or disassembly and immune defense. After comparative analysis, 24 of the 90 DEPs were detected in RNA-seq and proteomics datasets simultaneously. In addition, real-time RT-PCR experiments were performed to check the differential expression of the 24 genes, and the results were consistent with the RNA-seq data. According to gene ontology (GO analysis, we found that a big part of these differentially expressed genes were related to the process of stress or immunity response. Several putative determinants and candidate effectors responsive to Agrobacterium mediated transformation of wheat cells were discussed. We speculate that some of these genes are possibly related to Agrobacterium infection. Our results will help to understand the interaction between Agrobacterium and host cells, and may facilitate developing efficient transformation strategies in cereal crops.

  1. Microarray analyses of glucocorticoid and vitamin D3 target genes in differentiating cultured human podocytes.

    Directory of Open Access Journals (Sweden)

    Xiwen Cheng

    Full Text Available Glomerular podocytes are highly differentiated epithelial cells that are key components of the kidney filtration units. Podocyte damage or loss is the hallmark of nephritic diseases characterized by severe proteinuria. Recent studies implicate that hormones including glucocorticoids (ligand for glucocorticoid receptor and vitamin D3 (ligand for vitamin D receptor protect or promote repair of podocytes from injury. In order to elucidate the mechanisms underlying hormone-mediated podocyte-protecting activity from injury, we carried out microarray gene expression studies to identify the target genes and corresponding pathways in response to these hormones during podocyte differentiation. We used immortalized human cultured podocytes (HPCs as a model system and carried out in vitro differentiation assays followed by dexamethasone (Dex or vitamin D3 (VD3 treatment. Upon the induction of differentiation, multiple functional categories including cell cycle, organelle dynamics, mitochondrion, apoptosis and cytoskeleton organization were among the most significantly affected. Interestingly, while Dex and VD3 are capable of protecting podocytes from injury, they only share limited target genes and affected pathways. Compared to VD3 treatment, Dex had a broader and greater impact on gene expression profiles. In-depth analyses of Dex altered genes indicate that Dex crosstalks with a broad spectrum of signaling pathways, of which inflammatory responses, cell migration, angiogenesis, NF-κB and TGFβ pathways are predominantly altered. Together, our study provides new information and identifies several new avenues for future investigation of hormone signaling in podocytes.

  2. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  3. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

    2013-01-01

    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  4. Temporal expression pattern of genes during the period of sex differentiation in human embryonic gonads

    DEFF Research Database (Denmark)

    Mamsen, Linn S; Ernst, Emil H; Borup, Rehannah

    2017-01-01

    The precise timing and sequence of changes in expression of key genes and proteins during human sex-differentiation and onset of steroidogenesis was evaluated by whole-genome expression in 67 first trimester human embryonic and fetal ovaries and testis and confirmed by qPCR and immunohistochemistry...... (IHC). SRY/SOX9 expression initiated in testis around day 40 pc, followed by initiation of AMH and steroidogenic genes required for androgen production at day 53 pc. In ovaries, gene expression of RSPO1, LIN28, FOXL2, WNT2B, and ETV5, were significantly higher than in testis, whereas GLI1...... was significantly higher in testis than ovaries. Gene expression was confirmed by IHC for GAGE, SOX9, AMH, CYP17A1, LIN28, WNT2B, ETV5 and GLI1. Gene expression was not associated with the maternal smoking habits. Collectively, a precise temporal determination of changes in expression of key genes involved in human...

  5. Differential reconstructed gene interaction networks for deriving toxicity threshold in chemical risk assessment

    OpenAIRE

    Yang, Yi; Maxwell, Andrew; Zhang, Xiaowei; Wang, Nan; Perkins, Edward J; Zhang, Chaoyang; Gong, Ping

    2013-01-01

    Background Pathway alterations reflected as changes in gene expression regulation and gene interaction can result from cellular exposure to toxicants. Such information is often used to elucidate toxicological modes of action. From a risk assessment perspective, alterations in biological pathways are a rich resource for setting toxicant thresholds, which may be more sensitive and mechanism-informed than traditional toxicity endpoints. Here we developed a novel differential networks (DNs) appro...

  6. cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

    OpenAIRE

    Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

    1999-01-01

    A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

  7. Functional relationships between genes associated with differentiation potential of aged myogenic progenitors

    Directory of Open Access Journals (Sweden)

    Radhakrishnan Nagarajan

    2010-09-01

    Full Text Available Aging is accompanied by considerable heterogeneity with possible co-expression of differentiation pathways. The present study investigates the interplay between crucial myogenic, adipogenic and Wnt-related genes orchestrating aged myogenic progenitor differentiation (AMPD using clonal gene expression profiling in conjunction with Bayesian structure learning (BSL techniques. The expression of three myogenic regulatory factor genes (Myogenin, Myf-5, MyoD1, four genes involved in regulating adipogenic potential (C/EBPα, DDIT3, FoxC2, PPARγ, and two genes in the Wnt-signaling pathway (Lrp5, Wnt5a known to influence both differentiation programs were determined across thirty-four clones by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR. Three control genes were used for normalization of the clonal expression data (18S, GAPDH and B2M. Constraint-based BSL techniques, namely (a PC Algorithm, (b Grow-shrink algorithm (GS, and (c Incremental Association Markov Blanket (IAMB were used to model the functional relationships (FRs in the form of acyclic networks from the clonal expression profiles. A novel resampling approach that obviates the need for a user-defined confidence threshold is proposed to identify statistically significant FRs at small sample sizes. Interestingly, the resulting acyclic network consisted of FRs corresponding to myogenic, adipogenic, Wnt-related genes and their interaction. A significant number of these FRs were robust to normalization across the three house-keeping genes and the choice of the BSL technique. The results presented elucidate the delicate balance between differentiation pathways (i.e. myogenic as well as adipogenic and possible cross-talk between pathways in AMPD.

