WorldWideScience

Sample records for gene deletion demonstrates

  1. Demonstration of the presence of the "deleted" MIR122 gene in HepG2 cells.

    Science.gov (United States)

    Hamad, Ibrahim A Y; Fei, Yue; Kalea, Anastasia Z; Yin, Dan; Smith, Andrew J P; Palmen, Jutta; Humphries, Steve E; Talmud, Philippa J; Walker, Ann P

    2015-01-01

    MicroRNA 122 (miR-122) is highly expressed in the liver where it influences diverse biological processes and pathways, including hepatitis C virus replication and metabolism of iron and cholesterol. It is processed from a long non-coding primary transcript (~7.5 kb) and the gene has two evolutionarily-conserved regions containing the pri-mir-122 promoter and pre-mir-122 hairpin region. Several groups reported that the widely-used hepatocytic cell line HepG2 had deficient expression of miR-122, previously ascribed to deletion of the pre-mir-122 stem-loop region. We aimed to characterise this deletion by direct sequencing of 6078 bp containing the pri-mir-122 promoter and pre-mir-122 stem-loop region in HepG2 and Huh-7, a control hepatocytic cell line reported to express miR-122, supported by sequence analysis of cloned genomic DNA. In contrast to previous findings, the entire sequence was present in both cell lines. Ten SNPs were heterozygous in HepG2 indicating that DNA was present in two copies. Three validation isolates of HepG2 were sequenced, showing identical genotype to the original in two, whereas the third was different. Investigation of promoter chromatin status by FAIRE showed that Huh-7 cells had 6.2 ± 0.19- and 2.7 ± 0.01- fold more accessible chromatin at the proximal (HNF4α-binding) and distal DR1 transcription factor sites, compared to HepG2 cells (p=0.03 and 0.001, respectively). This was substantiated by ENCODE genome annotations, which showed a DNAse I hypersensitive site in the pri-mir-122 promoter in Huh-7 that was absent in HepG2 cells. While the origin of the reported deletion is unclear, cell lines should be obtained from a reputable source and used at low passage number to avoid discrepant results. Deficiency of miR-122 expression in HepG2 cells may be related to a relative deficiency of accessible promoter chromatin in HepG2 versus Huh-7 cells.

  2. Seven gene deletions in seven days

    DEFF Research Database (Denmark)

    Ingemann Jensen, Sheila; Lennen, Rebecca; Herrgard, Markus;

    2015-01-01

    enables growth at 37 °C, thereby facilitating removal of integrated antibiotic cassettes and deletion of additional genes in the same day. Phosphorothioated primers were demonstrated to enable simultaneous deletions during one round of electroporation. Utilizing these methods, we constructed strains...

  3. Targeted Gene Deletion Demonstrates that Cell Adhesion MoleculeICAM-4 is Critical for Erythroblastic Island Formation

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Gloria; Lo, Annie; Short, Sarah A.; Mankelow, Tosti J.; Spring, Frances; Parsons, Stephen F.; Mohandas, Narla; Anstee, David J.; Chasis, Joel Anne

    2006-02-15

    Erythroid progenitors differentiate in erythroblastic islands, bone marrow niches composed of erythroblasts surrounding a central macrophage. Evidence suggests that within islands adhesive interactions regulate erythropoiesis and apoptosis. We are exploring whether erythroid intercellular adhesion molecule-4 (ICAM-4), animmunoglobulin superfamily member, participates in island formation. Earlier, we identified alpha V integrins as ICAM-4 counter receptors. Since macrophages express alpha V, ICAM-4 potentially mediates island attachments. To test this, we generated ICAM-4 knockout mice and developed quantitative, live cell techniques for harvesting intact islands and for reforming islands in vitro. We observed a 47 percent decrease in islands reconstituted from ICAM-4 null marrow compared to wild type. We also found a striking decrease in islands formed in vivo in knockout mice. Further, peptides that block ICAM-4 alpha V adhesion produced a 53-57 percent decrease in reconstituted islands, strongly suggesting that ICAM-4 binding to macrophage alpha V functions in island integrity. Importantly, we documented that alpha V integrin is expressed in macrophages isolated from erythro blastic islands. Collectively, these data provide convincing evidence that ICAM-4 is critical in erythroblastic island formation via ICAM-4/alpha V adhesion and also demonstrate that the novel experimental strategies we developed will be valuable in exploring molecular mechanisms of erythroblastic island formation and their functional role in regulating erythropoiesis.

  4. Deletions of the elastin gene in Williams Syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Greenberg, F.; Nickerson, E.; McCaskill, C. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1994-09-01

    To investigate deletions in the elastin gene in patients with Williams Syndrome (WS), we screened 37 patients and their parents for deletions in the elastin gene by both fluorescence in situ hybridization (FISH) using cosmid cELN272 containing the 5{prime} end of the elastin gene and by polymerase chain reaction (PCR) using a primer pair which amplifies intron 17 in the elastin gene, producing a polymorphic amplification product. Thirty-two patients have been investigated by both the FISH and PCR techniques, one patient was studied only by PCR, and 4 patients were studied only by FISH. Overall, 34 of 37 patients (92%) were deleted for the elastin gene. Using the PCR marker, 14 patients were informative and 12 were shown to be deleted [maternal (n=5) and paternal (n=7)]. Using cosmid cELN272, 33 of 36 patients demonstrated a deletion of chromosome 7q11.23. In one family, both the mother and daughter were deleted due to an apparently de novo deletion arising in the mother. Three patients were not deleted using the elastin cosmid; 2 of these patients have classic WS. Another non-deleted patient has the typical facial features and hypercalcemia but normal intelligence. These three patients will be important in delineating the critical region(s) responsible for the facial features, hypercalcemia, mental retardation and supravalvular aortic stenosis (SVAS). There was not an absolute correlation between deletions in elastin and SVAS, although these individuals may be at risk for other cardiovascular complications such as hypertention. Since the majority of WS patients are deleted for a portion of the elastin gene, most likely this marker will be an important diagnostic tool, although more patients will need to be studied. Those patients who are not deleted but clinically have WS will be missed using only this one marker. Expansion of the critical region to other loci and identification of additional markers will be essential for identifying all patients with WS.

  5. HMG-CoA lyase (HL) gene: Cloning and characterization of the 5{prime} end of the mouse gene, gene targeting in ES cells, and demonstration of large deletions in three HL-deficient patients

    Energy Technology Data Exchange (ETDEWEB)

    Wang, S.; Robert, M.F.; Mitchell, G.A. [Hopital Sainte-Justine, Quebec (Canada)] [and others

    1994-09-01

    3-hydroxy-3-methylglutaryl CoA lyase (HL) is a mitochondrial matrix enzyme which catalyzes the last step of leucine catabolism and of ketogenesis. Autosomal recessive HL deficiency in humans results in episodes of hypoglycemia and coma. We are interested in the pathophysiology of HL deficiency as a model for both amino acid and fatty acid inborn errors. We have cloned the human and mouse HL genes. In order to analyze the 5{prime} nontranslated region of mouse HL gene, we cloned and sequenced a 1.8 kb fragment containing the 5{prime} extremity including exon 1 and about 1.6 kb of 5{prime} nontranslated sequence. The region surrounding exon 1 is CpG-rich (66.4%). Using the criteria of West, the Observed/Expected ratio for CpG dinucleotides is 0.7 ({ge}0.6 is consistent with a CpG island). We are carrying out primer extension and RNase protection experiments to determine the transcription initiation site. We constructed a gene targeting vector by introducing the neomycin resistance gene into exon 2 of a 7.5 kb genomic subclone of the mouse HL gene. Targeting was performed by electroporating 10 mg linearized vector into 10{sup 7} ES cells and selecting for 12 days with G418. 5/228 colonies (2.2%) had homologous recombination as shown by PCR screening and Southern analysis. We are microinjecting the 5 targeted clones into blastocysts to create an HL-deficient mouse. To date we have obtained two chimeras with contributions of 95% and 55% from 129, by coat color estimates. Three of 27 (11%) of the HL-deficient patients studied were suggested by genomic Southern analysis to be homozygous for large intragenic deletions. We confirmed this and defined the boundaries using exonic PCR.

  6. Somatic mosaicism for a DMD gene deletion

    Energy Technology Data Exchange (ETDEWEB)

    Saito, Kayoko; Ikeya, Kiyoko; Kondo, Eri [Tokyo Women`s Medical College (Japan)] [and others

    1995-03-13

    Mosaicism is a mixed state, with two cell populations of different genetic origins caused by a cell mutation occurring after fertilization. In the present case, DNA analysis of lymphocytes led to a DMD diagnosis before death. Postmortem immunocytochemical and DNA analysis showed somatic mosaicism. At age 18 years, blood lymphocyte DNA analysis showed a DMD gene deletion, upstream from exon 7 to the 5{prime} end containing both muscle and brain promoters. As the patient`s mother and elder sister had no deletions, he was considered to have a new mutation. Immunocytochemical studies of postmortem tissues showed that dystrophin was absent from the tongue, deltoid, intercostal, psoas and rectus femoris muscles, but there was a mix of dystrophin-positive and negative fibers in the rectus abdominis, cardiac, temporalis and sternocleidomastoid muscles. All diaphragm cells were dystrophin positive. Polymerase chain reaction (PCR) amplification from all tissues except the temporalis and sternocleidomastoid muscles, diaphragm and kidney, in which no deletion was found, showed the deletion from at least exon 6 to the 5{prime} end containing both muscle and brain promoters. In this case, a genomic deletion of the DMD gene contributed to the formation of tissues derived from both ectoderm and endoderm, and cells of mesodermal origin showed genotypic and phenotypic heterogeneity. Our results indicate a mutation of the present case may have occurred just before the period of germ layer formation. 34 refs., 7 figs.

  7. Group II intron-anchored gene deletion in Clostridium.

    Directory of Open Access Journals (Sweden)

    Kaizhi Jia

    Full Text Available Clostridium plays an important role in commercial and medical use, for which targeted gene deletion is difficult. We proposed an intron-anchored gene deletion approach for Clostridium, which combines the advantage of the group II intron "ClosTron" system and homologous recombination. In this approach, an intron carrying a fragment homologous to upstream or downstream of the target site was first inserted into the genome by retrotransposition, followed by homologous recombination, resulting in gene deletion. A functional unknown operon CAC1493-1494 located in the chromosome, and an operon ctfAB located in the megaplasmid of C. acetobutylicum DSM1731 were successfully deleted by using this approach, without leaving antibiotic marker in the genome. We therefore propose this approach can be used for targeted gene deletion in Clostridium. This approach might also be applicable for gene deletion in other bacterial species if group II intron retrotransposition system is established.

  8. Site-specific deletion and rearrangement of integron insert genes catalyzed by the integron DNA integrase.

    Science.gov (United States)

    Collis, C M; Hall, R M

    1992-01-01

    Deletion of individual antibiotic resistance genes found within the variable region of integrons is demonstrated. Evidence for gene duplications and rearrangements resulting from the insertion of gene units at new locations is also presented. Deletion, duplication, and rearrangement occur only in the presence of the integron-encoded DNA integrase. These events are precise and involve loss or gain of one or more complete insert units or gene cassettes. This confirms the recent definition of gene cassettes as consisting of the gene coding sequences, all except the last 7 bases of the 59-base element found at the 3' end of the gene, and the core site located 5' to the gene (Hall et al., Mol. Microbiol. 5:1941-1959, 1991) and demonstrates that individual gene cassettes are functional units which can be independently mobilized. Both deletions and duplications can be generated by integrase-mediated cointegrate formation followed by integrase-mediated resolution involving a different pair of sites. However, deletion occurs 10 times more frequently than duplication, and we propose that the majority of deletion events are likely to involve integrase-dependent excision of the gene unit to generate a circular gene cassette. The implications of these findings in understanding the evolution of integrons and the spread of antibiotic resistance genes in bacterial populations is discussed. Images PMID:1311297

  9. Characterization of a lymphoblastoid line deleted for lambda immunoglobulin genes

    Energy Technology Data Exchange (ETDEWEB)

    Hough, C.A., White, B.N., Holden, J.A. [Queen`s Univ., Ontario (Canada)

    1995-04-01

    While characterizing the cat eye syndrome (CES) supernumerary chromosome for the presence of {lambda} immunoglobulin gene region sequences, a lymphoblastoid cell line from one CES patient was identified in which there was selection of cells deleted from some IGLC and IGLV genes. Two distinct deletions, one on each chromosome 22, were identified, presumably arising from independent somatic recombination events occurring during B-lymphocyte differentiation. The extent of the deleted regions was determined using probes from the various IGLV subgroups and they each covered at least 82 kilobases. The precise definition of the deletions was not possible because of conservation of some restriction sites in the IGLV region. The cell line was used to map putative IGLV genes within the recombinant phage {lambda}V{lambda}135 to the distal part of the IGLV gene region. 35 refs., 4 figs.

  10. Bilateral hand amyotrophy with PMP-22 gene deletion.

    Science.gov (United States)

    Gochard, A; Guennoc, A M; Praline, J; Malinge, M C; de Toffol, B; Corcia, P

    2007-01-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) phenotypes are heterogeneous. We report the case of a 52-year-old woman without medical history, who complained of bilateral hand weakness suggestive first of a motor neuron disorder. The presence of a diffuse predominant distal demyelinating neuropathy suggested a deletion of PMP-22 gene, which was confirmed by genetic analysis. This case report underlines a novel phenotype related to the deletion of PMP-22 gene.

  11. Exon Deletions of Parkin Gene in Patients with Parkinson Disease

    Institute of Scientific and Technical Information of China (English)

    王涛; 梁直厚; 孙圣刚; 曹学兵; 彭海; 刘红进; 童萼塘

    2004-01-01

    Summary: Mutations in the parkin gene have recently been identified in familial and isolated patients with early-onset Parkinson disease (PD) and that subregions between exon 2 and 4 of the parkin gene are hot spots of deletive mutations. To study the distribution of deletions in the parkin gene among variant subset patients with PD in China, and to explore the role of parkin gene in the pathogenesis of PD, 63 patients were divided into early onset and later onset groups. Exons 1-12 were amplified by PCR, templated by the genomic DNA of patients, and then the deletion distribution detected by agarose electrophoresis. Four patients were found to be carrier of exon deletions in 63 patients with PD. The location of the deletion was on exon 2 (1 case), exon 3 (2 cases) and exon 4 (1 case). All patients were belong to the group of early onset PD. The results showed that parkin gene deletion on exon 2, exon 3 and exon 4 found in Chinese population contributes partly to early onset PD.

  12. The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.

    NARCIS (Netherlands)

    E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan

    1983-01-01

    textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA

  13. The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.

    NARCIS (Netherlands)

    E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan

    1983-01-01

    textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA f

  14. Targeted gene deletions in C. elegans using transposon excision

    Science.gov (United States)

    Frøkjær-Jensen, Christian; Davis, M. Wayne; Hollopeter, Gunther; Taylor, Jon; Harris, Todd; Nix, Paola; Lofgren, Rachel; Prestgard-Duke, Michael; Bastiani, Michael; Moerman, Donald G.; Jorgensen, Erik M.

    2010-01-01

    We have developed a method, MosDel, to generate targeted knock-outs of genes in C. elegans. We make use of the Mos1 transposase to excise a Mos1 transposon adjacent to the region to be deleted. The double-strand break is repaired using injected DNA as a template. Repair can delete up to 25 kb of DNA and simultaneously insert a positive selection marker. PMID:20418868

  15. Inheritable and precise large genomic deletions of non-coding RNA genes in zebrafish using TALENs.

    Directory of Open Access Journals (Sweden)

    Yun Liu

    Full Text Available Transcription activator-like effector nucleases (TALENs have so far been applied to disrupt protein-coding genes which constitute only 2-3% of the genome in animals. The majority (70-90% of the animal genome is actually transcribed as non-coding RNAs (ncRNAs, yet the lack of efficient tools to knockout ncRNA genes hinders studies on their in vivo functions. Here we have developed novel strategies using TALENs to achieve precise and inheritable large genomic deletions and knockout of ncRNA genes in zebrafish. We have demonstrated that individual miRNA genes could be disrupted using one pair of TALENs, whereas large microRNA (miRNA gene clusters and long non-coding RNA (lncRNA genes could be precisely deleted using two pairs of TALENs. We have generated large genomic deletions of two miRNA clusters (the 1.2 kb miR-17-92 cluster and the 79.8 kb miR-430 cluster and one long non-coding RNA (lncRNA gene (the 9.0 kb malat1, and the deletions are transmitted through the germline. Taken together, our results establish TALENs as a robust tool to engineer large genomic deletions and knockout of ncRNA genes, thus opening up new avenues in the application of TALENs to study the genome in vivo.

  16. Gene deletion in an Italian haemophilia B subject.

    Science.gov (United States)

    Bernardi, F; del Senno, L; Barbieri, R; Buzzoni, D; Gambari, R; Marchetti, G; Conconi, F; Panicucci, F; Positano, M; Pitruzzello, S

    1985-01-01

    DNA from 20 Italian haemophilia B patients was analysed by the Southern blotting technique and hybridisation to a factor IX cDNA probe. A large deletion of factor IX gene was detected in one patient with antibodies to the infused factor; the EcoRI pattern of the other 19 subjects examined was normal. Images PMID:4045960

  17. Gene deletion in an Italian haemophilia B subject.

    OpenAIRE

    De Bernardi, F.; del Senno, L; Barbieri, R.; Buzzoni, D; Gambari, R.; Marchetti, G.; Conconi, F; Panicucci, F; Positano, M; Pitruzzello, S

    1985-01-01

    DNA from 20 Italian haemophilia B patients was analysed by the Southern blotting technique and hybridisation to a factor IX cDNA probe. A large deletion of factor IX gene was detected in one patient with antibodies to the infused factor; the EcoRI pattern of the other 19 subjects examined was normal.

  18. Glucocerebrosidase 2 gene deletion rescues type 1 Gaucher disease

    OpenAIRE

    Mistry, Pramod K.; LIU, Jun; Sun, Li; Chuang, Wei-Lien; Yuen, Tony; Yang, Ruhua; Lu, Ping; Zhang, Kate; Li, Jianhua; Keutzer, Joan; Stachnik, Agnes; Mennone, Albert; Boyer, James L; Jain, Dhanpat; Brady, Roscoe O

    2014-01-01

    Type 1 Gaucher disease (GD1) is a rare autosomal recessive disorder caused by inherited mutations in the glucocerebrosidase (GBA1) gene. This disease results in a marked accumulation of glycosphingolipid substrates, causing visceromegaly, cytopenia, and osteopenia. Here, we have rescued this clinical phenotype in GD1 mice by genetically deleting Gba2, a gene encoding a downstream extralysosomal enzyme, GBA2. We also report that sphingosine production in GD1 patients may contribute to the low-...

  19. Functional profiling in Streptococcus mutans: construction and examination of a genomic collection of gene deletion mutants.

    Science.gov (United States)

    Quivey, R G; Grayhack, E J; Faustoferri, R C; Hubbard, C J; Baldeck, J D; Wolf, A S; MacGilvray, M E; Rosalen, P L; Scott-Anne, K; Santiago, B; Gopal, S; Payne, J; Marquis, R E

    2015-12-01

    A collection of tagged deletion mutant strains was created in Streptococcus mutans UA159 to facilitate investigation of the aciduric capability of this oral pathogen. Gene-specific barcoded deletions were attempted in 1432 open reading frames (representing 73% of the genome), and resulted in the isolation of 1112 strains (56% coverage) carrying deletions in distinct non-essential genes. As S. mutans virulence is predicated upon the ability of the organism to survive an acidic pH environment, form biofilms on tooth surfaces, and out-compete other oral microflora, we assayed individual mutant strains for the relative fitness of the deletion strain, compared with the parent strain, under acidic and oxidative stress conditions, as well as for their ability to form biofilms in glucose- or sucrose-containing medium. Our studies revealed a total of 51 deletion strains with defects in both aciduricity and biofilm formation. We have also identified 49 strains whose gene deletion confers sensitivity to oxidative damage and deficiencies in biofilm formation. We demonstrate the ability to examine competitive fitness of mutant organisms using the barcode tags incorporated into each deletion strain to examine the representation of a particular strain in a population. Co-cultures of deletion strains were grown either in vitro in a chemostat to steady-state values of pH 7 and pH 5 or in vivo in an animal model for oral infection. Taken together, these data represent a mechanism for assessing the virulence capacity of this pathogenic microorganism and a resource for identifying future targets for drug intervention to promote healthy oral microflora.

  20. Population stratification of a common APOBEC gene deletion polymorphism.

    Directory of Open Access Journals (Sweden)

    Jeffrey M Kidd

    2007-04-01

    Full Text Available The APOBEC3 gene family plays a role in innate cellular immunity inhibiting retroviral infection, hepatitis B virus propagation, and the retrotransposition of endogenous elements. We present a detailed sequence and population genetic analysis of a 29.5-kb common human deletion polymorphism that removes the APOBEC3B gene. We developed a PCR-based genotyping assay, characterized 1,277 human diversity samples, and found that the frequency of the deletion allele varies significantly among major continental groups (global FST = 0.2843. The deletion is rare in Africans and Europeans (frequency of 0.9% and 6%, more common in East Asians and Amerindians (36.9% and 57.7%, and almost fixed in Oceanic populations (92.9%. Despite a worldwide frequency of 22.5%, analysis of data from the International HapMap Project reveals that no single existing tag single nucleotide polymorphism may serve as a surrogate for the deletion variant, emphasizing that without careful analysis its phenotypic impact may be overlooked in association studies. Application of haplotype-based tests for selection revealed potential pitfalls in the direct application of existing methods to the analysis of genomic structural variation. These data emphasize the importance of directly genotyping structural variation in association studies and of accurately resolving variant breakpoints before proceeding with more detailed population-genetic analysis.

  1. Optimal in silico target gene deletion through nonlinear programming for genetic engineering.

    Science.gov (United States)

    Hong, Chung-Chien; Song, Mingzhou

    2010-02-24

    Optimal selection of multiple regulatory genes, known as targets, for deletion to enhance or suppress the activities of downstream genes or metabolites is an important problem in genetic engineering. Such problems become more feasible to address in silico due to the availability of more realistic dynamical system models of gene regulatory and metabolic networks. The goal of the computational problem is to search for a subset of genes to knock out so that the activity of a downstream gene or a metabolite is optimized. Based on discrete dynamical system modeling of gene regulatory networks, an integer programming problem is formulated for the optimal in silico target gene deletion problem. In the first result, the integer programming problem is proved to be NP-hard and equivalent to a nonlinear programming problem. In the second result, a heuristic algorithm, called GKONP, is designed to approximate the optimal solution, involving an approach to prune insignificant terms in the objective function, and the parallel differential evolution algorithm. In the third result, the effectiveness of the GKONP algorithm is demonstrated by applying it to a discrete dynamical system model of the yeast pheromone pathways. The empirical accuracy and time efficiency are assessed in comparison to an optimal, but exhaustive search strategy. Although the in silico target gene deletion problem has enormous potential applications in genetic engineering, one must overcome the computational challenge due to its NP-hardness. The presented solution, which has been demonstrated to approximate the optimal solution in a practical amount of time, is among the few that address the computational challenge. In the experiment on the yeast pheromone pathways, the identified best subset of genes for deletion showed advantage over genes that were selected empirically. Once validated in vivo, the optimal target genes are expected to achieve higher genetic engineering effectiveness than a trial

  2. Optimal in silico target gene deletion through nonlinear programming for genetic engineering.

    Directory of Open Access Journals (Sweden)

    Chung-Chien Hong

    Full Text Available BACKGROUND: Optimal selection of multiple regulatory genes, known as targets, for deletion to enhance or suppress the activities of downstream genes or metabolites is an important problem in genetic engineering. Such problems become more feasible to address in silico due to the availability of more realistic dynamical system models of gene regulatory and metabolic networks. The goal of the computational problem is to search for a subset of genes to knock out so that the activity of a downstream gene or a metabolite is optimized. METHODOLOGY/PRINCIPAL FINDINGS: Based on discrete dynamical system modeling of gene regulatory networks, an integer programming problem is formulated for the optimal in silico target gene deletion problem. In the first result, the integer programming problem is proved to be NP-hard and equivalent to a nonlinear programming problem. In the second result, a heuristic algorithm, called GKONP, is designed to approximate the optimal solution, involving an approach to prune insignificant terms in the objective function, and the parallel differential evolution algorithm. In the third result, the effectiveness of the GKONP algorithm is demonstrated by applying it to a discrete dynamical system model of the yeast pheromone pathways. The empirical accuracy and time efficiency are assessed in comparison to an optimal, but exhaustive search strategy. SIGNIFICANCE: Although the in silico target gene deletion problem has enormous potential applications in genetic engineering, one must overcome the computational challenge due to its NP-hardness. The presented solution, which has been demonstrated to approximate the optimal solution in a practical amount of time, is among the few that address the computational challenge. In the experiment on the yeast pheromone pathways, the identified best subset of genes for deletion showed advantage over genes that were selected empirically. Once validated in vivo, the optimal target genes are

  3. Large deletion in the NF1 gene associated with dysmorphism

    Energy Technology Data Exchange (ETDEWEB)

    Hughes, H.E.; Maynard, J.; Sourour, E. [University Hospital of Wales, Cardiff (United Kingdom)] [and others

    1994-09-01

    Neurofibromatosis type 1 is an autosomal dominant disorder with a prevalence of 1 in 3000. The major clinical features of the disease include cafe-au-lait spots, neurofibromas, Lisch nodules and auxillary freckling. Six sporadic NF1 patients with dysmorphism and intellectual impairment have been described to have a large deletion extending beyond the NF1 gene. We report another spordiac NF1 patient with severe developmental delay, early growth failure and dysmorphism (not Noonan-like) associated with a large deletion involving the NF1 gene. A panel of 12 polymorphic DNA markers within 4 cM of the NF1 gene were used to screen for the NF1 gene rearrangements. With all the polymorphic markers, only a single band was ever observed in this affected individual. However, with DNA probe EW301 which maps to 17p, a biparental inheritance was observed. Analysis with several microsatellite markers indicated that this patient had not inherited an allele from the father. A reduction in the hybridization signal was also observed when DNA from this patient was screened with cDNAs AE25, P5, B3A, and an extragenic marker EW206, clearly indicating hemizygosity at these loci. The combined evidence of dosage reduction and biparental inheritance with DNA marker EW301 indictates that this patient has a deletion of paternal origin rather than uniparental disomy. Pulsed-field gel electrophoresis has not, so far, revealed any evidence of an altered band pattern; however, studies are continuing. FISH analysis is currently in progress using YACs and cosmids to define the extent of this deletion.

  4. Research Progress on Pseudorabies Gene-deleted Vaccine

    Institute of Scientific and Technical Information of China (English)

    JIN Sheng-zao; CHEN Huang-chun; XIONG Fu

    2002-01-01

    Pseudorabies is caused by pseudorabies virus (PrV), which is a member of family Herpesviridae, subfamily Alphaherpesvirinae and is the agent of acute infectious disease in many domestic and wild animals. Swine was the natural host and reservior of PRV, which inflicts major economic loss in pig industries world wide. Immunization with safe, effective vaccine is main measurements to prevent the disease.In this assay, research progress on PRV gene-deleted vaccine used extensively today was discussed.

  5. Microhomology-mediated deletion and gene conversion in African trypanosomes.

    Science.gov (United States)

    Glover, Lucy; Jun, Junho; Horn, David

    2011-03-01

    Antigenic variation in African trypanosomes is induced by DNA double-strand breaks (DSBs). In these protozoan parasites, DSB repair (DSBR) is dominated by homologous recombination (HR) and microhomology-mediated end joining (MMEJ), while non-homologous end joining (NHEJ) has not been reported. To facilitate the analysis of chromosomal end-joining, we established a system whereby inter-allelic repair by HR is lethal due to loss of an essential gene. Analysis of intrachromosomal end joining in individual DSBR survivors exclusively revealed MMEJ-based deletions but no NHEJ. A survey of microhomologies typically revealed sequences of between 5 and 20 bp in length with several mismatches tolerated in longer stretches. Mean deletions were of 54 bp on the side closest to the break and 284 bp in total. Break proximity, microhomology length and GC-content all favored repair and the pattern of MMEJ described above was similar at several different loci across the genome. We also identified interchromosomal gene conversion involving HR and MMEJ at different ends of a duplicated sequence. While MMEJ-based deletions were RAD51-independent, one-sided MMEJ was RAD51 dependent. Thus, we describe the features of MMEJ in Trypanosoma brucei, which is analogous to micro single-strand annealing; and RAD51 dependent, one-sided MMEJ. We discuss the contribution of MMEJ pathways to genome evolution, subtelomere recombination and antigenic variation.

  6. Amplified and homozygously deleted genes in glioblastoma: impact on gene expression levels.

    Directory of Open Access Journals (Sweden)

    Inês Crespo

    Full Text Available BACKGROUND: Glioblastoma multiforme (GBM displays multiple amplicons and homozygous deletions that involve relevant pathogenic genes and other genes whose role remains unknown. METHODOLOGY: Single-nucleotide polymorphism (SNP-arrays were used to determine the frequency of recurrent amplicons and homozygous deletions in GBM (n = 46, and to evaluate the impact of copy number alterations (CNA on mRNA levels of the genes involved. PRINCIPAL FINDINGS: Recurrent amplicons were detected for chromosomes 7 (50%, 12 (22%, 1 (11%, 4 (9%, 11 (4%, and 17 (4%, whereas homozygous deletions involved chromosomes 9p21 (52% and 10q (22%. Most genes that displayed a high correlation between DNA CNA and mRNA levels were coded in the amplified chromosomes. For some amplicons the impact of DNA CNA on mRNA expression was restricted to a single gene (e.g., EGFR at 7p11.2, while for others it involved multiple genes (e.g., 11 and 5 genes at 12q14.1-q15 and 4q12, respectively. Despite homozygous del(9p21 and del(10q23.31 included multiple genes, association between these DNA CNA and RNA expression was restricted to the MTAP gene. CONCLUSIONS: Overall, our results showed a high frequency of amplicons and homozygous deletions in GBM with variable impact on the expression of the genes involved, and they contributed to the identification of other potentially relevant genes.

  7. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific......, and -168 allowed correct initiation of the transcripts and cell specificity of expression, while quantitative expression gradually decreased. Deletion to -58 completely abolished the expression of the gene. The amount of human product that in mice harboring the longest fragment contributes up to 50...... of the transgene was observed in cell types other than beta-islet cells....

  8. Engineering validamycin production by tandem deletion of γ-butyrolactone receptor genes in Streptomyces hygroscopicus 5008.

    Science.gov (United States)

    Tan, Gao-Yi; Peng, Yao; Lu, Chenyang; Bai, Linquan; Zhong, Jian-Jiang

    2015-03-01

    Paired homologs of γ-butyrolactone (GBL) biosynthesis gene afsA and GBL receptor gene arpA are located at different positions in genome of Streptomyces hygroscopicus 5008. Inactivation of afsA homologs dramatically decreased biosynthesis of validamycin, an important anti-fungal antibiotic and a critical substrate for antidiabetic drug synthesis, and the deletion of arpA homologs increased validamycin production by 26% (ΔshbR1) and 20% (ΔshbR3). By double deletion, the ΔshbR1/R3 mutant showed higher transcriptional levels of adpA-H (the S. hygroscopicus ortholog of the global regulatory gene adpA) and validamycin biosynthetic genes, and validamycin production increased by 55%. Furthermore, by engineering a high-producing industrial strain via tandem deletion of GBL receptor genes, validamycin production and productivity were enhanced from 19 to 24 g/L (by 26%) and from 6.7 to 9.7 g/L(-1) d(-1) (by 45%), respectively, which was the highest ever reported. The strategy demonstrated here may be useful to engineering other Streptomyces spp. with multiple pairs of afsA-arpA homologs.

  9. Inflammatory peeling skin syndrome caused by homozygous genomic deletion in the PSORS1 region encompassing the CDSN gene.

    Science.gov (United States)

    Ishida-Yamamoto, Akemi; Furio, Laetitia; Igawa, Satomi; Honma, Masaru; Tron, Elodie; Malan, Valerie; Murakami, Masamoto; Hovnanian, Alain

    2014-01-01

    Peeling skin syndrome (PSS) type B is a rare recessive genodermatosis characterized by lifelong widespread, reddish peeling of the skin with pruritus. The disease is caused by small-scale mutations in the Corneodesmosin gene (CDSN) leading to premature termination codons. We report for the first time a Japanese case resulting from complete deletion of CDSN. Corneodesmosin was undetectable in the epidermis, and CDSN was unamplifiable by PCR. QMPSF analysis demonstrated deletion of CDSN exons inherited from each parent. Deletion mapping using microsatellite haplotyping, CGH array and PCR analysis established that the genomic deletion spanned 49-72 kb between HCG22 and TCF19, removing CDSN as well as five other genes within the psoriasis susceptibility region 1 (PSORS1) on 6p21.33. This observation widens the spectrum of molecular defects underlying PSS type B and shows that loss of these five genes from the PSORS1 region does not result in an additional cutaneous phenotype.

  10. VIP Gene Deletion in Mice Causes Cardiomyopathy Associated with Upregulation of Heart Failure Genes

    Energy Technology Data Exchange (ETDEWEB)

    Szema, Anthony M.; Hamidi, Sayyed A.; Smith, S. David; Benveniste, Helene; Katare, Rajesh Gopalrao

    2013-05-20

    Vasoactive Intestinal Peptide (VIP), a pulmonary vasodilator and inhibitor of vascular smooth muscle proliferation, is absent in pulmonary arteries of patients with idiopathic pulmonary arterial hypertension (PAH). We previously determined that targeted deletion of the VIP gene in mice leads to PAH with pulmonary vascular remodeling and right ventricular (RV) dilatation. Whether the left ventricle is also affected by VIP gene deletion is unknown. In the current study, we examined if VIP knockout mice (VIP-/-) develop both right (RV) and left ventricular (LV) cardiomyopathy, manifested by LV dilatation and systolic dysfunction, as well as overexpression of genes conducive to heart failure.

  11. Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

    DEFF Research Database (Denmark)

    Fromont-Racine, M; Bucchini, D; Madsen, O;

    1990-01-01

    Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific tra...... of the transgene was observed in cell types other than beta-islet cells.......Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific......, and -168 allowed correct initiation of the transcripts and cell specificity of expression, while quantitative expression gradually decreased. Deletion to -58 completely abolished the expression of the gene. The amount of human product that in mice harboring the longest fragment contributes up to 50...

  12. Deletion and deletion/insertion mutations in the juxtamembrane domain of the FLT3 gene in adult acute myeloid leukemia

    Directory of Open Access Journals (Sweden)

    Kristin K. Deeb

    2014-01-01

    Full Text Available In contrast to FLT3 ITD mutations, in-frame deletions in the FLT3 gene have rarely been described in adult acute leukemia. We report two cases of AML with uncommon in-frame mutations in the juxtamembrane domain of the FLT3 gene: a 3-bp (c.1770_1774delCTACGinsGT; p.F590_V592delinsLF deletion/insertion and a 12-bp (c.1780_1791delTTCAGAGAATAT; p.F594_Y597del deletion. We verified by sequencing that the reading frame of the FLT3 gene was preserved and by cDNA analysis that the mRNA of the mutant allele was expressed in both cases. Given the recent development of FLT3 inhibitors, our findings may be of therapeutic value for AML patients harboring similar FLT3 mutations.

  13. STUDY OF DELETION OF P16 GENE IN THE PROGRESSION OF BRAIN ASTROCYTOMAS

    Institute of Scientific and Technical Information of China (English)

    Zhai Guang; Yuan Xianhou

    1998-01-01

    Objective:To study the relationship between deletion of P16 gene and occurrence and progression of astrocytomas. Methods: The techniques of polymerase chain reaction (PCR) and immunohistochemistry were used to detect the deletion of exon2 of P16 gene and expression of P16 gene in 52 cases of Brain astrocytoma.Results: The deletion rate of exon2 of P16 gene in the tumors analyzed was 34.6%. Most of them with deletion of exon2 of p16 gene were high grade astrocytomas (grade Ⅲ 42%, grade Ⅳ 50%). 61.5% of the tumors were absent from expression of p16 and the deletion rate of p16 protein increased with the grade of astrocytoma (X2=10.83, P<0.005). Conclusion: Deletion of p16 gene and protein may correlate with the malignant progression of astrocytoma.

  14. Increased biomass production and glycogen accumulation in apcE gene deleted Synechocystis sp. PCC 6803.

    Science.gov (United States)

    Joseph, Ancy; Aikawa, Shimpei; Sasaki, Kengo; Matsuda, Fumio; Hasunuma, Tomohisa; Kondo, Akihiko

    2014-01-01

    The effect of phycobilisome antenna-truncation in the cyanobacterium Synechocystis sp. PCC 6803 on biomass production and glycogen accumulation have not yet been fully clarified. To investigate these effects here, the apcE gene, which encodes the anchor protein linking the phycobilisome to the thylakoid membrane, was deleted in a glucose tolerant strain of Synechocystis sp. PCC 6803. Biomass production of the apcE-deleted strain under photoautotrophic and atmospheric air conditions was 1.6 times higher than that of strain PCC 6803 (1.32 ± 0.01 versus 0.84 ± 0.07 g cell-dry weight L(-1), respectively) after 15 days of cultivation. In addition, the glycogen content of the apcE-deleted strain (24.2 ± 0.7%) was also higher than that of strain PCC 6803 (11.1 ± 0.3%). Together, these results demonstrate that antenna truncation by deleting the apcE gene was effective for increasing biomass production and glycogen accumulation under photoautotrophic and atmospheric air conditions in Synechocystis sp. PCC 6803.

  15. R3-R4 deletion in the PRNP gene is associated with Creutzfeldt-Jakob disease (CJD)

    Energy Technology Data Exchange (ETDEWEB)

    Cervenakova, L.; Brown, P.; Nagle, J. [and others

    1994-09-01

    There are conflicting reports on the association of deletions in the PRNP gene on chromosome 20 with CJD, a rapidly progressive fatal spongiform encephalopathy. We accumulated data suggesting that a deletion of R3-R4 type (parts of the third and fourth repeats are deleted from the area of four repeating 24 bp sequences in the 5{prime} region of the gene) is causing CJD. Screening of 129 unaffected control individuals demonstrated presence of a deletion of R2 type in four (1.55% of the studied chromosomes), but none of them had the R3-R4 type. Of 181 screened patients with spongiform encephalopathies, two had a deletion of R3-R4 type with no other mutations in the coding sequence. Both patients had a classical rapidly progressive dementing disease and diffuse spongiform degeneration, and both cases were apparently sporadic. The same R3-R4 type of deletion was detected in three additional neuropathologically confirmed spongiform encephalopathy patients, of which two had other known pathogenic mutations in the PRNP gene: at codon 178 on the methionine allele exhibiting the phenotype of fatal familial insomnia, and codon 200 causing CJD with severe dementia; the third was a patient with iatrogenic CJD who developed the disease after treatment with growth hormone extracted from cadaveric human pituitary glands. In all cases the deletion coincided with a variant sequence at position 129 coding for methionine.

  16. Gene Deletion by Fluorescence-Reported Allelic Exchange Mutagenesis in Chlamydia trachomatis

    Directory of Open Access Journals (Sweden)

    Konrad E. Mueller

    2016-01-01

    Full Text Available Although progress in Chlamydia genetics has been rapid, genomic modification has previously been limited to point mutations and group II intron insertions which truncate protein products. The bacterium has thus far been intractable to gene deletion or more-complex genomic integrations such as allelic exchange. Herein, we present a novel suicide vector dependent on inducible expression of a chlamydial gene that renders Chlamydia trachomatis fully genetically tractable and permits rapid reverse genetics by fluorescence-reported allelic exchange mutagenesis (FRAEM. We describe the first available system of targeting chlamydial genes for deletion or allelic exchange as well as curing plasmids from C. trachomatis serovar L2. Furthermore, this approach permits the monitoring of mutagenesis by fluorescence microscopy without disturbing bacterial growth, a significant asset when manipulating obligate intracellular organisms. As proof of principle, trpA was successfully deleted and replaced with a sequence encoding both green fluorescent protein (GFP and β-lactamase. The trpA-deficient strain was unable to grow in indole-containing medium, and this phenotype was reversed by complementation with trpA expressed in trans. To assess reproducibility at alternate sites, FRAEM was repeated for genes encoding type III secretion effectors CTL0063, CTL0064, and CTL0065. In all four cases, stable mutants were recovered one passage after the observation of transformants, and allelic exchange was limited to the specific target gene, as confirmed by whole-genome sequencing. Deleted sequences were not detected by quantitative real-time PCR (qPCR from isogenic mutant populations. We demonstrate that utilization of the chlamydial suicide vector with FRAEM renders C. trachomatis highly amenable to versatile and efficient genetic manipulation.

  17. Deletion of PLCB1 gene in schizophrenia-affected patients.

    Science.gov (United States)

    Lo Vasco, Vincenza Rita; Cardinale, Giuseppina; Polonia, Patrizia

    2012-04-01

    A prevalence of 1% in the general population and approximately 50% concordance rate in monozygotic twins was reported for schizophrenia, suggesting that genetic predisposition affecting neurodevelopmental processes might combine with environmental risk factors. A multitude of pathways seems to be involved in the aetiology and/or pathogenesis of schizophrenia, including dopaminergic, serotoninergic, muscarinic and glutamatergic signalling. The phosphoinositide signal transduction system and related phosphoinositide-specific phospholipase C (PI-PLC) enzymes seem to represent a point of convergence in these networking pathways during the development of selected brain regions. The existence of a susceptibility locus on the short arm of chromosome 20 moved us to analyse PLCB1, the gene codifying for PI-PLC β1 enzyme, which maps on 20p12. By using interphase fluorescent in situ hybridization methodology, we found deletions of PLCB1 in orbito-frontal cortex samples of schizophrenia-affected patients.

  18. [From gene to disease; deletion of the DAZ-gene from the Y-chromosome in oligo- or azoospermia

    NARCIS (Netherlands)

    Tuerlings, J.H.A.M.; Hoefsloot, L.H.; Kremer, J.A.M.

    2001-01-01

    DAZ gene deletions at the azoospermia factor (AZF) locus on the Y chromosome, have been implicated as one of the major causes of idiopathic male subfertility. Deletions of the entire DAZ gene have been reported in azoospermia as well as in oligozoospermia. The DAZ gene encodes a RNA binding protein

  19. Glucocerebrosidase 2 gene deletion rescues type 1 Gaucher disease

    Science.gov (United States)

    Mistry, Pramod K.; Liu, Jun; Sun, Li; Chuang, Wei-Lien; Yuen, Tony; Yang, Ruhua; Lu, Ping; Zhang, Kate; Li, Jianhua; Keutzer, Joan; Stachnik, Agnes; Mennone, Albert; Boyer, James L.; Jain, Dhanpat; Brady, Roscoe O.; New, Maria I.; Zaidi, Mone

    2014-01-01

    The inherited deficiency of the lysosomal glucocerebrosidase (GBA) due to mutations in the GBA gene results in Gaucher disease (GD). A vast majority of patients present with nonneuronopathic, type 1 GD (GD1). GBA deficiency causes the accumulation of two key sphingolipids, glucosylceramide (GL-1) and glucosylsphingosine (LysoGL-1), classically noted within the lysosomes of mononuclear phagocytes. How metabolites of GL-1 or LysoGL-1 produced by extralysosomal glucocerebrosidase GBA2 contribute to the GD1 pathophysiology is not known. We recently recapitulated hepatosplenomegaly, cytopenia, hypercytokinemia, and the bone-formation defect of human GD1 through conditional deletion of Gba in Mx1–Cre+:GD1 mice. Here we show that the deletion of Gba2 significantly rescues the GD1 clinical phenotype, despite enhanced elevations in GL-1 and LysoGL-1. Most notably, the reduced bone volume and bone formation rate are normalized. These results suggest that metabolism of GL-1 or LysoGL-1 into downstream bioactive lipids is a major contributor to the bone-formation defect. Direct testing revealed a strong inhibition of osteoblast viability by nanomolar concentrations of sphingosine, but not of ceramide. These findings are consistent with toxicity of high circulating sphingosine levels in GD1 patients, which decline upon enzyme-replacement therapy; serum ceramide levels remain unchanged. Together, complementary results from mice and humans affected with GD1 not only pinpoint sphingosine as being an osteoblast toxin, but also set forth Gba2 as a viable therapeutic target for the development of inhibitors to ameliorate certain disabling consequences of GD1. PMID:24639522

  20. Common fragile site profiling in epithelial and erythroid cells reveals that most recurrent cancer deletions lie in fragile sites hosting large genes.