  8. In silico reversal of repeat-induced point mutation (RIP identifies the origins of repeat families and uncovers obscured duplicated genes

    Directory of Open Access Journals (Sweden)

    Hane James K

    2010-11-01

    Full Text Available Abstract Background Repeat-induced point mutation (RIP is a fungal genome defence mechanism guarding against transposon invasion. RIP mutates the sequence of repeated DNA and over time renders the affected regions unrecognisable by similarity search tools such as BLAST. Results DeRIP is a new software tool developed to predict the original sequence of a RIP-mutated region prior to the occurrence of RIP. In this study, we apply deRIP to the genome of the wheat pathogen Stagonospora nodorum SN15 and predict the origin of several previously uncharacterised classes of repetitive DNA. Conclusions Five new classes of transposon repeats and four classes of endogenous gene repeats were identified after deRIP. The deRIP process is a new tool for fungal genomics that facilitates the identification and understanding of the role and origin of fungal repetitive DNA. DeRIP is open-source and is available as part of the RIPCAL suite at http://www.sourceforge.net/projects/ripcal.

  9. Identification of differentially expressed genes in cucumber (Cucumis sativus L.) root under waterlogging stress by digital gene expression profile.

    Science.gov (United States)

    Qi, Xiao-Hua; Xu, Xue-Wen; Lin, Xiao-Jian; Zhang, Wen-Jie; Chen, Xue-Hao

    2012-03-01

    High-throughput tag-sequencing (Tag-seq) analysis based on the Solexa Genome Analyzer platform was applied to analyze the gene expression profiling of cucumber plant at 5 time points over a 24h period of waterlogging treatment. Approximately 5.8 million total clean sequence tags per library were obtained with 143013 distinct clean tag sequences. Approximately 23.69%-29.61% of the distinct clean tags were mapped unambiguously to the unigene database, and 53.78%-60.66% of the distinct clean tags were mapped to the cucumber genome database. Analysis of the differentially expressed genes revealed that most of the genes were down-regulated in the waterlogging stages, and the differentially expressed genes mainly linked to carbon metabolism, photosynthesis, reactive oxygen species generation/scavenging, and hormone synthesis/signaling. Finally, quantitative real-time polymerase chain reaction using nine genes independently verified the tag-mapped results. This present study reveals the comprehensive mechanisms of waterlogging-responsive transcription in cucumber. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Differential expression of transglutaminase genes in patients with chronic periodontitis.

    Science.gov (United States)

    Currò, M; Matarese, G; Isola, G; Caccamo, D; Ventura, V P; Cornelius, C; Lentini, M; Cordasco, G; Ientile, R

    2014-09-01

    Gingival epithelium plays a key role in the protection of oral tissues from microbial challenge, especially during the periodontal disease. This study was aimed to evaluate levels of mRNA transcripts of different forms of transglutaminase in the human gingival tissues from patients with chronic periodontitis and relative controls. This study included 22 patients with chronic periodontitis (CP) and 22 healthy controls. For each patient, the values of probing depth (PD), clinical attachment level (CAL), and bleeding on probing (BOP) were recorded. Gene expression of transglutaminase 1, transglutaminase 2, transglutaminase 3, and metalloprotease 2 was evaluated by real-time PCR, while that of Factor XIIIA and metalloprotease 9 by RT-PCR. The values of all the clinical parameters were significantly higher in the CP group than in the healthy control group (P chronic injury in the damaged gingival and emphasizes the key role of these enzymes in gingival remodelling/healing and adaptive processes. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Regulation and patterns of endogenous and exogenous gene expression during differentiation of embryonal carcinoma cells

    International Nuclear Information System (INIS)

    Astigiano, S.; Sherman, M.I.; Abarzua, P.

    1989-01-01

    Embryonal carcinoma (EC) cells offer an interesting model system for evaluating differentiation because the cells are pluripotent, thus resembling germ cells and embryonic stem cells, and because a number of agents have been defined that are capable of promoting the differentiation of these cells. This chapter examines how EC cells might be triggered to differentiate, with emphasis on retinoic acid because this compound is a potent, naturally occurring inducer that has been studied extensively in this system. The nature of alterations in gene expression during EC cell differentiation is reviewed from the perspective of evaluating whether these changes are likely to be responsible for, or a result of, the differentiation event. Finally, the authors consider in molecular terms why EC cells, but not their differentiated derivatives, are refractory to the expression of many viral genomes following infection. Based upon these studies, they propose that fundamental changes in gene expression that are observed when differentiation is triggered in EC cells are likely to be due to the disappearance or neutralization of strong repressor elements

  12. Identification of Powdery Mildew Responsive Genes in Hevea brasiliensis through mRNA Differential Display

    Science.gov (United States)

    Li, Xiang; Bi, Zhenghong; Di, Rong; Liang, Peng; He, Qiguang; Liu, Wenbo; Miao, Weiguo; Zheng, Fucong

    2016-01-01

    Powdery mildew is an important disease of rubber trees caused by Oidium heveae B. A. Steinmann. As far as we know, none of the resistance genes related to powdery mildew have been isolated from the rubber tree. There is little information available at the molecular level regarding how a rubber tree develops defense mechanisms against this pathogen. We have studied rubber tree mRNA transcripts from the resistant RRIC52 cultivar by differential display analysis. Leaves inoculated with the spores of O. heveae were collected from 0 to 120 hpi in order to identify pathogen-regulated genes at different infection stages. We identified 78 rubber tree genes that were differentially expressed during the plant–pathogen interaction. BLAST analysis for these 78 ESTs classified them into seven functional groups: cell wall and membrane pathways, transcription factor and regulatory proteins, transporters, signal transduction, phytoalexin biosynthesis, other metabolism functions, and unknown functions. The gene expression for eight of these genes was validated by qRT-PCR in both RRIC52 and the partially susceptible Reyan 7-33-97 cultivars, revealing the similar or differential changes of gene expressions between these two cultivars. This study has improved our overall understanding of the molecular mechanisms of rubber tree resistance to powdery mildew. PMID:26840302

  13. Differential susceptibility to maternal expressed emotion in children with ADHD and their siblings? Investigating plasticity genes, prosocial and antisocial behaviour

    NARCIS (Netherlands)

    Richards, Jennifer S; Hartman, Catharina A; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Arias Vásquez, Alejandro; Buitelaar, Jan K

    The differential susceptibility theory states that children differ in their susceptibility towards environmental experiences, partially due to plasticity genes. Individuals carrying specific variants in such genes will be more disadvantaged in negative but, conversely, more advantaged in positive

  14. Alternative splicing and differential gene expression in colon cancer detected by a whole genome exon array

    Directory of Open Access Journals (Sweden)

    Sugnet Charles

    2006-12-01

    Full Text Available Abstract Background Alternative splicing is a mechanism for increasing protein diversity by excluding or including exons during post-transcriptional processing. Alternatively spliced proteins are particularly relevant in oncology since they may contribute to the etiology of cancer, provide selective drug targets, or serve as a marker set for cancer diagnosis. While conventional identification of splice variants generally targets individual genes, we present here a new exon-centric array (GeneChip Human Exon 1.0 ST that allows genome-wide identification of differential splice variation, and concurrently provides a flexible and inclusive analysis of gene expression. Results We analyzed 20 paired tumor-normal colon cancer samples using a microarray designed to detect over one million putative exons that can be virtually assembled into potential gene-level transcripts according to various levels of prior supporting evidence. Analysis of high confidence (empirically supported transcripts identified 160 differentially expressed genes, with 42 genes occupying a network impacting cell proliferation and another twenty nine genes with unknown functions. A more speculative analysis, including transcripts based solely on computational prediction, produced another 160 differentially expressed genes, three-fourths of which have no previous annotation. We also present a comparison of gene signal estimations from the Exon 1.0 ST and the U133 Plus 2.0 arrays. Novel splicing events were predicted by experimental algorithms that compare the relative contribution of each exon to the cognate transcript intensity in each tissue. The resulting candidate splice variants were validated with RT-PCR. We found nine genes that were differentially spliced between colon tumors and normal colon tissues, several of which have not been previously implicated in cancer. Top scoring candidates from our analysis were also found to substantially overlap with EST-based bioinformatic

  15. Gene expression profiling reveals new potential players of gonad differentiation in the chicken embryo.

    Directory of Open Access Journals (Sweden)

    Gwenn-Aël Carré

    Full Text Available BACKGROUND: In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s involved in gonad differentiation is still incomplete. METHODOLOGY/PRINCIPAL FINDINGS: With the aim of improving characterization of the molecular pathway(s involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. CONCLUSION/SIGNIFICANCE: This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors

  16. Normal uniform mixture differential gene expression detection for cDNA microarrays

    Directory of Open Access Journals (Sweden)

    Raftery Adrian E

    2005-07-01

    Full Text Available Abstract Background One of the primary tasks in analysing gene expression data is finding genes that are differentially expressed in different samples. Multiple testing issues due to the thousands of tests run make some of the more popular methods for doing this problematic. Results We propose a simple method, Normal Uniform Differential Gene Expression (NUDGE detection for finding differentially expressed genes in cDNA microarrays. The method uses a simple univariate normal-uniform mixture model, in combination with new normalization methods for spread as well as mean that extend the lowess normalization of Dudoit, Yang, Callow and Speed (2002 1. It takes account of multiple testing, and gives probabilities of differential expression as part of its output. It can be applied to either single-slide or replicated experiments, and it is very fast. Three datasets are analyzed using NUDGE, and the results are compared to those given by other popular methods: unadjusted and Bonferroni-adjusted t tests, Significance Analysis of Microarrays (SAM, and Empirical Bayes for microarrays (EBarrays with both Gamma-Gamma and Lognormal-Normal models. Conclusion The method gives a high probability of differential expression to genes known/suspected a priori to be differentially expressed and a low probability to the others. In terms of known false positives and false negatives, the method outperforms all multiple-replicate methods except for the Gamma-Gamma EBarrays method to which it offers comparable results with the added advantages of greater simplicity, speed, fewer assumptions and applicability to the single replicate case. An R package called nudge to implement the methods in this paper will be made available soon at http://www.bioconductor.org.