    Science.gov (United States)

    Le Tallec, Benoît; Millot, Gaël Armel; Blin, Marion Esther; Brison, Olivier; Dutrillaux, Bernard; Debatisse, Michelle

    2013-08-15

    Cancer genomes exhibit numerous deletions, some of which inactivate tumor suppressor genes and/or correspond to unstable genomic regions, notably common fragile sites (CFSs). However, 70%-80% of recurrent deletions cataloged in tumors remain unexplained. Recent findings that CFS setting is cell-type dependent prompted us to reevaluate the contribution of CFS to cancer deletions. By combining extensive CFS molecular mapping and a comprehensive analysis of CFS features, we show that the pool of CFSs for all human cell types consists of chromosome regions with genes over 300 kb long, and different subsets of these loci are committed to fragility in different cell types. Interestingly, we find that transcription of large genes does not dictate CFS fragility. We further demonstrate that, like CFSs, cancer deletions are significantly enriched in genes over 300 kb long. We now provide evidence that over 50% of recurrent cancer deletions originate from CFSs associated with large genes.

  1. Molecular genetic analyses of human NKG2C (KLRC2) gene deletion

    NARCIS (Netherlands)

    Miyashita, R; Tsuchiya, N; Hikami, K; Kuroki, K; Fukazawa, T; Bijl, M; Kallenberg, CGM; Hashimoto, H; Yabe, T; Tokunaga, K

    Human NKG2A, NKG2C and NKG2E genes are located on 12p13 in the NK gene complex. We recently identified deletion of NKG2C in a Japanese population. This study was performed to identify the breakpoint, and to examine the association of NKG2C deletion with susceptibility to rheumatoid arthritis and

  2. The rates and patterns of deletions in the human factor IX gene

    Energy Technology Data Exchange (ETDEWEB)

    Ketterling, R.P.; Vielhaber, E.L.; Lind, T.J.; Thorland, E.C.; Sommer S.S. (Mayo Clinic/Foundation, Rochester, MN (United States))

    1994-02-01

    Deletions are commonly observed in genes with either segments of highly homologous sequences or excessive gene length. However, in the factor IX gene and in most genes, deletions (of [ge]21 bp) are uncommon. The authors have analyzed DNA from 290 families with hemophilia B (203 independent mutations) and have found 12 deletions >20 bp. Eleven of these are >2 kb (range >3-163 kb), and one is 1.1 kb. The junctions of the four deletions that are completely contained within the factor IX gene have been determined. A novel mutation occurred in patient HB128: the data suggest that a 26.8-kb deletion occurred between two segments of alternating purines and pyrimidines and that a 2.3-kb sense strand segment derived from the deleted region was inserted. For a sample of 203 independent mutations, the authors estimate the [open quotes]baseline[close quotes] rates of deletional mutation per base pair per generation as a function of size. The rate for large (>2 kb)I deletions is exceedingly low. For every mutational event in which a given base is at the junction of a large deletion, there are an estimated 58 microdeletions (<20 bp) and 985 single-base substitutions at that base. Analysis of the nine reported deletion junctions in the factor IX gene literature reveals that (i) five are associated with inversion, orphan sequences, or sense strand insertions; (ii) four are simple deletions that display an excess of short direct repeats at their junctions; (iii) there is no dramatic clustering of junctions within the gene; and (iv) with the exception of alternating purines and pyrimidines, deletion junctions are not preferentially associated with repetitive DNA. 58 refs., 5 figs., 5 tabs.

  3. Bridging the Gene-Behavior Divide through Neuroimaging Deletion Syndromes: Velocardiofacial (22q11.2 Deletion) and Williams (7q11.23 Deletion) Syndromes

    Science.gov (United States)

    Eisenberg, Daniel Paul; Jabbi, Mbemba; Berman, Karen Faith

    2010-01-01

    Investigating the relationship between genes and the neural substrates of complex human behavior promises to provide essential insight into the pathophysiology of mental disorders. One approach to this inquiry is through neuroimaging of individuals with microdeletion syndromes that manifest in specific neuropsychiatric phenotypes. Both Velocardiofacial Syndrome (VCFS) and Williams Syndrome (WS) involve haploinsufficiency of a relatively small set of identified genes on the one hand and association with distinct, clinically-relevant behavioral and cognitive profiles on the other hand. In VCFS, there is a deletion in chromosomal region 22q11.2 and a resultant predilection toward psychosis, poor arithmetic proficiency, and low performance intelligence quotients. In WS, there is a deletion in chromosomal region 7q11.23 and a resultant predilection toward hypersociability, non-social anxiety, impaired visuospatial construction, and often intellectual impairment. Structural and functional neuroimaging studies have begun not only to map these well-defined genetic alterations to systems-level brain abnormalities, but also to identify relationships between neural phenotypes and particular genes within the critical deletion regions. Though neuroimaging of both VCFS and WS presents specific, formidable methodological challenges, including comparison subject selection and accounting for neuroanatomical and vascular anomalies in patients, and many questions remain, the literature to date on these syndromes, reviewed herein, constitutes a fruitful “bottom-up” approach to defining gene-brain relationships. PMID:20206275

  4. Identifying relationships among genomic disease regions: predicting genes at pathogenic SNP associations and rare deletions.

    Directory of Open Access Journals (Sweden)

    Soumya Raychaudhuri

    2009-06-01

    Full Text Available Translating a set of disease regions into insight about pathogenic mechanisms requires not only the ability to identify the key disease genes within them, but also the biological relationships among those key genes. Here we describe a statistical method, Gene Relationships Among Implicated Loci (GRAIL, that takes a list of disease regions and automatically assesses the degree of relatedness of implicated genes using 250,000 PubMed abstracts. We first evaluated GRAIL by assessing its ability to identify subsets of highly related genes in common pathways from validated lipid and height SNP associations from recent genome-wide studies. We then tested GRAIL, by assessing its ability to separate true disease regions from many false positive disease regions in two separate practical applications in human genetics. First, we took 74 nominally associated Crohn's disease SNPs and applied GRAIL to identify a subset of 13 SNPs with highly related genes. Of these, ten convincingly validated in follow-up genotyping; genotyping results for the remaining three were inconclusive. Next, we applied GRAIL to 165 rare deletion events seen in schizophrenia cases (less than one-third of which are contributing to disease risk. We demonstrate that GRAIL is able to identify a subset of 16 deletions containing highly related genes; many of these genes are expressed in the central nervous system and play a role in neuronal synapses. GRAIL offers a statistically robust approach to identifying functionally related genes from across multiple disease regions--that likely represent key disease pathways. An online version of this method is available for public use (http://www.broad.mit.edu/mpg/grail/.

  5. Analysis of dystrophin gene deletions by multiplex PCR in eastern India

    Directory of Open Access Journals (Sweden)

    Basak Jayasri

    2006-01-01

    Full Text Available The most common genetic neuromuscular disease of childhood, Duchenne and Becker muscular dystrophy (DMD/BMD is caused by deletion, duplication or point mutation of the dystrophin gene located at Xp 21.2. In the present study DNA from seventy unrelated patients clinically diagnosed as having DMD/BMD referred from different parts of West Bengal, a few other states and Bangladesh are analyzed using the multiplex polymerase chain reaction (m-PCR to screen for exon deletions and its distribution within the dystrophin gene. Out of seventy patients forty six (63% showed large intragenic deletion in the dystrophin gene. About 79% of these deletions are located in the hot spot region i.e., between exon 42 to 53. This is the first report of frequency and distribution of deletion in dystrophin gene in eastern Indian DMD/BMD population.

  6. DELETION AND 5'CPG ISLAND METHYLATION OF p15 GENE IN BRAIN GLIOMA

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective: To investigate the abnormality of p15 gene in brain glioma and the correlation of it with occurrence or malignant progression of brain glioma. Methods: Deletion and 5'CPG island methylation of p15 gene were detected by the methods of PCR and PCR-based methylation in 56 cases of brain glioma. Results: Out of 43 cases of high grade glioma, 14 cases were found to have homozygous deletion of p15E1, while none of the 13 cases of low grade glioma was found to have deletion of p15E1 (P<0.05). Methylation of 5'CPG Island of p15 gene was found only in four cases of glioma. Conclusion: Abnormality of p15 gene may involved in the occurrence and malignant progression of brain glioma. Homozygous deletion of gene is the major mechanism of inactivation for p15 gene in brain glioma.

  7. Marfan syndrome with a complex chromosomal rearrangement including deletion of the FBN1 gene

    Directory of Open Access Journals (Sweden)

    Colovati Mileny ES

    2012-01-01

    Full Text Available Abstract Background The majority of Marfan syndrome (MFS cases is caused by mutations in the fibrillin-1 gene (FBN1, mapped to chromosome 15q21.1. Only few reports on deletions including the whole FBN1 gene, detected by molecular cytogenetic techniques, were found in literature. Results We report here on a female patient with clinical symptoms of the MFS spectrum plus craniostenosis, hypothyroidism and intellectual deficiency who presents a 1.9 Mb deletion, including the FBN1 gene and a complex rearrangement with eight breakpoints involving chromosomes 6, 12 and 15. Discussion This is the first report of MFS with a complex chromosome rearrangement involving a deletion of FBN1 and contiguous genes. In addition to the typical clinical findings of the Marfan syndrome due to FBN1 gene haploinsufficiency, the patient presents features which may be due to the other gene deletions and possibly to the complex chromosome rearrangement.

  8. Detection of Homozygous Deletions and Mutations in the CDKN2A Gene in Hydatidiform Moles

    Institute of Scientific and Technical Information of China (English)

    Jing Wang; Shuying Wu; Ying Gu; Yan Zhu; Xiaowei Zhang

    2008-01-01

    OBJECTIVE To investigate homozygous deletions and mutations in the CDKN2A gene (p16INK4a and p14ARF gene) in hydatidiform moles.METHODS A total of 38 hydatidiform mole samples and 30 villi samples were examined for homozygous deletions in the CDKN2A gene by PCR and for mutations by DHPLC.RESULTS I) Among 38 hydatidiform mole samples,homozygous deletions in the p16INK4a exon 1 were identified in 5 cases (13.2%), while no homozygous deletions were found in the p16INK4a exon 1 of 30 early-pregnancy samples. The rates of those deletions in hydatidiform compared to early-pregnancy villi samples was statistically significant (P = 0.036). Ii) No homozygous deletions in the p14ARF exon 1 or p16INK4a exon 2 were found in any of the hydatidiform moles or early-preganancy samples, iii)In all hydatidiform moles and early-pregnancy villi samples, no mutations were detected by DHPLC.CONCLUSION We suggest there may be a close correlation between homozygous deletions in the CDKN2A gene and occurrence of hydatidiform moles variation in the CDKN2A gene is mainly caused by homozygous deletions, while mutations may be not a major cause.

  9. FREQUENT DELETION OF MTS1/p16 GENE AND CORRELATION WITH CLINICOPATHOLOGICAL PARAMETERS IN ENDOMETRIAL CARCINOMA

    Institute of Scientific and Technical Information of China (English)

    Zhou Chunxiao; Sun Jianheng; Lu Shixin; Jin Shunqian; Liu Hailing; Sheng Xiugui

    1998-01-01

    Objective:To investigate the possible relationship between deletion of MTS/p16 gene and progression of endometrial carcinoma. Methods: Forty-six primary endometrial carcinoma, 7 tumor-adjacent endometrial tissue, 10 normal endometrial tissue specimen and 5 xenografts from patients with endometrial carcinoma were examined for homozygous deletion of MTS/p16 gene by polymerase chain reaction-based analysis. Results: Of 46 endometrial cancer specimens, 9 showed homozygous deletion, no deletion was detected in the tumor-adjacent and normal endometial tissues. Nor was it detected in well-differentiated endometrial carcinoma and all xenografts. Conclusions: Deletion of MTS1/p16 gene might contribute to the progression of endometrial carcinoma and could be served as indicator for predicting prognosis.

  10. Relatively low proportion of dystrophin gene deletions in Israeili Duchenne and Becker muscular dystrophy patients

    Energy Technology Data Exchange (ETDEWEB)

    Shomrat, R.; Gluck, E.; Legum, C.; Shiloh, Y. [Tel Aviv Univ. (Israel)

    1994-02-15

    Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these exons 44-45, and the remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. 43 refs., 1 fig., 1 tab.

  11. Germinal mosaicism for a deletion of the FMR1 gene leading to fragile X syndrome.

    Science.gov (United States)

    Jiraanont, P; Hagerman, R J; Neri, G; Zollino, M; Murdolo, M; Tassone, F

    2016-09-01

    Aberrant CGG trinucleotide amplification within the FMR1 gene, which spans approximately 38 Kb of genomic DNA is almost always what leads to fragile X syndrome (FXS). However, deletions of part or the entire FMR1 gene can also cause FXS. Both CGG amplification-induced silencing and deletions result in the absence of the FMR1 gene product, FMRP. Here, we report a rare case of germinal mosaicism of a deletion encompassing approximately 300 Kb of DNA, which by removing the entire FMR1 gene led to FXS. The male proband, carrying the deletion, presented in clinic with the typical features of FXS. His mother was analyzed by FISH on metaphase chromosomes with cosmid probe c22.3 spanning the FMR1 locus, and she was found not to carry the deletion on 30 analyzed cells from peripheral blood lymphocytes. Prenatal examination of the mother's third pregnancy showed that the male fetus also had the same deletion as the proband. Following this prenatal diagnosis, FISH analysis in the mother was expanded to 400 metaphases from peripheral lymphocytes, and a heterozygous FMR1 deletion was found in three. Although this result could be considered questionable from a diagnostic point of view, it indicates that the deletion is in the ovary's germinal cells.

  12. Contiguous gene syndromes due to deletions in the distal short arm of the human X chromosome

    Energy Technology Data Exchange (ETDEWEB)

    Ballabio, A.; Andria, G. (Univ. of Reggio Calabria, Catanzaro (Italy)); Bardoni, B.; Fraccaro, M.; Maraschio, P.; Zuffardi, O.; Guioli, S.; Camerino, G. (Univ. of Pavia (Italy)); Carrozzo, R. (Univ. of Naples (Italy)); Bick, D.; Campbell, L. (Univ. of Texas, San Antonio (USA)); Hamel, B. (Univ. of Nijmegen (Netherlands)); Ferguson-Smith, M.A. (Univ. of Cambridge (England)); Gimelli, G. (G. Gaslini Institute, Genoa (Italy))

    1989-12-01

    Mendelian inherited disorders to deletions of adjacent genes on a chromosome have been described as contiguous gene syndromes. Short stature, chondrodysplasia punctata, mental retardation, steroid sulfatase deficiency, and Kallmann syndrome have been found as isolated entities or associated in various combination in 27 patients with interstitial and terminal deletions involving the distal short are of the X chromosome. The use of cDNA and genomic probes from the Xp22-pter region allowed us to identify 12 different deletion intervals and to confirm, and further refine, the chromosomal assignment of X-linked recessive chondrodysplasia punctata and Kallmann syndrome genes. A putative pseudoautosomal gene affecting height and an X-linked nonspecific mental retardation gene have been tentatively assigned to specific intervals. The deletion panel described is a useful tool for mapping new sequences and orienting chromosome walks in the region.

  13. An Alu-mediated large deletion of the FUT2 gene in individuals with the ABO-Bombay phenotype.

    Science.gov (United States)

    Koda, Y; Soejima, M; Johnson, P H; Smart, E; Kimura, H

    2000-01-01

    Recently, we have found an allelic deletion of the secretor alpha(1,2)fucosyltransferase (FUT2) gene in individuals with the classical Bombay phenotype of the ABO system. The FUT2 gene consists of two exons separated by an intron that spans approximately 7 kb. The first exon is noncoding, whereas exon 2 contains the complete coding sequence. Since the 5' breakpoint of the deletion has previously been mapped to the single intron of FUT2, we have cloned the junction region of the deletion in a Bombay individual by cassette-mediated polymerase chain reaction. In addition, the region from the 3' untranslated region of FUT2 to the 3' breakpoint sequence has been amplified from a control individual. DNA sequence analysis of this region indicates that the 5' breakpoint is within a free left Alu monomer (FLAM-C) sequence that lies 1.3 kb downstream of exon 1, and that the 3' breakpoint is within a complete Alu element (AluSx) that is positioned 1.5 kb downstream of exon 2. The size of the deletion is estimated to be about 10 kb. There is a 25-bp sequence identity between the reference DNA sequences surrounding the 5' and 3' breakpoints. This demonstrates that an Alu-mediated large gene deletion generated by unequal crossover is responsible for secretor alpha(1,2)fucosyltransferase deficiency in Indian Bombay individuals.

  14. An intronic deletion in the PROM1 gene leads to autosomal recessive cone-rod dystrophy

    Science.gov (United States)

    Eidinger, Osnat; Leibu, Rina; Newman, Hadas; Rizel, Leah; Perlman, Ido

    2015-01-01

    Purpose To investigate the genetic basis for autosomal recessive cone-rod dystrophy (CRD) in a consanguineous Israeli Jewish family. Methods Patients underwent a detailed ophthalmic evaluation, including eye examination, visual field testing, optical coherence tomography (OCT), and electrophysiological tests, electroretinography (ERG) and visual evoked potential (VEP). Genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array was performed to identify homozygous regions shared among two of the affected individuals. Mutation screening of the underlying gene was performed with direct sequencing. In silico and in vitro analyses were used to predict the effect of the identified mutation on splicing. Results The affected family members are three siblings who have various degrees of progressive visual deterioration, glare, color vision abnormalities, and night vision difficulties. Visual field tests revealed central scotomas of different extension. Cone and rod ERG responses were reduced, with cones more severely affected. Homozygosity mapping revealed several homozygous intervals shared among two of the affected individuals. One included the PROM1 gene. Sequence analysis of the 26 coding exons of PROM1 in one affected individual revealed no mutations in the coding sequence or in intronic splice sites. However, in intron 21, proximate to the intron–exon junction, we observed a homozygous 10 bp deletion between positions −26 and −17 (c.2281–26_-17del). The deletion was linked to a known SNP, c.2281–6C>G. The deletion cosegregated with the disease in the family, and was not detected in public databases or in 101 ethnically-matched control individuals. In silico analysis predicted that this deletion would lead to altered intron 21 splicing. Bioinformatic analysis predicted that a recognition site for the SRSF2 splicing factor is located within the deleted sequence. The in vitro splicing assay demonstrated that c.2281–26_-17del leads to

  15. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    Science.gov (United States)

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  16. Cardiac characterization of 16 patients with large NF1 gene deletions.

    Science.gov (United States)

    Nguyen, R; Mir, T S; Kluwe, L; Jett, K; Kentsch, M; Mueller, G; Kehrer-Sawatzki, H; Friedman, J M; Mautner, V-F

    2013-10-01

    The aim of this study was to characterize cardiac features of patients with neurofibromatosis 1 (NF1) and large deletions of the NF1 gene region. The study participants were 16 patients with large NF1 deletions and 16 age- and sex-matched NF1 patients without such deletions. All the patients were comprehensively characterized clinically and by echocardiography. Six of 16 NF1 deletion patients but none of 16 non-deletion NF1 patients have major cardiac abnormalities (p = 0.041). Congenital heart defects (CHDs) include mitral insufficiency in two patients and ventricular septal defect, aortic stenosis, and aortic insufficiency in one patient each. Three deletion patients have hypertrophic cardiomyopathy. Two patients have intracardiac tumors. NF1 patients without large deletions have increased left ventricular (LV) diastolic posterior wall thickness (p NF1, suggestive of eccentric LV hypertrophy. CHDs and other cardiovascular anomalies are more frequent among patients with large NF1 deletion and may cause serious clinical complications. Eccentric LV hypertrophy may occur in NF1 patients without whole gene deletions, but the clinical significance of this finding is uncertain. All patients with clinical suspicion for NF1 should be referred to a cardiologist for evaluation and surveillance.

  17. Analysis of Dystrophin Gene Deletions by Multiplex PCR in Moroccan Patients

    Directory of Open Access Journals (Sweden)

    Aziza Sbiti

    2002-01-01

    Full Text Available Duchenne and Becker muscular dystrophy (DMD and BMD are X-linked diseases resulting from a defect in the dystrophin gene located on Xp21. DMD is the most frequent neuromuscular disease in humans (1/3500 male newborn. Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. We have analyzed DNA from 72 Moroccan patients with DMD/BMD using the multiplex polymerase chain reaction (PCR to screen for exon deletions within the dystrophin gene, and to estimate the frequency of these abnormalities. We found dystrophin gene deletions in 37 cases. Therefore the frequency in Moroccan DMD/BMD patients is about 51.3%. All deletions were clustered in the two known hot-spots regions, and in 81% of cases deletions were detected in the region from exon 43 to exon 52. These findings are comparable to those reported in other studies. It is important to note that in our population, we can first search for deletions of DMD gene in the most frequently deleted exons determined by this study. This may facilitate the molecular diagnosis of DMD and BMD in our country.

  18. Large contiguous gene deletions in Sjögren-Larsson syndrome.

    Science.gov (United States)

    Engelstad, Holly; Carney, Gael; S'aulis, Dana; Rise, Janae; Sanger, Warren G; Rudd, M Katharine; Richard, Gabriele; Carr, Christopher W; Abdul-Rahman, Omar A; Rizzo, William B

    2011-11-01

    Sjögren-Larsson syndrome (SLS) is an autosomal recessive disorder characterized by ichthyosis, mental retardation, spasticity and mutations in the ALDH3A2 gene for fatty aldehyde dehydrogenase, an enzyme that catalyzes the oxidation of fatty aldehyde to fatty acid. More than 70 mutations have been identified in SLS patients, including small deletions or insertions, missense mutations, splicing defects and complex nucleotide changes. We now describe 2 SLS patients whose disease is caused by large contiguous gene deletions of the ALDH3A2 locus on 17p11.2. The deletions were defined using long distance inverse PCR and microarray-based comparative genomic hybridization. A 24-year-old SLS female was homozygous for a 352-kb deletion involving ALDH3A2 and 4 contiguous genes including ALDH3A1, which codes for the major soluble protein in cornea. Although lacking corneal disease, she showed severe symptoms of SLS with uncommon deterioration in oral motor function and loss of ambulation. The other 19-month-old female patient was a compound heterozygote for a 1.44-Mb contiguous gene deletion and a missense mutation (c.407C>T, P136L) in ALDH3A2. These studies suggest that large gene deletions may account for up to 5% of the mutant alleles in SLS. Geneticists should consider the possibility of compound heterozygosity for large deletions in patients with SLS and other inborn errors of metabolism, which has implications for carrier testing and prenatal diagnosis.

  19. Gap-PCR Screening for Common Large Deletional Mutations of β-Globin Gene Cluster Revealed a Higher Prevalence of the Turkish Inversion/Deletion (δβ0 Mutation in Antalya

    Directory of Open Access Journals (Sweden)

    Türker Bilgen

    2016-05-01

    Full Text Available Objective: Although the calculated carrier frequency for point mutations of the β-globin gene is around 10% for Antalya Province, nothing is known about the profile of large deletional mutations involving the β-globin gene. In this study, we aimed to screen common deletional mutations in the β-globin gene cluster in patients for whom direct DNA sequencing was not able to demonstrate the mutation(s responsible for the disease phenotype. Materials and Methods: Thirty-one index cases selected with a series of selection events among 60 cases without detected β-globin gene mutation from 580 thalassemia-related cases tested by direct sequencing over the last 4 years in our diagnostic center were screened for the most common 8 different large deletional mutations of the β-globin gene cluster by gap-PCR. Results: We detected 1 homozygous and 9 heterozygous novel unrelated cases for the Turkish inversion/deletion (δβ0 mutation in our series of 31 cases. Our study showed that the Turkish inversion/ deletion (δβ0 mutation per se accounts for 16.6% of the unidentified causative alleles and also accounts for 1.5% of all detected mutations over the last 4 years in our laboratory. Conclusion: Since molecular diagnosis of deletional mutations in the β-globin gene cluster warrants different approaches, it deserves special attention in order to provide prenatal diagnosis and prevention opportunities to the families involved. We conclude that the Turkish inversion/deletion (δβ0, as the most prevalent deletional mutation detected so far, has to be routinely tested for in Antalya, and the gapPCR approach has valuable diagnostic potential in the patients at risk.

  20. Alu insertion/deletion of ACE gene polymorphism might not affect ...

    African Journals Online (AJOL)

    Widodo

    2016-09-03

    Sep 3, 2016 ... Received 2 May 2016; accepted 1 August 2016. Available ... The Egyptian Journal of Medical Human Genetics (2017) 18, 187–191. HOSTED BY ..... insertion–deletion polymorphism of ACE gene and Alzheimer's · disease in ...

  1. Deletion of a single-copy DAAM1 gene in congenital heart defect: a case report

    Directory of Open Access Journals (Sweden)

    Bao Bihui

    2012-08-01

    Full Text Available Abstract Background With an increasing incidence of congenital heart defects (CHDs in recent years, genotype-phenotype correlation and array-based methods have contributed to the genome-wide analysis and understanding of genetic variations in the CHD population. Here, we report a copy number deletion of chromosomal 14q23.1 in a female fetus with complex congenital heart defects. This is the first description of DAAM1 gene deletion associated with congenital heart anomalies. Case Presentation Compared with the control population, one CHD fetus showed a unique copy number deletion of 14q23.1, a region that harbored DAAM1 and KIAA0666 genes. Conclusions Results suggest that the copy number deletion on chromosome 14q23.1 may be critical for cardiogenesis. However, the exact relationship and mechanism of how DAAM1 and KIAA0666 deletion contributes to the onset of CHD is yet to be determined.

  2. 5q14.3 deletion neurocutaneous syndrome: Contiguous gene syndrome caused by simultaneous deletion of RASA1 and MEF2C: A progressive disease.

    Science.gov (United States)

    Ilari, Rita; Agosta, Guillermo; Bacino, Carlos

    2016-03-01

    We report the case of a young girl who was presented with complex clinical symptoms caused by the deletion of contiguous genes: RASA1 and MEF2C, located on chromosome 5q14.3. Specifically, the diagnosis of her skin disorder and vascular malformations involving central nervous system is consistent with a RASopathy. The child's neurological manifestations are observed in most patients suffering from 5q14.3 by deletion or mutation of the MEF2C gene. A review of the literature allowed us to conclude that the contiguous deletion of genes RASA1 and MEF2C fulfills the criteria for the diagnosis of a Neurocutaneous syndrome as proposed by Carr et al. [2011]. We also assessed the penetrance of RASA1 and clinical manifestations of MEF2C according to the type of deletion. This child described presents the complete symptomatology of both deleted genes. We would also like to highlight the progression of the disorder.

  3. Clinical and molecuar characterization of Brazilian patients with growth hormone gene deletions

    Directory of Open Access Journals (Sweden)

    I.J.P. Arnhold

    1998-04-01

    Full Text Available Genomic DNA from 23 patients with isolated growth hormone (GH deficiency (12 males and 11 females: heights -4.9 ± 1.4 SDS was screened for GH gene deletions by restriction endonuclease analysis of polymerase chain reaction amplification products. Three unrelated patients had typical features of severe GH deficiency and deletions (6.7 kb in two and 7.6 kb in one of the GH gene. The two patients with 6.7-kb deletions developed growth-attenuating anti-GH antibodies whereas the patient with the 7.6-kb deletion continued to grow with GH replacement therapy. Our finding that 3/23 (~13% Brazilian subjects had GH gene deletions agrees with previous studies of severe isolated GH deficiency subjects in other populations. Two of three subjects (67% with deletions developed blocking antibodies despite administration of exogenous GH at low doses. Interestingly, only 1/10 of cases with affected relatives or parental consanguinity had GH-1 gene deletions

  4. Alu Sx repeat-induced homozygous deletion of the StAR gene causes lipoid congenital adrenal hyperplasia.

    Science.gov (United States)

    Eiden-Plach, Antje; Nguyen, Huy-Hoang; Schneider, Ursula; Hartmann, Michaela F; Bernhardt, Rita; Hannemann, Frank; Wudy, Stefan A

    2012-05-01

    Lipoid congenital adrenal hyperplasia (Lipoid CAH) is the most severe form of the autosomal recessive disorder CAH. A general loss of the steroid biosynthetic activity caused by defects in the StAR gene manifests as life-threatening primary adrenal insufficiency. We report a case of Lipoid CAH caused by a so far not described homozygous deletion of the complete StAR gene and provide diagnostic results based on a GC-MS steroid metabolomics and molecular genetic analysis. The patient presented with postnatal hypoglycemia, vomiting, adynamia, increasing pigmentation and hyponatremia. The constellation of urinary steroid metabolites suggested Lipoid CAH and ruled out all other forms of CAH or defects of aldosterone biosynthesis. After treatment with sodium supplementation, hydrocortisone and fludrocortisone the child fully recovered. Molecular genetic analysis demonstrated a homozygous 12.1 kb deletion in the StAR gene locus. The breakpoints of the deletion are embedded into two typical genomic repetitive Alu Sx elements upstream and downstream of the gene leading to the loss of all exons and regulatory elements. We established deletion-specific and intact allele-specific PCR methods and determined the StAR gene status of all available family members over three generations. This analysis revealed that one of the siblings, who died a few weeks after birth, carried the same genetic defect. Since several Alu repeats at the StAR gene locus increase the probability of deletions, patients with typical symptoms of lipoid CAH lacking evidence for the presence of both StAR alleles should be analyzed carefully for this kind of disorder.

  5. Deletion analysis of SMN1 and NAIP genes in southern Chinese children with spinal muscular atrophy

    Institute of Scientific and Technical Information of China (English)

    Yu-hua LIANG; Xiao-ling CHEN; Zhong-sheng YU; Chun-yue CHEN; Sheng BI; Lian-gen MAO; Bo-lin ZHOU; Xian-ning ZHANG

    2009-01-01

    Spinal muscular atrophy (SMA) is a disorder characterized by degeneration of lower motor neurons and occasionally bulbar motor neurons leading to progressive limb and trunk paralysis as well as muscular atrophy. Three types of SMA are rec-ognized depending on the age of onset, the maximum muscular activity achieved, and survivorship: SMA1, SMA2, and SMA3. The survival of motor neuron (SMN) gene has been identified as an SMA determining gene, whereas the neuronal apoptosis inhibitory protein (NAIP) gene is considered to be a modifying factor of the severity of SMA. The main objective of this study was to analyze the deletion of SMN1 and NAIP genes in southern Chinese children with SMA. Here, polymerase chain reaction (PCR) combined with restriction fragment length polymorphism (RFLP) was performed to detect the deletion of both exon 7 and exon 8 of SMNI and exon 5 of NAIP in 62 southern Chinese children with strongly suspected clinical symptoms of SMA. All the 32 SMAI patients and 76% (13/17) of SMA2 patients showed homozygous deletions for exon 7 and exon 8, and all the 13 SMA3 patients showed single deletion of SMN1 exon 7 along with 24% (4/17) of SMA2 patients. Eleven out of 32 (34%) SMA1 patients showed NAIP deletion, and none of SMA2 and SMA3 patients was found to have NAIP deletion. The findings of homozygous deletions of exon 7 and/or exon 8 of SMN1 gene confirmed the diagnosis of SMA, and suggested that the deletion of SMN1 exon 7 is a major cause of SMA in southern Chinese children, and that the NA1P gene may be a modifying factor for disease severity of SMA 1. The molecular diagnosis system based on PCR-RFLP analysis can conveniently be applied in the clinical testing, genetic counseling, prenatal diagnosis and preimplantation genetic diagnosis of SMA.

  6. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R

    2003-01-01

    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  7. Screening the dystrophin gene suggests a high rate of polymorphism in general but no exonic deletions in schizophrenics

    Energy Technology Data Exchange (ETDEWEB)

    Lindor, N.M.; Sobell, J.L.; Thibodeau, S.N. [Mayo Clinic/Foundation, Rochester, MN (United States)] [and others

    1994-03-15

    The dystrophin gene, located at chromosome Xp21, was evaluated as a candidate gene in chronic schizophrenia in response to the report of a large family in which schizophrenia cosegregated with Becker muscular dystrophy. Genomic DNA from 94 men with chronic schizophrenia was evaluated by Southern blot analysis using cDNA probes that span exons 1-59. No exonic deletions were identified. An unexpectedly high rate of polymorphism was calculated in this study and two novel polymorphisms were found, demonstrating the usefulness of the candidate gene approach even when results of the original study are negative. 41 refs., 1 fig., 4 tabs.

  8. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    Energy Technology Data Exchange (ETDEWEB)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-05-01

    From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF{sub 1} mice irradiated with {sup 60}Co {gamma}-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from {gamma}-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5{prime} region of the mRb gene.

  9. Identification and molecular characterization of four new large deletions in the beta-globin gene cluster.

    Science.gov (United States)

    Joly, Philippe; Lacan, Philippe; Garcia, Caroline; Couprie, Nicole; Francina, Alain

    2009-01-01

    Despite the fact that mutations in the human beta-globin gene cluster are essentially point mutations, a significant number of large deletions have also been described. We present here four new large deletions in the beta-globin gene cluster that have been identified on patients displaying an atypical hemoglobin phenotype (high HbF) at routine analysis. The first deletion, which spreads over 2.0 kb, removes the entire beta-globin gene, including its promoter, and is associated with a typical beta-thal minor phenotype. The three other deletions are larger (19.7 to 23.9 kb) and remove both the delta and beta-globin genes. Phenotypically, they look like an HPFH-deletion as they are associated with normal hematological parameters. The precise localization of their 5' and 3' breakpoints gives new insights about the differences between HPFH and (deltabeta)(0)-thalassemia at the molecular level. The importance of detection of these deletions in prenatal diagnosis and newborn screening of hemoglobinopathies is also discussed.

  10. An atypical case of fragile X syndrome caused by a deletion that includes FMRI gene

    Energy Technology Data Exchange (ETDEWEB)

    Quan, F.; Zonana, J.; Gunter, K.; Peterson, K.L.; Magenis, R.E., Popovich, B.W. [Shriners Hospital for Crippled Children, Portland, OR (United States)

    1995-05-01

    Fragile X syndrome is the most common form of inherited mental retardation and results from the transcriptional inactivation of the FMR1 gene. In the vast majority of cases, this is caused by the expansion of an unstable CGG repeat in the first exon of the FMR1 gene. We describe here a phenotypically atypical case of fragile X syndrome, caused by a deletion that includes the entire FMR1 gene and {ge}9.0 Mb of flanking DNA. The proband, RK, was a 6-year-old mentally retarded male with obesity and anal atresia. A diagnosis of fragile X syndrome was established by the failure of RK`s DNA to hybridize to a 558-bp PstI-XhoI fragment (pfxa3) specific for the 5{prime}-end of the FMR1 gene. The analysis of flanking markers in the interval from Xq26.3-q28 indicated a deletion extending from between 160-500 kb distal and 9.0 Mb proximal to the FMR1 gene. High-resolution chromosome banding confirmed a deletion with breakpoints in Xq26.3 and Xq27.3. This deletion was maternally transmitted and arose as a new mutation on the grandpaternal X chromosome. The maternal transmission of the deletion was confirmed by FISH using a 34-kb cosmid (c31.4) containing most of the FMR1 gene. These results indicated that RK carried a deletion of the FMR1 region with the most proximal breakpoint described to date. This patient`s unusual clinical presentation may indicate the presence of genes located in the deleted interval proximal to the FMR1 locus that are able to modify the fragile X syndrome phenotype. 36 refs., 7 figs.

  11. Variable penetrance of hypogonadism in a sibship with Kallmann syndrome due to a deletion of the KAL gene

    Energy Technology Data Exchange (ETDEWEB)

    Parenti, G.; Rizzolo, M.G.; Ghezzi, M. [Federico II University, Naples (Italy)] [and others

    1995-07-03

    We report on the clinical and molecular characterization of 3 sibs with X-linked ichthyosis and variable expression of Kallmann syndrome. One of the affected brothers had mild hyposmia and showed normal pubertal progression. However, we demonstrated the same partial deletion of the X-linked Kallmann gene, sparing the first exon in the mildly affected patient as well as in one of his severely affected brothers. 13 refs., 1 fig., 1 tab.

  12. A HOMOLOGOUS GENE-REPORTER SYSTEM FOR THE BASIDIOMYCETE SCHIZOPHYLLUM-COMMUNE BASED ON INTERNALLY DELETED HOMOLOGOUS GENES

    NARCIS (Netherlands)

    SCHUREN, FHJ; HARMSEN, MC; WESSELS, JGH

    Problems encountered in our attempts to achieve expression of heterologous genes, driven by ascomycetous regulatory sequences, in homobasidiomycetes led us to develop a gene-reporter system based on the expression of homologous genes in Schizophyllum commune. Internal deletions were made in the

  13. Alu-mediated large deletion of the CDSN gene as a cause of peeling skin disease.

    Science.gov (United States)

    Wada, T; Matsuda, Y; Muraoka, M; Toma, T; Takehara, K; Fujimoto, M; Yachie, A

    2014-10-01

    Peeling skin disease (PSD) is an autosomal recessive skin disorder caused by mutations in CDSN and is characterized by superficial peeling of the upper epidermis. Corneodesmosin (CDSN) is a major component of corneodesmosomes that plays an important role in maintaining epidermis integrity. Herein, we report a patient with PSD caused by a novel homozygous large deletion in the 6p21.3 region encompassing the CDSN gene, which abrogates CDSN expression. Several genes including C6orf15, PSORS1C1, PSORS1C2, CCHCR1, and TCF19 were also deleted, however, the patient showed only clinical features typical of PSD. The deletion size was 59.1 kb. Analysis of the sequence surrounding the breakpoint showed that both telomeric and centromeric breakpoints existed within Alu-S sequences that were oriented in opposite directions. These results suggest an Alu-mediated recombination event as the mechanism underlying the deletion in our patient.

  14. Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes.

    Science.gov (United States)

    Fernández-Martínez, Lorena T; Bibb, Mervyn J

    2014-11-18

    The search for new natural products is leading to the isolation of novel actinomycete species, many of which will ultimately require genetic analysis. Some of these isolates will likely exhibit low intrinsic frequencies of homologous recombination and fail to sporulate under laboratory conditions, exacerbating the construction of targeted gene deletions and replacements in genetically uncharacterised strains. To facilitate the genetic manipulation of such species, we have developed an efficient method to generate gene or gene cluster deletions in actinomycetes by homologous recombination that does not introduce any other changes to the targeted organism's genome. We have synthesised a codon optimised I-SceI gene for expression in actinomycetes that results in the production of the yeast I-SceI homing endonuclease which produces double strand breaks at a unique introduced 18 base pair recognition sequence. Only those genomes that undergo homologous recombination survive, providing a powerful selection for recombinants, approximately half of which possess the desired mutant genotype. To demonstrate the efficacy and efficiency of the system, we deleted part of the gene cluster for the red-pigmented undecylprodiginine complex of compounds in Streptomyces coelicolor M1141. We believe that the system we have developed will be broadly applicable across a wide range of actinomycetes.

  15. Gene deletion of cytosolic ATP: citrate lyase leads to altered organic acid production in Aspergillus niger

    DEFF Research Database (Denmark)

    Meijer, Susan Lisette; Nielsen, Michael Lynge; Olsson, Lisbeth

    2009-01-01

    With the availability of the genome sequence of the filamentous fungus Aspergillus niger, the use of targeted genetic modifications has become feasible. This, together with the fact that A. niger is well established industrially, makes this fungus an attractive micro-organism for creating a cell...... factory platform for production of chemicals. Using molecular biology techniques, this study focused on metabolic engineering of A. niger to manipulate its organic acid production in the direction of succinic acid. The gene target for complete gene deletion was cytosolic ATP: citrate lyase (acl), which...... the acl gene. Additionally, the total amount of organic acids produced in the deletion strain was significantly increased. Genome-scale stoichiometric metabolic model predictions can be used for identifying gene targets. Deletion of the acl led to increased succinic acid production by A. niger....

  16. Deletion of psychiatric risk gene Cacna1c impairs hippocampal neurogenesis in cell-autonomous fashion.

    Science.gov (United States)

    Völkening, Bianca; Schönig, Kai; Kronenberg, Golo; Bartsch, Dusan; Weber, Tillmann

    2017-05-01

    Ca(2+) is a universal signal transducer which fulfills essential functions in cell development and differentiation. CACNA1C, the gene encoding the alpha-1C subunit (i.e., Cav 1.2) of the voltage-dependent l-type calcium channel (LTCC), has been implicated as a risk gene in a variety of neuropsychiatric disorders. To parse the role of Cav 1.2 channels located on astrocyte-like stem cells and their descendants in the development of new granule neurons, we created Tg(GLAST-CreERT2) /Cacna1c(fl/fl) /RCE:loxP mice, a transgenic tool that allows cell-type-specific inducible deletion of Cacna1c. The EGFP reporter was used to trace the progeny of recombined type-1 cells. FACS-sorted Cacna1c-deficient neural precursor cells from the dentate gyrus showed reduced proliferative activity in neurosphere cultures. Moreover, under differentiation conditions, Cacna1c-deficient NPCs gave rise to fewer neurons and more astroglia. Similarly, under basal conditions in vivo, Cacna1c gene deletion in type-1 cells decreased type-1 cell proliferation and reduced the neuronal fate-choice decision of newly born cells, resulting in reduced net hippocampal neurogenesis. Unexpectedly, electroconvulsive seizures completely compensated for the proliferation deficit of Cacna1c deficient type-1 cells, indicating that there must be Cav 1.2-independent mechanisms of controlling proliferation related to excitation. In the aggregate, this is the first report demonstrating the presence of functional L-type 1.2 channels on type-1 cells. Cav 1.2 channels promote type-1 cell proliferation and push the glia-to-neuron ratio in the direction of a neuronal fate choice and subsequent neuronal differentiation. Cav 1.2 channels expressed on NPCs and their progeny possess the ability to shape neurogenesis in a cell-autonomous fashion. © 2017 Wiley Periodicals, Inc.

  17. Mapping of polyketide biosynthesis pathways in Aspergillus nidulans using a genome wide PKS gene deletion library

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Rank, Christian; Klejnstrup, Marie Louise;

    In order to map new links between PKS genes and their products in Aspergillus nidulans we have systematically deleted all thirty-two individual genes predicted to encode polyketide synthases in this model organism. This number greatly exceeds the number of currently known PKs calling for new...

  18. Detection of a functional insertion sequence responsible for deletion of the thermostable direct hemolysin gene (tdh) in Vibrio parahaemolyticus.