  17. Gene Expression Profiling Reveals New Potential Players of Gonad Differentiation in the Chicken Embryo

    Science.gov (United States)

    Carré, Gwenn-Aël; Couty, Isabelle; Hennequet-Antier, Christelle; Govoroun, Marina S.

    2011-01-01

    Background In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s) involved in gonad differentiation is still incomplete. Methodology/Principal Findings With the aim of improving characterization of the molecular pathway(s) involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein) and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. Conclusion/Significance This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors of chicken gonad

  18. Consistent Differential Expression Pattern (CDEP) on microarray to identify genes related to metastatic behavior.

    Science.gov (United States)

    Tsoi, Lam C; Qin, Tingting; Slate, Elizabeth H; Zheng, W Jim

    2011-11-11

    To utilize the large volume of gene expression information generated from different microarray experiments, several meta-analysis techniques have been developed. Despite these efforts, there remain significant challenges to effectively increasing the statistical power and decreasing the Type I error rate while pooling the heterogeneous datasets from public resources. The objective of this study is to develop a novel meta-analysis approach, Consistent Differential Expression Pattern (CDEP), to identify genes with common differential expression patterns across different datasets. We combined False Discovery Rate (FDR) estimation and the non-parametric RankProd approach to estimate the Type I error rate in each microarray dataset of the meta-analysis. These Type I error rates from all datasets were then used to identify genes with common differential expression patterns. Our simulation study showed that CDEP achieved higher statistical power and maintained low Type I error rate when compared with two recently proposed meta-analysis approaches. We applied CDEP to analyze microarray data from different laboratories that compared transcription profiles between metastatic and primary cancer of different types. Many genes identified as differentially expressed consistently across different cancer types are in pathways related to metastatic behavior, such as ECM-receptor interaction, focal adhesion, and blood vessel development. We also identified novel genes such as AMIGO2, Gem, and CXCL11 that have not been shown to associate with, but may play roles in, metastasis. CDEP is a flexible approach that borrows information from each dataset in a meta-analysis in order to identify genes being differentially expressed consistently. We have shown that CDEP can gain higher statistical power than other existing approaches under a variety of settings considered in the simulation study, suggesting its robustness and insensitivity to data variation commonly associated with microarray

  19. In Silico Gene-Level Evolution Explains Microbial Population Diversity through Differential Gene Mobility

    NARCIS (Netherlands)

    van Dijk, Bram; Hogeweg, P.

    2016-01-01

    Microbial communities can show astonishing ecological and phylogenetic diversity. What is the role of pervasive horizontal gene transfer (HGT) in shaping this diversity in the presence of clonally expanding "killer strains"? Does HGT of antibiotic production and resistance genes erase phylogenetic

  20. Adipose gene expression prior to weight loss can differentiate and weakly predict dietary responders.

    Directory of Open Access Journals (Sweden)

    David M Mutch

    Full Text Available BACKGROUND: The ability to identify obese individuals who will successfully lose weight in response to dietary intervention will revolutionize disease management. Therefore, we asked whether it is possible to identify subjects who will lose weight during dietary intervention using only a single gene expression snapshot. METHODOLOGY/PRINCIPAL FINDINGS: The present study involved 54 female subjects from the Nutrient-Gene Interactions in Human Obesity-Implications for Dietary Guidelines (NUGENOB trial to determine whether subcutaneous adipose tissue gene expression could be used to predict weight loss prior to the 10-week consumption of a low-fat hypocaloric diet. Using several statistical tests revealed that the gene expression profiles of responders (8-12 kgs weight loss could always be differentiated from non-responders (<4 kgs weight loss. We also assessed whether this differentiation was sufficient for prediction. Using a bottom-up (i.e. black-box approach, standard class prediction algorithms were able to predict dietary responders with up to 61.1%+/-8.1% accuracy. Using a top-down approach (i.e. using differentially expressed genes to build a classifier improved prediction accuracy to 80.9%+/-2.2%. CONCLUSION: Adipose gene expression profiling prior to the consumption of a low-fat diet is able to differentiate responders from non-responders as well as serve as a weak predictor of subjects destined to lose weight. While the degree of prediction accuracy currently achieved with a gene expression snapshot is perhaps insufficient for clinical use, this work reveals that the comprehensive molecular signature of adipose tissue paves the way for the future of personalized nutrition.

  1. Differential gene expression profiles of peripheral blood mononuclear cells in childhood asthma.

    Science.gov (United States)

    Kong, Qian; Li, Wen-Jing; Huang, Hua-Rong; Zhong, Ying-Qiang; Fang, Jian-Pei

    2015-05-01

    Asthma is a common childhood disease with strong genetic components. This study compared whole-genome expression differences between asthmatic young children and healthy controls to identify gene signatures of childhood asthma. Total RNA extracted from peripheral blood mononuclear cells (PBMC) was subjected to microarray analysis. QRT-PCR was performed to verify the microarray results. Classification and functional characterization of differential genes were illustrated by hierarchical clustering and gene ontology analysis. Multiple logistic regression (MLR) analysis, receiver operating characteristic (ROC) curve analysis, and discriminate power were used to scan asthma-specific diagnostic markers. For fold-change>2 and p childhood asthma model for prediction and diagnosis.

  2. Differential gene expression in colon cancer of the caecum versus the sigmoid and rectosigmoid

    DEFF Research Database (Denmark)

    Birkenkamp-Demtroder, K; Olesen, S H; Sørensen, Flemming Brandt

    2005-01-01

    or left sided tumours of the colon, showing more pronounced differences in Dukes' C than B tumours. Thirty genes differentially expressed in tumour tissue were common to adenocarcinomas of both sides, including known tumour markers such as the matrix metalloproteinases. Keratins 8, 19, and 20 as well...

  3. CHD1 regulates cell fate determination by activation of differentiation-induced genes.

    Science.gov (United States)

    Baumgart, Simon J; Najafova, Zeynab; Hossan, Tareq; Xie, Wanhua; Nagarajan, Sankari; Kari, Vijayalakshmi; Ditzel, Nicholas; Kassem, Moustapha; Johnsen, Steven A

    2017-07-27

    The coordinated temporal and spatial activation of gene expression is essential for proper stem cell differentiation. The Chromodomain Helicase DNA-binding protein 1 (CHD1) is a chromatin remodeler closely associated with transcription and nucleosome turnover downstream of the transcriptional start site (TSS). In this study, we show that CHD1 is required for the induction of osteoblast-specific gene expression, extracellular-matrix mineralization and ectopic bone formation in vivo. Genome-wide occupancy analyses revealed increased CHD1 occupancy around the TSS of differentiation-activated genes. Furthermore, we observed that CHD1-dependent genes are mainly induced during osteoblast differentiation and are characterized by higher levels of CHD1 occupancy around the TSS. Interestingly, CHD1 depletion resulted in increased pausing of RNA Polymerase II (RNAPII) and decreased H2A.Z occupancy close to the TSS, but not at enhancer regions. These findings reveal a novel role for CHD1 during osteoblast differentiation and provide further insights into the intricacies of epigenetic regulatory mechanisms controlling cell fate determination. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Differential accumulation of nif structural gene mRNA in Azotobacter vinelandii.

    Science.gov (United States)

    Hamilton, Trinity L; Jacobson, Marty; Ludwig, Marcus; Boyd, Eric S; Bryant, Donald A; Dean, Dennis R; Peters, John W

    2011-09-01

    Northern analysis was employed to investigate mRNA produced by mutant strains of Azotobacter vinelandii with defined deletions in the nif structural genes and in the intergenic noncoding regions. The results indicate that intergenic RNA secondary structures effect the differential accumulation of transcripts, supporting the high Fe protein-to-MoFe protein ratio required for optimal diazotrophic growth.

  5. Identification and expression patterns of adipokine genes during adipocyte differentiation in the Tibetan goat (Capra hircus).

    Science.gov (United States)

    Li, Xueying; Wang, Yan; Guo, Jiazhong; Zhong, Tao; Li, Li; Zhang, Hongping; Wang, Linjie

    2018-02-15

    Adipokines are secreted by adipose tissue and play an important role in the regulation of lipid metabolism. However, the information regarding adipokines in goats is limited. PPARγ is a key gene in adipocyte differentiation and activates adipokine genes. Rosiglitazone is a PPARγ agonist and can promote the expression of PPARγ to increase the expression of lipogenesis-related genes. Therefore, investigation of the relationship between rosiglitazone and adipokines will help us to better understand the function of PPARγ in lipid metabolism in Tibetan goats. In this study, we cloned the resistin (RETN), apelin (APLN), fibroblast growth factor 21 (FGF21), and visfatin (NAMPT) genes from non-pregnant female Tibetan goat adipose tissue. APLN and NAMPT were predominantly expressed in the kidney, and FGF21 was expressed at the highest levels in the liver in vivo. In fat tissues, the highest expression levels of FGF21 and RETN were detected in omental fat, whereas their expression in perirenal and subcutaneous fat was extremely weak. APLN and NAMPT were abundantly expressed in omental and subcutaneous fat in vivo. In addition, the four adipokines had different expression profiles during goat adipocyte differentiation in vitro. Oil red O staining showed that rosiglitazone could promote adipocyte differentiation and lipid droplet formation. In addition, rosiglitazone significantly increased the expression of FGF21 and RETN (pgoat adipocyte differentiation. And PPARγ could regulate the expression of the four adipokines, but the detailed regulatory mechanism still needs to be elucidated. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Profile of Inflammation-associated genes during Hepatic Differentiation of Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Joseph Ignatius Irudayam