    Science.gov (United States)

    Kamruzzaman, Muhammad; Bhoopong, Phuangthip; Vuddhakul, Varaporn; Nishibuchi, Mitsuaki

    2008-09-15

    The thermostable direct hemolysin coded by the tdh gene is a marker of virulent strains of Vibrio parahaemolyticus. The tdh genes are flanked by insertion sequences collectively named as ISVs or their remnants; but the ISVs so far examined have accumulated mutations in the transposase genes and underwent structural arrangements and their transposition activity could not be expected; the tdh gene was thus considered to have been acquired by V. parahaemolyticus through horizontal transfer in the past during evolution. We recently isolated from the same patient tdh+ strains and a tdh(-) strain (PCR examination) that were otherwise indistinguishable. The purpose of this study was to examine the hypothesis that the tdh(-) strain was derived from the tdh+ strain by a deletion of the tdh gene mediated by a functional ISV. Southern blot hybridization showed tdh+ sequences in the tdh(-) strain (PSU-1466). Nucleotide sequence analysis of the tdh and its flanking sequences revealed the tdh gene was split into two parts and they were located 3182-bp apart in PSU-1466. The two tdh sequences were flanked by one of the ISVs, named as ISVpa3, in PSU-1466. This genetic structure could be explained by an ISVpa3-mediated partial tdh deletion from a tdh+ strain followed by transposition of the duplicated ISVpa3 and the deleted tdh sequence into a neighboring location. The ISVpa3 of PSU-1466 coded for a full-length transposase and a DDE motif. We were able to demonstrate transposition activity of the ISVpa3 cloned from PSU-1466 using the replicon fusion assay with the conjugal transfer of a cointegrate from Escherichia coli to V. parahaemolyticus. Our data support ISVpa3-mediated partial tdh deletion resulted in the emergence of the tdh(-) strain.

  19. Stable disruption of ethanol production by deletion of the genes encoding alcohol dehydrogenase isozymes in Saccharomyces cerevisiae.

    Science.gov (United States)

    Ida, Yoshihiro; Furusawa, Chikara; Hirasawa, Takashi; Shimizu, Hiroshi

    2012-02-01

    We analyzed the effects of the deletions of genes encoding alcohol dehydrogenase (ADH) isozymes of Saccharomyces cerevisiae. The decrease in ethanol production by ADH1 deletion alone could be partially compensated by the upregulation of other isozyme genes, while the deletion of all known ADH isozyme genes stably disrupted ethanol production. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  20. EXPRESSION AND DELETION ANALYSIS OF EcoRII ENDONUCLEASE AND METHYLASE GENE

    Institute of Scientific and Technical Information of China (English)

    刘金毅; 赵晓娟; 孟雁; 沈洁; 薛越强; 史顺娣; 蔡有余

    2001-01-01

    Objective. To clone complete EcoRII restriction endonuclease gene (ecoRllR) and methyltransferase gene(ecoRllM) in one ector and to analyze the coordinating expression of this whole R-M system.Methods. Unidirectional deletion subclones were constructed with ExolII. ecoRllR/M genes were preliminari-ly located in the cloned fragment according to the enzyme activities of subclones. Exact deletion sites were deter-mined by sequencing, and transcriptional start sites were determined by S1 mapping.Results. The DNA fragment which was cloned into pBluescript SK + contained intact ecoRIlR gene andecoRllM gene, anc two transcriptional start sites of ecoRllR gene were determined. 132bp to 458bp from 3' endof ecoRllR gene ar.e indispensable to enzyme activities and deletion of 202bp from 3' end of ecoRllM gene madeenzyme lose the capability in DNA protection to resist specific cut with EcoRII endonuclease (EcoRII. R). Dele-tion of the coding ar d flanking sequences of one gene did not affect the expression of the other gene, and the recombi-nants only containing ecoRllR gene appeared to be lethal to dcm+ host.Conclusion. scoRllM gene linking closely to ecoRIIR gene is very important for the existence of the R-M sys-tem in process of evolution, but the key to control EcoRlI R-M order may not exist in transcriptional level .``Liu Jmy,Corresponding author.

  1. Becker muscular dystrophy in Indian patients: Analysis of dystrophin gene deletion patterns

    Directory of Open Access Journals (Sweden)

    Dastur Rashna

    2008-01-01

    Full Text Available Background: Becker muscular dystrophy (BMD is caused by mutations in the dystrophin gene with variable phenotypes. Becker muscular dystrophy patients have low levels of nearly full-length dystrophin and carry in-frame mutations, which allow partial functioning of the protein. Aim: To study the deletion patterns of BMD and to correlate the same with reading frame rule and different phenotypes. Setting: A tertiary care teaching hospital. Design: This is a prospective hospital-based study. Materials and Methods: Thirty-two exons spanning different "hot spot" regions using Multiplex PCR techniques were studied in 347 patients. Two hundred and twenty-two showed deletions in one or more of the 32 exons. Out of these, 46 diagnosed as BMD patients were analyzed. Results: Forty-six BMD patients showed deletions in both regions of the dystrophin gene. Out of these 89.1% (41/46 were in-frame deletions. Deletions starting with Exon 45 were found in 76.1% (35/46 of the cases. Mutations in the majority of cases i.e. 39/46 (84.8% were seen in 3′ downstream region (Exon 45-55, distal rod domain. Few, i.e. 5/46 (10.8% showed deletions in 5′ upstream region (Exons 3-20, N-terminus and proximal rod domain of the gene, while in 2/46 (4.4% large mutations (>40 bp spanning both regions (Exons 3-55 were detected. Conclusion: This significant gene deletion analysis has been carried out for BMD patients particularly from Western India using 32 exons.

  2. A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

    Science.gov (United States)

    Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

    2010-01-01

    A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

  3. Copy Number Deletion Has Little Impact on Gene Expression Levels in Racehorses

    Directory of Open Access Journals (Sweden)

    Kyung-Do Park

    2014-09-01

    Full Text Available Copy number variations (CNVs, important genetic factors for study of human diseases, may have as large of an effect on phenotype as do single nucleotide polymorphisms. Indeed, it is widely accepted that CNVs are associated with differential disease susceptibility. However, the relationships between CNVs and gene expression have not been characterized in the horse. In this study, we investigated the effects of copy number deletion in the blood and muscle transcriptomes of Thoroughbred racing horses. We identified a total of 1,246 CNVs of deletion polymorphisms using DNA re-sequencing data from 18 Thoroughbred racing horses. To discover the tendencies between CNV status and gene expression levels, we extracted CNVs of four Thoroughbred racing horses of which RNA sequencing was available. We found that 252 pairs of CNVs and genes were associated in the four horse samples. We did not observe a clear and consistent relationship between the deletion status of CNVs and gene expression levels before and after exercise in blood and muscle. However, we found some pairs of CNVs and associated genes that indicated relationships with gene expression levels: a positive relationship with genes responsible for membrane structure or cytoskeleton and a negative relationship with genes involved in disease. This study will lead to conceptual advances in understanding the relationship between CNVs and global gene expression in the horse.

  4. Deletion of Salmonella enterica serovar typhimurium sipC gene

    Institute of Scientific and Technical Information of China (English)

    Maryam; Safarpour; Dehkordi; Abbas; Doosti; Asghar; Arshi

    2015-01-01

    Objective:To construct a novel plasmid as Salmonella enterica serovar typhimurium(S.typhimurium)sip C gene knockouts candidate.Methods:In this research,50upstream and 30downstream regions of S.typhimurium sip C gene and kanamycin gene were PCR amplified.Each of these DNA fragment was cloned into p GEM T-easy vector.The construct was confirmed by PCR and restriction digest.Results:PCR amplified 320,206 and 835 bp DNA fragments were subcloned into p ET-32 vector resulting with a plasmid called p ET-32-sip C up-kan-sip C down.Conclusions:The new plasmid(p ET-32-sip C up-kan-sip C down)is useful for genetic engineering and for future manipulation of S.typhimurium sip C gene.

  5. Deletion of Salmonella enterica serovar typhimurium sipC gene

    Institute of Scientific and Technical Information of China (English)

    Maryam Safarpour Dehkordi; Abbas Doosti; Asghar Arshi

    2015-01-01

    Objective: To construct a novel plasmid as Salmonella enterica serovar typhimurium (S. typhimurium) sipC gene knockouts candidate. Methods: In this research, 50 upstream and 30 downstream regions of S. typhimurium sipC gene and kanamycin gene were PCR amplified. Each of these DNA fragment was cloned into pGEM T-easy vector. The construct was confirmed by PCR and restriction digest. Results: PCR amplified 320, 206 and 835 bp DNA fragments were subcloned into pET-32 vector resulting with a plasmid called pET-32-sipC up-kan-sip C down. Conclusions: The new plasmid (pET-32-sipC up-kan-sip C down) is useful for genetic engineering and for future manipulation of S. typhimurium sipC gene.

  6. Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Y.; Woloschak, G.E. [Argonne National Lab., IL (United States). Center for Mechanistic Biology and Biotechnology

    1997-08-01

    This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF{sub 1} male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P < 0.05) higher percentage of mRb deletions in lung adenocarcinomas from mice exposed to 60 once-weekly {gamma}-ray doses than those from mice receiving 24 once-weekly {gamma}-ray doses at low doses and low dose rates; however, the percentage was not significantly different (P > 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose {gamma} irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed.

  7. Screening of Dystrophin Gene Deletions in Egyptian Patients with DMD/BMD Muscular Dystrophies

    Directory of Open Access Journals (Sweden)

    Laila K. Effat

    2000-01-01

    Full Text Available Duchenne muscular dystrophy (DMD and Becker muscular dystrophy (BMD are allelic disorders caused by mutations within the dystrophin gene. Our study has identified 100 Egyptian families collected from the Human Genetics Clinic, National Research Center, Cairo. All cases were subjected to complete clinical evaluation pedigree analysis, electromyography studies, estimation of serum creatine phosphokinase enzyme (CPK levels and DNA analysis. Multiplex PCR using 18 pairs of specific primers were used for screening of deletion mutations within the dystrophin gene. A frequency of 55% among the families. Sixty per cent of detected deletions involved multiple exons spanning the major or the minor hot spot of the dystrophin gene. The remainder 40% which mainly involved exon 45. Comparing these findings with frequencies of other countries it was found that our figures fall within the reported range of 40%– for deletions. The distribution of deletions in our study and other different studies was variable and specific ethnic differences do not apparently account for specific deletions. In addition this study concluded that employment of the 18 exon analysis is a cost effective and a highly accurate (97% to launch a nationwide program.

  8. Deletions in a ribosomal protein-coding gene are associated with tigecycline resistance in Enterococcus faecium.

    Science.gov (United States)

    Niebel, Marc; Quick, Joshua; Prieto, Ana Maria Guzman; Hill, Robert L R; Pike, Rachel; Huber, Damon; David, Miruna; Hornsey, Michael; Wareham, David; Oppenheim, Beryl; Woodford, Neil; van Schaik, Willem; Loman, Nicholas

    2015-11-01

    Enterococcus faecium is an emerging nosocomial pathogen associated with antibiotic therapy in the hospital environment. Whole-genome sequences were determined for three pairs of related, consecutively collected E. faecium clinical isolates to determine putative mechanisms of resistance to tigecycline. The first isolates (1S, 2S and 3S) in each of the three pairs were sensitive to tigecycline [minimum inhibitory concentration (MIC) of 0.125 mg/L]. Following tigecycline therapy, the second isolate in each pair demonstrated increased resistance to tigecycline. Two isolates (1R and 2R) were resistant (MIC of 8 mg/L) and one isolate (3I) demonstrated reduced susceptibility (MIC of 0.5 mg/L). Mutations distinguishing each pair of sensitive and resistant isolates were determined through alignment to a reference genome and variant detection. In addition, a de novo assembly of each isolate genome was constructed to confirm mutations. A total of 16 mutations in eleven coding sequences were determined. Mutations in the rpsJ gene, which encodes a structural protein forming part of the 30S ribosomal subunit, were detected in each of the pairs. Mutations were in regions proximal to the predicted tigecycline-binding site. Predicted amino acid substitutions were detected in 1R and 3I. The resistant strains were additionally associated with deletions of 15 nucleotides (2R) and 3 nucleotides (1R). This study confirms that amino acid substitutions in rpsJ contribute towards reduced susceptibility to tigecycline and suggests that deletions may be required for tigecycline resistance in E. faecium.

  9. Exclusion of APC and VHL gene deletions by array-based comparative hybridization in two patients with microscopically visible chromosomal aberrations.

    Science.gov (United States)

    Wallerstein, Robert J; Brooks, Susan Sklower; Streck, Deanna L; Kurvathi, Rohini; Toruner, Gokce A

    2007-10-15

    Karyotyping is a major component of the genetic work-up of patients with dysmorphism. Cytogenetic aberrations close to a known tumor suppressor gene raise important clinical issues because deletion of that tumor suppressor gene can cause genetic predisposition to cancer. We present two cancer-free dysmorphic patients with karyotypes of 46,XX,del(5)(q15q22.3) and 46,XX,del(3)(p25.2~pter). These deletions are close to the APC and VHL genes that confer susceptibility to familial Adenomatous polyposis (OMIM #17510) and von-Hippel-Lindau syndrome (OMIM #193300), respectively. The array-based comparative genomic hybridization (array-CGH) analysis using a custom Agilent 44K oligonucleotide array demonstrated an interstitial 20.7-megabase (Mb) deletion on 5q (chr5: 89,725,638-110,491,345) and a terminal 9.45-Mb deletion on 3p (chr3:pter-9,450,984). According to the March 2006 human reference sequence, the APC gene is located at chr5: 112,101,483-112,209,835 and the VHL gene is located at chr3: 10,158,319-10,168,746. These results indicate that the APC gene is 2,300 kilobases (kb) and the VHL gene is 700 kb away from deleted regions. Southern blot analysis for APC and VHL genes were negative, consistent with array-CGH findings. These results demonstrate the power of array-CCH to assess potential tumor suppressor gene involvement and cancer risk in patients with microscopically visible deletions in areas near tumor suppressors.

  10. Type I oculocutaneous albinism (OCA1) associated with a large deletion of the tyrosinase (TYR) gene

    Energy Technology Data Exchange (ETDEWEB)

    Spritz, R.A.; Wick, P.A.; Holmes, S.A.; Schnur, R.E. [Univ. of Wisconsin, Madison, WI (United States)]|[Children`s Hospital of Philadelphia, PA (United States)

    1994-09-01

    OCA1 is an autosomal recessive disorder in which the biosynthesis of melanin is reduced or absent in skin, hair, and eyes, due to deficient enzymatic activity of tyrosinase. TYR consists of 5 exons spanning over 65 kb at 11q14-q21. Analyses of TYR in >400 unrelated patients with OCA1 have identified more than 50 different point mutations; however, no large deletions have been detected. Here we report a large deletion of TYR in a Caucasian boy with OCA1B. Simultaneous SSCP/heteroduplex screening and DNA sequence analysis indicated that the patient was apparently homozygous for a previously described TYR mutation, adjacent to the 3` splice site of IVS2 (-7, t{r_arrow}a). To distinguish between possible gene deletion vs. maternal uniparental isodisomy, we characterized several chromosome 11 polymorphisms. Maternal uniparental isodisomy was excluded by the patient`s heterozygosity for alleles at D11S35 (11q21-122) and HBG2 (11p15.5). In addition, the patient failed to inherit paternal alleles at an MboI RFLP in exon 1 of TYR and at a TaqI RFLP in the promoter region of the gene. To detect a possible submicroscopic deletion, we performed quantitative Southern blot hybridization using a full length TYR cDNA. Compared with controls, both the patient and his father appeared deleted for two or three TYR-derived PstI fragments; the two TYRL-derived fragments appeared normal. These data indicate that the patient and his father have a partial TYR deletion, including at least exons 1, 2, and IVS2. Based on the organization of the gene, this deletion is at least 50 kb in size. The patient is thus hemizygous for the maternally-inherited mutation in IVS2, accounting for his OCA1B phenotype.

  11. The einkorn wheat (Triticum monococcum) mutant, maintained vegetative phase, is caused by a deletion in the VRN1 gene.

    Science.gov (United States)

    Shitsukawa, Naoki; Ikari, Chihiro; Shimada, Sanae; Kitagawa, Satoshi; Sakamoto, Koichi; Saito, Hiroyuki; Ryuto, Hiromichi; Fukunishi, Nobuhisa; Abe, Tomoko; Takumi, Shigeo; Nasuda, Shuhei; Murai, Koji

    2007-04-01

    The einkorn wheat (Triticum monococcum) mutant, maintained vegetative phase (mvp), was induced by nitrogen ion-beam treatment and was identified by its inability to transit from the vegetative to reproductive phase. In our previous study, we showed that WAP1 (wheat APETALA1) is a key gene in the regulatory pathway that controls phase transition from vegetative to reproductive growth in common wheat. WAP1 is an ortholog of the VRN1 gene that is responsible for vernalization insensitivity in einkorn wheat. The mvp mutation resulted from deletion of the VRN1 coding and promoter regions, demonstrating that WAP1/VRN1 is an indispensable gene for phase transition in wheat. Expression analysis of flowering-related genes in mvp plants indicated that wheat GIGANTIA (GI), CONSTANS (CO) and SUPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) genes either act upstream of or in a different pathway to WAP1/VRN1.

  12. Deletion of Cmu genes in mouse B lymphocytes upon stimulation with LPS.

    Science.gov (United States)

    Radbruch, A; Sablitzky, F

    1983-01-01

    Mouse B lymphocytes can be activated polyclonally by bacterial lipopolysaccharide (LPS) to differentiate into plasmablasts. Within several days many cells perform immunoglobulin (Ig) class switching in vitro. We have purified LPS blasts expressing IgM or only IgG3 on the cell surface and analysed the DNA of these cells by Southern hybridisation blotting to detect rearrangement or deletion of CH genes. Quantitative evaluation of the Southern blots suggests that populations of surface IgG3+ (sIgG3+) cells from 6-day and sIgM+ cells from 8-day-old cultures contain only about half as many Cmu genes as spleen cells. Cmu deletion is nearly complete in populations of sIgG3+ cells from 9-day-old cultures. Therefore, upon stimulation with LPS, within a few days Cmu is deleted in most sIgG3+ cells from both chromosomes.

  13. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    Energy Technology Data Exchange (ETDEWEB)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-04-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF{sub 1} mice irradiated with {sup 60}Co {gamma} rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of {sup 60}Co {gamma} rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from {gamma}-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5{prime} region of the mRb gene.

  14. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    Energy Technology Data Exchange (ETDEWEB)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-01-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF[sub 1] mice irradiated with [sup 60]Co [gamma] rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of [sup 60]Co [gamma] rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from [gamma]-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5[prime] region of the mRb gene.

  15. Deletions in the Y-derived amelogenin gene fragment in the Indian population

    Directory of Open Access Journals (Sweden)

    Sahoo Sanghamitra

    2006-04-01

    Full Text Available Abstract Background Rare failures in amelogenin-based gender typing of individuals have been observed globally. In this study, we report the deletion of a large fragment of the amelogenin gene in 10 individuals out of 4,257 male samples analyzed from 104 different endogamous populations of India. Methods Samples were analyzed using commercial genetic profiling kits. Those that exhibited failures in amelogenin-based gender identification were further analyzed with published as well as newly designed primers to ascertain the nature and extent of mutation. Results The failure rate among Indian males was 0.23 %. Though the exact size and nature of the deletion (single point mutations at a number of positions or a single large deletion could not be determined in the present study, it is inferred that the deletion spans a region downstream of the reverse primer-binding site of commercially available amelogenin primer sets. Deletions were conspicuously absent among the Mongoloid tribes of Northeast India, while both caste and tribal groups harbored these mutations, which was predominantly among the Y-chromosomes belonging to J2 lineage. Conclusion Our study indicates that the different amelogenin primer sets currently included in genetic profiling multiplex kits may result in erroneous interpretations due to mutations undetectable during routine testing. Further there are indications that these mutations could possibly be lineage-specific, inherited deletions.

  16. Deletion of ribosomal protein genes is a common vulnerability in human cancer, especially in concert with TP53 mutations.

    Science.gov (United States)

    Ajore, Ram; Raiser, David; McConkey, Marie; Jöud, Magnus; Boidol, Bernd; Mar, Brenton; Saksena, Gordon; Weinstock, David M; Armstrong, Scott; Ellis, Steven R; Ebert, Benjamin L; Nilsson, Björn

    2017-04-01

    Heterozygous inactivating mutations in ribosomal protein genes (RPGs) are associated with hematopoietic and developmental abnormalities, activation of p53, and altered risk of cancer in humans and model organisms. Here we performed a large-scale analysis of cancer genome data to examine the frequency and selective pressure of RPG lesions across human cancers. We found that hemizygous RPG deletions are common, occurring in about 43% of 10,744 cancer specimens and cell lines. Consistent with p53-dependent negative selection, such lesions are underrepresented in TP53-intact tumors (P ≪ 10(-10)), and shRNA-mediated knockdown of RPGs activated p53 in TP53-wild-type cells. In contrast, we did not see negative selection of RPG deletions in TP53-mutant tumors. RPGs are conserved with respect to homozygous deletions, and shRNA screening data from 174 cell lines demonstrate that further suppression of hemizygously deleted RPGs inhibits cell growth. Our results establish RPG haploinsufficiency as a strikingly common vulnerability of human cancers that associates with TP53 mutations and could be targetable therapeutically. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  17. Multi-exon deletions of the FBN1 gene in Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Schrijver Iris

    2001-10-01

    Full Text Available Abstract Background Mutations in the fibrillin -1 gene (FBN1 cause Marfan syndrome (MFS, an autosomal dominant multi-system connective tissue disorder. The 200 different mutations reported in the 235 kb, 65 exon-containing gene include only one family with a genomic multi-exon deletion. Methods We used long-range RT-PCR for mutation detection and long-range genomic PCR and DNA sequencing for identification of deletion breakpoints, allele-specific transcript analyses to determine stability of the mutant RNA, and pulse-chase studies to quantitate fibrillin synthesis and extracellular matrix deposition in cultured fibroblasts. Southern blots of genomic DNA were probed with three overlapping fragments covering the FBN1 coding exons Results Two novel multi-exon FBN1 deletions were discovered. Identical nucleotide pentamers were found at or near the intronic breakpoints. In a Case with classic MFS, an in-frame deletion of exons 42 and 43 removed the C-terminal 24 amino acids of the 5th LTBP (8-cysteine domain and the adjacent 25th calcium-binding EGF-like (6-cysteine domain. The mutant mRNA was stable, but fibrillin synthesis and matrix deposition were significantly reduced. A Case with severe childhood-onset MFS has a de novo deletion of exons 44–46 that removed three EGF-like domains. Fibrillin protein synthesis was normal, but matrix deposition was strikingly reduced. No genomic rearrangements were detected by Southern analysis of 18 unrelated MFS samples negative for FBN1 mutation screening. Conclusions Two novel deletion cases expand knowledge of mutational mechanisms and genotype/phenotype correlations of fibrillinopathies. Deletions or mutations affecting an LTBP domain may result in unstable mutant protein cleavage products that interfere with microfibril assembly.

  18. Deletion analysis of oligomycin PKS genes (olmA) in Streptomyces avermitilis

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xiaolin; CHEN Zhi; ZHAO Jinlei; SONG Yuan; WEN Ying; LI Jilun

    2004-01-01

    Gene deletion vector pXL05(pKC1139∷△olmA1 +△olmA4) was used to disrupt oligomycin PKS encoding genes (olmA) in Streptomyces avermitilis CZ8-73, the producer of anthelmintic avermectins B and the cell growth inhibitor oligomycin. olmA gene cluster in the chromosome was displaced by deletion allele on the plasmid via double crossover. Four of disruptants were confirmed by Southern blotting. Shaking flask experiments and HPLC analyses showed that the four mutants no longer produced the toxic oligomycin, but only made four components of avermectins B, which were avermectin B1a, B1b, B2a, B2b. The yields of avermectins B in these mutants were separately equal to those in CZ8-73. This revealed that olmA genes deletion did not affect the biosynthesis of avermectins. The deletion mutants were proved to be genetically stable, and thus might be promising strains in industrial production of avermectins B.

  19. Intragenic deletion in the LARGE gene causes Walker-Warburg syndrome.

    NARCIS (Netherlands)

    Reeuwijk, J. van; Grewal, P.K.; Salih, M.A.; Beltran Valero de Bernabe, D.; McLaughlan, J.M.; Michielse, C.B.; Herrmann, R.; Hewitt, J.E.; Steinbrecher, A.; Seidahmed, M.Z.; Shaheed, M.M.; Abomelha, A.; Brunner, H.G.; Bokhoven, J.H.L.M. van; Voit, T.

    2007-01-01

    Intragenic homozygous deletions in the Large gene are associated with a severe neuromuscular phenotype in the myodystrophy (myd) mouse. These mutations result in a virtual lack of glycosylation of alpha-dystroglycan. Compound heterozygous LARGE mutations have been reported in a single human patient,

  20. Establishment of a Cre recombinase based mutagenesis protocol for markerless gene deletion in Streptococcus suis.

    Science.gov (United States)

    Koczula, A; Willenborg, J; Bertram, R; Takamatsu, D; Valentin-Weigand, P; Goethe, R

    2014-12-01

    The lack of knowledge about pathogenicity mechanisms of Streptococcus (S.) suis is, at least partially, attributed to limited methods for its genetic manipulation. Here, we established a Cre-lox based recombination system for markerless gene deletions in S. suis serotype 2 with high selective pressure and without undesired side effects.

  1. Insertion/deletion polymorphism of the ACE gene and adherence to ACE inhibitors

    NARCIS (Netherlands)

    H. Schelleman (Hedi); O.H. Klungel (Olaf); C.M. van Duijn (Cock); J.C.M. Witteman (Jacqueline); A. Hofman (Albert); A.C. de Boer (Anthonius); B.H.Ch. Stricker (Bruno)

    2005-01-01

    textabstractAims: We investigated whether the insertion/deletion (I/D) polymorphism of the ACE gene modified the adherence to ACE inhibitors as measured by the discontinuation of an ACE inhibitor, or addition of another antihypertensive drug. Methods: This was a cohort study among 239 subjects who

  2. Insertion/deletion polymorphism of the ACE gene and adherence to ACE inhibitors

    NARCIS (Netherlands)

    Schelleman, H; Klungel, O H; van Duijn, C M; Witteman, J C M; Hofman, A; de Boer, A; Stricker, B H Ch

    AIMS: We investigated whether the insertion/deletion (I/D) polymorphism of the ACE gene modified the adherence to ACE inhibitors as measured by the discontinuation of an ACE inhibitor, or addition of another antihypertensive drug. METHODS: This was a cohort study among 239 subjects who started ACE

  3. Deletion of ku homologs increases gene targeting frequency in Streptomyces avermitilis.

    Science.gov (United States)

    Zhang, Xiaojuan; Chen, Wei; Zhang, Yang; Jiang, Libin; Chen, Zhi; Wen, Ying; Li, Jilun

    2012-06-01

    Streptomyces avermitilis is an industrially important soil bacterium known for production of avermectins, which are antiparasitic agents useful in animal health care, agriculture, and treatment of human infections. ku genes play a key role in the non-homologous end-joining pathway for repair of DNA double strand breaks. We identified homologs of eukaryotic ku70 and ku80 genes, termed ku1 and ku2, in S. avermitilis. Mutants with deletion of ku1, ku2, and both genes were constructed and their phenotypic changes were characterized. Deletion of ku genes had no apparent adverse effects on growth, spore formation, or avermectin production. The ku mutants, in comparison to wild-type strain, were slightly more sensitive to the DNA-damaging agent ethyl methanesulfonate, but not to UV exposure or to bleomycin. Gene targeting frequencies by homologous recombination were higher in the ku mutants than in wild-type strain. We conclude that ku-deleted strains will be useful hosts for efficient gene targeting and will facilitate functional analysis of genes in S. avermitilis and other industrially important bacterial strains.

  4. Contiguous gene deletion of ELOVL7, ERCC8 and NDUFAF2 in a patient with a fatal multisystem disorder

    DEFF Research Database (Denmark)

    Janssen, Rolf J R J; Distelmaier, Felix; Smeets, Roel

    2009-01-01

    gene deletion on chromosome 5. The deletion encompassed the NDUFAF2, ERCC8 and ELOVL7 genes, encoding complex I assembly factor 2 (also known as human B17.2L), a protein of the transcription-coupled nucleotide excision repair (TC-NER) machinery, and a putative elongase of very long-chain fatty acid...

  5. Adipose-Specific Deletion of Autophagy-Related Gene 7 (atg7) in Mice Reveals a Role in Adipogenesis

    National Research Council Canada - National Science Library

    Yong Zhang; Scott Goldman; Rebecca Baerga; Yun Zhao; Masaaki Komatsu; Shengkan Jin

    2009-01-01

    .... Autophagy is a membrane trafficking process leading to lysosomal degradation. Here, we investigated the effect of the deletion of an essential autophagy gene, autophagy-related gene 7 (atg7), on adipogenesis...

  6. Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries

    DEFF Research Database (Denmark)

    Alvaro, D.; Sunjevaric, I.; Reid, R. J.

    2006-01-01

    We have developed a new method, systematic hybrid loss of heterozygosity, to facilitate genomic screens utilizing the yeast gene deletion library. Screening is performed using hybrid diploid strains produced through mating the library haploids with strains from a different genetic background...... mating a library gene deletion haploid to such a conditional centromere strain, which corresponds to the chromosome carrying the gene deletion, loss of heterozygosity (LOH) at the gene deletion locus can be generated in these otherwise hybrid diploids. The use of hybrid diploid strains permits...... complementation of any spurious recessive mutations in the library strain, facilitating attribution of the observed phenotype to the documented gene deletion and dramatically reducing false positive results commonly obtained in library screens. The systematic hybrid LOH method can be applied to virtually any...

  7. Tackling the issue of environmental survival of live Salmonella Typhimurium vaccines: deletion of the lon gene.

    Science.gov (United States)

    Leyman, Bregje; Boyen, Filip; Van Parys, Alexander; Verbrugghe, Elin; Haesebrouck, Freddy; Pasmans, Frank

    2012-12-01

    Vaccination is an important measure to control Salmonella contamination in the meat production chain. A previous study showed that both the ΔrfaJ and ΔrfaL strains are suitable markers and allow serological differentiation of infected and vaccinated animals. The aim of this study was to verify whether deletion of the lon gene in a Salmonella Typhimurium ΔrfaJ marker strain resulted in decreased environmental survival. Our results indicate that deletion of the lon gene in the ΔrfaJ strain did not affect invasiveness in IPEC-J2 cells and resulted in an increased susceptibility to UV, disinfectants (such as hydrogen peroxide and tosylchloramide sodium) and citric acid. Immunization of pigs with inactivated ΔrfaJ or ΔlonΔrfaJ vaccines allowed differentiation of infected and vaccinated pigs. Furthermore, deletion of the lon gene did not reduce the protection conferred by live wild type or ΔrfaJ vaccines against subsequent challenge with a virulent Salmonella Typhimurium strain in BALB/c mice. Based on our results in mice, we conclude that deletion of lon in ΔrfaJ contributes to environmental safety of the ΔrfaJ DIVA strain.

  8. An analysis of substitution, deletion and insertion mutations in cancer genes.

    Science.gov (United States)

    Iengar, Prathima

    2012-08-01

    Cancer-associated mutations in cancer genes constitute a diverse set of mutations associated with the disease. To gain insight into features of the set, substitution, deletion and insertion mutations were analysed at the nucleotide level, from the COSMIC database. The most frequent substitutions were c → t, g → a, g → t, and the most frequent codon changes were to termination codons. Deletions more than insertions, FS (frameshift) indels more than I-F (in-frame) ones, and single-nucleotide indels, were frequent. FS indels cause loss of significant fractions of proteins. The 5'-cut in FS deletions, and 5'-ligation in FS insertions, often occur between pairs of identical bases. Interestingly, the cut-site and 3'-ligation in insertions, and 3'-cut and join-pair in deletions, were each found to be the same significantly often (p Proto-oncogenes undergo fewer, less-disruptive mutations, in selected protein regions, to activate a single allele. Finally, catalogues, in ranked order, of genes mutated in each cancer, and cancers in which each gene is mutated, were created. The study highlights the nucleotide level preferences and disruptive nature of cancer mutations.

  9. Gene dosage analysis identifies large deletions of the FECH gene in 10% of families with erythropoietic protoporphyria.

    Science.gov (United States)

    Whatley, Sharon D; Mason, Nicola G; Holme, S Alexander; Anstey, Alex V; Elder, George H; Badminton, Michael N

    2007-12-01

    Erythropoietic protoporphyria (EPP) is an inherited cutaneous porphyria characterized by partial deficiency of ferrochelatase (FECH), accumulation of protoporphyrin IX in erythrocytes, skin, and liver, and acute photosensitivity. Genetic counseling in EPP requires identification of FECH mutations, but current sequencing-based procedures fail to detect mutations in about one in six families. We have used gene dosage analysis by quantitative PCR to identify large deletions of the FECH gene in 19 (58%) of 33 unrelated UK patients with EPP in whom mutations could not be detected by sequencing. Seven deletions were identified, six of which were previously unreported. Breakpoints were identified for six deletions (c.1-7887-IVS1+2425insTTCA; c.1-9629-IVS1+2437; IVS2-1987-IVS4+352del; c.768-IVS7+244del; IVS7+2784-IVS9+108del; IVS6+2350-TGA+95del). Five breakpoints were in intronic repeat sequences (AluSc, AluSq, AluSx, L1MC4). The remaining deletion (Del Ex3-4) is likely to be a large insertion-deletion. Combining quantitative PCR with routine sequencing increased the sensitivity of mutation detection in 189 unrelated UK patients with EPP from 83% (95% CI: 76-87%) to 93% (CI: 88-96%) (P=0.003). Our findings show that large deletions of the FECH gene are an important cause of EPP. Gene dosage analysis should be incorporated into routine procedures for mutation detection in EPP.

  10. Phosphoinositide-specific Phospholipase C β1 gene deletion in bipolar disorder affected patient.

    Science.gov (United States)

    Lo Vasco, Vincenza Rita; Longo, Lucia; Polonia, Patrizia

    2013-03-01

    The involvement of phosphoinositides (PI) signal transduction pathway and related molecules, such as the Phosphoinositide-specific Phospholipase C (PI-PLC) enzymes, in the pathophysiology of mood disorders is corroborated by a number of recent evidences. Our previous works identified the deletion of PLCB1 gene, which codifies for the PI-PLC β1 enzyme, in 4 out 15 patients affected with schizophrenia, and no deletion both in major depression affected patients and in normal controls. By using interphase fluorescent in situ hybridization methodology, we analyzed PLCB1 in paraffin embedded samples of orbito-frontal cortex of 15 patients affected with bipolar disorder. Deletion of PLCB1 was identified in one female patient.

  11. Partial Gene Deletions of PMP22 Causing Hereditary Neuropathy with Liability to Pressure Palsies

    Directory of Open Access Journals (Sweden)

    Sun-Mi Cho

    2014-01-01

    Full Text Available Hereditary neuropathy with liability to pressure palsies (HNPP is an autosomal neuropathy that is commonly caused by a reciprocal 1.5 Mb deletion on chromosome 17p11.2, at the site of the peripheral myelin protein 22 (PMP22 gene. Other patients with similar phenotypes have been shown to harbor point mutations or small deletions, although there is some clinical variation across these patients. In this report, we describe a case of HNPP with copy number changes in exon or promoter regions of PMP22. Multiplex ligation-dependent probe analysis revealed an exon 1b deletion in the patient, who had been diagnosed with HNPP in the first decade of life using molecular analysis.

  12. Total alpha-globin gene cluster deletion has high frequency in Filipinos

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, J.A.; Haruyama, A.Z.; Chu, B.M. [Kapiolani Medical Center, Honolulu, HI (United States)] [and others

    1994-09-01

    Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms; {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).

  13. Deletion in the FMR1 gene in a fragile-X male

    Energy Technology Data Exchange (ETDEWEB)

    Mannermaa, A.; Pulkkinen, L.; Kajanoja, E. [Kuopio Univ., Hospital (Finland)] [and others

    1996-08-09

    The pathogenesis of fragile-X syndrome is a consequence of absence of the FMR1 gene product associated with expansion of the CGG repeat and abnormal methylation of this and a CpG island 250 hp proximal to the CGG repeat located at exon 1 in the FMR1 gene. While this is usually the case, some suspected fragile-X syndrome patients have been described with a mutation other than CGG expansion. We describe here an affected fragile-X male, who was found to be mosaic of a full mutation of the CGG expansion and a deletion in the FMR1 gene. The patient`s phenotype is probably mainly due to the effect of the full mutation of the repeat sequence. Thus, the influence of the deletion is difficult to evaluate. 20 refs., 2 figs.

  14. First contiguous gene deletion causing biotinidase deficiency: The enzyme deficiency in three Sri Lankan children

    Directory of Open Access Journals (Sweden)

    Danika Nadeen Senanayake

    2015-03-01

    Full Text Available We report three symptomatic children with profound biotinidase deficiency from Sri Lanka. All three children presented with typical clinical features of the disorder. The first is homozygous for a missense mutation in the BTD gene (c.98_104 del7insTCC; p.Cys33PhefsX36 that is commonly seen in the western countries, the second is homozygous for a novel missense mutation (p.Ala439Asp, and the third is the first reported instance of a contiguous gene deletion causing the enzyme deficiency. In addition, this latter finding exemplifies the importance of considering a deletion within the BTD gene for reconciling enzymatic activity with genotype, which can occur in asymptomatic children who are identified by newborn screening.

  15. Molecular basis and consequences of a deletion in the amelogenin gene, analyzed by capture PCR

    Energy Technology Data Exchange (ETDEWEB)

    Lagerstroem-Fermer, M.; Pettersson, U.; Landegren, U. (Univ. of Uppsala (Sweden))

    1993-07-01

    A mutation that disrupts the gene for one of the major proteins in tooth enamel has been investigated. The mutation is located in the amelogenin gene and causes X-linked amelogenesis imperfecta, characterized by defective mineralization of tooth enamel. The authors have isolated the breakpoints of a 5-kb deletion in the amelogenin gene on the basis of nucleotide sequence information located upstream of the lesion, using a technique termed capture PCR. The deletion removes five of the seven exons, spanning from the second intron to the last exon. Only the first two codons for the mature protein remain, consistent with the relatively severe phenotype of affected individuals in the present family. The mutation appears to have arisen as an illegitimate recombination event since of 11 nucleotide positions immediately surrounding the two breakpoints, 9 are identical. 17 refs., 3 figs., 1 tab.

  16. A common deletion at D6S265 in the hemochromatosis gene region

    Energy Technology Data Exchange (ETDEWEB)

    Pyper, W.R.; Burt, M.J.; Powell, L.W. [Queensland Institute of Medical Research and Department of Medicine, Brisbane (Australia)] [and others

    1994-09-01

    Positional cloning of the hemochromatosis (HC) gene on chromosome 6p has utilized a number of highly polymorphic microsatellite markers. While the putative HC gene has been localized within 1 cM of HLA-A, definition of the genetic limits of the HC locus has been controversial. Isolation and characterization of additional markers within this region will enable construction of a physical map upon which the HC gene can located. D6S265 is one such microsatellite, physically mapped within 120 kb centromeric of HLA-A. Recombinant and linkage analysis of this dinucleotide repeat in 24 Australian families segregating for HC positioned D6S265 within 1 cM of the HC gene, while allele association analysis showed allele 1 to be significantly increased in HC patients ({chi}{sup 2}=41.4, p<0.001, RR=5.75). In 6 of the 24 HC families, a D6265 locus deletion was found to segregate with HLA-A25 and HLA-A26 alleles. The D6S265 locus deletion was not associated with expression of HC. This study enables us to exclude candidate HC genes from the deleted region involving D6S265, and gives further support for an area of instability in the HLA class I region.

  17. Speckle-type POZ (pox virus and zinc finger protein) protein gene deletion in ovarian cancer: Fluorescence in situ hybridization analysis of a tissue microarray.

    Science.gov (United States)

    Hu, Xiaoyu; Yang, Zhu; Zeng, Manman; Liu, Y I; Yang, Xiaotao; Li, Yanan; Li, X U; Yu, Qiubo

    2016-07-01

    The aim of the present study was to investigate the status of speckle-type POZ (pox virus and zinc finger protein) protein (SPOP) gene located on chromosome 17q21 in ovarian cancer (OC). The present study evaluated a tissue microarray, which contained 90 samples of ovarian cancer and 10 samples of normal ovarian tissue, using fluorescence in situ hybridization (FISH). FISH is a method where a SPOP-specific DNA red fluorescence probe was used for the experimental group and a centromere-specific DNA green fluorescence probe for chromosome 17 was used for the control group. The present study demonstrated that a deletion of the SPOP gene was observed in 52.27% (46/88) of the ovarian cancer tissues, but was not identified in normal ovarian tissues. Simultaneously, monosomy 17 was frequently identified in the ovarian cancer tissues, but not in the normal ovarian tissues. Furthermore, the present data revealed that the ovarian cancer histological subtype and grade were significantly associated with a deletion of the SPOP gene, which was assessed by the appearance of monosomy 17 in the ovarian cancer samples; the deletion of the SPOP gene was observed in a large proportion of serous epithelial ovarian cancer (41/61; 67.21%), particularly in grade 3 (31/37; 83.78%). In conclusion, deletion of the SPOP gene on chromosome 17 in ovarian cancer samples, which results from monosomy 17, indicates that the SPOP gene may serve as a tumor suppressor gene in ovarian cancer.

  18. Deletion of the TNFAIP3/A20 gene detected by FICTION analysis in classical Hodgkin lymphoma

    Directory of Open Access Journals (Sweden)

    Nomoto Junko

    2012-10-01

    Full Text Available Abstract Background The TNFAIP3 gene, which encodes a ubiquitin-modifying enzyme (A20 involved in the negative regulation of NF-κB signaling, is frequently inactivated by gene deletions/mutations in a variety of B-cell malignancies. However, the detection of this in primary Hodgkin lymphoma (HL specimens is hampered by the scarcity of Hodgkin Reed-Sternberg (HR-S cells even after enrichment by micro-dissection. Methods We used anti-CD30 immunofluorescence with fluorescence in-situ hybridization (FISH to evaluate the relative number of TNFAIP3/CEP6 double-positive signals in CD30-positive cells. Results From a total of 47 primary classical Hodgkin lymphoma (cHL specimens, 44 were evaluable. We found that the relative numbers of TNFAIP3/CD30 cells were distributed among three groups, corresponding to those having homozygous (11%, heterozygous (32%, and no (57% deletions in TNFAIP3. This shows that TNFAIP3 deletions could be sensitively detected using our chosen methods. Conclusions Comparing the results with mutation analysis, TNFAIP3 inactivation was shown to have escaped detection in many samples with homozygous deletions. This suggests that TNFAIP3 inactivation in primary cHL specimens might be more frequent than previously reported.

  19. Deletion of the TNFAIP3/A20 gene detected by FICTION analysis in classical Hodgkin lymphoma

    Science.gov (United States)

    2012-01-01

    Background The TNFAIP3 gene, which encodes a ubiquitin-modifying enzyme (A20) involved in the negative regulation of NF-κB signaling, is frequently inactivated by gene deletions/mutations in a variety of B-cell malignancies. However, the detection of this in primary Hodgkin lymphoma (HL) specimens is hampered by the scarcity of Hodgkin Reed-Sternberg (HR-S) cells even after enrichment by micro-dissection. Methods We used anti-CD30 immunofluorescence with fluorescence in-situ hybridization (FISH) to evaluate the relative number of TNFAIP3/CEP6 double-positive signals in CD30-positive cells. Results From a total of 47 primary classical Hodgkin lymphoma (cHL) specimens, 44 were evaluable. We found that the relative numbers of TNFAIP3/CD30 cells were distributed among three groups, corresponding to those having homozygous (11%), heterozygous (32%), and no (57%) deletions in TNFAIP3. This shows that TNFAIP3 deletions could be sensitively detected using our chosen methods. Conclusions Comparing the results with mutation analysis, TNFAIP3 inactivation was shown to have escaped detection in many samples with homozygous deletions. This suggests that TNFAIP3 inactivation in primary cHL specimens might be more frequent than previously reported. PMID:23039325

  20. Germinal mosaicism in a sample of families with Duchenne/Becker muscular dystrophy with partial deletions in the DMD gene.