    2015-12-01

    Full Text Available Expression of genes associated with inflammation was analyzed during differentiation of human pluripotent stem cells (PSCs to hepatic cells. Messenger RNA transcript profiles of differentiated endoderm (day 5, hepatoblast (day 15 and hepatocyte-like cells (day 21 were obtained by RNA sequencing analysis. When compared to endoderm cells an immature cell type, the hepatic cells (days 15 and 21 had significantly higher expression of acute phase protein genes including complement factors, coagulation factors, serum amyloid A and serpins. Furthermore, hepatic phase of cells expressed proinflammatory cytokines IL18 and IL32 as well as cytokine receptors IL18R1, IL1R1, IL1RAP, IL2RG, IL6R, IL6ST and IL10RB. These cells also produced CCL14, CCL15, and CXCL- 1, 2, 3, 16 and 17 chemokines. Endoderm cells had higher levels of chemokine receptors, CXCR4 and CXCR7, than that of hepatic cells. Sirtuin family of genes involved in aging, inflammation and metabolism were differentially regulated in endoderm and hepatic phase cells. Ligands and receptors of the tumor necrosis factor (TNF family as well as downstream signaling factors TRAF2, TRAF4, FADD, NFKB1 and NFKBIB were differentially expressed during hepatic differentiation.

  7. Melanoma differentiation associated gene-7/interleukin-24 (mda-7/IL-24): Novel gene therapeutic for metastatic melanoma

    International Nuclear Information System (INIS)

    Fisher, Paul B.; Sarkar, Devanand; Lebedeva, Irina V.; Emdad, Luni; Gupta, Pankaj; Sauane, Moira; Su Zaozhong; Grant, Steven; Dent, Paul; Curiel, David T.; Senzer, Neil; Nemunaitis, John

    2007-01-01

    A potentially less toxic approach for cancer therapy comprises induction of tumor cells to lose growth potential irreversibly and terminally differentiate. Combining this scheme termed 'differentiation therapy of cancer' with subtraction hybridization to human melanoma cells resulted in the cloning of melanoma differentiation associated (mda) genes displaying elevated expression as a consequence of induction of terminal differentiation. One originally novel gene, mda-7, was found to display elevated expression in normal melanocytes and nevi with progressive loss of expression as a consequence of melanoma development and progression to metastasis. Based on structure, biochemical properties and chromosomal location, mda-7 has now been reclassified as interleukin (IL)-24, a member of the expanding IL-10 family of cytokines. In vitro cell culture and in vivo animal studies indicate that mda-7/IL-24 selectively induces programmed cell death (apoptosis) in multiple human cancers (including melanomas), without harming normal cells, and promotes profound anti-tumor activity in nude mice containing human tumor xenografts. Based on these remarkable properties, a Phase I clinical trial was conducted to test the safety of administration of mda-7/IL-24 by a replication incompetent adenovirus (Ad.mda-7; INGN 241) in patients with advanced solid cancers including melanoma. mda-7/IL-24 was found to be safe and to promote significant clinical activity, particularly in the context of patients with metastatic melanoma. These results provide an impetus for further clinical studies and document a central paradigm of cancer therapy, namely translation of basic science from the 'bench to the bedside.'

  8. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen

    2011-01-01

    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  9. Differential expression and interaction of host factors augment HIV-1 gene expression in neonatal mononuclear cells

    International Nuclear Information System (INIS)

    Sundaravaradan, Vasudha; Mehta, Roshni; Harris, David T.; Zack, Jerome A.; Ahmad, Nafees

    2010-01-01

    We have previously shown a higher level of HIV-1 replication and gene expression in neonatal (cord) blood mononuclear cells (CBMC) compared with adult blood cells (PBMC), which could be due to differential expression of host factors. We performed the gene expression profile of CBMC and PBMC and found that 8013 genes were expressed at higher levels in CBMC than PBMC and 8028 genes in PBMC than CBMC, including 1181 and 1414 genes upregulated after HIV-1 infection in CBMC and PBMC, respectively. Several transcription factors (NF-κB, E2F, HAT-1, TFIIE, Cdk9, Cyclin T1), signal transducers (STAT3, STAT5A) and cytokines (IL-1β, IL-6, IL-10) were upregulated in CBMC than PBMC, which are known to influence HIV-1 replication. In addition, a repressor of HIV-1 transcription, YY1, was down regulated in CBMC than PBMC and several matrix metalloproteinase (MMP-7, -12, -14) were significantly upregulated in HIV-1 infected CBMC than PBMC. Furthermore, we show that CBMC nuclear extracts interacted with a higher extent to HIV-1 LTR cis-acting sequences, including NF-κB, NFAT, AP1 and NF-IL6 compared with PBMC nuclear extracts and retroviral based short hairpin RNA (shRNA) for STAT3 and IL-6 down regulated their own and HIV-1 gene expression, signifying that these factors influenced differential HIV-1 gene expression in CBMC than PBMC.