    Science.gov (United States)

    Bermúdez-López, Cesárea; García-de Teresa, Benilde; González-del Angel, Ariadna; Alcántara-Ortigoza, Miguel Angel

    2014-02-01

    Germinal mosaicism should be considered when estimating the recurrence risk in families with Duchenne/Becker muscular dystrophy (D/BMD). Germinal mosaicism, however, has not been assessed in Mexican families with deletions in the DMD gene. To determine the distribution of deletions in the two hot spots and the proportion of de novo and transmitted deletions, we analyzed 153 individuals with D/BMD and a DMD partial deletion and 322 of their maternal female relatives. Predilection for the distal hot spot was observed in 112 families (73%), while gene dosage analysis of female relatives of D/BMD patients identified germinal mosaicism deletions in at least 11.6% of the patients' families, thought to result from de novo mutations. Recurrence risk due to germinal mosaicism justifies carrier detection in maternal female relatives and prenatal diagnosis in mothers of individuals with apparently de novo DMD deletions.

  1. Treacher Collins syndrome with a de Novo 5-bp deletion in the TCOF1 gene.

    Science.gov (United States)

    Su, Pen-Hua; Chen, Jia-Yu; Chen, Suh-Jen; Yu, Ju-Shan

    2006-06-01

    Treacher Collins syndrome (TCS) is an autosomal dominant disorder of craniofacial development with features including malar hypoplasia, micrognathia, microtia, downward slanting palpebral fissures, lower eyelid coloboma, conductive hearing loss, and cleft palate. TCS is caused by mutations in the TCOF1 gene, which encodes the nuclear phosphoprotein treacle. Here, we describe a 1-day-old male infant with classical TCS presentation. A 5-bp deletion in exon 22 of the TCOF1 gene (3469del ACTCT) was found to cause a premature stop codon. This is the first report of TCOF1 gene mutation in the Taiwanese population.

  2. Early-onset obesity and paternal 2pter deletion encompassing the ACP1, TMEM18, and MYT1L genes

    Science.gov (United States)

    Doco-Fenzy, Martine; Leroy, Camille; Schneider, Anouck; Petit, Florence; Delrue, Marie-Ange; Andrieux, Joris; Perrin-Sabourin, Laurence; Landais, Emilie; Aboura, Azzedine; Puechberty, Jacques; Girard, Manon; Tournaire, Magali; Sanchez, Elodie; Rooryck, Caroline; Ameil, Agnès; Goossens, Michel; Jonveaux, Philippe; Lefort, Geneviève; Taine, Laurence; Cailley, Dorothée; Gaillard, Dominique; Leheup, Bruno; Sarda, Pierre; Geneviève, David

    2014-01-01

    Obesity is a common but highly, clinically, and genetically heterogeneous disease. Deletion of the terminal region of the short arm of chromosome 2 is rare and has been reported in about 13 patients in the literature often associated with a Prader–Willi-like phenotype. We report on five unrelated patients with 2p25 deletion of paternal origin presenting with early-onset obesity, hyperphagia, intellectual deficiency, and behavioural difficulties. Among these patients, three had de novo pure 2pter deletions, one presented with a paternal derivative der(2)t(2;15)(p25.3;q26) with deletion in the 2pter region and the last patient presented with an interstitial 2p25 deletion. The size of the deletions was characterized by SNP array or array-CGH and was confirmed by fluorescence in situ hybridization (FISH) studies. Four patients shared a 2p25.3 deletion with a minimal critical region estimated at 1.97 Mb and encompassing seven genes, namely SH3HYL1, ACP1, TMEMI8, SNTG2, TPO, PXDN, and MYT1L genes. The fifth patient had a smaller interstitial deletion encompassing the TPO, PXDN, and MYT1L genes. Paternal origin of the deletion was determined by genotyping using microsatellite markers. Analysis of the genes encompassed in the deleted region led us to speculate that the ACP1, TMEM18, and/or MYT1L genes might be involved in early-onset obesity. In addition, intellectual deficiency and behavioural troubles can be explained by the heterozygous loss of the SNTG2 and MYT1L genes. Finally, we discuss the parent-of-origin of the deletion. PMID:24129437

  3. Early-onset obesity and paternal 2pter deletion encompassing the ACP1, TMEM18, and MYT1L genes.

    Science.gov (United States)

    Doco-Fenzy, Martine; Leroy, Camille; Schneider, Anouck; Petit, Florence; Delrue, Marie-Ange; Andrieux, Joris; Perrin-Sabourin, Laurence; Landais, Emilie; Aboura, Azzedine; Puechberty, Jacques; Girard, Manon; Tournaire, Magali; Sanchez, Elodie; Rooryck, Caroline; Ameil, Agnès; Goossens, Michel; Jonveaux, Philippe; Lefort, Geneviève; Taine, Laurence; Cailley, Dorothée; Gaillard, Dominique; Leheup, Bruno; Sarda, Pierre; Geneviève, David

    2014-04-01

    Obesity is a common but highly, clinically, and genetically heterogeneous disease. Deletion of the terminal region of the short arm of chromosome 2 is rare and has been reported in about 13 patients in the literature often associated with a Prader-Willi-like phenotype. We report on five unrelated patients with 2p25 deletion of paternal origin presenting with early-onset obesity, hyperphagia, intellectual deficiency, and behavioural difficulties. Among these patients, three had de novo pure 2pter deletions, one presented with a paternal derivative der(2)t(2;15)(p25.3;q26) with deletion in the 2pter region and the last patient presented with an interstitial 2p25 deletion. The size of the deletions was characterized by SNP array or array-CGH and was confirmed by fluorescence in situ hybridization (FISH) studies. Four patients shared a 2p25.3 deletion with a minimal critical region estimated at 1.97 Mb and encompassing seven genes, namely SH3HYL1, ACP1, TMEMI8, SNTG2, TPO, PXDN, and MYT1L genes. The fifth patient had a smaller interstitial deletion encompassing the TPO, PXDN, and MYT1L genes. Paternal origin of the deletion was determined by genotyping using microsatellite markers. Analysis of the genes encompassed in the deleted region led us to speculate that the ACP1, TMEM18, and/or MYT1L genes might be involved in early-onset obesity. In addition, intellectual deficiency and behavioural troubles can be explained by the heterozygous loss of the SNTG2 and MYT1L genes. Finally, we discuss the parent-of-origin of the deletion.

  4. EZH2 expression in gliomas: Correlation with CDKN2A gene deletion/ p16 loss and MIB-1 proliferation index.

    Science.gov (United States)

    Purkait, Suvendu; Sharma, Vikas; Jha, Prerana; Sharma, Mehar Chand; Suri, Vaishali; Suri, Ashish; Sharma, B S; Sarkar, Chitra

    2015-10-01

    Enhancer of zeste homolog 2 (EZH2) mediated down-regulation of CDKN2A/p16 has been observed in cell lines as well as in a few carcinomas. However, there is no study correlating EZH2 expression with CDKN2A/p16 status in gliomas. Hence, the present study was conducted to evaluate EZH2 expression in astrocytic and oligodendroglial tumors and correlate with CDKN2A/p16 status as well as MIB-1 labeling index (LI). Gliomas of all grades (n = 118) were studied using immunohistochemistry to assess EZH2, p16 and MIB-1 LI and fluorescence in situ hybrization to evaluate CDKN2A gene status. EZH2 expression and CDKN2A homozygous deletion (HD) were both significantly more frequent in high-grade gliomas (HGG). Further, strong EZH2 expression (LI ≥ 25%) was significantly more common in HGGs without CDKN2A HD (48.7%; 19/39) as compared to cases with deletion (15.8%; 3/19). Loss of p16 expression was noted in 100% and 51.3% of CDKN2A deleted and non-deleted tumors, respectively. Notably, 80% (16/20) of the CDKN2A non-deleted HGGs with p16 loss had strong EZH2 expression, in contrast to only 15.8% (3/19) in the deleted group. Loss of p16 expression significantly correlated with MIB-1 LI, irrespective of EZH2 status. Thus, this study shows that EZH2 expression correlates with tumor grade in both astrocytic and oligodendroglial tumors and hence can be used as a diagnostic marker to differentiate between low and HGGs. Further, this is the first report demonstrating an inverse correlation of strong EZH2 expression with CDKN2A HD in HGGs. Loss of p16 protein expression is mostly attributable to CDKN2A HD and correlates significantly with MIB-1 LI. Notably, our study for the first time suggests a possible epigenetic mechanism of p16 loss in CDKN2A non-deleted HGGs mediated by strong EZH2 expression. A hypothetical model for control of proliferative activity in low versus HGGs is therefore proposed. © 2015 Japanese Society of Neuropathology.

  5. Targeted Genes Sequencing Identified a Novel 15 bp Deletion on GJA8 in a Chinese Family with Autosomal Dominant Congenital Cataracts

    Institute of Scientific and Technical Information of China (English)

    Han-Yi Min; Peng-Peng Qiao; Asan; Zhi-Hui Yan; Hui-Feng Jiang; Ya-Ping Zhu; Hui-Qian Du

    2016-01-01

    Background:Congenital cataract (CC) is the leading cause of visual impairment or blindness in children worldwide.Because of highly genetic and clinical heterogeneity,a molecular diagnosis of the lens disease remains a challenge.Methods:In this study,we tested a three-generation Chinese family with autosomal dominant CCs by targeted sequencing of 45 CC genes on next generation sequencing and evaluated the pathogenicity of the detected mutation by protein structure,pedigree validation,and molecular dynamics (MD) simulation.Results:A novel 15 bp deletion on GJA8 (c.426_440delGCTGGAGGGGACCCT or p.143_147delLEGTL) was detected in the family.The deletion,concemed with an in-frame deletion of 5 amino acid residues in a highly evolutionarily conserved region within the cytoplasmic loop domain of the gap junction channel protein connexin 50 (Cx50),was in full cosegregation with the cataract phenotypes in the family but not found in 1100 control exomes.MD simulation revealed that the introduction of the deletion destabilized the Cx50 gap junction channel,indicating the deletion as a dominant-negative mutation.Conclusions:The above results support the pathogenic role of the 15 bp deletion on GJA8 in the Chinese family and demonstrate targeted genes sequencing as a resolution to molecular diagnosis of CCs.

  6. Dopaminergic neuron-specific deletion of p53 gene is neuroprotective in an experimental Parkinson's disease model.

    Science.gov (United States)

    Qi, Xin; Davis, Brandon; Chiang, Yung-Hsiao; Filichia, Emily; Barnett, Austin; Greig, Nigel H; Hoffer, Barry; Luo, Yu

    2016-09-01

    p53, a stress response gene, is involved in diverse cell death pathways and its activation has been implicated in the pathogenesis of Parkinson's disease (PD). However, whether the neuronal p53 protein plays a direct role in regulating dopaminergic (DA) neuronal cell death is unknown. In this study, in contrast to the global inhibition of p53 function by pharmacological inhibitors and in traditional p53 knock-out (KO) mice, we examined the effect of DA specific p53 gene deletion in DAT-p53KO mice. These DAT-p53KO mice did not exhibit apparent changes in the general structure and neuronal density of DA neurons during late development and in aging. However, in DA-p53KO mice treated with the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), we found that the induction of Bax and p53 up-regulated modulator of apoptosis (PUMA) mRNA and protein levels by MPTP were diminished in both striatum and substantia nigra of these mice. Notably, deletion of the p53 gene in DA neurons significantly reduced dopaminergic neuronal loss in substantia nigra, dopaminergic neuronal terminal loss at striatum and, additionally, decreased motor deficits in mice challenged with MPTP. In contrast, there was no difference in astrogliosis between WT and DAT-p53KO mice in response to MPTP treatment. These findings demonstrate a specific contribution of p53 activation in DA neuronal cell death by MPTP challenge. Our results further support the role of programmed cell death mediated by p53 in this animal model of PD and identify Bax, BAD and PUMA genes as downstream targets of p53 in modulating DA neuronal death in the in vivo MPTP-induced PD model. We deleted p53 gene in dopaminergic neurons in late developmental stages and found that DA specific p53 deletion is protective in acute MPTP animal model possibly through blocking MPTP-induced BAX and PUMA up-regulation. Astrocyte activation measured by GFAP positive cells and GFAP gene up-regulation in the striatum shows no difference

  7. Gene deletion strategy to examine the involvement of the two chondroitin lyases in Flavobacterium columnare virulence.

    Science.gov (United States)

    Li, Nan; Qin, Ting; Zhang, Xiao Lin; Huang, Bei; Liu, Zhi Xin; Xie, Hai Xia; Zhang, Jin; McBride, Mark J; Nie, Pin

    2015-11-01

    Flavobacterium columnare is an important bacterial pathogen of freshwater fish that causes high mortality of infected fish and heavy economic losses in aquaculture. The pathogenesis of this bacterium is poorly understood, in part due to the lack of efficient methods for genetic manipulation. In this study, a gene deletion strategy was developed and used to determine the relationship between the production of chondroitin lyases and virulence. The F. johnsoniae ompA promoter (PompA) was fused to sacB to construct a counterselectable marker for F. columnare. F. columnare carrying PompA-sacB failed to grow on media containing 10% sucrose. A suicide vector carrying PompA-sacB was constructed, and a gene deletion strategy was developed. Using this approach, the chondroitin lyase-encoding genes, cslA and cslB, were deleted. The ΔcslA and ΔcslB mutants were both partially deficient in digestion of chondroitin sulfate A, whereas a double mutant (ΔcslA ΔcslB) was completely deficient in chondroitin lyase activity. Cells of F. columnare wild-type strain G4 and of the chondroitin lyase-deficient ΔcslA ΔcslB mutant exhibited similar levels of virulence toward grass carp in single-strain infections. Coinfections, however, revealed a competitive advantage for the wild type over the chondroitin lyase mutant. The results indicate that chondroitin lyases are not essential virulence factors of F. columnare but may contribute to the ability of the pathogen to compete and cause disease in natural infections. The gene deletion method developed in this study may be employed to investigate the virulence factors of this bacterium and may have wide application in many other members of the phylum Bacteroidetes.

  8. Mouse otocyst transuterine gene transfer restores hearing in mice with connexin 30 deletion-associated hearing loss.

    Science.gov (United States)

    Miwa, Toru; Minoda, Ryosei; Ise, Momoko; Yamada, Takao; Yumoto, Eiji

    2013-06-01

    Although numerous causative genes for hereditary hearing loss have been identified, there are no fundamental treatments for this condition. Herein, we describe a novel potential treatment for genetic hearing loss. Because mutations or deletions in the connexin (Cx) genes are common causes of profound congenital hearing loss in both humans and mice, we investigated whether gene supplementation therapy using the wild-type Cx gene could cure hearing loss. We first generated inner ear-specific connexin 30 (Cx30)-deficient mice via the transuterine transfer of Cx30-targeted short hairpin RNA (shRNA-Cx30) into otocysts. The inner ear-specific Cx30-deficient mice mimicked homozygous Cx30-deficient mice both histologically and physiologically. Subsequently, we cotransfected the shRNA-Cx30 and the wild-type Cx30 gene. The cotransfected mice exhibited Cx30 expression in the cochleae and displayed normal auditory functions. Next, we performed the transuterine transfer of the wild-type Cx30 gene into the otocysts of homozygous Cx30-deficient mice, thereby rescuing the lack of Cx30 expression in the cochleae and restoring auditory functioning. These results demonstrate that supplementation therapy with wild-type genes can restore postnatal auditory functioning. Moreover, this is the first report to show that Cx-related genetic hearing loss is treatable by in vivo gene therapy.

  9. Germline deletions in the tumour suppressor gene FOCAD are associated with polyposis and colorectal cancer development.

    Science.gov (United States)

    Weren, Robbert D A; Venkatachalam, Ramprasath; Cazier, Jean-Baptiste; Farin, Henner F; Kets, C Marleen; de Voer, Richarda M; Vreede, Lilian; Verwiel, Eugène T P; van Asseldonk, Monique; Kamping, Eveline J; Kiemeney, Lambertus A; Neveling, Kornelia; Aben, Katja K H; Carvajal-Carmona, Luis; Nagtegaal, Iris D; Schackert, Hans K; Clevers, Hans; van de Wetering, Marc; Tomlinson, Ian P; Ligtenberg, Marjolijn J L; Hoogerbrugge, Nicoline; Geurts van Kessel, Ad; Kuiper, Roland P

    2015-06-01

    Heritable genetic variants can significantly affect the lifetime risk of developing cancer, including polyposis and colorectal cancer (CRC). Variants in genes currently known to be associated with a high risk for polyposis or CRC, however, explain only a limited number of hereditary cases. The identification of additional genetic causes is, therefore, crucial to improve CRC prevention, detection and treatment. We have performed genome-wide and targeted DNA copy number profiling and resequencing in early-onset and familial polyposis/CRC patients, and show that deletions affecting the open reading frame of the tumour suppressor gene FOCAD are recurrent and significantly enriched in CRC patients compared with unaffected controls. All patients carrying FOCAD deletions exhibited a personal or family history of polyposis. RNA in situ hybridization revealed FOCAD expression in epithelial cells in the colonic crypt, the site of tumour initiation, as well as in colonic tumours and organoids. Our data suggest that monoallelic germline deletions in the tumour suppressor gene FOCAD underlie moderate genetic predisposition to the development of polyposis and CRC.

  10. CO-DELETION OF BOTH p15/p16 GENES CORRELATES WITH POOR PROGNOSIS NON-SMALL CELL LUNG CNACER

    Institute of Scientific and Technical Information of China (English)

    胡颖; 廖美琳; 丁嘉安; 周瑾; 许凯黎

    2002-01-01

    Objective: To investigate the relationship between co-deletion of p15/p16 genes and the prognostic significance in patients with non-small cell lung cancer (NSCLC). Methods: By using polymerase chain reaction (PCR), the loss of p15/pl6 genes was examined in DNA samples from 140 NSCLC patients. Results: The rate of co-deletion in adenocarcinoma was significantly higher than that in squamous cell carcinoma (P0.05). By a five years' follow-up survey, the survival rate of NSCLC patients with co-deletion of pl5/pl6 genes was obviously lower than that of patients without co-deletion (P<0.01). In the multivariate analysis, co-deletion of p15/p16 genes and TNM stages were identified as independent predictors for overall survival (P<0.01). Conclusion: Since the co-deletion of pl5/pl6 genes is significantly related to the prognosis of NSCLC patients, detecting co-deletion of both genes might be used as a potential marker for NSCLC prognosis.

  11. Osteopathia striata congenita with cranial sclerosis and intellectual disability due to contiguous gene deletions involving the WTX locus

    DEFF Research Database (Denmark)

    Holman, Sk; Morgan, T; Baujat, G;

    2013-01-01

    sclerosis, with a high prevalence of cleft palate and hearing loss. Intellectual disability or neurodevelopmental delay is not observed in females with point mutations in WTX leading to OSCS. One female has been described with a deletion spanning multiple neighbouring genes suggesting that deletion of some...

  12. Possible deletion of a developmentally regulated heavy-chain variable region gene in autoimmune diseases

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Pei-Ming; Olee, Tsaiwei; Kozin, F.; Carson, D.A.; Chen, P.P. (Research Institute of Scripps Clinic, La Jolla, CA (USA)); Olsen, N.J. (Vanderbilt Univ., Nashville, TN (USA)); Siminovitch, K.A. (Univ. of Toronto (Canada))

    1990-10-01

    Several autoantibody-associated variable region (V) genes are preferentially expressed during early ontogenic development, suggesting strongly that they are of developmental and physiological importance. As such, it is possible that polymorphisms in one or more of these genes may alter susceptibility to autoimmune disease. The authors have searched extensively for a probe related to a developmentally regulated V gene that has the power to differentiate among highly homologous V genes in human populations. Using such a probe (i.e., Humhv3005/P1) related to both anti-DNA and anti-IgG autoantibodies, they studied restriction fragment length polymorphisms in patients with rheumatoid arthritis and systemic lupus erythematosus and found an apparent heavy-chain V (V{sub H}) gene deletion that was nearly restricted to the autoimmune patients. These data suggest that deletions of physiologically important V{sub H} genes may increase the risk of autoimmunity through indirect effects on the development and homeostasis of the B-cell repertoire.

  13. Deletion of the thymidine kinase gene induces complete attenuation of the Georgia isolate of African swine fever virus.

    Science.gov (United States)

    Sanford, B; Holinka, L G; O'Donnell, V; Krug, P W; Carlson, J; Alfano, M; Carrillo, C; Wu, Ping; Lowe, Andre; Risatti, G R; Gladue, D P; Borca, M V

    2016-02-02

    African swine fever virus (ASFV) is the etiological agent of a contagious and often lethal viral disease of domestic pigs. There are no vaccines to control Africa swine fever (ASF). Experimental vaccines have been developed using genetically modified live attenuated ASFVs obtained by specifically deleting virus genes involved in virulence, including the thymidine kinase (TK) gene. TK has been shown to be involved in the virulence of several viruses, including ASFV. Here we report the construction of a recombinant virus (ASFV-G/V-ΔTK) obtained by deleting the TK gene in a virulent strain of ASFV Georgia adapted to replicate in Vero cells (ASFV-G/VP30). ASFV-G/P-ΔTK demonstrated decreased replication both in primary swine macrophage cell cultures and in Vero cells compared with ASFV-G/VP30. In vivo, intramuscular administration of up to 10(6) TCID50 of ASFV-G/V-ΔTK does not result in ASF disease. However, these animals are not protected when challenged with the virulent parental Georgia strain.

  14. A novel contiguous gene deletion of AVPR2 and ARHGAP4 genes in male dizygotic twins with nephrogenic diabetes insipidus and intellectual disability.

    Science.gov (United States)

    Huang, Lingli; Poke, Gemma; Gecz, Jozef; Gibson, Kate

    2012-10-01

    The clinical features of loss of ARHGAP4 function remain unclear despite several reports of different patterns of deletions inactivating different functional regions of the protein. The protein encoded by ARHGAP4 is thought to function as a Rho GTPase activating protein. Characterization of the genetic defect causing X-linked nephrogenic diabetes insipidus (NDI) and intellectual disability in two dizygotic twin brothers revealed a novel contiguous deletion of 17,905 bp encompassing the entire AVPR2 gene and extending into intron 7 of the ARHGAP4 gene. Examination of their mother showed that she was a carrier of this deletion. An attempt was made to distinguish the putative clinical signs of an ARHGAP4 deletion from the well-defined phenotype of X-linked NDI caused by an AVPR2 gene deletion. By reviewing all characterized deletions encompassing ARHGAP4, we reconsider the potential role of ARHGAP4 in cognition.

  15. The PML gene is linked to a megabase-scale insertion/deletion restriction fragment length polymorphism

    Energy Technology Data Exchange (ETDEWEB)

    Goy, A.; Xiao, Y.H.; Passalaris, T. [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)] [and others

    1995-03-20

    The PML gene located on chromosome band 15q22 is involved with the RAR{alpha} locus (17q21) in a balanced reciprocal translocation uniquely observed in acute promyelocytic leukemia. Physical mapping studies by pulsed-field gel electrophoresis revealed that the PML gene is flanked by two CpG islands that are separated by a variable distance in normal individuals. Several lines of evidence demonstrate that this is the consequence of a large insertion/deletion polymorphism linked to the PML locus: (1) overlapping fragments obtained with a variety of rare-cutting restriction enzymes demonstrated the same variability in distance between the flanking CpG islands; (2) mapping with restriction enzymes insensitive to CpG methylation confirmed that the findings were not a consequence of variable methylation of CpG dinucleotides; (3) the polymorphism followed a Mendelian inheritance pattern. This polymorphism is localized 3{prime} to the PML locus. There are five common alleles, described on the basis of BssHII fragments, ranging from 220 to 350 kb with increments of approximately 30 kb between alleles. Both heterozygous (61%) and homozygous (391%) patterns were observed in normal individuals. Mega-base-scale insertion/deletion restriction fragment length polymorphisms are very rare and have been described initially in the context of multigene families. Such structures have been also reported as likely regions of genetic instability. High-resolution restriction mapping of this particular structure linked to the PML locus is underway. 47 refs., 4 figs., 1 tab.

  16. Suicide Vector Construction of Haemophilus parasuis hhd B Gene Marker-free Deleted

    Institute of Scientific and Technical Information of China (English)

    Song Shuai; Li Miao; Li Yan; Jiang Zhiyong; Cai Rujian; Yang Dongxia; Li Chunling

    2015-01-01

    To construct the suicide vector of hhd B gene marker-free mutant in Haemophilus parasuis( HPS),two pairs of specific primers were designed and synthesized according to the hhd B gene upstream and downstream sequences of HPS published in Gen Bank. The hhd B gene upstream and downstream sequences were amplified by PCR,which were further ligated( hhd B-up + down) through overlapping PCR method. NotⅠand SalⅠrestriction enzyme sites were introduced on both ends of the ligated sequence. After the corresponding digestion,the hhd B-up + down sequence was directionally cloned to the suicide plasmid vector p EMOC2. Results showed that the suicide vector of hhd B gene marker-free deleted( p EMOC2Δhhd B) with stable inheritance in E. coli β2155 strain was successfully obtained,thereby laying the foundation for construction of HPS-hhd B gene marker-free mutant strain.

  17. Esophageal atresia with tracheoesophageal fistula in a patient with 7q35-36.3 deletion including SHH gene.

    Science.gov (United States)

    Busa, Tiffany; Panait, Nicoleta; Chaumoitre, Kathia; Philip, Nicole; Missirian, Chantal

    2016-10-01

    Terminal 7q deletion is rarely reported in the literature. Holoprosencephaly and sacral dysgenesis are found in association with this deletion, due to haploinsufficiency of SHH and HLBX9 genes respectively. We report on a 2-year-old boy with 7q35-36.3 deletion encompassing SHH identified by oligonucleotide array comparative genomic hybridization. In addition to other frequent features, the patient presented with esophageal atresia and tracheoeosophageal fistula diagnosed at birth. This case, together with two others previously described, one presenting with esophageal atresia, the other with congenital esophageal stenosis, confirms the possible association between congenital esophageal malformations and 7q terminal deletion including SHH.

  18. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System.

    Science.gov (United States)

    Min, Kyunghun; Ichikawa, Yuichi; Woolford, Carol A; Mitchell, Aaron P

    2016-01-01

    Clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-associated gene 9 (CRISPR-Cas9) systems are used for a wide array of genome-editing applications in organisms ranging from fungi to plants and animals. Recently, a CRISPR-Cas9 system has been developed for the diploid fungal pathogen Candida albicans; the system accelerates genetic manipulation dramatically [V. K. Vyas, M. I. Barrasa, and G. R. Fink, Sci Adv 1(3):e1500248, 2015, http://dx.doi.org/10.1126/sciadv.1500248]. We show here that the CRISPR-Cas9 genetic elements can function transiently, without stable integration into the genome, to enable the introduction of a gene deletion construct. We describe a transient CRISPR-Cas9 system for efficient gene deletion in C. albicans. Our observations suggest that there are two mechanisms that lead to homozygous deletions: (i) independent recombination of transforming DNA into each allele and (ii) recombination of transforming DNA into one allele, followed by gene conversion of the second allele. Our approach will streamline gene function analysis in C. albicans, and our results indicate that DNA can function transiently after transformation of this organism. IMPORTANCE The fungus Candida albicans is a major pathogen. Genetic analysis of this organism has revealed determinants of pathogenicity, drug resistance, and other unique biological features, as well as the identities of prospective drug targets. The creation of targeted mutations has been greatly accelerated recently through the implementation of CRISPR genome-editing technology by Vyas et al. [Sci Adv 1(3):e1500248, 2015, http://dx.doi.org/10.1126/sciadv.1500248]. In this study, we find that CRISPR elements can be expressed from genes that are present only transiently, and we develop a transient CRISPR system that further accelerates C. albicans genetic manipulation.

  19. Gene expression and single nucleotide polymorphism array analyses of spindle cell lipomas and conventional lipomas with 13q14 deletion.

    Science.gov (United States)

    Bartuma, Hammurabi; Nord, Karolin H; Macchia, Gemma; Isaksson, Margareth; Nilsson, Jenny; Domanski, Henryk A; Mandahl, Nils; Mertens, Fredrik

    2011-08-01

    Spindle cell lipomas (SCL) are circumscribed, usually s.c. tumors that typically occur on the posterior neck, shoulder, and back of middle aged men. Cytogenetically, almost all SCL are characterized by deletions of chromosome arm 13q, often in combination with loss of 16q. Deletions of 13q are seen also in approximately 15% of conventional lipomas. Through single nucleotide polymorphism (SNP) array analyses, we identified two minimal deleted regions (MDR) in 13q14 in SCL. In MDR1, four genes were located, including the tumor suppressor gene RB1. MDR1 in SCL overlapped with the MDR detected in conventional lipomas with 13q14 deletion. In MDR2 in SCL there were 34 genes and the two microRNA (miRNA) genes miR-15a and miR-16-1. Global gene expression analysis was used to study the impact of the deletions on genes mapping to the two SCL-associated MDR. Five genes (C13orf1, DHRS12, ATP7B, ALG11, and VPS36) in SCL and one gene (C13orf1) in conventional lipomas with 13q-deletions were found to be significantly underexpressed compared with control tissues. Quantitative real-time PCR showed that miR-16-1 was expressed at lower levels in SCL than in the control samples. No mutations were found at sequencing of RB1, miR-15a, and miR-16-1. Our findings further delineate the target region for the 13q deletion in SCL and conventional lipomas and show that the deletions are associated with down-regulated expression of several genes, notably C13orf1, which was the only gene to be significantly down-regulated in both tumor types. Copyright © 2011 Wiley-Liss, Inc.

  20. Unusual presentation of Kallmannn syndrome with contiguous gene deletion in three siblings of a family.

    Science.gov (United States)

    Madhu, Sri Venkat; Kant, Saket; Holla, Vikram Venkappayya; Arora, Rakesh; Rathi, Sahaj

    2012-12-01

    We report the case of 3 brothers aged 34, 24, and 22 years, unmarried, who presented to our endocrinology clinic with absence of secondary sexual characters. There was no such history in other siblings, but their maternal uncle had similar complaints. On examination, all 3 had pre-pubertal appearance, voice, and genitalia along with anosmia and bimanual synkinesia. Cryptorchidism was noticed in 2 while third person had small hypoplastic testes. It was also noted that all 3 patients had icthyosis mainly involving trunk, back, and limbs. The hormonal assays were consistent with isolated hypogonadotrophic hypogonadism. IQ testing revealed mental retardation in the 2 patients. Ultrasound showed ectopic right kidney in one patient, atrophic right kidney in the second patient while the third patient had normal kidneys. MRI brain of all the patients showed poorly visualized olfactory tract and bulb. Kallmann syndrome (KS) was diagnosed based on hormonal evaluation and MRI results. Of the four types of KS: Synkinesia, renal anomaly, and X-linked pedigree pattern in our patients pointed towards X-linked type 1 KS as the possible cause. But, icthyosis and mental retardation are not usual presentation of type 1 KS. They are usually seen as a result of contiguous gene deletion of KAL1, steroid sulfatase (STS), and mental retardation (MRX) gene on X chromosome. Hence, the possible gene defect in our cases is inherited defect in contiguous gene deletion. The contiguous gene deletion as the cause of KS in 3 patients of same family is very rare and worth reporting. Also, the significance of phenotype-genotypic association in Kallmann syndrome is discussed.

  1. Identification of a novel functional deletion variant in the 5'-UTR of the DJ-1 gene

    Directory of Open Access Journals (Sweden)

    Warnich Louise

    2009-10-01

    Full Text Available Abstract Background DJ-1 forms part of the neuronal cellular defence mechanism against oxidative insults, due to its ability to undergo self-oxidation. Oxidative stress has been implicated in the pathogenesis of central nervous system damage in different neurodegenerative disorders including Alzheimer's disease and Parkinson's disease (PD. Various mutations in the DJ-1 (PARK7 gene have been shown to cause the autosomal recessive form of PD. In the present study South African PD patients were screened for mutations in DJ-1 and we aimed to investigate the functional significance of a novel 16 bp deletion variant identified in one patient. Methods The possible effect of the deletion on promoter activity was investigated using a Dual-Luciferase Reporter assay. The DJ-1 5'-UTR region containing the sequence flanking the 16 bp deletion was cloned into a pGL4.10-Basic luciferase-reporter vector and transfected into HEK293 and BE(2-M17 neuroblastoma cells. Promoter activity under hydrogen peroxide-induced oxidative stress conditions was also investigated. Computational (in silico cis-regulatory analysis of DJ-1 promoter sequence was performed using the transcription factor-binding site database, TRANSFAC via the PATCH™ and rVISTA platforms. Results A novel 16 bp deletion variant (g.-6_+10del was identified in DJ-1 which spans the transcription start site and is situated 93 bp 3' from a Sp1 site. The deletion caused a reduction in luciferase activity of approximately 47% in HEK293 cells and 60% in BE(2-M17 cells compared to the wild-type (P Conclusion This is the first report of a functional DJ-1 promoter variant, which has the potential to influence transcript stability or translation efficiency. Further work is necessary to determine the extent to which the g.-6_+10del variant affects the normal function of the DJ-1 promoter and whether this variant confers a risk for PD.

  2. Novel large deletion in the ACTA1 gene in a child with autosomal recessive nemaline myopathy.

    Science.gov (United States)

    Friedman, Bethany; Simpson, Kara; Tesi-Rocha, Carolina; Zhou, Delu; Palmer, Cheryl A; Suchy, Sharon F

    2014-04-01

    Nemaline myopathy (NM) is a genetically and clinically heterogeneous disorder resulting from a disruption of the thin filament proteins of the striated muscle sarcomere. The disorder is typically characterized by muscle weakness including the face, neck, respiratory, and limb muscles and is clinically classified based on the age of onset and severity. Mutations in the ACTA1 gene contribute to a significant proportion of NM cases. The majority of ACTA1 gene mutations are missense mutations causing autosomal dominant NM by producing an abnormal protein. However, approximately 10% of ACTA1 gene mutations are associated with autosomal recessive NM; these mutations are associated with loss of protein function. We report the first case of a large deletion in the ACTA1 gene contributing to autosomal recessive NM. This case illustrates the importance of understanding disease mechanisms at the molecular level to accurately infer the inheritance pattern and potentially aid with clinical management. Copyright © 2014. Published by Elsevier B.V.

  3. High risk genetic factor in Chinese patients with idiopathic male infertility:deletion of DAZ gene copy on Y chromosome

    Institute of Scientific and Technical Information of China (English)

    杨元; 肖翠英; 张思仲; 张思孝; 黄明孔; 林立

    2004-01-01

    @@ Idiopathic azoospermia or oligozoospermia affects approximately 2%-4% of all married males. Recently studies have confirmed that the deletion of DAZ in AZFc region of Y chromosome may be one of the important genetic aetiologies of Caucasian male infertility. To determine the relationship between DAZ gene deletion and idiopathic male infertility in Chinese population, we analysed the DAZ gene copy number of AZFc region in patients with idiopathic azoospermia or oligozoospermia, as well as fertile Chinese men.

  4. The evolution of small insertions and deletions in the coding genes of Drosophila melanogaster.

    Science.gov (United States)

    Chong, Zechen; Zhai, Weiwei; Li, Chunyan; Gao, Min; Gong, Qiang; Ruan, Jue; Li, Juan; Jiang, Lan; Lv, Xuemei; Hungate, Eric; Wu, Chung-I

    2013-12-01

    Studies of protein evolution have focused on amino acid substitutions with much less systematic analysis on insertion and deletions (indels) in protein coding genes. We hence surveyed 7,500 genes between Drosophila melanogaster and D. simulans, using D. yakuba as an outgroup for this purpose. The evolutionary rate of coding indels is indeed low, at only 3% of that of nonsynonymous substitutions. As coding indels follow a geometric distribution in size and tend to fall in low-complexity regions of proteins, it is unclear whether selection or mutation underlies this low rate. To resolve the issue, we collected genomic sequences from an isogenic African line of D. melanogaster (ZS30) at a high coverage of 70× and analyzed indel polymorphism between ZS30 and the reference genome. In comparing polymorphism and divergence, we found that the divergence to polymorphism ratio (i.e., fixation index) for smaller indels (size ≤ 10 bp) is very similar to that for synonymous changes, suggesting that most of the within-species polymorphism and between-species divergence for indels are selectively neutral. Interestingly, deletions of larger sizes (size ≥ 11 bp and ≤ 30 bp) have a much higher fixation index than synonymous mutations and 44.4% of fixed middle-sized deletions are estimated to be adaptive. To our surprise, this pattern is not found for insertions. Protein indel evolution appear to be in a dynamic flux of neutrally driven expansion (insertions) together with adaptive-driven contraction (deletions), and these observations provide important insights for understanding the fitness of new mutations as well as the evolutionary driving forces for genomic evolution in Drosophila species.

  5. Severe fetal and neonatal hemolytic anemia due to a 198 kb deletion removing the complete β-globin gene cluster.

    Science.gov (United States)

    Verhovsek, Madeleine; Shah, Nirmish R; Wilcox, Ibifiri; Koenig, Sara C; Barros, Tiago; Thornburg, Courtney D; Steinberg, Martin H; Luo, Hong-yuan; Chui, David H K

    2012-11-01

    Fetal and neonatal hemolytic anemia can be caused by (γδβ)(0)-thalassemia deletions of the β-globin gene cluster. Many of these deletions have not been well characterized, and diagnostic tests are not readily available, thus hampering carrier detection, family counseling, and antenatal diagnosis. We report and define a 198 kb deletion removing the entire β-globin gene cluster, which was found in members of a multigeneration family of Irish/Scottish descent. The proband had life-threatening fetal and neonatal hemolytic anemia which subsided by 1 year of age. Copyright © 2012 Wiley Periodicals, Inc.

  6. Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

    Directory of Open Access Journals (Sweden)

    Evelyne Coppin

    Full Text Available Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

  7. Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

    Science.gov (United States)

    Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe

    2012-01-01

    Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

  8. Altered murine tissue colonization by Borrelia burgdorferi following targeted deletion of linear plasmid 17-carried genes.

    Science.gov (United States)

    Casselli, Timothy; Tourand, Yvonne; Bankhead, Troy

    2012-05-01

    The causative agent of Lyme disease, Borrelia burgdorferi, possesses a segmented genome comprised of a single linear chromosome and upwards of 23 linear and circular plasmids. Much of what is known about plasmid-borne genes comes from studying laboratory clones that have spontaneously lost one or more plasmids during in vitro passage. Some plasmids, including the linear plasmid lp17, are never or rarely reported to be lost during routine culture; therefore, little is known about the requirement of these conserved plasmids for infectivity. In this study, the effects of deleting regions of lp17 were examined both in vitro and in vivo. A mutant strain lacking the genes bbd16 to bbd25 showed no deficiency in the ability to establish infection or disseminate to the bloodstream of mice; however, colonization of peripheral tissues was delayed. Despite the ability to colonize ear, heart, and joint tissues, this mutant exhibited a defect in bladder tissue colonization for up to 56 days postinfection. This phenotype was not observed in immunodeficient mice, suggesting that bladder colonization by the mutant strain was inhibited by an adaptive immune-based mechanism. Moreover, the mutant displayed increased expression of outer surface protein C in vitro, which was correlated with the absence of the gene bbd18. To our knowledge, this is the first report involving genetic manipulation of lp17 in an infectious clone of B. burgdorferi and reveals for the first time the effects of lp17 gene deletion during murine infection by the Lyme disease spirochete.

  9. Deletion of cdvB paralogous genes of Sulfolobus acidocaldarius impairs cell division.

    Science.gov (United States)

    Yang, Nuan; Driessen, Arnold J M

    2014-03-01

    The majority of Crenarchaeota utilize the cell division system (Cdv) to divide. This system consists of three highly conserved genes, cdvA, cdvB and cdvC that are organized in an operon. CdvC is homologous to the AAA-type ATPase Vps4, involved in multivesicular body biogenesis in eukaryotes. CdvA is a unique archaeal protein that interacts with the membrane, while CdvB is homologous to the eukaryal Vps24 and forms helical filaments. Most Crenarcheota contain additional CdvB paralogs. In Sulfolobus acidocaldarius these are termed CdvB1-3. We have used a gene inactivation approach to determine the impact of these additional cdvB genes on cell division. Independent deletion mutants of these genes were analyzed for growth and protein localization. One of the deletion strains (ΔcdvB3) showed a severe growth defect on plates and delayed growth on liquid medium. It showed the formation of enlarged cells and a defect in DNA segregation. Since these defects are accompanied with an aberrant localization of CdvA and CdvB, we conclude that CdvB3 fulfills an important accessory role in cell division.

  10. Autosomal Recessive Nonsyndromic Hearing Impairment due to a Novel Deletion in the RDX Gene

    Directory of Open Access Journals (Sweden)

    Kwanghyuk Lee

    2011-01-01

    Full Text Available The RDX gene anchors cytoskeletal actin of stereocilia to hair cell transmembrane and is responsible for autosomal recessive nonsyndromic hearing impairment (ARNSHI due to DFNB24. A genome scan was performed using DNA samples from a consanguineous Pakistani family with ARNSHI. A significant maximum two-point LOD score of 4.5 (θ=0 and multipoint LOD score of 5.8 were achieved at marker D11S1998 (chr11 : 117.20 Mb. The region of homozygosity is bounded by markers D11S2000 (105.06 Mb and D11S4464 (123.13 Mb and contains the NSHI genes TECTA and RDX. Although no potentially causal variants were identified in the TECTA gene, within the RDX gene a novel deletion c.1076_1079delTTAA (p.Ile359Lysfs*6 was identified. The RDX deletion segregates with ARNSHI within the family and was not observed in 500 control chromosomes. It is predicted to cause premature truncation of radixin at the α-helical domain and to result in nonfunctional transcripts within the cochlea. RDX isoforms which encode the coiled-coil region of the α-helical domain are deemed necessary for proper function of hair cell stereocilia.

  11. Infectious bronchitis viruses with naturally occurring genomic rearrangement and gene deletion.

    Science.gov (United States)

    Hewson, Kylie A; Ignjatovic, Jagoda; Browning, Glenn F; Devlin, Joanne M; Noormohammadi, Amir H

    2011-02-01

    Infectious bronchitis viruses (IBVs) are group III coronaviruses that infect poultry worldwide. Genetic variations, including whole-gene deletions, are key to IBV evolution. Australian subgroup 2 IBVs contain sequence insertions and multiple gene deletions that have resulted in a substantial genomic divergence from international IBVs. The genomic variations present in Australian IBVs were investigated and compared to those of another group III coronavirus, turkey coronavirus (TCoV). Open reading frames (ORFs) found throughout the genome of Australian IBVs were analogous in sequence and position to TCoV ORFs, except for ORF 4b, which appeared to be translocated to a different position in the subgroup 2 strains. Subgroup 2 strains were previously reported to lack genes 3a, 3b and 5a, with some also lacking 5b. Of these, however, genes 3b and 5b were found to be present but contained various mutations that may affect transcription. In this study, it was found that subgroup 2 IBVs have undergone a more substantial genomic rearrangements than previously thought.

  12. Identification of a PKP2 gene deletion in a family with arrhythmogenic right ventricular cardiomyopathy.

    Science.gov (United States)

    Li Mura, Ilena Egle Astrid; Bauce, Barbara; Nava, Andrea; Fanciulli, Manuela; Vazza, Giovanni; Mazzotti, Elisa; Rigato, Ilaria; De Bortoli, Marzia; Beffagna, Giorgia; Lorenzon, Alessandra; Calore, Martina; Dazzo, Emanuela; Nobile, Carlo; Mostacciuolo, Maria Luisa; Corrado, Domenico; Basso, Cristina; Daliento, Luciano; Thiene, Gaetano; Rampazzo, Alessandra

    2013-11-01

    Arrhythmogenic right ventricular cardiomyopathy (ARVC) is a primary heart muscle disease characterized by progressive myocardial loss, with fibro-fatty replacement, and high frequency of ventricular arrhythmias that can lead to sudden cardiac death. ARVC is a genetically determined disorder, usually caused by point mutations in components of the cardiac desmosome. Conventional mutation screening of ARVC genes fails to detect causative mutations in about 50% of index cases, suggesting a further genetic heterogeneity. We performed a genome-wide linkage study and a copy number variations (CNVs) analysis, using high-density SNP arrays, in an ARVC family showing no mutations in any of the desmosomal genes. The CNVs analysis identified a heterozygous deletion of about 122 kb on chromosome 12p11.21, including the entire plakophilin-2 gene and shared by all affected family members. It was not listed on any of available public CNVs databases and was confirmed by quantitative real-time PCR. This is the first SNP array-based genome-wide study leading to the identification of a CNV segregating with the disease phenotype in an ARVC family. This result underscores the importance of performing additional analysis for possible genomic deletions/duplications in ARVC patients without point mutations in known disease genes.

  13. Enhancement or attenuation of disease by deletion of genes from Citrus tristeza virus.

    Science.gov (United States)

    Tatineni, Satyanarayana; Dawson, William O

    2012-08-01

    Stem pitting is a common virus-induced disease of perennial woody plants induced by a range of different viruses. The phenotype results from sporadic areas of the stem in which normal xylem and phloem development is prevented during growth of stems. These alterations interfere with carbohydrate transport, resulting in reduced plant growth and yield. Citrus tristeza virus (CTV), a phloem-limited closterovirus, induces economically important stem-pitting diseases of citrus. CTV has three nonconserved genes (p33, p18, and p13) that are not related to genes of other viruses and that are not required for systemic infection of some species of citrus, which allowed us to examine the effect of deletions of these genes on symptom phenotypes. In the most susceptible experimental host, Citrus macrophylla, the full-length virus causes only very mild stem-pitting symptoms. Surprisingly, we found that certain deletion combinations (p33 and p18 and/or p13) induced greatly increased stem-pitting symptoms, while other combinations (p13 or p13 plus p18) resulted in reduced stem pitting. These results suggest that the stem-pitting phenotype, which is one of more economically important disease phenotypes, can result not from a specific sequence or protein but from a balance between the expression of different viral genes. Unexpectedly, using green fluorescent protein-tagged full-length virus and deletion mutants (CTV9Δp33 and CTV9Δp33Δp18Δp13), the virus was found at pitted areas in abnormal locations outside the normal ring of phloem. Thus, increased stem pitting was associated not only with a prevention of xylem production but also with a proliferation of cells that supported viral replication, suggesting that at random areas of stems the virus can elicit changes in cellular differentiation and development.

  14. Compensatory evolution for a gene deletion is not limited to its immediate functional network

    Directory of Open Access Journals (Sweden)

    Bull JJ

    2009-05-01

    Full Text Available Abstract Background Genetic disruption of an important phenotype should favor compensatory mutations that restore the phenotype. If the genetic basis of the phenotype is modular, with a network of interacting genes whose functions are specific to that phenotype, compensatory mutations are expected among the genes of the affected network. This perspective was tested in the bacteriophage T3 using a genome deleted of its DNA ligase gene, disrupting DNA metabolism. Results In two replicate, long-term adaptations, phage compensatory evolution accommodated the low ligase level provided by the host without reinventing its own ligase. In both lines, fitness increased substantially but remained well below that of the intact genome. Each line accumulated over a dozen compensating mutations during long-term adaptation, and as expected, many of the compensatory changes were within the DNA metabolism network. However, several compensatory changes were outside the network and defy any role in DNA metabolism or biochemical connection to the disruption. In one line, these extra-network changes were essential to the recovery. The genes experiencing compensatory changes were moderately conserved between T3 and its relative T7 (25% diverged, but the involvement of extra-network changes was greater in T3. Conclusion Compensatory evolution was only partly limited to the known functionally interacting partners of the deleted gene. Thus gene interactions contributing to fitness were more extensive than suggested by the functional properties currently ascribed to the genes. Compensatory evolution offers an easy method of discovering genome interactions among specific elements that does not rest on an a priori knowledge of those elements or their interactions.

  15. Identification of two point mutations and a one base deletion in exon 19 of the dystrophin gene by heteroduplex formation.

    Science.gov (United States)

    Prior, T W; Papp, A C; Snyder, P J; Burghes, A H; Sedra, M S; Western, L M; Bartello, C; Mendell, J R

    1993-03-01

    Two thirds of the Duchenne muscular dystrophy population have either gene deletions or duplications. The nondeletion/duplication cases are most likely the result of point mutations or small deletions and duplications that cannot be easily identified by current strategies. The major obstacle in identifying small mutations is due to the large size of the dystrophin gene. We selectively screened 5 DMD exons containing CpG dinucleotides in 110 DMD patients without detectable deletions or duplications. Nonsenses mutations are frequently due to a C- to -T transition within a CG dinucleotide pair. To screen for the nonsense mutations, we used the heteroduplex method. Utilizing this approach, we identified 2 different nonsense mutations and a single base deletion all occurring in exon 19. This is the first report of a clustering of small mutations in the dystrophin gene.

  16. A Simple Model of Hox Genes: Bone Morphology Demonstration

    Science.gov (United States)

    Shmaefsky, Brian

    2008-01-01

    Visual demonstrations of abstract scientific concepts are effective strategies for enhancing content retention (Shmaefsky 2004). The concepts associated with gene regulation of growth and development are particularly complex and are well suited for teaching with visual models. This demonstration provides a simple and accurate model of Hox gene…

  17. The impact of gene duplication, insertion, deletion, lateral gene transfer and sequencing error on orthology inference: a simulation study.

    Science.gov (United States)

    Dalquen, Daniel A; Altenhoff, Adrian M; Gonnet, Gaston H; Dessimoz, Christophe

    2013-01-01

    The identification of orthologous genes, a prerequisite for numerous analyses in comparative and functional genomics, is commonly performed computationally from protein sequences. Several previous studies have compared the accuracy of orthology inference methods, but simulated data has not typically been considered in cross-method assessment studies. Yet, while dependent on model assumptions, simulation-based benchmarking offers unique advantages: contrary to empirical data, all aspects of simulated data are known with certainty. Furthermore, the flexibility of simulation makes it possible to investigate performance factors in isolation of one another.Here, we use simulated data to dissect the performance of six methods for orthology inference available as standalone software packages (Inparanoid, OMA, OrthoInspector, OrthoMCL, QuartetS, SPIMAP) as well as two generic approaches (bidirectional best hit and reciprocal smallest distance). We investigate the impact of various evolutionary forces (gene duplication, insertion, deletion, and lateral gene transfer) and technological artefacts (ambiguous sequences) on orthology inference. We show that while gene duplication/loss and insertion/deletion are well handled by most methods (albeit for different trade-offs of precision and recall), lateral gene transfer disrupts all methods. As for ambiguous sequences, which might result from poor sequencing, assembly, or genome annotation, we show that they affect alignment score-based orthology methods more strongly than their distance-based counterparts.

  18. The impact of gene duplication, insertion, deletion, lateral gene transfer and sequencing error on orthology inference: a simulation study.

    Directory of Open Access Journals (Sweden)

    Daniel A Dalquen

    Full Text Available The identification of orthologous genes, a prerequisite for numerous analyses in comparative and functional genomics, is commonly performed computationally from protein sequences. Several previous studies have compared the accuracy of orthology inference methods, but simulated data has not typically been considered in cross-method assessment studies. Yet, while dependent on model assumptions, simulation-based benchmarking offers unique advantages: contrary to empirical data, all aspects of simulated data are known with certainty. Furthermore, the flexibility of simulation makes it possible to investigate performance factors in isolation of one another.Here, we use simulated data to dissect the performance of six methods for orthology inference available as standalone software packages (Inparanoid, OMA, OrthoInspector, OrthoMCL, QuartetS, SPIMAP as well as two generic approaches (bidirectional best hit and reciprocal smallest distance. We investigate the impact of various evolutionary forces (gene duplication, insertion, deletion, and lateral gene transfer and technological artefacts (ambiguous sequences on orthology inference. We show that while gene duplication/loss and insertion/deletion are well handled by most methods (albeit for different trade-offs of precision and recall, lateral gene transfer disrupts all methods. As for ambiguous sequences, which might result from poor sequencing, assembly, or genome annotation, we show that they affect alignment score-based orthology methods more strongly than their distance-based counterparts.

  19. An armed oncolytic adenovirus system,ZD55-gene,demonstrating potent antitumoral efficacy

    Institute of Scientific and Technical Information of China (English)

    ZI LAI ZHANG; WEI GUO ZOU; CHUN XIA LUO; BING HUA LI; JIN HUI WANG; LAN YING SUN; QI JUN QIAN; XIN YUAN LIU

    2003-01-01

    ONYXONYX-015 is an attractive therapeutic adenovirus for cancer because it can selectively replicate in tumor cells and kill them.To date,clinicaltrials of this adenovirus have demonstrated marked safety but not potent enough when it was used alone.In this paper,we put forward a novel concept of Gene-Viro Therapy strategy and in this way,we constructed an armed therapeutic onco1ytic adenovirus system,ZD55-gene,whichis not only deleted of E1B 55-kD gene similar to ONYX-015,but also armed with foreign antitumor gene.ZD55-gene exhibited similar cytopathic effects and replication Kinetics to that of ONYX-015 in vitro.Importantly,the carried gene 1s expressed and the expression level can increase with the replication of virus.Consequently,a significant antitumoral efficacy was observed when ZD55-CD/5-FU was used as an example in nude mice with subcutaneous human SW620 colon cancer.Our data demonstratedthat ZD55-gene,which utilizingthe Gene-ViroTherapy strategy,is more efficacious than each individual component in vivo.

  20. Exploration of geosmin synthase from Streptomyces peucetius ATCC 27952 by deletion of doxorubicin biosynthetic gene cluster.

    Science.gov (United States)

    Singh, Bijay; Oh, Tae-Jin; Sohng, Jae Kyung

    2009-10-01

    Thorough investigation of Streptomyces peucetius ATCC 27952 genome revealed a sesquiterpene synthase, named spterp13, which encodes a putative protein of 732 amino acids with significant similarity to S. avermitilis MA-4680 (SAV2163, GeoA) and S. coelicolor A3(2) (SCO6073). The proteins encoded by SAV2163 and SCO6073 produce geosmin in the respective strains. However, the spterp13 gene seemed to be silent in S. peucetius. Deletion of the doxorubicin gene cluster from S. peucetius resulted in increased cell growth rate along with detectable production of geosmin. When we over expressed the spterp13 gene in S. peucetius DM07 under the control of an ermE* promoter, 2.4 +/- 0.4-fold enhanced production of geosmin was observed.

  1. Parallel analysis of tagged deletion mutants efficiently identifies genes involved in endoplasmic reticulum biogenesis.

    Science.gov (United States)

    Wright, Robin; Parrish, Mark L; Cadera, Emily; Larson, Lynnelle; Matson, Clinton K; Garrett-Engele, Philip; Armour, Chris; Lum, Pek Yee; Shoemaker, Daniel D

    2003-07-30

    Increased levels of HMG-CoA reductase induce cell type- and isozyme-specific proliferation of the endoplasmic reticulum. In yeast, the ER proliferations induced by Hmg1p consist of nuclear-associated stacks of smooth ER membranes known as karmellae. To identify genes required for karmellae assembly, we compared the composition of populations of homozygous diploid S. cerevisiae deletion mutants following 20 generations of growth with and without karmellae. Using an initial population of 1,557 deletion mutants, 120 potential mutants were identified as a result of three independent experiments. Each experiment produced a largely non-overlapping set of potential mutants, suggesting that differences in specific growth conditions could be used to maximize the comprehensiveness of similar parallel analysis screens. Only two genes, UBC7 and YAL011W, were identified in all three experiments. Subsequent analysis of individual mutant strains confirmed that each experiment was identifying valid mutations, based on the mutant's sensitivity to elevated HMG-CoA reductase and inability to assemble normal karmellae. The largest class of HMG-CoA reductase-sensitive mutations was a subset of genes that are involved in chromatin structure and transcriptional regulation, suggesting that karmellae assembly requires changes in transcription or that the presence of karmellae may interfere with normal transcriptional regulation.

  2. Functional dissection of regulatory models using gene expression data of deletion mutants.

    Directory of Open Access Journals (Sweden)

    Jin'e Li

    Full Text Available Genome-wide gene expression profiles accumulate at an alarming rate, how to integrate these expression profiles generated by different laboratories to reverse engineer the cellular regulatory network has been a major challenge. To automatically infer gene regulatory pathways from genome-wide mRNA expression profiles before and after genetic perturbations, we introduced a new Bayesian network algorithm: Deletion Mutant Bayesian Network (DM_BN. We applied DM_BN to the expression profiles of 544 yeast single or double deletion mutants of transcription factors, chromatin remodeling machinery components, protein kinases and phosphatases in S. cerevisiae. The network inferred by this method identified causal regulatory and non-causal concurrent interactions among these regulators (genetically perturbed genes that are strongly supported by the experimental evidence, and generated many new testable hypotheses. Compared to networks reconstructed by routine similarity measures or by alternative Bayesian network algorithms, the network inferred by DM_BN excels in both precision and recall. To facilitate its application in other systems, we packaged the algorithm into a user-friendly analysis tool that can be downloaded at http://www.picb.ac.cn/hanlab/DM_BN.html.

  3. A 57-bp deletion in the ovine KAP6-1 gene affects wool fibre diameter.

    Science.gov (United States)

    Zhou, H; Gong, H; Li, S; Luo, Y; Hickford, J G H

    2015-08-01

    High glycine-tyrosine keratin-associated proteins (HGT-KAPs) are predominantly present in the orthocortex of wool fibres. They vary in abundance in different wools and have been implicated in regulating wool fibre properties, but little is known about the functional roles of these proteins in the fibre matrix. In this study, we used polymerase chain reaction--single-strand conformational polymorphism (PCR-SSCP) analysis to screen for variation in a gene encoding the ovine HGT-KAP6-1 protein. We identified three gene variants (A, B and C). Variants A and B were similar to each other, with only three nucleotide differences occurring downstream of the coding sequence. However, variant C had a 57-bp deletion that would notionally result in a loss of 19 amino acids in the protein. The presence of C was found to be associated with an increase in mean fibre diameter (MFD), fibre diameter standard deviation (FDSD), coefficient of variation of fibre diameter (CVFD) and prickle factor (percentage of fibres over 30 microns; PF). Sheep of genotype BC produced wool of greater MFD, FDSD and PF than sheep of genotypes AA, AB and BB. The CVFD was greater in the BC sheep than the AB sheep. The results suggest that variation in ovine KRTAP6-1 affects wool fibre diameter-associated traits and that the 57-bp deletion in this gene would lead to coarser wool with greater FDSD, CVFD and PF.

  4. Clinical and pathological implications of GSTM1 and GSTT1 gene deletions in sporadic breast cancer

    Directory of Open Access Journals (Sweden)

    Maria Salete Costa Gurgel

    2011-12-01

    Full Text Available There is a lack of consensus about the influence of GST M1/T1 gene deletions (DEL on sporadic breast cancer (SBC. To evaluate the occurrence of DEL in 177 SBC cases and in 169 controls, and compare clinical and biological characteristics. A lower frequency of GSTM1 DEL was observed in mulatto women, OR=0.48 (0.24–0.98. The risk of nuclear grade 3 tumors (GN3 was lower in patients with GSTT1 DEL, OR=0.37 (0.15–0.90. DEL of at least one gene (ALOG was associated with women who had not breastfed, OR=0.41 (0.19–0.88, and with negative hormone receptor, HR–, ORadj=2.25 (1.03–4.90. Both genes deleted (BGD was associated with non-classic invasive ductal carcinoma (NCDC, ORadj=12.09 (1.03–142.03. Mulatto women with SBC had a lower frequency of GSTM1 DEL, while tumors differentiated were related to GSTT1 DEL. HRtumors were related with DEL ALOG, and the BGD was associated with a greater risk of NCDC.

  5. Mutation mismatch repair gene deletions in diffuse large B-cell lymphoma.

    Science.gov (United States)

    Couronné, Lucile; Ruminy, Philippe; Waultier-Rascalou, Agathe; Rainville, Vinciane; Cornic, Marie; Picquenot, Jean-Michel; Figeac, Martin; Bastard, Christian; Tilly, Hervé; Jardin, Fabrice

    2013-05-01

    To further unravel the molecular pathogenesis of diffuse large B-cell lymphoma (DLBCL), we performed high-resolution comparative genomic hybridization on lymph node biopsies from 70 patients. With this strategy, we identified microdeletions of genes involved in the mutation mismatch repair (MMR) pathway in two samples. The first patient presented with a homozygous deletion of MSH2-MSH6 due to duplication of an unbalanced pericentric inversion of chromosome 2. The other case showed a PMS2 heterozygous deletion. PMS2 and MSH2-MSH6 abnormalities, respectively, resulted in a decrease and complete loss of gene expression. However, unlike tumors associated with the hereditary non-polyposis colorectal cancer syndrome or immunodeficiency-related lymphomas, no microsatellite instability was detected. Mutational profiles revealed especially in one patient an aberrant hypermutation without a clear activation-induced cytidine deaminase signature, indicating a breakdown of the high-fidelity repair in favor of the error-prone repair pathway. Our findings suggest that in a rare subset of patients, inactivation of the genes of the MMR pathway is likely an important step in the molecular pathogenesis of DLBCL and does not involve the same molecular mechanisms as other common neoplasms with MMR deficiency.

  6. Generation of stable mutants and targeted gene deletion strains in Cryptococcus neoformans through electroporation.

    Science.gov (United States)

    Lin, Xiaorong; Chacko, Nadia; Wang, Linqi; Pavuluri, Yashwant

    2015-04-01

    Cryptococcus neoformans is the etiologic agent of cryptococcal meningitis that causes more than half a million deaths worldwide each year. This capsulated basidiomycetous yeast also serves as a model for micropathogenic studies. The ability to make stable mutants, either via ectopic integration or homologous recombination, has been accomplished using biolistic transformation. This technical advance has greatly facilitated the research on the basic biology and pathogenic mechanisms of this pathogen in the past two decades. However, biolistic transformation is costly, and its reproducibility varies widely. Here we found that stable ectopic integration or targeted gene deletion via homologous replacement could be accomplished through electroporative transformation. The stability of the transformants obtained through electroporation and the frequency of homologous replacement is highly dependent on the selective marker. A frequency of homologous recombination among the stable transformants obtained by electroporation is comparable to those obtained by biolistic transformation (∼10%) when dominant drug selection markers are used, which is much higher than what has been previously reported for electroporation when auxotrophic markers were used (0.001% to 0.1%). Furthermore, disruption of the KU80 gene or generation of gene deletion constructs using the split marker strategy, two approaches known to increase homologous replacement among transformants obtained through biolistic transformation, also increase the frequency of homologous replacement among transformants obtained through electroporation. Therefore, electroporation provides a low cost alternative for mutagenesis in Cryptococcus.

  7. DIA1R is an X-linked gene related to Deleted In Autism-1.

    Directory of Open Access Journals (Sweden)

    Azhari Aziz

    Full Text Available BACKGROUND: Autism spectrum disorders (ASDS are frequently occurring disorders diagnosed by deficits in three core functional areas: social skills, communication, and behaviours and/or interests. Mental retardation frequently accompanies the most severe forms of ASDs, while overall ASDs are more commonly diagnosed in males. Most ASDs have a genetic origin and one gene recently implicated in the etiology of autism is the Deleted-In-Autism-1 (DIA1 gene. METHODOLOGY/PRINCIPAL FINDINGS: Using a bioinformatics-based approach, we have identified a human gene closely related to DIA1, we term DIA1R (DIA1-Related. While DIA1 is autosomal (chromosome 3, position 3q24, DIA1R localizes to the X chromosome at position Xp11.3 and is known to escape X-inactivation. The gene products are of similar size, with DIA1 encoding 430, and DIA1R 433, residues. At the amino acid level, DIA1 and DIA1R are 62% similar overall (28% identical, and both encode signal peptides for targeting to the secretory pathway. Both genes are ubiquitously expressed, including in fetal and adult brain tissue. CONCLUSIONS/SIGNIFICANCE: Examination of published literature revealed point mutations in DIA1R are associated with X-linked mental retardation (XLMR and DIA1R deletion is associated with syndromes with ASD-like traits and/or XLMR. Together, these results support a model where the DIA1 and DIA1R gene products regulate molecular traffic through the cellular secretory pathway or affect the function of secreted factors, and functional deficits cause disorders with ASD-like symptoms and/or mental retardation.

  8. A Next-generation Genetically Attenuated Plasmodium falciparum Parasite Created by Triple Gene Deletion

    OpenAIRE

    Mikolajczak, Sebastian A.; Lakshmanan, Viswanathan; Fishbaugher, Matthew; Camargo, Nelly; Harupa, Anke; Kaushansky, Alexis; Douglass, Alyse N.; Baldwin, Michael; Healer, Julie; O'Neill, Matthew; Phuong, Thuan; Cowman, Alan; Kappe, Stefan H. I.

    2014-01-01

    Immunization with live-attenuated Plasmodium sporozoites completely protects against malaria infection. Genetic engineering offers a versatile platform to create live-attenuated sporozoite vaccine candidates. We previously generated a genetically attenuated parasite (GAP) by deleting the P52 and P36 genes in the NF54 wild-type (WT) strain of Plasmodium falciparum (Pf p52−/p36− GAP). Preclinical assessment of p52−/p36− GAP in a humanized mouse model indicated an early and severe liver stage gr...

  9. Total beta-globin gene deletion has high frequency in Filipinos

    Energy Technology Data Exchange (ETDEWEB)

    Patrick, N.; Miyakawa, F.; Hunt, J.A. [Univ. of Hawaii, Honolulu, HI (United States)] [and others

    1994-09-01

    The distribution of {beta}-thalassemia [{beta}{sup Th}] mutations is unique to each ethnic group. Most mutations affect one or a few bases; large deletions have been rare. Among families screened in Hawaii, [{beta}{sup Th}] heterozygotes were diagnosed by microcytosis, absence of abnormal hemoglobins on isoelectric focusing, and raised Hb A{sub 2} by chromatography. Gene frequency for {beta}{sup Th} was 0.02 in Filipinos. In Filipinos, polymerase chain reaction [PCR] with denaturing gradient gel electrophoresis for {beta}{sup Th} mutations detected a mutation in only 6 of 42 {beta}{sup Th} heterozygotes; an IVS2-666 C/T polymorphism showed non-heterozygosity in 37 and heterozygosity in only 5 of these {beta}{sup Th} heterozygotes. One {beta}{sup Th}/{beta}{sup Th} major patient and his mother had no mutation detected by allele-specific oligomer hybridization; PCR failed to amplify any DNA from his {beta}-globin gene. After a total {beta}-globin gene deletion [{beta}{sup Del}] was found in a Filipino family in Ontario, specific PCR amplification for {beta}{sup Del} detected this in 43 of 53 {beta}{sup Th} Filipino samples tested; the above {beta}{sup Th}/{beta}{sup Th} patient was a ({beta}{sup Del}/{beta}{sup Del}) homozygote. The {beta}{sup Del} may account for over 60% of all {beta}{sup Th} alleles in Filipinos; this is the highest proportion of a deletion {beta}{sup Th} mutation reported from any population. Most but not all {beta}{sup Del} heterozygotes had high Hb F [5.13 {plus_minus} 3.94 mean {plus_minus} 1 s.d.] compared to the codon 41/42 four base deletion common in Chinese [2.30 {plus_minus} 0.86], or to {beta}{sup Th} heterozygotes with normal {alpha}-globin genes [2.23 {plus_minus} 0.80].

  10. Familial spinal neurofibromatosis due to a multiexonic NF1 gene deletion.

    Science.gov (United States)

    Pizzuti, Antonio; Bottillo, Irene; Inzana, Francesca; Lanari, Valentina; Buttarelli, Francesca; Torrente, Isabella; Giallonardo, Anna Teresa; De Luca, Alessandro; Dallapiccola, Bruno

    2011-08-01

    We report the detailed clinical presentation and molecular features of a spinal neurofibromatosis familial case where a 40-year-old woman, presenting with multiple bilateral spinal neurofibromas and no other clinical feature of neurofibromatosis type 1 (NF1), inherited a paternal large multiexonic deletion (c.5944-?_7126+?del) which resulted in NF1 gene haploinsufficiency at the RNA level. In the clinically unaffected 73-year-old father, spinal cord MRI disclosed bilateral and symmetrical hypertrophy of spinal lumbosacral roots. Our study widens the phenotypic and mutational spectrum of NF1 and illustrates the difficulties of counseling patients with border-line or atypical presentation of this disorder.

  11. Analysis of a large cluster of nonessential genes deleted from a vaccinia virus terminal transposition mutant.

    Science.gov (United States)

    Kotwal, G J; Moss, B

    1988-12-01

    The principal objectives of this study were to analyze the structure and coding potential of a long segment of DNA missing from a previously isolated (B. Moss, E. Winters, and J. A. Cooper (1981) J. Virol. 40, 387-395) attenuated variant of vaccinia virus strain WR and to examine the precise changes in the genome accompanying the deletion. The sequences of a 14.5-kbp region located at the left end of the standard vaccinia virus genome, extending from within the inverted terminal repetition (ITR) of the HindIII C fragment to the end of the HindIII N fragment, and of a 3-kbp segment from a corresponding region of the variant genome were determined. A comparison of these sequences revealed that the variant contained a deletion of 12 kbp and an insertion of 2.1 kbp. The origin of the inserted DNA was traced to the HindIII B region by using oligonucleotide probes indicating that a transposition of unique DNA located adjacent to the right ITR had occurred. Structural analysis indicated no extensive homologies, nucleotide substitutions, additions, or deletions at the boundaries of the transposed DNA. Examination of the right end of the variant genome indicated that a copy of the transposed DNA was still present and, therefore, the length of the ITR had been increased by 2.1 kbp. The variant genome could have formed by a mechanism that resulted in the replacement of a 22-kbp left-terminal fragment with a 12-kbp right-terminal fragment. The DNA missing from the variant and contained within the standard vaccinia virus WR genome contains 17 contiguous open reading frames (ORFs), all of which are directed leftward and apparently not required for replication in cultured cells. One deleted ORF has a 60% sequence similarity to another gene encoding a 42,000-Da protein present within the ITR suggesting that duplications have previously occurred during the evolution of vaccinia virus. Another deleted ORF has a 39% sequence similarity to a complement 4b binding protein. The

  12. Analysis of pools of targeted Salmonella deletion mutants identifies novel genes affecting fitness during competitive infection in mice.

    Directory of Open Access Journals (Sweden)

    Carlos A Santiviago

    2009-07-01

    Full Text Available Pools of mutants of minimal complexity but maximal coverage of genes of interest facilitate screening for genes under selection in a particular environment. We constructed individual deletion mutants in 1,023 Salmonella enterica serovar Typhimurium genes, including almost all genes found in Salmonella but not in related genera. All mutations were confirmed simultaneously using a novel amplification strategy to produce labeled RNA from a T7 RNA polymerase promoter, introduced during the construction of each mutant, followed by hybridization of this labeled RNA to a Typhimurium genome tiling array. To demonstrate the ability to identify fitness phenotypes using our pool of mutants, the pool was subjected to selection by intraperitoneal injection into BALB/c mice and subsequent recovery from spleens. Changes in the representation of each mutant were monitored using T7 transcripts hybridized to a novel inexpensive minimal microarray. Among the top 120 statistically significant spleen colonization phenotypes, more than 40 were mutations in genes with no previously known role in this model. Fifteen phenotypes were tested using individual mutants in competitive assays of intraperitoneal infection in mice and eleven were confirmed, including the first two examples of attenuation for sRNA mutants in Salmonella. We refer to the method as Array-based analysis of cistrons under selection (ABACUS.

  13. Analysis of pools of targeted Salmonella deletion mutants identifies novel genes affecting fitness during competitive infection in mice.

    Directory of Open Access Journals (Sweden)

    Carlos A Santiviago

    2009-07-01

    Full Text Available Pools of mutants of minimal complexity but maximal coverage of genes of interest facilitate screening for genes under selection in a particular environment. We constructed individual deletion mutants in 1,023 Salmonella enterica serovar Typhimurium genes, including almost all genes found in Salmonella but not in related genera. All mutations were confirmed simultaneously using a novel amplification strategy to produce labeled RNA from a T7 RNA polymerase promoter, introduced during the construction of each mutant, followed by hybridization of this labeled RNA to a Typhimurium genome tiling array. To demonstrate the ability to identify fitness phenotypes using our pool of mutants, the pool was subjected to selection by intraperitoneal injection into BALB/c mice and subsequent recovery from spleens. Changes in the representation of each mutant were monitored using T7 transcripts hybridized to a novel inexpensive minimal microarray. Among the top 120 statistically significant spleen colonization phenotypes, more than 40 were mutations in genes with no previously known role in this model. Fifteen phenotypes were tested using individual mutants in competitive assays of intraperitoneal infection in mice and eleven were confirmed, including the first two examples of attenuation for sRNA mutants in Salmonella. We refer to the method as Array-based analysis of cistrons under selection (ABACUS.

  14. Large deletions encompassing the TCOF1 and CAMK2A genes are responsible for Treacher Collins syndrome with intellectual disability.

    Science.gov (United States)

    Vincent, Marie; Collet, Corinne; Verloes, Alain; Lambert, Laetitia; Herlin, Christian; Blanchet, Catherine; Sanchez, Elodie; Drunat, Séverine; Vigneron, Jacqueline; Laplanche, Jean-Louis; Puechberty, Jacques; Sarda, Pierre; Geneviève, David

    2014-01-01

    Mandibulofacial dysostosis is part of a clinically and genetically heterogeneous group of disorders of craniofacial development, which lead to malar and mandibular hypoplasia. Treacher Collins syndrome is the major cause of mandibulofacial dysostosis and is due to mutations in the TCOF1 gene. Usually patients with Treacher Collins syndrome do not present with intellectual disability. Recently, the EFTUD2 gene was identified in patients with mandibulofacial dysostosis associated with microcephaly, intellectual disability and esophageal atresia. We report on two patients presenting with mandibulofacial dysostosis characteristic of Treacher Collins syndrome, but associated with unexpected intellectual disability, due to a large deletion encompassing several genes including the TCOF1 gene. We discuss the involvement of the other deleted genes such as CAMK2A or SLC6A7 in the cognitive development delay of the patients reported, and we propose the systematic investigation for 5q32 deletion when intellectual disability is associated with Treacher Collins syndrome.

  15. Large deletion of the GJB6 gene in deaf patients heterozygous for the GJB2 gene mutation: genotypic and phenotypic analysis.

    Science.gov (United States)

    Feldmann, Delphine; Denoyelle, Françoise; Chauvin, Pierre; Garabédian, Eréa-Noël; Couderc, Rémy; Odent, Sylvie; Joannard, Alain; Schmerber, Sébastien; Delobel, Bruno; Leman, Jacques; Journel, Hubert; Catros, Hélène; Le Maréchal, Cédric; Dollfus, Hélène; Eliot, Marie-Madeleine; Delaunoy, Jean-Pierre; David, Albert; Calais, Catherine; Drouin-Garraud, Valérie; Obstoy, Marie-Françoise; Bouccara, Didier; Sterkers, Olivier; Huy, Patrice Tran Ba; Goizet, Cyril; Duriez, Françoise; Fellmann, Florence; Hélias, Jocelyne; Vigneron, Jacqueline; Montaut, Bétina; Lewin, Patricia; Petit, Christine; Marlin, Sandrine

    2004-06-15

    Recent investigations identified a large deletion of the GJB6 gene in trans to a mutation of GJB2 in deaf patients. We looked for GJB2 mutations and GJB6 deletions in 255 French patients presenting with a phenotype compatible with DFNB1. 32% of the patients had biallelic GJB2 mutations and 6% were a heterozygous for a GJB2 mutation and a GJB6 deletion. Biallelic GJB2 mutations and combined GJB2/GJB6 anomalies were more frequent in profoundly deaf children. Based on these results, we are now assessing GJB6 deletion status in cases of prelingual hearing loss. Copyright 2004 Wiley-Liss, Inc.

  16. Clinical implications of cytosine deletion of exon 5 of P53 gene in non small cell lung cancer patients

    Directory of Open Access Journals (Sweden)

    Rashid Mir

    2016-01-01

    Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.

  17. Pathogenicity and immunogenicity of recombinant Tiantan Vaccinia Virus with deleted C12L and A53R genes.

    Science.gov (United States)

    Dai, Kaifan; Liu, Ying; Liu, Mingjie; Xu, Jianqing; Huang, Wei; Huang, Xianggang; Liu, Lianxing; Wan, Yanmin; Hao, Yanling; Shao, Yiming

    2008-09-15

    Interest is increasing regarding replicating poxvirus as HIV vaccine vector. In China, the Tiantan Vaccinia Virus (TV) has been used most extensively in the battle of eradicating smallpox. Recently, TV was developing as vaccine vector to fight against infectious diseases such as human immunodeficiency virus (HIV). However, replicating vaccinia virus sometimes may pose serious post-vaccination complications, especially in immunosuppressed individuals. To develop a safer and more effective TV-based vector, we constructed C12L (vIL-18 binding protein) and A53R (vTNF receptor homolog) gene-deleted mutants which are based on parental TV and VTKgpe (TV expressing HIV gagpol and env gene), respectively. The pathogenicity and immunogenicity were also evaluated. Deleting these two immunomodulatory genes lessened the virulence of the parental virus in both mice and rabbit models. Notably, C12L deletion mutant attenuated the skin virulence of parental virus by as high as approximate 2 logs. Furthermore, VTKgpe with A53R and C12L gene deletion retains the high immunogenicity of the parental virus to elicit strong humoral and cellular responses to the HIV target genes despite the remarkable attenuation. These data suggest that deletion of the cytokine viroceptor gene is feasible to obtain a safer and replication-competent TV vector for vaccination and immunotherapy.

  18. A Japanese boy with myalgia and cramps has a novel in-frame deletion of the dystrophin gene.

    Science.gov (United States)

    Ishigaki, C; Patria, S Y; Nishio, H; Yabe, M; Matsuo, M

    1996-05-01

    We report a Japanese Becker muscular dystrophy (BMD) patient with occasional myalgia and cramps during normal activity that developed at the age of 28 months. His family history was negative for neuromuscular diseases. Muscle biopsy analyses, including dystrophin immunostaining, disclosed no clinically relevant findings. The diagnosis of BMD was initially made at the age of 10 years, when indications of persistent high serum levels of CK prompted us to screen deletions in the dystrophin gene by amplification of 19 deletion-prone exons from the genomic DNA by the polymerase chain reaction (PCR). Among the exons examined, exons 13 and 17 were deleted. To clarify the size of the deletion, the dystrophin transcript was analyzed by reverse transcription PCR. The determined nucleotide sequence of the amplified product encompassing exons 10 to 20 disclosed that the entire segment corresponding to exons 13 to 18 (810 bp) was absent, a deletion that would be expected to cause the production of a dystrophin protein lacking 270 amino acids from the rod domain. This result indicates that occasional myalgia and cramps could be early clinical manifestations of mild BMD, especially in patients who have a deletion in the rod domain, and that deletion screening of the dystrophin gene might be the only reliable method to diagnose such cases.

  19. [Repression of the enzyme inducible syntheses in Escherichia coli K12 mutant with a deleted ptsH gene].

    Science.gov (United States)

    Gershanovich, V N; Il'ina, T S; Rusina, O Iu; Iurovitskaia, N V; Bol'shakova, T N

    1977-01-01

    The genome of lambda phage with thermosensitive repressor was integrated into the pts region of the E. coli chromosome. Such a lysogenic culture behaves as a pts mutant at 30 degrees. Heating of cells of this strain leads to the induction of lambda prophage and formation of deletions in the pts region. A mutant with a deletion covering ptsH gene was isolated after prophage induction. The deletion nature of pts mutation was confirmed in genetic and biochemical experiments. It was shown that the deletion is small and does not involve ptsI and lig genes. The isolated deltaptsH mutant possesses all characteristics of pts mutants: pleiotropic impairment of transport and utilization of a number of carbohydrates, repression of the enzyme inducible synthesis and resistance to catabolite repression with glucose. These data (together with earlier ones) allow us to conclude that the phosphorylated form of HPr is involved (in direct of indirect manner/ in activation of DNA transcription.

  20. Similarity of DMD gene deletion and duplication in the Chinese patients compared to global populations

    Directory of Open Access Journals (Sweden)

    Yan Ming

    2008-04-01

    Full Text Available Abstract Background DNA deletion and duplication were determined as the major mutation underlying Duchenne muscular dystrophy (DMD and Becker muscular dystrophy (BMD. Method Applying multiplex ligation-dependent probe amplification (MLPA, we have analyzed 179 unrelated DMD/BMD subjects from northern China. Results Seventy-three percent of the subjects were found having a deletion (66.25% or duplication (6.25%. Exons 51–52 were detected as the most common fragment deleted in single-exon deletion, and the region of exons 45–50 was the most common exons deleted in multi-exon deletions. About 90% of DMD/BMD cases carry a small size deletion that involves 10 exons or less, 26.67% of which carry a single-exon deletion. Most of the smaller deletions resulted in an out-of-frame mutation. The most common exons deleted were determined to be between exon 48 and exon 52, with exon 50 was the model allele. Verifying single-exon deletion, one sample with a deletion of exon 53 that was initially observed from MLPA showed that there was a single base deletion that abolished the ligation site in MLPA. Confirmation of single-exon deletion is recommended to exclude single base deletion or mutation at the MLPA ligation site. Conclusion The frequency of deletion and duplication in northern China is similar to global ethnic populations.

  1. Detection of APC gene deletions in colorectal malignancies using quantitative PCR in a Chinese population.

    Science.gov (United States)

    Fang, Zhengyu; Xiong, Yi; Li, Jiana; Liu, Li; Li, Manhui; Zhang, Wei; Shi, Lei; Wan, Jun

    2011-09-01

    The adenomatous polyposis coli (APC) gene has been shown to be involved in genetic instability and to be downregluated in several human carcinomas. The chromosome locus of APC, 5q21-22, is frequently deleted in colorectal cancers (CRCs). The functional impact of such regions needs to be extensively investigated in large amount of clinical samples. Case-matched tissues of CRC and adjacent normal epithelium (n = 134) were included in this study. Quantitative PCR was carried out to examine the copy number as well as mRNA expression of APC gene in colorectal malignancies. Our results showed that copy number deletions of APC were present in a relatively high percentage of colorectal cancer samples (26.1%, 35 out of 134). There was a positive correlation between copy number decrease of APC and tumor progression in CRCs. Furthermore, copy number loss of APC was correlated with decreased mRNA expression. However, mRNA levels of APC were also impaired in CRC samples with unaltered copy numbers, indicating that sporadic CRCs exhibit different mechanisms of APC regulation.

  2. A nine-nucleotide deletion and splice variation in the coding region of the interferon induced ISG12 gene

    DEFF Research Database (Denmark)

    Smidt, Kamille; Hansen, Lise Lotte; Søgaard, T Max M;

    2003-01-01

    distributed between ISG12 and ISG12-S in breast carcinoma cells, in cancer cell lines and in cervical cytobrush material with neoplastic lesions. In addition, we have found a nine-nucleotide deletion situated in exon 4 of the ISG12 gene. This deletion leads to a three-amino-acid deletion (AMA) in the putative...... inducible splice variant of ISG12 lacking exon 2 leading to a putative truncated protein isoform of Mr 7400, ISG12-S. In cells from blood and cervical cytobrush material from healthy women, the level of ISG12-S expression was higher than ISG12 expression, whereas the expression pattern was more evenly...

  3. A novel single-base deletion mutation of the RUNX2 gene in a Chinese family with cleidocranial dysplasia.

    Science.gov (United States)

    Fang, C Y; Xue, J J; Tan, L; Jiang, C H; Gao, Q P; Liang, D S; Wu, L Q

    2011-12-14

    We identified a disease-causing mutation of the RUNX2 gene in a four-generation Chinese family affected with cleidocranial dysplasia (CCD). For mutation analysis, the coding region of RUNX2 was sequenced with DNA from two patients and three unaffected family members. The RUNX2 mutation was investigated in 50 normal controls by denaturing high pressure liquid chromatography. A heterozygous single-base deletion (c.549delC) of RUNX2, which predicts a termination site at the 185th codon and leads to a stop in the runt domain of RUNX2 protein, was detected in both patients but not in the three unaffected members of the family. This mutation was also not found in 50 controls and has not been reported previously. We demonstrated that a novel mutation (c.549delC) of RUNX2 is associated with CCD in a Chinese family, adding to the repertoire of RUNX2 mutations related to CCD.

  4. Complement factor I deficiency: a not so rare immune defect. Characterization of new mutations and the first large gene deletion

    Directory of Open Access Journals (Sweden)

    Alba-Domínguez María

    2012-06-01

    Full Text Available Abstract Background Complement Factor I (CFI is a serine protease with an important role in complement alternative pathway regulation. Complete factor I deficiency is strongly associated with severe infections. Approximately 30 families with this deficiency have been described worldwide. Patients and methods We have studied five new Spanish families suffering from CFI deficiency. From 19 screened people, 7 homozygous, 10 heterozygous and 2 healthy subjects were identified. Clinical, biochemical and genetic descriptions are included. Results Molecular studies demonstrated 4 novel mutations in the screened individuals; amongst them, we describe here the first great gene deletion reported in the CFI locus, which includes full exon 2 and part of the large intron 1. Conclusion CFI deficiency is possibly an underestimated defect and the eventual existence of this deficiency should be tested in those patients exhibiting low C3 and recurrent bacterial infections. We propose a simple diagnostic flowchart to help clinicians in the identification and correct diagnosis of such patients.

  5. Comparative genome analysis of deleted genes in Shigella flexneri 2a strain 301

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Comparative genome analysis is performed between Shigella flexneri 2a strain 301 and its close relatives, the nonpathogenic E. Coli K-12 strain MG1655. Result shows that there are 136 DNA segments whose size is larger than 1000 bp absent from Shigella flexneri 2a strain 301, which is up to 717253 bp in total length. These deleted segments altogether contain 670 open reading frames (ORFs). Prediction of these ORFs indicates that there are 40% genes of unknown function. The other genes of definite functions encode metabolic enzymes, structure proteins, transcription regulatory factors and some elements correlated with horizontal transfer. Here we compare the complete genomic sequences of the two closely related species, which differ in pathogenic phenotype. To our knowledge, this not only reveals the difference of genomic sequence between the two important enteric pathogens for the first time, but also provides valuable clues to further researches in its process of physiological activity, pathogenesis and the evolution of enteric bacteria.

  6. Deletion of pigR gene in Monascus ruber leads to loss of pigment production.

    Science.gov (United States)

    Xie, Nana; Liu, Qingpei; Chen, Fusheng

    2013-09-01

    Pigments produced by Monascus are traditional food colorants and are widely used as dietary supplements. Since genes involving in pigment biosynthesis have not been reported, we describe the identification of a putative pigment-regulatory gene (pigR) obtained by molecular analysis of an albino strain of Monascus ruber M7. In the pigR-deleted strain (ΔpigR), neither the pigments nor pigR expression were detected by HPLC or reverse-transcription PCR, respectively, whereas the introduction of the pigR, together with a constitutive trpC promoter into ΔpigR, caused it to produce 5.4 U of red pigments/g dry mycelia, about 12-fold higher than Monascus ruber M7 (0.46 U/g dry mycelia). Thus pigR up-regulates pigment production in Monascus ruber M7.