  10. Differential gene expression profile in pig adipose tissue treated with/without clenbuterol

    Directory of Open Access Journals (Sweden)

    Deng Xue M

    2007-11-01

    Full Text Available Abstract Background Clenbuterol, a beta-agonist, can dramatically reduce pig adipose accumulation at high dosages. However, it has been banned in pig production because people who eat pig products treated with clenbuterol can be poisoned by the clenbuterol residues. To understand the molecular mechanism for this fat reduction, cDNA microarray, real-time PCR, two-dimensional electrophoresis and mass spectra were used to study the differential gene expression profiles of pig adipose tissues treated with/without clenbuterol. The objective of this research is to identify novel genes and physiological pathways that potentially facilitate clenbuterol induced reduction of adipose accumulation. Results Clenbuterol was found to improve the lean meat percentage about 10 percent (P Conclusion Pig fat accumulation was reduced dramatically with clenbuterol treatment. Histological sections and global evaluation of gene expression after administration of clenbuterol in pigs identified profound changes in adipose cells. With clenbuterol stimulation, adipose cell volumes decreased and their gene expression profile changed, which indicate some metabolism processes have been also altered. Although the biological functions of the differentially expressed genes are not completely known, higher expressions of these molecules in adipose tissue might contribute to the reduction of fat accumulation. Among these genes, five lipid metabolism related genes were of special interest for further study, including apoD and apoR. The apoR expression was increased at both the RNA and protein levels. The apoR may be one of the critical molecules through which clenbuterol reduces fat accumulation.

  11. Identification of genes differentially expressed in testes containing carcinoma in situ

    DEFF Research Database (Denmark)

    Hoei-Hansen, C E; Nielsen, J E; Almstrup, K

    2004-01-01

    Virtually all testicular germ cell tumours originate from a common precursor, the carcinoma in situ (CIS) cell. The precise nature of the molecular mechanisms leading to CIS remains largely unknown. We performed the first systematic analysis of gene expression in testis with CIS compared to normal...... the novel expressed sequence tag (EST) OIC1 (Overexpressed In CIS). The genes could be grouped functionally into genes involved in cell growth, proliferation, differentiation, immunological response, and genes with unknown biological function. Examples of overexpressed genes are SFRP1 that is involved...... to testicular development (e.g. DCN, IGFBP6, SFRP1, SALL1), supporting our hypothesis that the origin of CIS is probably associated with disturbances of the fetal development of the testis....

  12. Functional features of gene expression profiles differentiating gastrointestinal stromal tumours according to KIT mutations and expression

    International Nuclear Information System (INIS)

    Ostrowski, Jerzy; Dobosz, Anna Jerzak Vel; Jarosz, Dorota; Ruka, Wlodzimierz; Wyrwicz, Lucjan S; Polkowski, Marcin; Paziewska, Agnieszka; Skrzypczak, Magdalena; Goryca, Krzysztof; Rubel, Tymon; Kokoszyñska, Katarzyna; Rutkowski, Piotr; Nowecki, Zbigniew I

    2009-01-01

    Gastrointestinal stromal tumours (GISTs) represent a heterogeneous group of tumours of mesenchymal origin characterized by gain-of-function mutations in KIT or PDGFRA of the type III receptor tyrosine kinase family. Although mutations in either receptor are thought to drive an early oncogenic event through similar pathways, two previous studies reported the mutation-specific gene expression profiles. However, their further conclusions were rather discordant. To clarify the molecular characteristics of differentially expressed genes according to GIST receptor mutations, we combined microarray-based analysis with detailed functional annotations. Total RNA was isolated from 29 frozen gastric GISTs and processed for hybridization on GENECHIP ® HG-U133 Plus 2.0 microarrays (Affymetrix). KIT and PDGFRA were analyzed by sequencing, while related mRNA levels were analyzed by quantitative RT-PCR. Fifteen and eleven tumours possessed mutations in KIT and PDGFRA, respectively; no mutation was found in three tumours. Gene expression analysis identified no discriminative profiles associated with clinical or pathological parameters, even though expression of hundreds of genes differentiated tumour receptor mutation and expression status. Functional features of genes differentially expressed between the two groups of GISTs suggested alterations in angiogenesis and G-protein-related and calcium signalling. Our study has identified novel molecular elements likely to be involved in receptor-dependent GIST development and allowed confirmation of previously published results. These elements may be potential therapeutic targets and novel markers of KIT mutation status

  13. Differential expression of genes regulated in response to drought stress in diploid cotton (Gossypium arboreum) (abstract)

    International Nuclear Information System (INIS)

    Hussain, T.; Majeed, A.; Maqbool, A.; Hussain, S.S.; Ali, T.; Riazuddin, S.

    2005-01-01

    Negative effects on the Water status of plants is one of the most common and deleterious stresses experienced by wild and cultivated plants throughout the World. Our project is designed to identify, clone and characterize gene sequences regulated in response to Water stress (e.g., drought). We used the differential-display reverse transcriptase polymerase chain reaction (DD-RT- PCA) methodology to accomplish our Objectives. Structural and functional characterization of environmental stress-induced genes has contributed to a better understanding of how plants respond and adapt to different abiotic stresses. Differential display was used to compare overall difference in gene expression between draught stressed and unstressed (control) plants of diploid Cotton (Gossypium arboreum). DDRT-PCR product from stressed and unstressed samples resolved side by side on 6% PAGE to compare qualitative and quantitative difference in mRNA expression. A total of 81 primer combinations were tested. DDRT -PCR enabled us to identify differentially expressed transcripts between water stressed and non-stressed cotton seedlings. PAGE revealed a total of 347 DNA transcripts in stressed samples (New Transcripts) while 110 down regulated and 209 up regulated DNA transcripts were also recorded. Similarly. 22 DNA transcripts were identified based on the comparative study of PAGE and Agarose gel electrophoresis. These sequences showed various degree homology With draught tolerant genes in the gene bank. (author)

  14. Differential gene expression between African American and European American colorectal cancer patients.

    Directory of Open Access Journals (Sweden)

    Biljana Jovov

    Full Text Available The incidence and mortality of colorectal cancer (CRC is higher in African Americans (AAs than other ethnic groups in the U. S., but reasons for the disparities are unknown. We performed gene expression profiling of sporadic CRCs from AAs vs. European Americans (EAs to assess the contribution to CRC disparities. We evaluated the gene expression of 43 AA and 43 EA CRC tumors matched by stage and 40 matching normal colorectal tissues using the Agilent human whole genome 4x44K cDNA arrays. Gene and pathway analyses were performed using Significance Analysis of Microarrays (SAM, Ten-fold cross validation, and Ingenuity Pathway Analysis (IPA. SAM revealed that 95 genes were differentially expressed between AA and EA patients at a false discovery rate of ≤5%. Using IPA we determined that most prominent disease and pathway associations of differentially expressed genes were related to inflammation and immune response. Ten-fold cross validation demonstrated that following 10 genes can predict ethnicity with an accuracy of 94%: CRYBB2, PSPH, ADAL, VSIG10L, C17orf81, ANKRD36B, ZNF835, ARHGAP6, TRNT1 and WDR8. Expression of these 10 genes was validated by qRT-PCR in an independent test set of 28 patients (10 AA, 18 EA. Our results are the first to implicate differential gene expression in CRC racial disparities and indicate prominent difference in CRC inflammation between AA and EA patients. Differences in susceptibility to inflammation support the existence of distinct tumor microenvironments in these two patient populations.

  15. A stochastic model for identifying differential gene pair co-expression patterns in prostate cancer progression

    Directory of Open Access Journals (Sweden)

    Mao Yu

    2009-07-01

    Full Text Available Abstract Background The identification of gene differential co-expression patterns between cancer stages is a newly developing method to reveal the underlying molecular mechanisms of carcinogenesis. Most researches of this subject lack an algorithm useful for performing a statistical significance assessment involving cancer progression. Lacking this specific algorithm is apparently absent in identifying precise gene pairs correlating to cancer progression. Results In this investigation we studied gene pair co-expression change by using a stochastic process model for approximating the underlying dynamic procedure of the co-expression change during cancer progression. Also, we presented a novel analytical method named 'Stochastic process model for Identifying differentially co-expressed Gene pair' (SIG method. This method has been applied to two well known prostate cancer data sets: hormone sensitive versus hormone resistant, and healthy versus cancerous. From these data sets, 428,582 gene pairs and 303,992 gene pairs were identified respectively. Afterwards, we used two different current statistical methods to the same data sets, which were developed to identify gene pair differential co-expression and did not consider cancer progression in algorithm. We then compared these results from three different perspectives: progression analysis, gene pair identification effectiveness analysis, and pathway enrichment analysis. Statistical methods were used to quantify the quality and performance of these different perspectives. They included: Re-identification Scale (RS and Progression Score (PS in progression analysis, True Positive Rate (TPR in gene pair analysis, and Pathway Enrichment Score (PES in pathway analysis. Our results show small values of RS and large values of PS, TPR, and PES; thus, suggesting that gene pairs identified by the SIG method are highly correlated with cancer progression, and highly enriched in disease-specific pathways. From

  16. Causal structure of oscillations in gene regulatory networks: Boolean analysis of ordinary differential equation attractors.

    Science.gov (United States)

    Sun, Mengyang; Cheng, Xianrui; Socolar, Joshua E S

    2013-06-01

    A common approach to the modeling of gene regulatory networks is to represent activating or repressing interactions using ordinary differential equations for target gene concentrations that include Hill function dependences on regulator gene concentrations. An alternative formulation represents the same interactions using Boolean logic with time delays associated with each network link. We consider the attractors that emerge from the two types of models in the case of a simple but nontrivial network: a figure-8 network with one positive and one negative feedback loop. We show that the different modeling approaches give rise to the same qualitative set of attractors with the exception of a possible fixed point in the ordinary differential equation model in which concentrations sit at intermediate values. The properties of the attractors are most easily understood from the Boolean perspective, suggesting that time-delay Boolean modeling is a useful tool for understanding the logic of regulatory networks.

  17. Differential expression of granulopoiesis related genes in neutrophil subsets distinguished by membrane expression of CD177

    DEFF Research Database (Denmark)

    Hu, Nan; Mora-Jensen, Helena; Theilgaard-Mønch, Kim

    2014-01-01

    OBJECTIVE: Differential gene expression in CD177+ and CD177- neutrophils was investigated, in order to detect possible differences in neutrophil function which could be related to the pathogenesis of ANCA-associated Vasculitides (AAV). METHODS: Neutrophils were isolated from healthy controls (HC......) with high, negative or bimodal CD177 expression, and sorted into CD177+ and CD177- subpopulations. Total RNA was screened for expression of 24,000 probes with Illumina Ref-8 Beadchips. Genes showing differential expression between CD177+ and CD177- subsets in microarray analysis were re-assessed using...... quantitative-PCR. CD177 expression on neutrophil precursors in bone marrow was analyzed using quantitative PCR and flowcytometry. RESULTS: The proportion of CD177+ cells increased during