  7. Phenotype profiling of single gene deletion mutants of E. coli using Biolog technology.

    Science.gov (United States)

    Tohsato, Yukako; Mori, Hirotada

    2008-01-01

    Phenotype MicroArray (PM) technology is high-throughput phenotyping system and is directly applicable to assay the effects of genetic changes in cells. In this study, we performed comprehensive PM analysis using single gene deletion mutants of central metabolic pathway and related genes. To elucidate the structure of central metabolic networks in Escherichia coli K-12, we focused 288 different PM conditions of carbon and nitrogen sources and performed bioinformatic analysis. For data processing, we employed noise reduction procedures. The distance between each of the mutants was defined by Manhattan distance and agglomerative Ward's hierarchical method was applied for clustering analysis. As a result, five clusters were revealed which represented to activate or repress cellular respiratory activities. Furthermore, the results might suggest that Glyceraldehyde-3P plays a key role as a molecular switch of central metabolic network.

  8. Bovine spongiform encephalopathy associated insertion/deletion polymorphisms of the prion protein gene in the four beef cattle breeds from North China.

    Science.gov (United States)

    Zhu, Xiang-Yuan; Feng, Fu-Ying; Xue, Su-Yuan; Hou, Ting; Liu, Hui-Rong

    2011-10-01

    Two insertion/deletion (indel) polymorphisms of the prion protein gene (PRNP), a 23-bp indel in the putative promoter region and a 12-bp indel within intron I, are associated with the susceptibility to bovine spongiform encephalopathy (BSE) in cattle. In the present study, the polymorphism frequencies of the two indels in four main beef cattle breeds (Hereford, Simmental, Black Angus, and Mongolian) from North China were studied. The results showed that the frequencies of deletion genotypes and alleles of 23- and 12-bp indels were lower, whereas the frequencies of insertion genotypes and alleles of the two indels were higher in Mongolian cattle than in the other three cattle breeds. In Mongolian cattle, the 23-bp insertion / 12-bp insertion was the major haplotype, whereas in Hereford, Simmental, and Black Angus cattle, the 23-bp deletion / 12-bp deletion was the major haplotype. These results demonstrated that Mongolian cattle could be more resistant to BSE, compared with the other three cattle breeds, because of its relatively low frequencies of deletion genotypes and alleles of 23- and 12-bp indel polymorphisms. Thus, this race could be important for selective breeding to improve resistance against BSE in this area.

  9. Molecular definition of a chromosome 9p21 germ-line deletion in a woman with multiple melanomas and a plexiform neurofibroma: implications for 9p tumor-suppressor gene(s).

    Science.gov (United States)

    Petty, E M; Gibson, L H; Fountain, J W; Bolognia, J L; Yang-Feng, T L; Housman, D E; Bale, A E

    1993-01-01

    Cutaneous malignant melanoma (CMM) is often familial, but the mode of inheritance and the chromosomal location of melanoma susceptibility locus are controversial. Identification of a 34-year-old woman with eight primary malignant melanomas, multiple atypical moles, and a de novo constitutional cytogenetic rearrangement involving chromosomes 5p and 9p suggested the presence of a melanoma predisposition gene at one of these locations. A high-resolution karyotype showed a partial deletion of a dark-staining Giemsa band, either 5p14 or 9p21. The patient was heterozygous for five 5p14 RFLPs. In situ hybridization with D9S3 indicated that this 9p21 marker was deleted. Gene dosage studies demonstrated the deletion of two more distal 9p21 markers, D9S126 and IFNA. In addition, she was hemizygous for the more proximal 9p21 short tandem-repeat polymorphism at D9S104. D9S18, D9S19, and D9S33 were retained, localizing the deletion to 9p21 between D9S19 on the proximal side and D9S33 on the distal side. Pulsed-field gel electrophoresis with D9S19 and D9S33 did not reveal any junction fragments in the patient's DNA. This germ-line deletion suggests that mutations in a 9p21 gene may initiate melanoma tumorigenesis. Images Figure 1 Figure 2 Figure 3 PMID:8317504

  10. Molecular definition of a chromosome 9p21 germ-line deletion in a woman with multiple melanomas and a plexiform neurofibroma: Implications for 9p tumor-suppressor gene(s)

    Energy Technology Data Exchange (ETDEWEB)

    Petty, E.M.; Gibson, L.H.; Yang-Feng, T.L.; Bale, A.E.; Bolognia, J.L. (Yale Univ. School of Medicine, New Haven, CT (United States)); Fountain, J.W.; Housman, D.E. (Massachusetts Institute of Technology, Cambridge (United States))

    1993-07-01

    Cutaneous malignant melanoma (CMM) is often familial, but the mode of inheritance and the chromosomal location of a melanoma susceptibility locus are controversial. Identification of a 34-year-old woman with eight primary malignant melanomas, multiple atypical moles, and a de novo constitutional cytogenetic rearrangement involving chromosomes 5p and 9p suggested the presence of a melanoma predisposition gene at one of these locations. A high-resolution karyotype showed a partial deletion of a dark-staining Giemsa band, either 5p14 or 9p21. The patient was heterozygous for five 5p14 RFLPs. In situ hybridization with D9S3 indicated that this 9p21 marker was deleted. Gene dosage studies demonstrated the deletion of two more distal 9p21 markers, D9S126 and IFNA. In addition, she was hemizygous for the more proximal 9p21 short tandem-repeat polymorphism at D9S104. D9S18, D9S19, and D9S33 were retained, localizing the deletion to 9p21 between D9S19 on the proximal side and D9S33 on the distal side. Pulsed-field gel electrophoresis with D9S19 and D9S33 did not reveal any junction fragments in the patient's DNA. This germ-line deletion suggests that mutations in a 9p21 gene may initiate melanoma tumorigenesis. 39 refs., 4 figs., 1 tab.

  11. A novel deletion partly removing the AVP gene causes autosomal recessive inheritance of early-onset neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Christensen, J H; Kvistgaard, H; Knudsen, J; Shaikh, G; Tolmie, J; Cooke, S; Pedersen, S; Corydon, T J; Gregersen, N; Rittig, S

    2013-01-01

    Familial neurohypophyseal diabetes insipidus (FNDI) typically presents with age-dependent penetrance and autosomal dominant inheritance caused by missense variations in one allele of the AVP gene encoding the arginine vasopressin (AVP) prohormone. We present the molecular genetic characteristics underlying an unusual form of FNDI occurring with very early onset and seemingly autosomal recessive inheritance. By DNA amplification and sequencing, we identified a novel variant allele of the AVP gene carrying a 10,396 base pair deletion involving the majority of the AVP gene as well as its regulatory sequences in the intergenic region between the AVP and the OXT gene, encoding the oxytocin prohormone. We found two chromosomes carrying the deletion in affected family members and one in unaffected family members suspected to transmit the deleted allele. Whole-genome array analysis confirmed the results and excluded the presence of any additional major pathogenic abnormalities. The deletion is predicted to abolish the transcription of the AVP gene, thus the fact that family members heterozygous for the deletion remain healthy argues, in general, against haploinsufficiency as the pathogenic mechanism FNDI. Accordingly, our data is strong support to the prevailing idea that dominant inheritance of FNDI is due to a dominant-negative effect exerted by variant AVP prohormone.

  12. Dopamine D2 receptor gene -141C Insertion/Deletion polymorphism in Turkish schizophrenic patients.

    Science.gov (United States)

    Kurt, Hulyam; Dikmen, Miris; Basaran, Ayşe; Yenilmez, Cinar; Ozdemir, Figen; Degirmenci, Irfan; Gunes, Hasan Veysi; Kucuk, Meral Urhan; Mutlu, Fezan

    2011-02-01

    Schizophrenia is a chronic and neuropsychiatric disease that affects about 0.5-1% of the world's population. An increase in dopamine and dopamine D2 receptor (DRD2) gene products has been well described in schizophrenic patients. Several groups have studied the relationship between dopaminergic hyperactivity and cellular communications have obtained discordant results. Studies searching for the relationship between the schizophrenia and DRD2 gene have gained more interest. Our objective was to determine the relationships among schizophrenic symptoms in schizophrenia subtypes and severity of symptoms in terms of DRD2 gene -141C Insertion/Deletion [Ins/Del; I/D] polymorphism by PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) assay method. Genomic DNA was prepared from peripheral blood by using salt extraction method. After amplification of genomic DNA, PCR products were digested with BstNI restriction enzyme for the detection of DRD2 gene -141C Ins/Del polymorphism in 73 schizophrenic patients and 60 healthy control subjects. The allelic frequencies of the DRD2 gene -141C Ins/Del polymorphism in case and control groups were 79.5 and 77.5% for I allele; 20.5 and 22.5% for D allele respectively. There was no significant difference in frequencies of genotypes and alleles between the two groups. In schizophrenic and control subjects, there were no significant relationship in severity of the disease and schizophrenia types among the -141C Ins/Del genotypes and alleles.

  13. Novel Mutations and Deletions of the KIT (Steel Factor Receptor) Gene in Human Piebaldism

    Science.gov (United States)

    Ezoe, Kazuhiko; Holmes, Stuart A.; Ho, Lingling; Bennett, Christopher P.; Bolognia, Jean L.; Brueton, Louise; Burn, John; Falabella, Rafael; Gatto, Emilia M.; Ishii, Norihisa; Moss, Celia; Pittelkow, Mark R.; Thompson, Elizabeth; Ward, K. Anne; Spritz, Richard A.

    1995-01-01

    Piebaldism is an autosomal dominant genetic disorder of pigmentation characterized by white patches of skin and hair. Melanocytes are lacking in these hypopigmented regions, the result of mutations of the KIT gene, which encodes the cell surface receptor for steel factor (SLF). We describe the analysis of 26 unrelated patients with piebaldism-like hypopigmentation—17 typical patients, 5 with atypical clinical features or family histories, and 4 with other disorders that involve white spotting. We identified novel pathologic mutations or deletions of the KIT gene in 10 (59%) of the typical patients, and in 2 (40%) of the atypical patients. Overall, we have identified pathologic KIT gene mutations in 21 (75%) of 28 unrelated patients with typical piebaldism we have studied. Of the patients without apparent KIT mutations, none have apparent abnormalities of the gene encoding SLF itself (MGF), and genetic linkage analyses in two of these families are suggestive of linkage of the piebald phenotype to KIT. Thus, most patients with typical piebaldism appear to have abnormalities of the KIT gene. ImagesFigure 2 PMID:7529964

  14. Deletion of degQ gene enhances outer membrane vesicle production of Shewanella oneidensis cells.

    Science.gov (United States)

    Ojima, Yoshihiro; Mohanadas, Thivagaran; Kitamura, Kosei; Nunogami, Shota; Yajima, Reiki; Taya, Masahito

    2017-04-01

    Shewanella oneidensis is a Gram-negative facultative anaerobe that can use a wide variety of terminal electron acceptors for anaerobic respiration. In this study, S. oneidensis degQ gene, encoding a putative periplasmic serine protease, was cloned and expressed. The activity of purified DegQ was inhibited by diisopropyl fluorophosphate, a typical serine protease-specific inhibitor, indicating that DegQ is a serine protease. In-frame deletion and subsequent complementation of the degQ were carried out to examine the effect of envelope stress on the production of outer membrane vesicles (OMVs). Analysis of periplasmic proteins from the resulting S. oneidensis strain showed that deletion of degQ induced protein accumulation and resulted in a significant decrease in protease activity within the periplasmic space. OMVs from the wild-type and mutant strains were purified and observed by transmission electron microscopy. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of the OMVs showed a prominent band at ~37 kDa. Nanoliquid chromatography-tandem mass spectrometry analysis identified three outer membrane porins (SO3896, SO1821, and SO3545) as dominant components of the band, suggesting that these proteins could be used as indices for comparing OMV production by S. oneidensis strains. Quantitative evaluation showed that degQ-deficient cells had a fivefold increase in OMV production compared with wild-type cells. Thus, the increased OMV production following the deletion of DegQ in S. oneidensis may be responsible for the increase in envelope stress.

  15. P450XXI (steroid 21-hydroxylase) gene deletions are not found in family studies of congenital adrenal hyperplasia

    Energy Technology Data Exchange (ETDEWEB)

    Matteson, K.J.; Phillips, J.A. III; Miller, W.L.; Chung, B.C.; Orlando, P.J.; Frisch, H.; Ferrandez, A.; Burr, I.M.

    1987-08-01

    Congenital adrenal hyperplasia (CAH) is a common genetic disorder due to defective 21-hydroxylation of steroid hormones. The human P450XXIA2 gene encodes cytochrome P450c21 (steroid 21-monooxygenase (steroid 21-hydroxylase)), which mediates 21-hydroxylation. The P450XXIA2 gene may be distinguished from the duplicated P450XXIA1 pseudogene by cleavage with the restriction endonuclease Taq I, with the XXIA2 gene characterized by a 3.7-kilobase (kb) fragment and the XXIA1 pseudogene characterized by a 3.2-kb fragment. Restriction endonuclease mapping by several laboratories has suggested that deletion of the P450XXIA2 gene occurs in about 25% of patients with CAH, as their genomic DNA lacks detectable 3.7-kb Taq I fragments. The authors have cloned human P450c21 cDNA and used it to study genomic DNA prepared from 51 persons in 10 families, each of which includes 2 or more persons with CAH. After Taq I digestion, apparent deletions are seen in 7 of the 20 alleles of the probands; using EcoRI, apparent deletions are seen in 9 of the 20 alleles. However, the apparently deleted alleles seen with Taq I do not coincide with those seen with EcoRI. Furthermore, studies with Bgl II, EcoRI, Kpn I, and Xba I yield normal patterns with at least two enzymes in all cases. Since all probands yielded normal patterns with at least two of the five enzymes used, they conclude that the P450XXIA2 gene deletions widely reported in CAH patients probably represent gene conversions, unequal crossovers,or polymorphisms rather than simple gene deletions.

  16. Recombination-dependent deletion formation in mammalian cells deficient in the nucleotide excision repair gene ERCC1.

    Science.gov (United States)

    Sargent, R G; Rolig, R L; Kilburn, A E; Adair, G M; Wilson, J H; Nairn, R S

    1997-11-25

    Nucleotide excision repair proteins have been implicated in genetic recombination by experiments in Saccharomyces cerevisiae and Drosophila melanogaster, but their role, if any, in mammalian cells is undefined. To investigate the role of the nucleotide excision repair gene ERCC1, the hamster homologue to the S. cerevisiae RADIO gene, we disabled the gene by targeted knockout. Partial tandem duplications of the adenine phosphoribosyltransferase (APRT) gene then were constructed at the endogenous APRT locus in ERCC1- and ERCC1+ cells. To detect the full spectrum of gene-altering events, we used a loss-of-function assay in which the parental APRT+ tandem duplication could give rise to APRT- cells by homologous recombination, gene rearrangement, or point mutation. Measurement of rates and analysis of individual APRT- products indicated that gene rearrangements (principally deletions) were increased at least 50-fold, whereas homologous recombination was affected little. The formation of deletions is not caused by a general effect of the ERCC1 deficiency on gene stability, because ERCC1- cell lines with a single wild-type copy of the APRT gene yielded no increase in deletions. Thus, deletion formation is dependent on the tandem duplication, and presumably the process of homologous recombination. Recombination-dependent deletion formation in ERCC1- cells is supported by a significant decrease in a particular class of crossover products that are thought to arise by repair of a heteroduplex intermediate in recombination. We suggest that the ERCC1 gene product in mammalian cells is involved in the processing of heteroduplex intermediates in recombination and that the misprocessed intermediates in ERCC1- cells are repaired by illegitimate recombination.

  17. Homozygous Deletions and Recurrent Amplifications Implicate New Genes Involved in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Wennuan Liu

    2008-08-01

    Full Text Available Prostate cancer cell lines provide ideal in vitro systems for the identification and analysis of prostate tumor suppressors and oncogenes. A detailed characterization of the architecture of prostate cancer cell line genomes would facilitate the study of precise roles of various genes in prostate tumorigenesis in general. To contribute to such a characterization, we used the GeneChip 500K single nucleotide polymorphic (SNP array for analysis of genotypes and relative DNA copy number changes across the genome of 11 cell lines derived from both normal and cancerous prostate tissues. For comparison purposes, we also examined the alterations observed in the cell lines in tumor/normal pairs of clinical samples from 72 patients. Along with genome-wide maps of DNA copy number changes and loss of heterozygosity for these cell lines, we report previously unreported homozygous deletions and recurrent amplifications in prostate cancers in this study. The homozygous deletions affected a number of biologically important genes, including PPP2R2A and BNIP3L identified in this study and CDKN2A/CDKN2B reported previously. Although most amplified genomic regions tended to be large, amplifications at 8q24.21 were of particular interest because the affected regions are relatively small, are found in multiple cell lines, are located near MYC, an oncogene strongly implicated in prostate tumorigenesis, and are known to harbor SNPs that are associated with inherited susceptibility for prostate cancer. The genomic alterations revealed in this study provide an important catalog of positional information relevant to efforts aimed at deciphering the molecular genetic basis of prostate cancer.

  18. Familial glucocorticoid resistance caused by a splice site deletion in the human glucocorticoid receptor gene

    Energy Technology Data Exchange (ETDEWEB)

    Karl, M.; Lamberts, S.W.J.; Detera-Wadleigh, S.D.; Encio, I.J.; Stratakis, C.A.; Hurley, D.M.; Accili, D.; Chrousos, G.P. (National Institutes of Health, Bethesda, MD (United States) Erasmus Univ. of Rotterdam (Netherlands))

    1993-03-01

    The clinical syndrome of generalized, compensated glucocorticoid resistance is characterized by increased cortisol secretion without clinical evidence of hyper- or hypocortisolism, and manifestations of androgen and/or mineralocorticoid excess. This condition results from partial failure of the glucocorticoid receptor (GR) to modulate transcription of its target genes. The authors studied the molecular mechanisms of this syndrome in a Dutch kindred, whose affected members had hypercortisolism and approximately half of normal GRs, and whose proband was a young woman with manifestations of hyperandrogenism. Using the polymerase chain reaction to amplify and sequence each of the nine exons of the GR gene [alpha], along with their 5[prime]- and 3[prime]-flanking regions, the authors identified a 4-base deletion at the 3[prime]-boundary of exon 6 in one GR allele ([Delta][sub 4]), which removed a donor splice site in all three affected members studied. In contrast, the sequence of exon 6 in the two unaffected siblings was normal. A single nucleotide substitution causing an amino acid substitution in the amino terminal domain of the GR (asparagine to serine, codon 363) was also discovered in exon 2 of the other allele (G[sub 1220]) in the proband, in one of her affected brothers and in her unaffected sister. This deletion in the glucocorticoid receptor gene was associated with the expression of only one allele and a decrease of GR protein by 50% in affected members of this glucocorticoid resistant family. The mutation identified in exon 2 did not segregate with the disease and appears to be of no functional significance. The presence of the null allele was apparently compensated for by increased cortisol production at the expense of concurrent hyperandrogenism. 40 refs., 3 figs.

  19. A novel break point of the BMPR2 gene exonic deletion in a patient with pulmonary arterial hypertension.

    Science.gov (United States)

    Aimi, Yuki; Hirayama, Tomomi; Kataoka, Masaharu; Momose, Yuichi; Nishimaki, Saiko; Matsushita, Kenichi; Yoshino, Hideaki; Satoh, Toru; Gamou, Shinobu

    2013-12-01

    The presence of genetic rearrangements of bone morphogenetic protein type 2 receptor (BMPR2) was identified in pulmonary arterial hypertension (PAH) patients as the deletion or duplication of one or more exons of the gene. We recently investigated the deletion break points in exonic deletions of BMPR2 in two Japanese familial cases with PAH, and found that these were Alu-mediated via either non-allelic homologous recombination or non-homologous recombination. We herein report the third case of exonic deletion, which was in a 25-year-old female PAH patient with a deletion of BMPR2 exon 3. The break point in this case was not located in an Alu sequence. The 5'- and 3'-break point maps between the inverted Alu sequences in intron 2 and in exon 3, respectively, resulted in a 759-bp deletion. This novel exonic deletion in this PAH case may be a unique and non-recurrent rearrangement, and appears to be of a different size from that in other patients.

  20. Oculo-facio-cardio-dental (OFCD) syndrome: the first Italian case of BCOR and co-occurring OTC gene deletion.

    Science.gov (United States)

    Di Stefano, C; Lombardo, B; Fabbricatore, C; Munno, C; Caliendo, I; Gallo, F; Pastore, L

    2015-04-01

    Oculo-facio-cardio-dental (OFCD) syndrome is a rare genetic disorder affecting ocular, facial, dental and cardiac systems. The syndrome is an X-linked dominant trait and it might be lethal in males. This syndrome is usually caused by mutations in the BCL6 interacting co-repressor gene (BCOR). We described a female child with mild phenotype of oculo-facio-cardio-dental syndrome. Array-comparative genomic hybridization (a-CGH) analysis revealed a de novo heterozygous deletion in the Xp11.4 region of approximately 2.3 Mb, involving BCOR and ornithine carbamoyl-transferase (OTC) genes. The deletion observed was subsequently confirmed by real time PCR. In this study we report a first case with co-occurrence of BCOR and OTC genes completely deleted in OFCD syndrome.

  1. Heme oxygenase-2 gene deletion attenuates oxidative stress in neurons exposed to extracellular hemin

    Directory of Open Access Journals (Sweden)

    Benvenisti-Zarom Luna

    2004-09-01

    Full Text Available Abstract Background Hemin, the oxidized form of heme, accumulates in intracranial hematomas and is a potent oxidant. Growing evidence suggests that it contributes to delayed injury to surrounding tissue, and that this process is affected by the heme oxygenase enzymes. In a prior study, heme oxygenase-2 gene deletion increased the vulnerability of cultured cortical astrocytes to hemin. The present study tested the effect of HO-2 gene deletion on protein oxidation, reactive oxygen species formation, and cell viability after mixed cortical neuron/astrocyte cultures were incubated with neurotoxic concentrations of hemin. Results Continuous exposure of wild-type cultures to 1–10 μM hemin for 14 h produced concentration-dependent neuronal death, as detected by both LDH release and fluorescence intensity after propidium iodide staining, with an EC50 of 1–2 μM; astrocytes were not injured by these low hemin concentrations. Cell death was consistently reduced by at least 60% in knockout cultures. Exposure to hemin for 4 hours, a time point that preceded cell lysis, increased protein oxidation in wild-type cultures, as detected by staining of immunoblots for protein carbonyl groups. At 10 μM hemin, carbonylation was increased 2.3-fold compared with control sister cultures subjected to medium exchanges only; this effect was reduced by about two-thirds in knockout cultures. Cellular reactive oxygen species, detected by fluorescence intensity after dihydrorhodamine 123 (DHR staining, was markedly increased by hemin in wild-type cultures and was localized to neuronal cell bodies and processes. In contrast, DHR fluorescence intensity in knockout cultures did not differ from that of sham-washed controls. Neuronal death in wild-type cultures was almost completely prevented by the lipid-soluble iron chelator phenanthroline; deferoxamine had a weaker but significant effect. Conclusions These results suggest that HO-2 gene deletion protects neurons in mixed

  2. Altered behavior in mice with deletion of the alpha2-antiplasmin gene.

    Science.gov (United States)

    Kawashita, Eri; Kanno, Yosuke; Ikeda, Kanako; Kuretake, Hiromi; Matsuo, Osamu; Matsuno, Hiroyuki

    2014-01-01

    The α2-antiplasmin (α2AP) protein is known to be a principal physiological inhibitor of plasmin, and is expressed in various part of the brain, including the hippocampus, cortex, hypothalamus and cerebellum, thus suggesting a potential role for α2AP in brain functions. However, the involvement of α2AP in brain functions is currently unclear. The goal of this study was to investigate the effects of the deletion of the α2AP gene on the behavior of mice. The motor function was examined by the wire hang test and rotarod test. To evaluate the cognitive function, a repeated rotarod test, Y-maze test, Morris water maze test, passive or shuttle avoidance test and fear conditioning test were performed. An open field test, dark/light transition test or tail suspension test was performed to determine the involvement of α2AP in anxiety or depression-like behavior. The α2AP knockout (α2AP-/-) mice exhibited impaired motor function compared with α2AP+/+ mice. The α2AP-/- mice also exhibited impairments in motor learning, working memory, spatial memory and fear conditioning memory. Furthermore, the deletion of α2AP induced anxiety-like behavior, and caused an anti-depression-like effect in tail suspension. Therefore, our findings suggest that α2AP is a crucial mediator of motor function, cognitive function, anxiety-like behavior and depression-like behavior, providing new insights into the role of α2AP in the brain functions.

  3. Deletion of an X-inactivation boundary disrupts adjacent gene silencing.

    Directory of Open Access Journals (Sweden)

    Lindsay M Horvath

    2013-11-01

    Full Text Available In mammalian females, genes on one X are largely silenced by X-chromosome inactivation (XCI, although some "escape" XCI and are expressed from both Xs. Escapees can closely juxtapose X-inactivated genes and provide a tractable model for assessing boundary function at epigenetically regulated loci. To delimit sequences at an XCI boundary, we examined female mouse embryonic stem cells carrying X-linked BAC transgenes derived from an endogenous escape locus. Previously we determined that large BACs carrying escapee Kdm5c and flanking X-inactivated transcripts are properly regulated. Here we identify two lines with truncated BACs that partially and completely delete the distal Kdm5c XCI boundary. This boundary is not required for escape, since despite integrating into regions that are normally X inactivated, transgenic Kdm5c escapes XCI, as determined by RNA FISH and by structurally adopting an active conformation that facilitates long-range preferential association with other escapees. Yet, XCI regulation is disrupted in the transgene fully lacking the distal boundary; integration site genes up to 350 kb downstream of the transgene now inappropriately escape XCI. Altogether, these results reveal two genetically separable XCI regulatory activities at Kdm5c. XCI escape is driven by a dominant element(s retained in the shortest transgene that therefore lies within or upstream of the Kdm5c locus. Additionally, the distal XCI boundary normally plays an essential role in preventing nearby genes from escaping XCI.

  4. Deletion of a malaria invasion gene reduces death and anemia, in model hosts.

    Directory of Open Access Journals (Sweden)

    Noé D Gómez

    Full Text Available Malaria parasites induce complex cellular and clinical phenotypes, including anemia, cerebral malaria and death in a wide range of mammalian hosts. Host genes and parasite 'toxins' have been implicated in malarial disease, but the contribution of parasite genes remains to be fully defined. Here we assess disease in BALB/c mice and Wistar rats infected by the rodent malaria parasite Plasmodium berghei with a gene knock out for merozoite surface protein (MSP 7. MSP7 is not essential for infection but in P. falciparum, it enhances erythrocyte invasion by 20%. In vivo, as compared to wild type, the P. berghei Δmsp7 mutant is associated with an abrogation of death and a decrease from 3% to 2% in peak, circulating parasitemia. The Δmsp7 mutant is also associated with less anemia and modest increase in the size of follicles in the spleen. Together these data show that deletion of a single parasite invasion ligand modulates blood stage disease, as measured by death and anemia. This work is the first to assess the contribution of a gene present in all plasmodial species in severe disease.

  5. COOH-terminal deletion of HBx gene is a frequent event in HBV-associated hepatocellular carcinoma

    Institute of Scientific and Technical Information of China (English)

    Xiao-Hong Liu; Jing Lin; Shu-Hui Zhang; Shun-Min Zhang; Mark A Feitelson; Heng-Jun Gao; Ming-Hua Zhu

    2008-01-01

    AIM:To investigate the hepatitis B virus (HBV) x gene (HBx) state in the tissues of HBV-related hepatocellular carcinoma (HCC) in Chinese patients and whether there were particular HBx mutations.METHODS:HBx gene was amplified and direct sequencing was used in genomic DNA samples from 20HCC and corresponding non-cancerous liver tissues from HBsAg-positive patients.HBV DNA integration and HBx deleted mutation were validated in 45 HCC patients at different stages by Southern blot analysis and polymerase chain reaction methods.RESULTS:The frequencies of HBx point mutations were significantly lower in HCC than their corresponding non-cancerous liver tissues (11/19 vs 18/19,P = 0.019).In contrast,deletions in HBx gene were significantly higher in HCC than their non-cancerous liver tissues (16/19 vs 4/19,P<0.001).The deletion of HBx COOH-terminal was detected in 14 HCC tissues.A specific integration of HBx at 17p13 locus was also found in 8 of 16 HCC,and all of them also exhibited full-length HBx deletions.Integrated or integrated coexistence with replicated pattern was obtained in 45.5% (20145)-56.8% (25145)tumors and 40.9% (18/45)-52.3% (23/45) non-tumor tissues.CONCLUSION:HBx deletion,especially the COOH-terminal deletion of HBx is a frequent event in HBV-associated HCC tissues in China.HBV integration had also taken place in partial HCC tissues.This supporting the hypothesis that deletion and probably integrated forms of the HBx gene may be implicated in liver carcinogenesis.

  6. Unambiguous demonstration of triple-helix-directed gene modification.

    Science.gov (United States)

    Barre, F X; Ait-Si-Ali, S; Giovannangeli, C; Luis, R; Robin, P; Pritchard, L L; Helene, C; Harel-Bellan, A

    2000-03-28

    Triple-helix-forming oligonucleotides (TFOs), which can potentially modify target genes irreversibly, represent promising tools for antiviral therapies. However, their effectiveness on endogenous genes has yet to be unambiguously demonstrated. To monitor endogenous gene modification by TFOs in a yeast model, we inactivated an auxotrophic marker gene by inserting target sequences of interest into its coding region. The genetically engineered yeast cells then were treated with psoralen-linked TFOs followed by UV irradiation, thus generating highly mutagenic covalent crosslinks at the target site whose repair could restore gene function; the number of revertants and spectrum of mutations generated were quantified. Results showed that a phosphoramidate TFO indeed reaches its target sequence, forms crosslinks, and generates mutations at the expected site via a triplex-mediated mechanism: (i) under identical conditions, no mutations were generated by the same TFO at two other loci in the target strain, nor in an isogenic control strain carrying a modified target sequence incapable of supporting triple-helix formation; (ii) for a given target sequence, whether the triplex was formed in vivo on an endogenous gene or in vitro on an exogenous plasmid, the nature of the mutations generated was identical, and consistent with the repair of a psoralen crosslink at the target site. Although the mutation efficiency was probably too low for therapeutic applications, our results confirm the validity of the triple-helix approach and provide a means of evaluating the effectiveness of new chemically modified TFOs and analogs.

  7. Analysis of a new homozygous deletion in the tumor suppressor region at 3p12.3 reveals two novel intronic noncoding RNA genes

    NARCIS (Netherlands)

    Angeloni, Debora; ter Elst, Arja; Wei, Ming Hui; van der Veen, Anneke Y.; Braga, Eleonora A.; Klimov, Eugene A.; Timmer, Tineke; Korobeinikova, Luba; Lerman, Michael I.; Buys, Charles H. C. M.

    2006-01-01

    Homozygous deletions or loss of heterozygosity (LOH) at human chromosome band 3p12 are consistent features of lung and other malignancies, suggesting the presence of a tumor suppressor gene(s) (TSG) at this location. Only one gene has been cloned thus far from the overlapping region deleted in lung

  8. Large deletions within the spinal muscular atrophy gene region in a patient with spinal muscular atrophy type 3

    Institute of Scientific and Technical Information of China (English)

    Wei Wei; Chunyue Chen; Wenting Liu; Zhenfang Du; Xiaoling Chen; Xianning Zhang

    2011-01-01

    Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disorder characterized by degeneration and loss of anterior horn cells in the spinal cord and brain stem nuclei, leading to progressive limb and trunk paralysis and muscular atrophy. Depending on the age of onset and maximum muscular function achieved, SMA is recognized as SMA1, SMA2, SMA3 or SMA4, and most patients have a deletion or truncation of the survival motor neuron 1 (SMN1) gene. In this report, we present a patient with a mild SMA phenotype, SMA3, and define his genetic abnormality. Tetra-primer amplification refractory mutation system PCR combined with restriction fragment length polymorphism analysis and array comparative genomic hybridization were used to determine the genetic variations in this patient. A 500 kb deletion in chromosome 5q13.2, including homozygous deletion of neuronal apoptosis inhibitory protein, and heterozygous deletion of occludin and B-double prime 1 was identified. This SMA region deletion did not involve SMN, indicating that SMN was likely to function normally. The phenotype was dependent of the large deletion and neuronal apoptosis inhibitory protein, occludin and B-double prime 1 may be candidate genes for SMA3.

  9. Overlapping submicroscopic deletions in Xq28 in two unrelated boys with developmental disorders: Identification of a gene near FRAXE

    Energy Technology Data Exchange (ETDEWEB)

    Gedeon, A.K.; Sutherland, G.R. [Women`s and Children`s Hospital, North Adelaide (Australia)]|[Univ. of Adelaide (Australia); Ades, L.C.; Gecz, J.; Baker, E.; Mulley, J.C. [Women`s and Children`s Hospital, North Adelaide (Australia); Keinaenen, M. [Clinical Laboratory Medix, Espoo (Finland); Kaeaeriaeinen, H. [Univ. of Helsinki (Finland)

    1995-04-01

    Two unrelated boys are described with delay in development and submicroscopic deletions in Xq28, near FRAXE. Molecular diagnosis to exclude the fragile X (FRAXA) syndrome used the direct probe pfxa3, together with a control probe pS8 (DXS296), against PstI restriction digests of DNA. Deletions were detected initially by the control probe pS8, which is an anonymous fragment subcloned from YAC 539, within 1 Mb distal to FRAXA. Further molecular analyses determined that the maximum size of the deletion is <100 kb in one boy (MK) and is wholly overlapped by the deletion of up to {approximately}200 kb in the other (CB). These deletions lie between the sequences detected by the probe VK21C (DXS296) and a dinucleotide repeat VK18AC (DXS295). The patient MK had only speech delay with otherwise normal development, while patient CB had global developmental delay that included speech delay. Detection of overlapping deletions in these two cases led to speculation that coding sequences of a gene(s) important in language development may be affected. Hybridization of the pS8 and VK21A probes to zooblots revealed cross-species homology. This conservation during evolution suggested that this region contains sequences with functional significance in normal development. The VK21A probe detected a 9.5-kb transcript in placenta and brain and a smaller, 2.5-kb, transcript in other tissues analyzed. 26 refs., 6 figs.

  10. Soluble epoxide hydrolase gene deletion improves blood flow and reduces infarct size after cerebral ischemia in reproductively senescent female mice

    Directory of Open Access Journals (Sweden)

    Kristen L Zuloaga

    2015-01-01

    Full Text Available Soluble epoxide hydrolase (sEH, a key enzyme in the metabolism of vasodilatory epoxyeicosatrienoic acids (EETs, is sexually dimorphic, suppressed by estrogen, and contributes to underlying sex differences in cerebral blood flow and injury after cerebral ischemia. We tested the hypothesis that sEH inhibition or gene deletion in reproductively senescent (RS female mice would increase cerebral perfusion and decrease infarct size following stroke. RS (15-18 month old and young (3-4 month old female sEH knockout (sEHKO mice and wild type (WT mice were subjected to 45 min middle cerebral artery occlusion (MCAO with laser Doppler perfusion monitoring. WT mice were treated with vehicle or a sEH inhibitor t-AUCB at the time of reperfusion and every 24hrs thereafter for 3 days. Differences in regional cerebral blood flow were measured in vivo using optical microangiography. Infarct size was measured 3 days after reperfusion. Infarct size and cerebral perfusion 24h after MCAO were not altered by age. Both sEH gene deletion and sEH inhibition increased cortical perfusion 24h after MCAO. Neither sEH gene deletion nor sEH inhibition reduced infarct size in young mice. However, sEH gene deletion, but not sEH inhibition of the hydrolase domain of the enzyme, decreased infarct size in RS mice. Results of these studies show that sEH gene deletion and sEH inhibition enhance cortical perfusion following MCAO and sEH gene deletion reduces damage after ischemia in RS female mice; however this neuroprotection in absent is young mice.

  11. The effect of the CCR5-delta32 deletion on global gene expression considering immune response and inflammation

    Directory of Open Access Journals (Sweden)

    Hütter Gero

    2011-10-01

    Full Text Available Abstract Background The natural function of the C-C chemokine receptor type 5 (CCR5 is poorly understood. A 32 base pair deletion in the CCR5 gene (CCR5-delta32 located on chromosome 3 results in a non-functional protein. It is supposed that this deletion causes an alteration in T-cell response to inflammation. For example, the presence of the CCR5-delta32 allele in recipients of allografts constitutes as an independent and protective factor associated with a decreased risk of graft-versus-host disease (GVHD and graft rejection. However, the mechanism of this beneficial effect of the deletion regarding GVHD is unknown. In this survey we searched for a CCR5-delta32 associated regulation of critical genes involved in the immune response and the development of GVHD. Methods We examined CD34+ hematopoietic progenitor cells derived from bone marrow samples from 19 healthy volunteers for the CCR5-delta32 deletion with a genomic PCR using primers flanking the site of the deletion. Results 12 individuals were found to be homozygous for CCR5 WT and 7 carried the CCR5-delta32 deletion heterozygously. Global gene expression analysis led to the identification of 11 differentially regulated genes. Six of them are connected with mechanisms of immune response and control: LRG1, CXCR2, CCRL2, CD6, CD7, WD repeat domain, and CD30L. Conclusions Our data indicate that the CCR5-delta32 mutation may be associated with differential gene expression. Some of these genes are critical for immune response, in the case of CD30L probably protective in terms of GVHD.

  12. Variants in linkage disequilibrium with the late cornified envelope gene cluster deletion are associated with susceptibility to psoriatic arthritis.

    LENUS (Irish Health Repository)

    Bowes, John

    2010-12-01

    A common deletion mapping to the psoriasis susceptibility locus 4 on chromosome 1q21, encompassing two genes of the late cornified envelope (LCE) gene cluster, has been associated with an increased risk of psoriasis vulgaris (PsV). One previous report found no association of the deletion with psoriatic arthritis (PsA), suggesting it may be a specific risk factor for PsV. Given the genetic overlap between PsA and PsV, a study was undertaken to investigate whether single nucleotide polymorphisms (SNPs) mapping to this locus are risk factors for PsA in a UK and Irish population.

  13. A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Directory of Open Access Journals (Sweden)

    Etchells J Peter

    2009-10-01

    Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.

  14. 11p13 deletions can be more frequent than the PAX6 gene point mutations in Polish patients with aniridia.

    Science.gov (United States)

    Wawrocka, Anna; Sikora, Agata; Kuszel, Lukasz; Krawczynski, Maciej R

    2013-08-01

    Aniridia is a rare, bilateral, congenital ocular disorder causing incomplete formation of the iris, usually characterized by iris aplasia/hypoplasia. It can also appear with other ocular anomalies, such as cataracts, glaucoma, corneal pannus, optic nerve hypoplasia, macular hypoplasia, or ectopia lentis. In the majority of cases, it is caused by mutation in the PAX6 gene, but it can also be caused by microdeletions that involve the 11p13 region. Twelve unrelated patients of Polish origin with a clinical diagnosis of aniridia were screened for the presence of microdeletions in the 11p13 region by means of multiplex ligation probe amplification (MLPA). Additionally, the coding regions of the PAX6 gene were sequenced in all probands. MLPA examination revealed different size deletions of the 11p13 region in five patients. In three cases, deletions encompassed the entire PAX6 gene and a few adjacent genes. In one case, a fragment of the PAX6 gene was deleted only. In the final case, the deletion did not include any PAX6 sequence. Our molecular findings provide further evidence of the existence of the distant 3' regulatory elements in the downstream region of the PAX6 gene, which is known from other studies to influence the level of protein expression. Sequence analysis of the PAX6 gene revealed the three different point mutations in the remaining four patients with aniridia. All the detected mutations were reported earlier. Based on accomplished results, the great diversity of the molecular basis of aniridia was found. It varies from point mutations to different size deletions in the 11p13 region which encompass partly or completely the PAX6 gene or cause a position effect.

  15. SPC-Cre-ERT2 transgenic mouse for temporal gene deletion in alveolar epithelial cells.

    Directory of Open Access Journals (Sweden)

    Yao-Song Gui

    Full Text Available Although several Cre-loxP-based gene knockout mouse models have been generated for the study of gene function in alveolar epithelia in the lung, their applications are still limited. In this study, we developed a SPC-Cre-ER(T2 mouse model, in which a tamoxifen-inducible Cre recombinase (Cre-ER(T2 is under the control of the human surfactant protein C (SPC promoter. The specificity and efficiency of Cre-ER(T2 activity was first evaluated by crossing SPC-Cre-ER(T2 mouse with ROSA26R mouse, a β-galactosidase reporter strain. We found that Cre-ER(T2 was expressed in 30.7% type II alveolar epithelial cells of SPC-Cre-ER(T2/ROSA26R mouse lung tissues in the presence of tamoxifen. We then tested the tamoxifen-inducible recombinase activity of Cre-ER(T2 in a mouse strain bearing TSC1 conditional knockout alleles (TSC1(fx/fx. TSC1 deletion was detected in the lungs of tamoxifen treated SPC-Cre-ER(T2/TSC1(fx/fx mice. Therefore this SPC-Cre-ER(T2 mouse model may be a valuable tool to investigate functions of genes in lung development, physiology and disease.

  16. SPC-Cre-ERT2 transgenic mouse for temporal gene deletion in alveolar epithelial cells.

    Science.gov (United States)

    Gui, Yao-Song; Wang, Lianmei; Tian, Xinlun; Feng, Ruie; Ma, Aiping; Cai, Baiqiang; Zhang, Hongbing; Xu, Kai-Feng

    2012-01-01

    Although several Cre-loxP-based gene knockout mouse models have been generated for the study of gene function in alveolar epithelia in the lung, their applications are still limited. In this study, we developed a SPC-Cre-ER(T2) mouse model, in which a tamoxifen-inducible Cre recombinase (Cre-ER(T2)) is under the control of the human surfactant protein C (SPC) promoter. The specificity and efficiency of Cre-ER(T2) activity was first evaluated by crossing SPC-Cre-ER(T2) mouse with ROSA26R mouse, a β-galactosidase reporter strain. We found that Cre-ER(T2) was expressed in 30.7% type II alveolar epithelial cells of SPC-Cre-ER(T2)/ROSA26R mouse lung tissues in the presence of tamoxifen. We then tested the tamoxifen-inducible recombinase activity of Cre-ER(T2) in a mouse strain bearing TSC1 conditional knockout alleles (TSC1(fx/fx)). TSC1 deletion was detected in the lungs of tamoxifen treated SPC-Cre-ER(T2)/TSC1(fx/fx) mice. Therefore this SPC-Cre-ER(T2) mouse model may be a valuable tool to investigate functions of genes in lung development, physiology and disease.

  17. Construction and characterization of pta gene-deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation.

    Science.gov (United States)

    Zhu, Ying; Liu, Xiaoguang; Yang, Shang-Tian

    2005-04-20

    Clostridium tyrobutyricum ATCC 25755 is an acidogenic bacterium, producing butyrate and acetate as its main fermentation products. In order to decrease acetate and increase butyrate production, integrational mutagenesis was used to disrupt the gene associated with the acetate formation pathway in C. tyrobutyricum. A nonreplicative integrational plasmid containing the phosphotransacetylase gene (pta) fragment cloned from C. tyrobutyricum by using degenerate primers and an erythromycin resistance cassette were constructed and introduced into C. tyrobutyricum by electroporation. Integration of the plasmid into the homologous region on the chromosome inactivated the target pta gene and produced the pta-deleted mutant (PTA-Em), which was confirmed by Southern hybridization. SDS-PAGE and two-dimensional protein electrophoresis results indicated that protein expression was changed in the mutant. Enzyme activity assays using the cell lysate showed that the activities of PTA and acetate kinase (AK) in the mutant were reduced by more than 60% for PTA and 80% for AK. The mutant grew more slowly in batch fermentation with glucose as the substrate but produced 15% more butyrate and 14% less acetate as compared to the wild-type strain. Its butyrate productivity was approximately 2-fold higher than the wild-type strain. Moreover, the mutant showed much higher tolerance to butyrate inhibition, and the final butyrate concentration was improved by 68%. However, inactivation of pta gene did not completely eliminate acetate production in the fermentation, suggesting the existence of other enzymes (or pathways) also leading to acetate formation. This is the first-reported genetic engineering study demonstrating the feasibility of using a gene-inactivation technique to manipulate the acetic acid formation pathway in C. tyrobutyricum in order to improve butyric acid production from glucose.

  18. Complementary Information Derived from CRISPR Cas9 Mediated Gene Deletion and Suppression. | Office of Cancer Genomics

    Science.gov (United States)

    CRISPR-Cas9 provides the means to perform genome editing and facilitates loss-of-function screens. However, we and others demonstrated that expression of the Cas9 endonuclease induces a gene-independent response that correlates with the number of target sequences in the genome. An alternative approach to suppressing gene expression is to block transcription using a catalytically inactive Cas9 (dCas9). Here we directly compare genome editing by CRISPR-Cas9 (cutting, CRISPRc) and gene suppression using KRAB-dCas9 (CRISPRi) in loss-of-function screens to identify cell essential genes.

  19. Gene expression and biological processes influenced by deletion of Stat3 in pulmonary type II epithelial cells

    Directory of Open Access Journals (Sweden)

    Whitsett Jeffrey A

    2007-12-01

    Full Text Available Abstract Background The signal transducer and activator of transcription 3 (STAT3 mediates gene expression in response to numerous growth factors and cytokines, playing an important role in many cellular processes. To better understand the molecular mechanisms by which Stat3 influences gene expression in the lung, the effect of pulmonary epithelial cell specific deletion of Stat3 on genome wide mRNA expression profiling was assessed. Differentially expressed genes were identified from Affymetrix Murine GeneChips analysis and subjected to gene ontology classification, promoter analysis, pathway mapping and literature mining. Results Total of 791 mRNAs were significantly increased and 314 mRNAs were decreased in response to the deletion of Stat3Δ/Δ in the lung. STAT is the most enriched cis-elements in the promoter regions of those differentially expressed genes. Deletion of Stat3 induced genes influencing protein metabolism, transport, chemotaxis and apoptosis and decreased the expression of genes mediating lipid synthesis and metabolism. Expression of Srebf1 and 2, genes encoding key regulators of fatty acid and steroid biosynthesis, was decreased in type II cells from the Stat3Δ/Δ mice, consistent with the observation that lung surfactant phospholipids content was decreased. Stat3 influenced both pro- and anti-apoptotic pathways that determine cell death or survival. Akt, a potential transcriptional target of Stat3, was identified as an important participant in Stat3 mediated pathways including Jak-Stat signaling, apoptosis, Mapk signaling, cholesterol and fatty acid biosynthesis. Conclusion Deletion of Stat3 from type II epithelial cells altered the expression of genes regulating diverse cellular processes, including cell growth, apoptosis and lipid metabolism. Pathway analysis indicates that STAT3 regulates cellular homeostasis through a complex regulatory network that likely enhances alveolar epithelial cell survival and surfactant

  20. Deletion of Specific Immune-Modulatory Genes from Modified Vaccinia Virus Ankara-Based HIV Vaccines Engenders Improved Immunogenicity in Rhesus Macaques

    Science.gov (United States)

    O'Mara, Leigh A.; Gangadhara, Sailaja; McQuoid, Monica; Zhang, Xiugen; Zheng, Rui; Gill, Kiran; Verma, Meena; Yu, Tianwei; Johnson, Brent; Li, Bing; Derdeyn, Cynthia A.; Ibegbu, Chris; Altman, John D.; Hunter, Eric; Feinberg, Mark B.

    2012-01-01

    Modified vaccinia virus Ankara (MVA) is a safe, attenuated orthopoxvirus that is being developed as a vaccine vector but has demonstrated limited immunogenicity in several early-phase clinical trials. Our objective was to rationally improve the immunogenicity of MVA-based HIV/AIDS vaccines via the targeted deletion of specific poxvirus immune-modulatory genes. Vaccines expressing codon-optimized HIV subtype C consensus Env and Gag antigens were generated from MVA vector backbones that (i) harbor simultaneous deletions of four viral immune-modulatory genes, encoding an interleukin-18 (IL-18) binding protein, an IL-1β receptor, a dominant negative Toll/IL-1 signaling adapter, and CC-chemokine binding protein (MVAΔ4-HIV); (ii) harbor a deletion of an additional (fifth) viral gene, encoding uracil-DNA glycosylase (MVAΔ5-HIV); or (iii) represent the parental MVA backbone as a control (MVA-HIV). We performed head-to-head comparisons of the cellular and humoral immune responses that were elicited by these vectors during homologous prime-boost immunization regimens utilizing either high-dose (2 × 108 PFU) or low-dose (1 × 107 PFU) intramuscular immunization of rhesus macaques. At all time points, a majority of the HIV-specific T cell responses, elicited by all vectors, were directed against Env, rather than Gag, determinants, as previously observed with other vector systems. Both modified vectors elicited up to 6-fold-higher frequencies of HIV-specific CD8 and CD4 T cell responses and up to 25-fold-higher titers of Env (gp120)-specific binding (nonneutralizing) antibody responses that were relatively transient in nature. While the correlates of protection against HIV infection remain incompletely defined, our results indicate that the rational deletion of specific genes from MVA vectors can positively alter their cellular and humoral immunogenicity profiles in nonhuman primates. PMID:22973033

  1. Analysis of crossover breakpoints yields new insights into the nature of the gene conversion events associated with large NF1 deletions mediated by nonallelic homologous recombination.

    Science.gov (United States)

    Bengesser, Kathrin; Vogt, Julia; Mussotter, Tanja; Mautner, Victor-Felix; Messiaen, Ludwine; Cooper, David N; Kehrer-Sawatzki, Hildegard

    2014-02-01

    Large NF1 deletions are mediated by nonallelic homologous recombination (NAHR). An in-depth analysis of gene conversion operating in the breakpoint-flanking regions of large NF1 deletions was performed to investigate whether the rate of discontinuous gene conversion during NAHR with crossover is increased, as has been previously noted in NAHR-mediated rearrangements. All 20 germline type-1 NF1 deletions analyzed were mediated by NAHR associated with continuous gene conversion within the breakpoint-flanking regions. Continuous gene conversion was also observed in 31/32 type-2 NF1 deletions investigated. In contrast to the meiotic type-1 NF1 deletions, type-2 NF1 deletions are predominantly of post-zygotic origin. Our findings therefore imply that the mitotic as well as the meiotic NAHR intermediates of large NF1 deletions are processed by long-patch mismatch repair (MMR), thereby ensuring gene conversion tract continuity instead of the discontinuous gene conversion that is characteristic of short-patch repair. However, the single type-2 NF1 deletion not exhibiting continuous gene conversion was processed without MMR, yielding two different deletion-bearing chromosomes, which were distinguishable in terms of their breakpoint positions. Our findings indicate that MMR failure during NAHR, followed by post-meiotic/mitotic segregation, has the potential to give rise to somatic mosaicism in human genomic rearrangements by generating breakpoint heterogeneity.

  2. A De Novo Whole GCK Gene Deletion Not Detected by Gene Sequencing, in a Boy with Phenotypic GCK Insufficiency

    Directory of Open Access Journals (Sweden)

    N. H. Birkebæk

    2011-01-01

    Full Text Available We report on a boy with diabetes mellitus and a phenotype indicating glucokinase (GCK insufficiency, but a normal GCK gene examination applying direct gene sequencing. The boy was referred for diabetes mellitus at 7.5 years old. His father, grandfather and great grandfather suffered type 2 DM. Several blood glucose profiles showed (BG of 6.5–10 mmol/L L. After three years on neutral insulin Hagedorn (NPH in a dose of 0.3 IU/kg/day haemoglobin A1c (HbA1c was 6.8%. Treatment was changed to sulphonylurea 750 mg a day, and after 4 years HbA1c was 7%. At that time a multiplex ligation-dependent amplification gene dosage assay (MLPA was done, revealing a whole GCK gene deletion. Medical treatment was ceased, and after one year HbA1c was 6.8%. This case underscores the importance of a MLPA examination if the phenotype of a patient is strongly indicative of GCK insufficiency and no mutation is identified using direct sequencing.

  3. Reduced beta-globin gene expression in adult mice containing deletions of locus control region 5' HS-2 or 5' HS-3.

    Science.gov (United States)

    Ley, T J; Hug, B; Fiering, S; Epner, E; Bender, M A; Groudine, M

    1998-06-30

    To gain insights into the functions of individual DNA'se hypersensitive sites within the beta globin locus control region (LCR), we deleted the endogenous 5' HS-2 and HS-3 regions from the mouse germline using homologous recombination techniques. We demonstrated that the deletion of either murine 5' HS-2 or 5' HS-3 reduced the expression of the embryonic epsilon y and beta h1 globin genes minimally in yolk sac-derived erythrocytes, but that both knockouts reduced the output of the adult beta (beta-Major + beta-Minor) globin genes by approximately 30% in adult erythrocytes. When the selectable marker PGK-Neo cassette was retained within either the HS-2 or HS-3 region, a much more severe reduction in globin gene expression was observed at all developmental stages. PGK-Neo was shown to be expressed in an erythroid-specific fashion when it was retained in the HS-3 position. These results show that neither 5' HS-2 nor HS-3 is required for the activity of embryonic globin genes, nor are these sites required for correct developmental switching. However, each site is required for approximately 30% of the total LCR activity associated with adult beta-globin gene expression in adult red blood cells. Each site therefore contains some non-redundant information that contributes to adult globin gene function.

  4. Prenatal diagnosis of a 7p15-p21 deletion encompassing the TWIST1 gene involved in Saethre-Chotzen syndrome.

    Science.gov (United States)

    Spaggiari, Emmanuel; Aboura, Azzedine; Sinico, Martine; Mabboux, Philippe; Dupont, Céline; Delezoide, Anne-Lise; Guimiot, Fabien

    2012-01-01

    Saethre-Chotzen syndrome is a craniosynostosis syndrome that is rarely diagnosed prenatally. It is caused by cytogenetic deletions or mutations of the TWIST1 gene. We report here a de novo prenatal case with clinically and molecularly well defined Saethre-Chotzen syndrome due to a TWIST1 deletion. This is the first reported case of a deletion encompassing the TWIST1 gene to be diagnosed prenatally. We recommend screening for a deletion of the TWIST1 gene if signs of coronal craniosynostosis with no clear etiology are observed on ultrasound examination.

  5. Saccharomyces cerevisiae FLO1 Gene Demonstrates Genetic Linkage to Increased Fermentation Rate at Low Temperatures

    Science.gov (United States)

    Deed, Rebecca C.; Fedrizzi, Bruno; Gardner, Richard C.

    2017-01-01

    Low fermentation temperatures are of importance to food and beverage industries working with Saccharomyces cerevisiae. Therefore, the identification of genes demonstrating a positive impact on fermentation kinetics is of significant interest. A set of 121 mapped F1 progeny, derived from a cross between haploid strains BY4716 (a derivative of the laboratory yeast S288C) and wine yeast RM11-1a, were fermented in New Zealand Sauvignon Blanc grape juice at 12.5°. Analyses of five key fermentation kinetic parameters among the F1 progeny identified a quantitative trait locus (QTL) on chromosome I with a significant degree of linkage to maximal fermentation rate (Vmax) at low temperature. Independent deletions of two candidate genes within the region, FLO1 and SWH1, were constructed in the parental strains (with S288C representing BY4716). Fermentation of wild-type and deletion strains at 12.5 and 25° confirmed that the genetic linkage to Vmax corresponds to the S288C version of the FLO1 allele, as the absence of this allele reduced Vmax by ∼50% at 12.5°, but not at 25°. Reciprocal hemizygosity analysis (RHA) between S288C and RM11-1a FLO1 alleles did not confirm the prediction that the S288C version of FLO1 was promoting more rapid fermentation in the opposing strain background, suggesting that the positive effect on Vmax derived from S288C FLO1 may only provide an advantage in haploids, or is dependent on strain-specific cis or trans effects. This research adds to the growing body of evidence demonstrating the role of FLO1 in providing stress tolerance to S. cerevisiae during fermentation. PMID:28143947

  6. Saccharomyces cerevisiae FLO1 Gene Demonstrates Genetic Linkage to Increased Fermentation Rate at Low Temperatures

    Directory of Open Access Journals (Sweden)

    Rebecca C. Deed

    2017-03-01

    Full Text Available Low fermentation temperatures are of importance to food and beverage industries working with Saccharomyces cerevisiae. Therefore, the identification of genes demonstrating a positive impact on fermentation kinetics is of significant interest. A set of 121 mapped F1 progeny, derived from a cross between haploid strains BY4716 (a derivative of the laboratory yeast S288C and wine yeast RM11-1a, were fermented in New Zealand Sauvignon Blanc grape juice at 12.5°. Analyses of five key fermentation kinetic parameters among the F1 progeny identified a quantitative trait locus (QTL on chromosome I with a significant degree of linkage to maximal fermentation rate (Vmax at low temperature. Independent deletions of two candidate genes within the region, FLO1 and SWH1, were constructed in the parental strains (with S288C representing BY4716. Fermentation of wild-type and deletion strains at 12.5 and 25° confirmed that the genetic linkage to Vmax corresponds to the S288C version of the FLO1 allele, as the absence of this allele reduced Vmax by ∼50% at 12.5°, but not at 25°. Reciprocal hemizygosity analysis (RHA between S288C and RM11-1a FLO1 alleles did not confirm the prediction that the S288C version of FLO1 was promoting more rapid fermentation in the opposing strain background, suggesting that the positive effect on Vmax derived from S288C FLO1 may only provide an advantage in haploids, or is dependent on strain-specific cis or trans effects. This research adds to the growing body of evidence demonstrating the role of FLO1 in providing stress tolerance to S. cerevisiae during fermentation.

  7. The somatic hypermutation activity of a follicular lymphoma links to large insertions and deletions of immunoglobulin genes.

    Science.gov (United States)

    Wu, H Y; Kaartinen, M

    1995-07-01

    A biopsy specimen from a patient with follicular lymphoma was divided into two fragments. DNA was extracted from one fragment and a 1.2 kb region of the functional heavy chain (IgH) gene was amplified, cloned and sequenced (eight clones). From the other fragment a cell line (HF-1) was started. The IgH gene region was amplified from the cell line, and sequenced without cloning. The nine sequences obtained could be arranged into a genealogical tree where the individual sequences differed from the deduced ancestor by 16-29 single nucleotide changes, some also by an insertion and/or a deletion. It is apparent that the sequence alterations were caused by somatic mutations during the growth of the lymphoma. The comparison of the sequences with two published (allelic) germline sequences of the human JH region showed approximately 20% non-homology. The differences included five additional multinucleotide insertion/deletion changes, the longest of them a 101-nucleotide insertion. Two long insertions were homologous to the adjacent germline sequences. We propose that most of the changes observed, including long deletions and insertions, represent or are linked to somatic hypermutation events of the Ig gene type. Although in a few cases large deletions and insertions (> 2 bp) have been found in mutated immunoglobulin genes, our results, for the first time, firmly link these deletions/insertions to somatic hypermutations; their frequency was found to be 2.2% of the observed mutational events in the non-translated gene regions. HF-1 is the first follicular lymphoma line successfully established from a lymphoma known to have hypermutated its Ig genes during the malignant growth. It is a candidate cell line to be studied for its ability to generate mutations of B cell type in cell cultures.

  8. Autoimmune lymphoproliferative syndrome in a patient with a new minimal deletion in the death domain of the FAS gene

    NARCIS (Netherlands)

    Gualco, Gabrieta; van den Berg, Anke; Koopmans, Sicco; Bacchi, Livia M.; Carneiro, Siderley S.; Ruiz, Everaldo; Vecchi, Ana Paula; Chan, John K. C.

    2008-01-01

    We present a case of autoimmune lymphoproliferative syndrome (ALPS) caused by a previously undescribed minimal deletion in the death domain of the FAS gene. ALPS is an uncommon disease associated with an impaired Fas-mediated apoptosis. The patient presented with a history of splenomegaly since 4 mo

  9. Lethal osteogenesis imperfecta congenita and a 300 base pair gene deletion for an α1(I)-like collagen.

    NARCIS (Netherlands)

    F.M. Pope; K.S.E. Cheah (Kathryn); A.C. Nicholls; A.B. Price; F.G. Grosveld (Frank)

    1984-01-01

    textabstractBroad boned lethal osteogenesis imperfecta is a severely crippling disease of unknown cause. By means of recombinant DNA technology a 300 base pair deletion in an alpha 1(I)-like collagen gene was detected in six patients and four complete parent-child groups including patients with this

  10. Robust Parameter Identification to Perform the Modeling of pta and poxB Genes Deletion Effect on Escherichia Coli.

    Science.gov (United States)

    Guerrero-Torres, V; Rios-Lozano, M; Badillo-Corona, J A; Chairez, I; Garibay-Orijel, C

    2016-08-01

    The aim of this study was to design a robust parameter identification algorithm to characterize the effect of gene deletion on Escherichia coli (E. coli) MG1655. Two genes (pta and poxB) in the competitive pathways were deleted from this microorganism to inhibit pyruvate consumption. This condition deviated the E. coli metabolism toward the Krebs cycle. As a consequence, the biomass, substrate (glucose), lactic, and acetate acids as well as ethanol concentrations were modified. A hybrid model was proposed to consider the effect of gene deletion on the metabolism of E. coli. The model parameters were estimated by the application of a least mean square method based on the instrument variable technique. To evaluate the parametric identifier method, a set of robust exact differentiators, based on the super-twisting algorithm, was implemented. The hybrid model was successfully characterized by the parameters obtained from experimental information of E. coli MG1655. The significant difference between parameters obtained with wild-type strain and the modified (with deleted genes) justifies the application of the parametric identification algorithm. This characterization can be used to optimize the production of different byproducts of commercial interest.

  11. Conditional beta1-integrin gene deletion in neural crest cells causes severe developmental alterations of the peripheral nervous system

    DEFF Research Database (Denmark)

    Pietri, Thomas; Eder, Olivier; Breau, Marie Anne;

    2004-01-01

    Integrins are transmembrane receptors that are known to interact with the extracellular matrix and to be required for migration, proliferation, differentiation and apoptosis. We have generated mice with a neural crest cell-specific deletion of the beta1-integrin gene to analyse the role of beta1-...

  12. A novel method to generate unmarked gene deletions in the intracellular pathogen Rhodococcus equi using 5-fluorocytosine conditional lethality

    NARCIS (Netherlands)

    van der Geize, R.; de Jong, W.; Hessels, G. I.; Grommen, A. W. F.; Jacobs, A. A. C.; Dijkhuizen, L.

    2008-01-01

    A novel method to efficiently generate unmarked in-frame gene deletions in Rhodococcus equi was developed, exploiting the cytotoxic effect of 5-fluorocytosine (5-FC) by the action of cytosine deaminase (CD) and uracil phosphoribosyltransferase (UPRT) enzymes. The opportunistic, intracellular

  13. Regulation of deleted in liver cancer-1 gene domains on the proliferation of human colon cancer HT29 cell

    Institute of Scientific and Technical Information of China (English)

    吴平平

    2013-01-01

    Objective To study the role of deleted in liver cancer-1(DLC-1) gene main domains on the regulation of hu-man colon cancer HT29 cell proliferation. Methods Subcloning recombinant plasmid vectors with Rho GTPase activating protein(RhoGAP),sterile alpha motif(SAM)

  14. Lethal osteogenesis imperfecta congenita and a 300 base pair gene deletion for an α1(I)-like collagen.

    NARCIS (Netherlands)

    F.M. Pope; K.S.E. Cheah (Kathryn); A.C. Nicholls; A.B. Price; F.G. Grosveld (Frank)

    1984-01-01

    textabstractBroad boned lethal osteogenesis imperfecta is a severely crippling disease of unknown cause. By means of recombinant DNA technology a 300 base pair deletion in an alpha 1(I)-like collagen gene was detected in six patients and four complete parent-child groups including patients with this

  15. Novel mutations including deletions of the entire OFD1 gene in 30 families with type 1 orofaciodigital syndrome

    DEFF Research Database (Denmark)

    Bisschoff, Izak J; Zeschnigk, Christine; Horn, Denise

    2013-01-01

    have studied 55 sporadic and six familial cases of suspected OFD1. Comprehensive mutation analysis in OFD1 revealed mutations in 37 female patients from 30 families; 22 mutations have not been previously described including two heterozygous deletions spanning OFD1 and neighbouring genes. Analysis...

  16. Identification of a Novel Deletion in AVP-NPII Gene in a Patient with Central Diabetes Insipidus.

    Science.gov (United States)

    Deniz, Ferhat; Acar, Ceren; Saglar, Emel; Erdem, Beril; Karaduman, Tugce; Yonem, Arif; Cagiltay, Eylem; Ay, Seyit Ahmet; Mergen, Hatice

    2015-01-01

    Central Diabetes Insipidus (CDI) is caused by a deficiency of antidiuretic hormone and characterized by polyuria, polydipsia and inability to concentrate urine. Our objective was to present the results of the molecular analyses of AVP-neurophysin II (AVP-NPII) gene in a large familial neurohypophyseal (central) DI pedigree. A male patient and his family members were analyzed and the prospective clinical data were collected. The proband applied to hospital for eligibility to be a recruit in Armed Forces. The patient had severe polyuria (20 L/day), polydipsia (20.5 L/day), fatique, and deep thirstiness. CDI was confirmed with the water deprivation-desmopressin test according to an increase in urine osmolality from 162 mOsm/kg to 432 mOsm/kg after desmopressin acetate injection. To evaluate the coding regions of AVP-NPII gene, polymerase chain reactions were performed and amplified regions were submitted to direct sequence analysis. We detected a heterozygous three base pair deletion at codon 69-70 (207_209delGGC) in exon 2, which lead to a deletion of the amino acid alanine. A three-dimensional protein structure prediction was shown for the deleted AVP-NPII and compared with the wild type. The three base pair deletion may yield an abnormal AVP precursor in neurophysin moiety, but further functional analyses are needed to understand the function of the deleted protein.

  17. Increased frequency of DNA deletions in pink-eyed unstable mice carrying a mutation in the Werner syndrome gene homologue.

    Science.gov (United States)

    Lebel, Michel

    2002-01-01

    Werner syndrome (WS) is a rare autosomal recessive disorder characterized by genomic instability and the premature onset of a number of age-related diseases, including cancers. Accumulating evidence indicates that the WS gene product is involved in resolving aberrant DNA structures that may arise during the process of DNA replication and/or transcription. To estimate the frequency of DNA deletions directly in the skin of mouse embryos, mice with a deletion of part of the murine WRN helicase domain were created. These mutant mice were then crossed to the pink-eyed unstable animals, which have a 70 kb internal duplication at the pink-eyed dilution (p) gene. This report indicates that the frequency of deletion of the duplicated sequence at the p locus is elevated in mice with a mutation in the WRN allele when compared with wild-type mice. In addition, the inhibitor of topoisomerase I camptothecin also increases the frequency of deletion at the p locus. This frequency is even more elevated in WRN mutant mice treated with camptothecin. In contrast, while the inhibition of poly(ADP-ribose) polymerase (PARP) activity by 3-aminobenzamide increases the frequency of DNA deletion, mutant WRN mice are not significantly more sensitive to the inhibition of PARP activity than wild-type animals.

  18. Altered behavior in mice with deletion of the alpha2-antiplasmin gene.

    Directory of Open Access Journals (Sweden)

    Eri Kawashita

    Full Text Available BACKGROUND: The α2-antiplasmin (α2AP protein is known to be a principal physiological inhibitor of plasmin, and is expressed in various part of the brain, including the hippocampus, cortex, hypothalamus and cerebellum, thus suggesting a potential role for α2AP in brain functions. However, the involvement of α2AP in brain functions is currently unclear. OBJECTIVES: The goal of this study was to investigate the effects of the deletion of the α2AP gene on the behavior of mice. METHODS: The motor function was examined by the wire hang test and rotarod test. To evaluate the cognitive function, a repeated rotarod test, Y-maze test, Morris water maze test, passive or shuttle avoidance test and fear conditioning test were performed. An open field test, dark/light transition test or tail suspension test was performed to determine the involvement of α2AP in anxiety or depression-like behavior. RESULTS AND CONCLUSIONS: The α2AP knockout (α2AP-/- mice exhibited impaired motor function compared with α2AP+/+ mice. The α2AP-/- mice also exhibited impairments in motor learning, working memory, spatial memory and fear conditioning memory. Furthermore, the deletion of α2AP induced anxiety-like behavior, and caused an anti-depression-like effect in tail suspension. Therefore, our findings suggest that α2AP is a crucial mediator of motor function, cognitive function, anxiety-like behavior and depression-like behavior, providing new insights into the role of α2AP in the brain functions.

  19. ACE Gene Insertion/Deletion Polymorphism and Type-2 Diabetic Nephropathy in Eastern Indian Population

    Directory of Open Access Journals (Sweden)

    Mithun Sikdar

    2013-02-01

    Full Text Available Background: Nephropathy is one of the major complications among the patients having type 1 or long term Type 2 diabetes and there are various studies that suggest its genetic predisposition. A 287 bp insertion/deletion (I/D polymorphism of the gene encoding angiotensin-I converting enzyme (ACE is shown to have association with diabetic nephropathy. Aim: To identify the association of ACE I/D polymorphism with subjects having diabetic nephropathy.Materials and methods: The present study examined the prevalence of ACE insertion/deletion polymorphism among 91 Bengali individuals from Eastern India. Among them 30 individuals belong to diabetic nephropathy (DN, 30 individuals having diabetes without nephropathy (DM and 31 normal controls. The DNA samples of studied subjects were genotyped using polymerase chain reaction.Results: The frequency of DD, ID and II genotypes in patients having diabetic nephropathy (DN were found to be 26.7%, 53.3% and 20.0% respectively, whereas the same for only diabetic patients (DM were 26.7%, 50.0%and 23.3% respectively. The frequencies of the same genotypes among the normal controls were found to be 9.68%, 64.5% and 25.8% respectively. Inspite of a slightly higher odds ratio for DD genotypes among DM and DN subjects in comparison to the normal group the distribution pattern of DD genotype did not differ significantly within the three cohorts. The frequency of D allele among the patients having diabetic nephropathy, diabetic without nephropathy and control subjects was found to be 0.533, 0.516 and 0.420 respectively. This distribution pattern also did not differ significantly (χ2=1.859, p>0.05.Conclusion: No significant association was found between ACE I/D polymorphism with diabetic nephropathy patients from Bengali caste population.

  20. Deletion of the Igf1 gene: suppressive effects on adult Leydig cell development.

    Science.gov (United States)

    Hu, Guo-Xin; Lin, Han; Chen, Guo-Rong; Chen, Bing-Bing; Lian, Qing-Quan; Hardy, Dianne O; Zirkin, Barry R; Ge, Ren-Shan

    2010-01-01

    Deletion of the insulin-like growth factor 1 (Igf1) gene was shown in previous studies to result in reduced numbers of Leydig cells in the testes of 35-day-old mice, and in reduced circulating testosterone levels. In the current study, we asked whether deletion of the Igf1 gene affects the number, proliferation, and/or steroidogenic function of some or all of the precursor cell types in the developmental sequence that leads to the establishment of adult Leydig cells (ALCs). Decreased numbers of cells in the Leydig cell lineage (ie, 3β-hydroxysteroid dehydrogenase-positive cells) were seen in testes of postnatal day (PND) 14-90 Igf1(-/-) mice compared with age-matched Igf1(+/+) controls. The development of ALCs proceeds from stem Leydig cells (SLCs) through progenitor Leydig cells (PLCs) and immature Leydig cells (ILCs). The bromodeoxyuridine labeling index of putative SLCs was similar in the Igf1(-/-) and Igf1(+/+) mice. In contrast, the labeling index of PLCs was reduced in the Igf1(-/-) mice on each day of PND 14 through PND 35, and that of more mature Leydig cells (referred to herein as LCs, a combination of ILCs plus ALCs) was reduced from PND 21 through PND 56. In Igf1(-/-) mice that received recombinant IGF-I, the labeling indices of PLCs and LCs were similar to those of age-matched Igf1(+/+) mice, indicating that the reductions in the labeling indices seen in the PLCs and LCs of the Igf1(-/-) mice were a consequence of reduced IGF-I. On each day of PND 21 through PND 90, testicular testosterone concentrations were significantly reduced in the Igf1(-/-) mice, as were the expressions of testis-specific mRNAs involved in steroidogenesis, including Star, Cyp11a1, and Cyp17a1. The increased expression of the gene for 5α-reductase (Srd5a1) in adult Igf1(-/-) testes suggests that the depletion of Igf1 might suppress or delay Leydig cell maturation. These observations, taken together, indicate that the reduced numbers of Leydig cells in the adult testes of Igf1

  1. A novel heterozygous deletion in the EVC2 gene causes Weyers acrofacial dysostosis.

    Science.gov (United States)

    Ye, Xiaoqian; Song, Guangtai; Fan, Mingwen; Shi, Lisong; Jabs, Ethylin Wang; Huang, Shangzhi; Guo, Ruiqiang; Bian, Zhuan

    2006-03-01

    Weyers acrofacial dysostosis (MIM 193530) is an autosomal dominant disorder clinically characterized by mild short stature, postaxial polydactyly, nail dystrophy and dysplastic teeth. Ellis-van Creveld syndrome (EvC, MIM 225500) is an autosomal recessive disorder with a similar, but more severe phenotype. Mutations in the EVC have been identified in both syndromes. However, the EVC mutations only occur in a small proportion of EvC patients. Recently, mutations in a new gene, EVC2, were found to be associated with other EvC cases. The EVC and EVC2 are located close to each other in a head-to-head configuration and may be functionally related. In this study, we report identification of a novel heterozygous deletion in the EVC2 that is responsible for autosomal dominant Weyers acrofacial dysostosis in a large Chinese family. This constitutes the first report of Weyers acrofacial dysostosis caused by this gene. Hence, the spectrum of malformation syndromes due to EVC2 mutations is further extended. Our data provides conclusive evidence that Weyers acrofacial dysostosis and EvC syndrome are allelic and genetically heterogeneous conditions.

  2. Metabolic flux balance analysis and the in silico analysis of Escherichia coli K-12 gene deletions

    Directory of Open Access Journals (Sweden)

    Edwards Jeremy S

    2000-07-01

    Full Text Available Abstract Background Genome sequencing and bioinformatics are producing detailed lists of the molecular components contained in many prokaryotic organisms. From this 'parts catalogue' of a microbial cell, in silico representations of integrated metabolic functions can be constructed and analyzed using flux balance analysis (FBA. FBA is particularly well-suited to study metabolic networks based on genomic, biochemical, and strain specific information. Results Herein, we have utilized FBA to interpret and analyze the metabolic capabilities of Escherichia coli. We have computationally mapped the metabolic capabilities of E. coli using FBA and examined the optimal utilization of the E. coli metabolic pathways as a function of environmental variables. We have used an in silico analysis to identify seven gene products of central metabolism (glycolysis, pentose phosphate pathway, TCA cycle, electron transport system essential for aerobic growth of E. coli on glucose minimal media, and 15 gene products essential for anaerobic growth on glucose minimal media. The in silico tpi-, zwf, and pta- mutant strains were examined in more detail by mapping the capabilities of these in silico isogenic strains. Conclusions We found that computational models of E. coli metabolism based on physicochemical constraints can be used to interpret mutant behavior. These in silica results lead to a further understanding of the complex genotype-phenotype relation. Supplementary information: http://gcrg.ucsd.edu/supplementary_data/DeletionAnalysis/main.htm

  3. Deletion in the EVC2 Gene Causes Chondrodysplastic Dwarfism in Tyrolean Grey Cattle

    Science.gov (United States)

    Murgiano, Leonardo; Jagannathan, Vidhya; Benazzi, Cinzia; Bolcato, Marilena; Brunetti, Barbara; Muscatello, Luisa Vera; Dittmer, Keren; Piffer, Christian; Gentile, Arcangelo; Drögemüller, Cord

    2014-01-01

    During the summer of 2013 seven Italian Tyrolean Grey calves were born with abnormally short limbs. Detailed clinical and pathological examination revealed similarities to chondrodysplastic dwarfism. Pedigree analysis showed a common founder, assuming autosomal monogenic recessive transmission of the defective allele. A positional cloning approach combining genome wide association and homozygosity mapping identified a single 1.6 Mb genomic region on BTA 6 that was associated with the disease. Whole genome re-sequencing of an affected calf revealed a single candidate causal mutation in the Ellis van Creveld syndrome 2 (EVC2) gene. This gene is known to be associated with chondrodysplastic dwarfism in Japanese Brown cattle, and dwarfism, abnormal nails and teeth, and dysostosis in humans with Ellis-van Creveld syndrome. Sanger sequencing confirmed the presence of a 2 bp deletion in exon 19 (c.2993_2994ACdel) that led to a premature stop codon in the coding sequence of bovine EVC2, and was concordant with the recessive pattern of inheritance in affected and carrier animals. This loss of function mutation confirms the important role of EVC2 in bone development. Genetic testing can now be used to eliminate this form of chondrodysplastic dwarfism from Tyrolean Grey cattle. PMID:24733244

  4. Characterization of a large deletion in the {beta}-globin gene cluster in a newborn with hemoglobin FE

    Energy Technology Data Exchange (ETDEWEB)

    Louie, E.; Dietz, L.; Shafer, F. [Children`s Hosptial, Oakland, CA (United States)] [and others

    1994-09-01

    A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.

  5. Entire CAPN3 gene deletion in a patient with limb-girdle muscular dystrophy type 2A.

    Science.gov (United States)

    Jaka, Oihane; Azpitarte, Margarita; Paisán-Ruiz, Coro; Zulaika, Miren; Casas-Fraile, Leire; Sanz, Raúl; Trevisiol, Nathalie; Levy, Nicolas; Bartoli, Marc; Krahn, Martin; López de Munain, Adolfo; Sáenz, Amets

    2014-09-01

    Limb-girdle muscular dystrophy type 2A (LGMD2A) due to mutations in the CAPN3 gene is one of the most common of autosomal recessive limb-girdle muscular dystrophies. We describe a patient who had a typical LGMD2A phenotype and posterior compartment involvement on MRI. Different genetic analyses were performed, including microarray analysis. There was an apparently homozygous mutation in exon 24, c.2465G>T, p.(*822Leuext62*), and a lack of correlation in the disease segregation analyses. This suggested the presence of a genomic rearrangement. In fact, a heterozygous deletion of the entire CAPN3 gene was found. This novel deletion comprised the terminal region of the GANC gene and the entire CAPN3 gene. This finding points out the need to reconsider and adapt our current strategy of molecular diagnosis in order to detect these types of genomic rearrangements that escape standard mutation screening procedures.

  6. [Two base deletion of the alpha (1,2) fucosyltransferase gene responsible for para-Bombay phenotype].

    Science.gov (United States)

    Zhu, Fa-ming; Xu, Xian-guo; Hong, Xiao-zhen; Yan, Li-xing

    2004-06-01

    To probe into the molecular genetics basis for para-Bombay phenotype. Red blood cell phenotype of the proband was characterized by serological techniques. Exons 6 and 7 of ABO gene, the entire coding region of alpha(1,2) fucosyltransferase (FUT1) gene and FUT2 gene were amplified by polymerase chain reaction (PCR) from genomic DNA of the proband respectively. The PCR products were excised and purified from agarose gels and were directly sequenced. AG at 547-552 deletion homozygous allele was found in the proband, which caused a reading frame shift and a premature stop codon. Parents of proband were heterozygous carriers. Two base deletion at position 547-552 of alpha (1,2) fucosyltransferase gene may cause para-Bombay phenotype.

  7. Identification of a deletion in the mismatch repair gene, MSH2, using mouse-human cell hybrids monosomal for chromosome 2.

    Science.gov (United States)

    Pyatt, R E; Nakagawa, H; Hampel, H; Sedra, M; Fuchik, M B; Comeras, I; de la Chapelle, A; Prior, T W

    2003-03-01

    Hereditary non-polyposis colorectal cancer is characterized by mutations in one of the DNA mismatch repair genes, primarily MLH1, MSH2, or MSH6. We report here the identification of a genomic deletion of approximately 11.4 kb encompassing the first two exons of the MSH2 gene in two generations of an Ohio family. By Southern blot analysis, using a cDNA probe spanning the first seven exons of MSH2, an alteration in each of three different enzyme digests (including a unique 13-kb band on HindIII digests) was observed, which suggested the presence of a large alteration in the 5' region of this gene. Mouse-human cell hybrids from a mutation carrier were then generated which contained a single copy each of human chromosome 2 on which the MSH2 gene resides. Southern blots on DNA from the cell hybrids demonstrated the same, unique 13-kb band from one MSH2 allele, as seen in the diploid DNA. DNA from this same monosomal cell hybrid failed to amplify in polymerase chain reactions (PCRs) using primers to exons 1 and 2, demonstrating the deletion of these sequences in one MSH2 allele, and the breakpoints involving Alu repeats were identified by PCR amplification and sequence analysis.

  8. Saethre-Chotzen syndrome and hyper IgE syndrome in a patient with a novel 11 bp deletion of the TWIST gene.

    Science.gov (United States)

    Boeck, A; Kosan, C; Ciznar, P; Kunz, J

    2001-11-15

    Molecular genetic studies in a seven-year-old boy and his mother demonstrated a novel 11 bp deletion in the TWIST gene (127del11), causing Saethre-Chotzen syndrome. The mother had rather mild signs of the Saethre-Chotzen syndrome; however, her son presented with marked acrocephalosyndactyly type 3, leading to craniotomy at three years. He also had recurrent infections and laboratory findings comparable with the hyper IgE syndrome, a rare primary immunodeficiency disorder. It is likely that the 11bp deletion caused the Saethre-Chotzen syndrome in the patient and his mother, and another, not yet identified genetic defect, seen in the patient but not in the mother, is responsible for the hyper IgE phenotype. A combination of these two congenital conditions has not been described to date.

  9. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  10. A Self-deleting Cre-lox-ermAM Cassette, CHESHIRE, for marker-less gene deletion in Streptococcus pneumoniae

    Science.gov (United States)

    Weng, Liming; Biswas, Indranil; Morrison, Donald A.

    2009-01-01

    Although targeted mutagenesis of Streptococcus pneumoniae is readily accomplished with the aid of natural genetic transformation and chimeric donor DNA constructs assembled in vitro, the drug resistance markers often employed for selection of recombinant products can themselves be undesirable by-products of the genetic manipulation. A new cassette carrying the erythromycin-resistance marker ermAM is described that can be used as a temporary marker for selection of desired recombinants. The cassette may subsequently be removed at will by virtue of an embedded fucose-regulated Cre recombinase gene and terminal lox66 and lox71 Cre recognition sites, with retention of 34 bp from the cassette as an inert residual double-mutant lox72 site. PMID:19850089

  11. RCSD1-ABL1 Translocation Associated with IKZF1 Gene Deletion in B-Cell Acute Lymphoblastic Leukemia

    Directory of Open Access Journals (Sweden)

    Shawana Kamran

    2015-01-01

    Full Text Available The RCSD1 gene has recently been identified as a novel gene fusion partner of the ABL1 gene in cases of B-cell Acute Lymphoblastic Leukemia (B-ALL. The RCSD1 gene is located at 1q23 and ABL1 is located at 9q34, so that the RCSD1-ABL1 fusion typically arises through a rare reciprocal translocation t(1;9(q23;q34. Only a small number of RCSD1-ABL1 positive cases of B-ALL have been described in the literature, and the full spectrum of clinical, morphological, immunophenotypic, and molecular features associated with this genetic abnormality has not been defined. We describe extensive genetic characterization of a case of B-ALL with RCSD1-ABL1 fusion, by using conventional cytogenetic analysis, Fluorescence In Situ Hybridization (FISH studies, and Chromosomal Microarray Analysis (CMA. The use of CMA resulted in detection of an approximately 70 kb deletion at 7p12.2, which caused a disruption of the IKZF1 gene. Deletions and mutations of IKZF1 are recurring abnormalities in B-ALL and are associated with a poor prognosis. Our findings highlight the association of the deletion of IKZF1 gene with the t(1;9(q24;q34 and illustrate the importance of comprehensive cytogenetic and molecular evaluation for accurate prediction of prognosis in patients with B-cell ALL.

  12. Deletion of twenty seven nucleotides within exon 11 of the band 3 gene identified in ovalocytosis in Lombok Island, Indonesia.

    Science.gov (United States)

    Alimsardjono, H; Mukono, I S; Dachlan, Y P; Matsuo, M

    1997-03-01

    This study reports the molecular characterization of ovalocytosis in Lombok Island, Indonesia. The analysis of genomic DNA by polymerase chain reaction shows that all 21 ovalocytotic individuals have two amplified products of different size from a region encompassing exon 11 of the band 3 gene. The sequence of the larger product matched perfectly with that of normal individuals. In the sequence of the smaller product, 27 nucleotides within exon 11 were deleted. The heterozygous presence of the deletion identified in other parts of Southeast Asia was confirmed in patients with ovalocytosis in an isolated island of eastern Indonesia.

  13. Effects of deletion of different PP2C protein phosphatase genes on stress responses in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sharmin, Dilruba; Sasano, Yu; Sugiyama, Minetaka; Harashima, Satoshi

    2014-10-01

    A key mechanism of signal transduction in eukaryotes is reversible protein phosphorylation, mediated through protein kinases and protein phosphatases (PPases). Modulation of signal transduction by this means regulates many biological processes. Saccharomyces cerevisiae has 40 PPases, including seven protein phosphatase 2C (PP2C PPase) genes (PTC1-PTC7). However, their precise functions remain poorly understood. To elucidate their cellular functions and to identify those that are redundant, we constructed 127 strains with deletions of all possible combinations of the seven PP2C PPase genes. All 127 disruptants were viable under nutrient-rich conditions, demonstrating that none of the combinations induced synthetic lethality under these conditions. However, several combinations exhibited novel phenotypes, e.g. the Δptc5Δptc7 double disruptant and the Δptc2Δptc3Δptc5Δptc7 quadruple disruptant exhibited low (13°C) and high (37°C) temperature-sensitive growth, respectively. Interestingly, the septuple disruptant Δptc1Δptc2Δptc3Δptc4Δptc5Δptc6Δptc7 showed an essentially normal growth phenotype at 37°C. The Δptc2Δptc3Δptc5Δptc7 quadruple disruptant was sensitive to LiCl (0.4 m). Two double disruptants, Δptc1Δptc2 and Δptc1Δptc4, displayed slow growth and Δptc1Δptc2Δptc4 could not grow on medium containing 1.5 m NaCl. The Δptc1Δptc6 double disruptant showed increased sensitivity to caffeine, congo red and calcofluor white compared to each single deletion. Our observations indicate that S. cerevisiae PP2C PPases have a shared and important role in responses to environmental stresses. These disruptants also provide a means for exploring the molecular mechanisms of redundant PTC gene functions under defined conditions.

  14. Improving the MVA vaccine potential by deleting the viral gene coding for the IL-18 binding protein.

    Directory of Open Access Journals (Sweden)

    Juliana Falivene

    Full Text Available BACKGROUND: Modified Vaccinia Ankara (MVA is an attenuated strain of Vaccinia virus (VACV currently employed in many clinical trials against HIV/AIDS and other diseases. MVA still retains genes involved in host immune response evasion, enabling its optimization by removing some of them. The aim of this study was to evaluate cellular immune responses (CIR induced by an IL-18 binding protein gene (C12L deleted vector (MVAΔC12L. METHODOLOGY/PRINCIPAL FINDINGS: BALB/c and C57BL/6 mice were immunized with different doses of MVAΔC12L or MVA wild type (MVAwt, then CIR to VACV epitopes in immunogenic proteins were evaluated in spleen and draining lymph nodes at acute and memory phases (7 and 40 days post-immunization respectively. Compared with parental MVAwt, MVAΔC12L immunization induced a significant increase of two to three-fold in CD8(+ and CD4(+ T-cell responses to different VACV epitopes, with increased percentage of anti-VACV cytotoxic CD8(+ T-cells (CD107a/b(+ during the acute phase of the response. Importantly, the immunogenicity enhancement was also observed after MVAΔC12L inoculation with different viral doses and by distinct routes (systemic and mucosal. Potentiation of MVA's CIR was also observed during the memory phase, in correlation with a higher protection against an intranasal challenge with VACV WR. Of note, we could also show a significant increase in the CIR against HIV antigens such as Env, Gag, Pol and Nef from different subtypes expressed from two recombinants of MVAΔC12L during heterologous DNA prime/MVA boost vaccination regimens. CONCLUSIONS/SIGNIFICANCE: This study demonstrates the relevance of IL-18 bp contribution in the immune response evasion during MVA infection. Our findings clearly show that the deletion of the viral IL-18 bp gene is an effective approach to increase MVA vaccine efficacy, as immunogenicity improvements were observed against vector antigens and more importantly to HIV antigens.

  15. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    Directory of Open Access Journals (Sweden)

    Paige A Winkler

    Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

  16. The chromatin "landscape" of a murine adult β-globin gene is unaffected by deletion of either the gene promoter or a downstream enhancer.

    Directory of Open Access Journals (Sweden)

    Brenda Cadiz-Rivera

    Full Text Available In mammals, the complex tissue- and developmental-specific expression of genes within the β-globin cluster is known to be subject to control by the gene promoters, by a locus control region (LCR located upstream of the cluster, and by sequence elements located across the intergenic regions. Despite extensive investigation, however, the complement of sequences that is required for normal regulation of chromatin structure and gene expression within the cluster is not fully defined. To further elucidate regulation of the adult β-globin genes, we investigate the effects of two deletions engineered within the endogenous murine β-globin locus. First, we find that deletion of the β2-globin gene promoter, while eliminating β2-globin gene expression, results in no additional effects on chromatin structure or gene expression within the cluster. Notably, our observations are not consistent with competition among the β-globin genes for LCR activity. Second, we characterize a novel enhancer located 3' of the β2-globin gene, but find that deletion of this sequence has no effect whatsoever on gene expression or chromatin structure. This observation highlights the difficulty in assigning function to enhancer sequences identified by the chromatin "landscape" or even by functional assays.

  17. The Chromatin “Landscape” of a Murine Adult β-Globin Gene Is Unaffected by Deletion of Either the Gene Promoter or a Downstream Enhancer

    Science.gov (United States)

    Cadiz-Rivera, Brenda; Fromm, George; de Vries, Christina; Fields, Jennifer; McGrath, Kathleen E.; Fiering, Steven; Bulger, Michael

    2014-01-01

    In mammals, the complex tissue- and developmental-specific expression of genes within the β-globin cluster is known to be subject to control by the gene promoters, by a locus control region (LCR) located upstream of the cluster, and by sequence elements located across the intergenic regions. Despite extensive investigation, however, the complement of sequences that is required for normal regulation of chromatin structure and gene expression within the cluster is not fully defined. To further elucidate regulation of the adult β-globin genes, we investigate the effects of two deletions engineered within the endogenous murine β-globin locus. First, we find that deletion of the β2-globin gene promoter, while eliminating β2-globin gene expression, results in no additional effects on chromatin structure or gene expression within the cluster. Notably, our observations are not consistent with competition among the β-globin genes for LCR activity. Second, we characterize a novel enhancer located 3′ of the β2-globin gene, but find that deletion of this sequence has no effect whatsoever on gene expression or chromatin structure. This observation highlights the difficulty in assigning function to enhancer sequences identified by the chromatin “landscape” or even by functional assays. PMID:24817273

  18. The chromatin "landscape" of a murine adult β-globin gene is unaffected by deletion of either the gene promoter or a downstream enhancer.

    Science.gov (United States)

    Cadiz-Rivera, Brenda; Fromm, George; de Vries, Christina; Fields, Jennifer; McGrath, Kathleen E; Fiering, Steven; Bulger, Michael

    2014-01-01

    In mammals, the complex tissue- and developmental-specific expression of genes within the β-globin cluster is known to be subject to control by the gene promoters, by a locus control region (LCR) located upstream of the cluster, and by sequence elements located across the intergenic regions. Despite extensive investigation, however, the complement of sequences that is required for normal regulation of chromatin structure and gene expression within the cluster is not fully defined. To further elucidate regulation of the adult β-globin genes, we investigate the effects of two deletions engineered within the endogenous murine β-globin locus. First, we find that deletion of the β2-globin gene promoter, while eliminating β2-globin gene expression, results in no additional effects on chromatin structure or gene expression within the cluster. Notably, our observations are not consistent with competition among the β-globin genes for LCR activity. Second, we characterize a novel enhancer located 3' of the β2-globin gene, but find that deletion of this sequence has no effect whatsoever on gene expression or chromatin structure. This observation highlights the difficulty in assigning function to enhancer sequences identified by the chromatin "landscape" or even by functional assays.

  19. A novel 30 bp deletion in the FOXL2 gene in a phenotypically normal woman with primary amenorrhoea: case report.

    Science.gov (United States)

    Gersak, Ksenija; Harris, Sarah E; Smale, Wendy J; Shelling, Andrew N

    2004-12-01

    In a Slovene patient with primary amenorrhoea without an association with blepharophimosis/ptosis/epicanthus inversus syndrome (BPES), a novel 30 bp deletion was identified in the FOXL2 gene. We report the clinical features of this woman who has spontaneously conceived and delivered two live healthy babies. The novel deletion was predicted to remove 10 out of 14 alanines (A221_A230del), from the polyalanine tract downstream of the winged helix/forkhead domain of the FOXL2 protein. The patient's parents and sister were shown not to carry this deletion. Despite seeing an anovulatory secretory pattern of FSH, follicles developed spontaneously. Persistent and consistent monitoring have practical implications for genetic and fertility counselling in the era when women with premature ovarian failure usually seek ovum donation. The role of FOXL2 in the development of infertility is still unclear, but several lines of evidence suggest that it plays a central role in follicle development.

  20. A Novel Deletion Mutation of the TYR Gene in a Patient With Oculocutaneous Albinism Type 1A

    Directory of Open Access Journals (Sweden)

    Talebi

    2016-01-01

    Full Text Available Introduction Oculocutaneous albinism (OCA is a genetically heterogeneous autosomal recessive genetic disorder that is characterized by reduced or completely absent pigmentation in the hair, skin, and eyes. Case Presentation In the present study, in order to verify OCA type 1A in a patient with clinical symptoms, and to study the variations of the TYR gene for the first time in southwest Iran, this gene was entirely sequenced. Conclusions A novel homozygous mutation, the deletion of exons 1 - 5 on the TYR gene, was found on the molecular genetic testing of this patient. Exon 1 - 5 deletion on TYR causes a lack of the tyrosinase enzyme and disturbs the melanin biosynthesis process.

  1. A novel deletion/insertion caused by a replication error in the β-globin gene locus control region.

    Science.gov (United States)

    Joly, Philippe; Lacan, Philippe; Garcia, Caroline; Meley, Roland; Pondarré, Corinne; Francina, Alain

    2011-01-01

    Deletions in the β-globin locus control region (β-LCR) lead to (εγδβ)(0)-thalassemia [(εγδβ)(0)-thal]. In patients suffering from these rare deletions, a normal hemoglobin (Hb), phenotype is found, contrasting with a hematological thalassemic phenotype. Multiplex-ligation probe amplification (MLPA) is an efficient tool to detect β-LCR deletions combined with long-range polymerase chain reaction (PCR) and DNA sequencing to pinpoint deletion breakpoints. We present here a novel 11,155 bp β-LCR deletion found in a French Caucasian patient which removes DNase I hypersensitive site 2 (HS2) to HS4 of the β-LCR. Interestingly, a 197 bp insertion of two inverted sequences issued from the HS2-HS3 inter-region is present and suggests a complex rearrangement during replication. Carriers of this type of thalassemia can be misdiagnosed as an α-thal trait. Consequently, a complete α- and β-globin gene cluster analysis is required to prevent a potentially damaging misdiagnosis in genetic counselling.

  2. Hereditary fructose intolerance: functional study of two novel ALDOB natural variants and characterization of a partial gene deletion.

    Science.gov (United States)

    Esposito, Gabriella; Imperato, Maria Rosaria; Ieno, Luigi; Sorvillo, Rosa; Benigno, Vincenzo; Parenti, Giancarlo; Parini, Rossella; Vitagliano, Luigi; Zagari, Adriana; Salvatore, Francesco

    2010-12-01

    Hereditary fructose intolerance (HFI) is an autosomal recessive metabolic disease caused by impaired functioning of human liver aldolase (ALDOB). At least 54 subtle/point mutations and only two large intragenic deletions have been found in the ALDOB gene. Here we report two novel ALDOB variants (p.R46W and p.Y343H) and an intragenic deletion that we found in patients with suspected HFI. The residual catalytic activity of the recombinant p.R46W and p.Y343H variants toward F1P was particularly altered. We also characterized a large intragenic deletion that we found in six unrelated patients. This is the first report of six unrelated patients sharing the same ALDOB deletion, thus indicating a founder effect for this allele in our geographic area. Because this deletion involves ALDOB exon 5, it can mimic worldwide common pathogenic genotypes, that is, homozygous p.A150P and p.A175D. Finally, the identification of only one ALDOB mutation in symptomatic patients suggests that HFI symptoms can, albeit rarely, appear also in heterozygotes. Therefore, an excessive and continuous fructose dietary intake may have deleterious effects even in apparently asymptomatic HFI carriers.

  3. Deletion of cagA gene of Helicobacter pylori by PCR products

    Institute of Scientific and Technical Information of China (English)

    Xun Zeng; Li-Hua He; Yan Yin; Mao-Jun Zhang; Jian-Zhong Zhang

    2005-01-01

    AIM: Cytotoxin-associated protein (antigen) A (CagA)plays an important role in Helicobacter pylori(H pylori)pathogenesis. Our aim was to obtain cagA mutant strains by a new mutation method so as to better understand the mechanism of CagA in epithelial cells. METHODS: In contrast with the traditional method using suicide plasmid, we constructed cagA- mutant strains directly with PCR products. The constructed mutant clones grew on selective media and allelic exchange was confirmed by Southern blot. Furthermore, two different transformation methods, electroporation, and natural transformation, were compared with regard to the efficiency of recombination.RESULTS: The mutation by PCR products could be completed within 3-5 d, and the recombination rate by electroporation and natural transformation was 4.02×10-8 and 1.03x 10-9 respectively. Mutation rate by electroporation (4.02× 10-8) was far higher than by natural transformation (1.03× 10-9) (P = 0.000<0.005).CONCLUSION: cagA- mutant strains have been constructed,which is important for further study on the function of CagA in epithelial cells. A mutation method by directly using PCR products has been proved successful with a much higher mutation rate, and is easier, especially when in combination with electroporation. This method could be widely used in gene deletion of H pylori.

  4. Safety and vaccine efficacy of an attenuated Vibrio vulnificus strain with deletions in major cytotoxin genes.

    Science.gov (United States)

    Kim, Young Ran; Lee, Shee Eun; Kim, Jong Ro; Rhee, Joon Haeng

    2015-12-01

    Vibrio vulnificus is a human pathogen causing a rapidly progressing fatal septicemia. We have previously reported that a V. vulnificus large toxin RtxA1 causes programmed necrotic cell death through calcium-mediated mitochondrial dysfunction. Here we developed a live attenuated vaccine strain (CMM781) having deletions in three genes encoding major virulence factors: RTX cytotoxin (rtxA1), hemolysin/cytolysin (vvhA) and metalloprotease (vvpE) of a clinical isolate strain CMCP6. The CMM781 strain showed significant attenuation in cytotoxicity and mouse lethality. The safety of CMM781 was also confirmed by measuring the transepithelial electric resistance of Caco-2 cell monolayers. Intragastric immunization of mice with the live attenuated V. vulnificus strain resulted in induction of systemic and mucosal antibodies specific to the pathogen. Moreover, the vaccinated mice were protected from challenges with high doses of the virulent strain through various injection routes. These results suggest that CMM781 appears to be a safe and effective vaccine candidate that would provide significant protection against V. vulnificus infection.

  5. Deletion of A44L, A46R and C12L Vaccinia Virus Genes from the MVA Genome Improved the Vector Immunogenicity by Modifying the Innate Immune Response Generating Enhanced and Optimized Specific T-Cell Responses

    Directory of Open Access Journals (Sweden)

    María Pía Holgado

    2016-05-01

    Full Text Available MVA is an attenuated vector that still retains immunomodulatory genes. We have previously reported its optimization after deleting the C12L gene, coding for the IL-18 binding-protein. Here, we analyzed the immunogenicity of MVA vectors harboring the simultaneous deletion of A44L, related to steroid synthesis and A46R, a TLR-signaling inhibitor (MVAΔA44L-A46R; or also including a deletion of C12L (MVAΔC12L/ΔA44L-A46R. The absence of biological activities of the deleted genes in the MVA vectors was demonstrated. Adaptive T-cell responses against VACV epitopes, evaluated in spleen and draining lymph-nodes of C57Bl/6 mice at acute/memory phases, were of higher magnitude in those animals that received deleted MVAs compared to MVAwt. MVAΔC12L/ΔA44L-A46R generated cellular specific memory responses of higher quality characterized by bifunctionality (CD107a/b+/IFN-γ+ and proliferation capacity. Deletion of selected genes from MVA generated innate immune responses with higher levels of determining cytokines related to T-cell response generation, such as IL-12, IFN-γ, as well as IL-1β and IFN-β. This study describes for the first time that simultaneous deletion of the A44L, A46R and C12L genes from MVA improved its immunogenicity by enhancing the host adaptive and innate immune responses, suggesting that this approach comprises an appropriate strategy to increase the MVA vaccine potential.

  6. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P

    2004-01-01

    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  7. Deletion of gene encoding methyltransferase (gidB) confers high-level antimicrobial resistance in Salmonella.

    Science.gov (United States)

    Mikheil, Dareen M; Shippy, Daniel C; Eakley, Nicholas M; Okwumabua, Ogi E; Fadl, Amin A

    2012-04-01

    The glucose-inhibited division gene (gid)B, which resides in the gid operon, was thought to have a role in the modulation of genes similar to that of gidA. Recent studies have indicated that GidB is a methyltransferase enzyme that is involved in the methylation of the 16S ribosomal RNA (rRNA) in Escherichia coli. In this study, we investigated the role of GidB in susceptibility to antibiotics and the overall biology of Salmonella. A gidB isogenic mutant of Salmonella was constructed and subsequently characterized under different conditions. Our data indicated that growth and invasion characteristics of the gidB mutant were similar to those of the wild type (WT). The gidB mutant was outgrown by the WT in a competitive growth assay, indicating a compromised overall bacterial fitness. Under the stress of nalidixic acid, the gidB mutant's motility was significantly reduced. Similarly, the mutant showed a filamentous morphology and smaller colony size compared with the rod-shaped and large colonies of the WT in the presence of nalidixic acid. Most importantly, deletion of gidB conferred high-level resistance to the aminoglycoside antibiotics streptomycin and neomycin. A primer extension assay determined the methylation site for the WT to be at G527 of the 16S rRNA. A lack of methylation in the mutant indicated that GidB is required for this methylation. Taken together, these data indicate that the GidB enzyme has a significant role in the alteration of antibiotic susceptibility and the modulation of growth and morphology under stress conditions in Salmonella.

  8. Hereditary spherocytosis associated with deletion of human erythrocyte ankyrin gene on chromosome 8.

    Science.gov (United States)

    Lux, S E; Tse, W T; Menninger, J C; John, K M; Harris, P; Shalev, O; Chilcote, R R; Marchesi, S L; Watkins, P C; Bennett, V

    1990-06-21

    Hereditary spherocytosis (HS) is one of the most common hereditary haemolytic anaemias. HS red cells from both autosound dominant and recessive variants are spectrin-deficient, which correlates with the severity of the disease. Some patients with recessive HS have a mutation in the spectrin alpha-2 domain (S.L.M. et al., unpublished observations), and a few dominant HS patients have an unstable beta-spectrin that is easily oxidized, which damages the protein 4.1 binding site and weakens spectrin-actin interactions. In most patients, however, the cause of spectrin deficiency is unknown. The alpha- and beta-spectrin loci are on chromosomes 1 and 14 respectively. The only other genetic locus for HS is SPH2, on the short arm of chromosome 8 (8p11). This does not correspond to any of the known loci of genes for red cell membrane proteins including protein 4.1 (1p36.2-p34), the anion exchange protein (AE1, band 3; 17q21-qter), glycophorin C (2q14-q21), and beta-actin (7pter-q22). Human erythrocyte ankyrin, which links beta-spectrin to the anion exchange protein, has recently been cloned. We now show that the ankyrin gene maps to chromosome 8p11.2, and that one copy is missing from DNA of two unrelated children with severe HS and heterozygous deletions of chromosome 8 (del(8)(p11-p21.1)). Affected red cells are also ankyrin-deficient. The data suggest that defects or deficiency or ankyrin are responsible for HS at the SPH2 locus.

  9. Gene Deletions Resulting in Increased Nitrogen Release by Azotobacter vinelandii: Application of a Novel Nitrogen Biosensor

    Science.gov (United States)

    Eberhart, Lauren J.; Ohlert, Janet M.; Knutson, Carolann M.; Plunkett, Mary H.

    2015-01-01

    Azotobacter vinelandii is a widely studied model diazotrophic (nitrogen-fixing) bacterium and also an obligate aerobe, differentiating it from many other diazotrophs that require environments low in oxygen for the function of the nitrogenase. As a free-living bacterium, A. vinelandii has evolved enzymes and transporters to minimize the loss of fixed nitrogen to the surrounding environment. In this study, we pursued efforts to target specific enzymes and further developed screens to identify individual colonies of A. vinelandii producing elevated levels of extracellular nitrogen. Targeted deletions were done to convert urea into a terminal product by disrupting the urease genes that influence the ability of A. vinelandii to recycle the urea nitrogen within the cell. Construction of a nitrogen biosensor strain was done to rapidly screen several thousand colonies disrupted by transposon insertional mutagenesis to identify strains with increased extracellular nitrogen production. Several disruptions were identified in the ammonium transporter gene amtB that resulted in the production of sufficient levels of extracellular nitrogen to support the growth of the biosensor strain. Further studies substituting the biosensor strain with the green alga Chlorella sorokiniana confirmed that levels of nitrogen produced were sufficient to support the growth of this organism when the medium was supplemented with sufficient sucrose to support the growth of the A. vinelandii in coculture. The nature and quantities of nitrogen released by urease and amtB disruptions were further compared to strains reported in previous efforts that altered the nifLA regulatory system to produce elevated levels of ammonium. These results reveal alternative approaches that can be used in various combinations to yield new strains that might have further application in biofertilizer schemes. PMID:25888177

  10. Biological and virulence characteristics of Salmonella enterica serovar Typhimurium following deletion of glucose-inhibited division (gidA) gene.

    Science.gov (United States)

    Shippy, Daniel C; Eakley, Nicholas M; Bochsler, Philip N; Chopra, Ashok K; Fadl, Amin A

    2011-06-01

    Salmonella enterica serovar Typhimurium is a frequent cause of enteric disease due to the consumption of contaminated food. Identification and characterization of bacterial factors involved in Salmonella pathogenesis would help develop effective strategies for controlling salmonellosis. To investigate the role of glucose-inhibited division gene (gidA) in Salmonella virulence, we constructed a Salmonella mutant strain in which gidA was deleted. Deletion of gidA rendered Salmonella deficient in the invasion of intestinal epithelial cells, bacterial motility, intracellular survival, and induction of cytotoxicity in host cells. Deletion of gidA rendered the organism to display a filamentous morphology compared to the normal rod-shaped nature of Salmonella. Furthermore, a significant attenuation in the induction of inflammatory cytokines and chemokines, histopathological lesions, and systemic infection was observed in mice infected with the gidA mutant. Most importantly, a significant increase in LD(50) was observed in mice infected with the gidA mutant, and mice immunized with the gidA mutant were able to survive a lethal dose of wild-type Salmonella. Additionally, deletion of gidA significantly altered the expression of several bacterial factors associated with pathogenesis as indicated by global transcriptional and proteomic profiling. Taken together, our data indicate GidA as a potential regulator of Salmonella virulence genes.

  11. Functional analysis of the PsbX protein by deletion of the corresponding gene in Synechocystis sp. PCC 6803.

    Science.gov (United States)

    Funk, C

    2000-12-01

    The psbX gene (sml0002) coding for a 4.1 kDa protein in Photosystem II of plants and cyanobacteria was deleted in both wild type and in a Photosystem I-less mutant of the cyanobacterium Synechocystis sp. PCC 6803. Polymerase chain reaction and sequencing analysis showed that the mutants had completely segregated. Deletion of the PsbX protein does not seem to influence growth rate, electron transport or water oxidation ability. Whereas a high light induction of the psbX mRNA could be observed in wild type, deletion of the gene did not lead to high light sensibility. Light saturation measurements and 77K fluorescence measurements indicated a minor disconnection of the antenna in the deletion mutant. Furthermore, fluorescence induction measurements as well as immuno-staining of the D1 protein showed that the amount of Photosystem II complexes in the mutants was reduced by 30%. Therefore, PsbX does not seem to be necessary for the Photosystem II electron transport, but directly or indirectly involved in the regulation of the amount of functionally active Photosystem II centres in Synechocystis sp. PCC 6803.

  12. Delineation of candidate genes responsible for structural brain abnormalities in patients with terminal deletions of chromosome 6q27.

    Science.gov (United States)

    Peddibhotla, Sirisha; Nagamani, Sandesh C S; Erez, Ayelet; Hunter, Jill V; Holder, J Lloyd; Carlin, Mary E; Bader, Patricia I; Perras, Helene M F; Allanson, Judith E; Newman, Leslie; Simpson, Gayle; Immken, LaDonna; Powell, Erin; Mohanty, Aaron; Kang, Sung-Hae L; Stankiewicz, Pawel; Bacino, Carlos A; Bi, Weimin; Patel, Ankita; Cheung, Sau W

    2015-01-01

    Patients with terminal deletions of chromosome 6q present with structural brain abnormalities including agenesis of corpus callosum, hydrocephalus, periventricular nodular heterotopia, and cerebellar malformations. The 6q27 region harbors genes that are important for the normal development of brain and delineation of a critical deletion region for structural brain abnormalities may lead to a better genotype-phenotype correlation. We conducted a detailed clinical and molecular characterization of seven unrelated patients with deletions involving chromosome 6q27. All patients had structural brain abnormalities. Using array comparative genomic hybridization, we mapped the size, extent, and genomic content of these deletions. The smallest region of overlap spans 1.7 Mb and contains DLL1, THBS2, PHF10, and C6orf70 (ERMARD) that are plausible candidates for the causation of structural brain abnormalities. Our study reiterates the importance of 6q27 region in normal development of brain and helps identify putative genes in causation of structural brain anomalies.

  13. Upon Accounting for the Impact of Isoenzyme Loss, Gene Deletion Costs Anticorrelate with Their Evolutionary Rates.

    Science.gov (United States)

    Jacobs, Christopher; Lambourne, Luke; Xia, Yu; Segrè, Daniel

    2017-01-01

    System-level metabolic network models enable the computation of growth and metabolic phenotypes from an organism's genome. In particular, flux balance approaches have been used to estimate the contribution of individual metabolic genes to organismal fitness, offering the opportunity to test whether such contributions carry information about the evolutionary pressure on the corresponding genes. Previous failure to identify the expected negative correlation between such computed gene-loss cost and sequence-derived evolutionary rates in Saccharomyces cerevisiae has been ascribed to a real biological gap between a gene's fitness contribution to an organism "here and now" and the same gene's historical importance as evidenced by its accumulated mutations over millions of years of evolution. Here we show that this negative correlation does exist, and can be exposed by revisiting a broadly employed assumption of flux balance models. In particular, we introduce a new metric that we call "function-loss cost", which estimates the cost of a gene loss event as the total potential functional impairment caused by that loss. This new metric displays significant negative correlation with evolutionary rate, across several thousand minimal environments. We demonstrate that the improvement gained using function-loss cost over gene-loss cost is explained by replacing the base assumption that isoenzymes provide unlimited capacity for backup with the assumption that isoenzymes are completely non-redundant. We further show that this change of the assumption regarding isoenzymes increases the recall of epistatic interactions predicted by the flux balance model at the cost of a reduction in the precision of the predictions. In addition to suggesting that the gene-to-reaction mapping in genome-scale flux balance models should be used with caution, our analysis provides new evidence that evolutionary gene importance captures much more than strict essentiality.

  14. Deletion of the MBII-85 snoRNA gene cluster in mice results in postnatal growth retardation.

    Directory of Open Access Journals (Sweden)

    Boris V Skryabin

    2007-12-01

    Full Text Available Prader-Willi syndrome (PWS [MIM 176270] is a neurogenetic disorder characterized by decreased fetal activity, muscular hypotonia, failure to thrive, short stature, obesity, mental retardation, and hypogonadotropic hypogonadism. It is caused by the loss of function of one or more imprinted, paternally expressed genes on the proximal long arm of chromosome 15. Several potential PWS mouse models involving the orthologous region on chromosome 7C exist. Based on the analysis of deletions in the mouse and gene expression in PWS patients with chromosomal translocations, a critical region (PWScr for neonatal lethality, failure to thrive, and growth retardation was narrowed to the locus containing a cluster of neuronally expressed MBII-85 small nucleolar RNA (snoRNA genes. Here, we report the deletion of PWScr. Mice carrying the maternally inherited allele (PWScr(m-/p+ are indistinguishable from wild-type littermates. All those with the paternally inherited allele (PWScr(m+/p- consistently display postnatal growth retardation, with about 15% postnatal lethality in C57BL/6, but not FVB/N crosses. This is the first example in a multicellular organism of genetic deletion of a C/D box snoRNA gene resulting in a pronounced phenotype.

  15. Genome-wide screening for genes whose deletions confer sensitivity to mutagenic purine base analogs in yeast

    Directory of Open Access Journals (Sweden)

    Kozmin Stanislav G

    2005-06-01

    Full Text Available Abstract Background N-hydroxylated base analogs, such as 6-hydroxylaminopurine (HAP and 2-amino-6-hydroxylaminopurine (AHA, are strong mutagens in various organisms due to their ambiguous base-pairing properties. The systems protecting cells from HAP and related noncanonical purines in Escherichia coli include specialized deoxyribonucleoside triphosphatase RdgB, DNA repair endonuclease V, and a molybdenum cofactor-dependent system. Fewer HAP-detoxification systems have been identified in yeast Saccharomyces cerevisiae and other eukaryotes. Cellular systems protecting from AHA are unknown. In the present study, we performed a genome-wide search for genes whose deletions confer sensitivity to HAP and AHA in yeast. Results We screened the library of yeast deletion mutants for sensitivity to the toxic and mutagenic action of HAP and AHA. We identified novel genes involved in the genetic control of base analogs sensitivity, including genes controlling purine metabolism, cytoskeleton organization, and amino acid metabolism. Conclusion We developed a method for screening the yeast deletion library for sensitivity to the mutagenic and toxic action of base analogs and identified 16 novel genes controlling pathways of protection from HAP. Three of them also protect from AHA.

  16. A novel deletion mutation in ASPM gene in an Iranian family with autosomal recessive primary microcephaly

    Directory of Open Access Journals (Sweden)

    Elinaz AKBARIAZAR

    2013-06-01

    Full Text Available How to Cite This Article: Akbarizar E, Ebrahimpour M, Akbari S, Arzhanghi S, Abedini SS, Najmabadi H, Kahrizi K. A Novel Deletion Mutation in ASPM Gene in an Iranian Family with Autosomal Recessive Primary Microcephaly. Iran J Child Neurol.  2013 Spring;7(2:23-30. ObjectiveAutosomal recessive primary microcephaly (MCPH is a neurodevelopmental and genetically heterogeneous disorder with decreased head circumference due to the abnormality in fetal brain growth. To date, nine loci and nine genes responsible for the situation have been identified. Mutations in the ASPM gene (MCPH5 is the most common cause of MCPH. The ASPM gene with 28 exons is essential for normal mitotic spindle function in embryonic neuroblasts.Materials & MethodsWe have ascertained twenty-two consanguineous families withintellectual disability and different ethnic backgrounds from Iran. Ten out of twenty-two families showed primary microcephaly in clinical examination. We investigated MCPH5 locus using homozygosity mapping by microsatellite marker. ResultSequence analysis of exon 8 revealed a deletion of nucleotide (T in donor site of splicing site of ASPM in one family. The remaining nine families were not linked to any of the known loci. More investigation will be needed to detect the causative defect in these families.ConlusionWe detected a novel mutation in the donor splicing site of exon 8 of the ASPM gene. This deletion mutation can alter the ASPM transcript leading to functional impairment of the gene product. References1. Pattison L, Crow YJ, Deeble VJ, Jackson AP, Jafri H, Rashid Y, et al. A Fifth Locus for Primary Autosomal Recessive Microcephaly Maps to Chromosome 1q31. Am J Hum Genet 2000;67(6:1578-80.2. Darvish H, Esmaeeli-Nieh S, Monajemi G, Mohseni M, Ghasemi-Firouzabadi S, Abedini S, et al. A clinical and molecular genetic study of 112 Iranian families with primary microcephaly. Journal of Medical Genetics 2010;47(12:823-8.3. Tolmie JL, M M, JB S, D D, JM C

  17. Severe phenotype in an apparent homozygosity caused by a large deletion in the CFTR gene: a case report.

    Science.gov (United States)

    Martins, Raisa da Silva; Fonseca, Ana Carolina Proença; Acosta, Franklyn Enrique Samudio; Folescu, Tania Wrobel; Higa, Laurinda Yoko Shinzato; Sad, Izabela Rocha; Chaves, Célia Regina Moutinho de Miranda; Cabello, Pedro Hernan; Cabello, Giselda Maria Kalil

    2014-08-30

    Over 1900 mutations have been identified in the cystic fibrosis conductance transmembrane regulator gene, including single nucleotide substitutions, insertions, and deletions. Unidentified mutations may still lie in introns or in regulatory regions, which are not routinely investigated, or in large genomic deletions, which are not revealed by conventional molecular analysis. The apparent homozygosity for a rare, cystic fibrosis conductance transmembrane regulator mutation screened by standard molecular analysis should be further investigated to confirm if the mutation is in fact homozygous. We describe a patient presenting with an apparent homozygous S4X mutation. A 13-year-old female patient of African descent with clinical symptoms of classic cystic fibrosis and a positive sweat test (97 mEq/L, diagnosed at age 3 years) presented with pancreatic insufficiency and severe pulmonary symptoms (initial lung colonization with Pseudomonas aeruginosa at age 4 years; forced vital capacity: 69%; forced expiratory volume: 51%; 2011). Furthermore, she developed severe acute lung disease and recurrent episodes of dehydration requiring hospitalization. The girl carried the CFTR mutation S4X in apparent homozygosity. However, further analysis revealed a large deletion in the second allele that included the region of the mutation. The deletion that we describe includes nucleotides 120-142, which correspond to a loss of 23 nucleotides that abolishes the normal translation initiation codon. This study reiterates the view that large, cystic fibrosis conductance transmembrane regulator deletions are an important cause of severe cystic fibrosis and emphasizes the importance of including large deletions/duplications in cystic fibrosis conductance transmembrane regulator diagnostic tests.

  18. Deletion of a regulatory gene within the cpk gene cluster reveals novel antibacterial activity in Streptomyces coelicolor A3(2)

    NARCIS (Netherlands)

    Gottelt, Marco; Kol, Stefan; Gomez-Escribano, Juan Pablo; Bibb, Mervyn; Takano, Eriko; Herron, P.R.

    2010-01-01

    Genome sequencing of Streptomyces coelicolor A3(2) revealed an uncharacterized type I polyketide synthase gene cluster (cpk) Here we describe the discovery of a novel antibacterial activity (abCPK) and a yellow-pigmented secondary metabolite (yCPK) after deleting a presumed pathway-specific regulato

  19. Deletion of a regulatory gene within the cpk gene cluster reveals novel antibacterial activity in Streptomyces coelicolor A3(2)

    NARCIS (Netherlands)

    Gottelt, Marco; Kol, Stefan; Gomez-Escribano, Juan Pablo; Bibb, Mervyn; Takano, Eriko

    Genome sequencing of Streptomyces coelicolor A3(2) revealed an uncharacterized type I polyketide synthase gene cluster (cpk) Here we describe the discovery of a novel antibacterial activity (abCPK) and a yellow-pigmented secondary metabolite (yCPK) after deleting a presumed pathway-specific

  20. Management Features of Asthma in Children Under the Deletion Polymorphism of Genes Gstt1 and Gstm1

    Directory of Open Access Journals (Sweden)

    Elena C. Koloskova

    2015-03-01

    Full Text Available It has been performed complex examination of 50 school-aged children with bronchial asthma, which included a study of acetylation phenotype and a determination of deletions in the genes of glutathione-S-transferase (GSTM1 and GSTT1. The study has shown that in children with slow acetylation phenotype and the absence of deletions in genes GSTT1 and GSTM1 аssociates with poor control of the disease that requires increased anti-inflammatory therapy with an emphasis on higher "step". When using the ACT test for the assessment of asthma control often determined by the underestimation of their child's condition, indicating that about the need for the objectification of control of the disease with the help of spirographic method and subsequent correction of the basic therapy.

  1. Acetylcholinesterase (AChE) gene modification in transgenic animals: functional consequences of selected exon and regulatory region deletion.

    Science.gov (United States)

    Camp, Shelley; Zhang, Limin; Marquez, Michael; de la Torre, Brian; Long, Jeffery M; Bucht, Goran; Taylor, Palmer

    2005-12-15

    AChE is an alternatively spliced gene. Exons 2, 3 and 4 are invariantly spliced, and this sequence is responsible for catalytic function. The 3' alternatively spliced exons, 5 and 6, are responsible for AChE disposition in tissue [J. Massoulie, The origin of the molecular diversity and functional anchoring of cholinesterases. Neurosignals 11 (3) (2002) 130-143; Y. Li, S. Camp, P. Taylor, Tissue-specific expression and alternative mRNA processing of the mammalian acetylcholinesterase gene. J. Biol. Chem. 268 (8) (1993) 5790-5797]. The splice to exon 5 produces the GPI anchored form of AChE found in the hematopoietic system, whereas the splice to exon 6 produces a sequence that binds to the structural subunits PRiMA and ColQ, producing AChE expression in brain and muscle. A third alternative RNA species is present that is not spliced at the 3' end; the intron 3' of exon 4 is used as coding sequence and produces the read-through, unanchored form of AChE. In order to further understand the role of alternative splicing in the expression of the AChE gene, we have used homologous recombination in stem cells to produce gene specific deletions in mice. Alternatively and together exon 5 and exon 6 were deleted. A cassette containing the neomycin gene flanked by loxP sites was used to replace the exon(s) of interest. Tissue analysis of mice with exon 5 deleted and the neomycin cassette retained showed very low levels of AChE expression, far less than would have been anticipated. Only the read-through species of the enzyme was produced; clearly the inclusion of the selection cassette disrupted splicing of exon 4 to exon 6. The selection cassette was then deleted in exon 5, exon 6 and exons 5 + 6 deleted mice by breeding to Ella-cre transgenic mice. AChE expression in serum, brain and muscle has been analyzed. Another AChE gene targeted mouse strain involving a region in the first intron, found to be critical for AChE expression in muscle cells [S. Camp, L. Zhang, M. Marquez, B

  2. A deletion in the gene encoding sphingomyelin phosphodiesterase 3 (Smpd3) results in osteogenesis and dentinogenesis imperfecta in the mouse.

    Science.gov (United States)

    Aubin, Isabelle; Adams, Carolyn P; Opsahl, Sibylle; Septier, Dominique; Bishop, Colin E; Auge, Nathalie; Salvayre, Robert; Negre-Salvayre, Anne; Goldberg, Michel; Guénet, Jean-Louis; Poirier, Christophe

    2005-08-01

    The mouse mutation fragilitas ossium (fro) leads to a syndrome of severe osteogenesis and dentinogenesis imperfecta with no detectable collagen defect. Positional cloning of the locus identified a deletion in the gene encoding neutral sphingomyelin phosphodiesterase 3 (Smpd3) that led to complete loss of enzymatic activity. Our knowledge of SMPD3 function is consistent with the pathology observed in mutant mice and provides new insight into human pathologies.

  3. Deleting exon 55 from the nebulin gene induces severe muscle weakness in a mouse model for nemaline myopathy

    OpenAIRE

    Ottenheijm, Coen A. C.; Buck, Danielle; de Winter, Josine M; Ferrara, Claudia; Piroddi, Nicoletta; Tesi, Chiara; Jasper, Jeffrey R.; Malik, Fady I.; Meng, Hui; Stienen, Ger J. M.; Beggs, Alan H.; Labeit, Siegfried; Poggesi, Corrado; Lawlor, Michael W.; Granzier, Henk

    2013-01-01

    Nebulin—a giant sarcomeric protein—plays a pivotal role in skeletal muscle contractility by specifying thin filament length and function. Although mutations in the gene encoding nebulin (NEB) are a frequent cause of nemaline myopathy, the most common non-dystrophic congenital myopathy, the mechanisms by which mutations in NEB cause muscle weakness remain largely unknown. To better understand these mechanisms, we have generated a mouse model in which Neb exon 55 is deleted (NebΔExon55) to repl...

  4. Candidate Genes and the Behavioral Phenotype in 22q11.2 Deletion Syndrome

    Science.gov (United States)

    Prasad, Sarah E.; Howley, Sarah; Murphy, Kieran C.

    2008-01-01

    There is an overwhelming evidence that children and adults with 22q11.2 deletion syndrome (22q11.2DS) have a characteristic behavioral phenotype. In particular, there is a growing body of evidence that indicates an unequivocal association between 22q11.2DS and schizophrenia, especially in adulthood. Deletion of 22q11.2 is the third highest risk…

  5. Tetrahydrodipicolinate N-succinyltransferase and dihydrodipicolinate synthase from Pseudomonas aeruginosa: structure analysis and gene deletion.

    Directory of Open Access Journals (Sweden)

    Robert Schnell

    Full Text Available The diaminopimelic acid pathway of lysine biosynthesis has been suggested to provide attractive targets for the development of novel antibacterial drugs. Here we report the characterization of two enzymes from this pathway in the human pathogen Pseudomonas aeruginosa, utilizing structural biology, biochemistry and genetics. We show that tetrahydrodipicolinate N-succinyltransferase (DapD from P. aeruginosa is specific for the L-stereoisomer of the amino substrate L-2-aminopimelate, and its D-enantiomer acts as a weak inhibitor. The crystal structures of this enzyme with L-2-aminopimelate and D-2-aminopimelate, respectively, reveal that both compounds bind at the same site of the enzyme. Comparison of the binding interactions of these ligands in the enzyme active site suggests misalignment of the amino group of D-2-aminopimelate for nucleophilic attack on the succinate moiety of the co-substrate succinyl-CoA as the structural basis of specificity and inhibition. P. aeruginosa mutants where the dapA gene had been deleted were viable and able to grow in a mouse lung infection model, suggesting that DapA is not an optimal target for drug development against this organism. Structure-based sequence alignments, based on the DapA crystal structure determined to 1.6 Å resolution revealed the presence of two homologues, PA0223 and PA4188, in P. aeruginosa that could substitute for DapA in the P. aeruginosa PAO1ΔdapA mutant. In vitro experiments using recombinant PA0223 protein could however not detect any DapA activity.

  6. Deletion of the immunoglobulin kappa chain intron enhancer abolishes kappa chain gene rearrangement in cis but not lambda chain gene rearrangement in trans.

    OpenAIRE

    Takeda, S; Zou, Y R; Bluethmann, H; Kitamura, D; Muller, U.; Rajewsky, K

    1993-01-01

    Immunoglobulins (Ig) secreted from a plasma cell contain either kappa or lambda light chains, but not both. This phenomenon is termed isotypic kappa-lambda exclusion. While kappa-producing cells have their lambda chain genes in germline configuration, in most lambda-producing cells the kappa chain genes are either non-productively rearranged or deleted. To investigate the molecular mechanism for isotypic kappa-lambda exclusion, in particular the role of the Ig kappa intron enhancer, we replac...

  7. Microarray based analysis of an inherited terminal 3p26.3 deletion, containing only the CHL1 gene, from a normal father to his two affected children

    Directory of Open Access Journals (Sweden)

    Lerone Margherita

    2011-04-01

    Full Text Available Abstract Background terminal deletions of the distal portion of the short arm of chromosome 3 cause a rare contiguous gene disorder characterized by growth retardation, developmental delay, mental retardation, dysmorphisms, microcephaly and ptosis. The phenotype of individuals with deletions varies from normal to severe. It was suggested that a 1,5 Mb minimal terminal deletion including the two genes CRBN and CNTN4 is sufficient to cause the syndrome. In addition the CHL1 gene, mapping at 3p26.3 distally to CRBN and CNTN4, was proposed as candidate gene for a non specific mental retardation because of its high level of expression in the brain. Methods and Results we describe two affected siblings in which array-CGH analysis disclosed an identical discontinuous terminal 3p26.3 deletion spanning less than 1 Mb. The deletion was transmitted from their normal father and included only the CHL1 gene. The two brothers present microcephaly, light mental retardation, learning and language difficulties but not the typical phenotype manifestations described in 3p- syndrome. Conclusion a terminal 3p26.3 deletion including only the CHL1 gene is a very rare finding previously reported only in one family. The phenotype of the affected individuals in the two families is very similar and the deletion has been inherited from an apparently normal parent. As already described for others recurrent syndromes with variable phenotype, these findings are challenging in genetic counselling because of an evident variable penetrance.

  8. Encephalopathy and bilateral cataract in a boy with an interstitial deletion of Xp22 comprising the CDKL5 and NHS genes.

    Science.gov (United States)

    Van Esch, Hilde; Jansen, Anna; Bauters, Marijke; Froyen, Guy; Fryns, Jean-Pierre

    2007-02-15

    We describe a male patient with a deletion at Xp22, detected by high resolution X-array CGH. The clinical phenotype present in this infant boy, consists of severe encephalopathy, congenital cataracts and tetralogy of Fallot and can be attributed to the deletion of the genes within the interval. Among these deleted genes are the gene for Nance-Horan syndrome and the cyclin-dependent kinase-like 5 gene (CDKL5), responsible for the early seizure variant of Rett syndrome. This is the first description of a male patient with a deletion of these genes, showing the involvement of CDKL5 in severe epileptic encephalopathy in males. Moreover it illustrates the added value of high resolution array-CGH in molecular diagnosis of mental retardation-multiple congenital anomaly cases.

  9. Upon Accounting for the Impact of Isoenzyme Loss, Gene Deletion Costs Anticorrelate with Their Evolutionary Rates

    Science.gov (United States)

    Xia, Yu; Segrè, Daniel

    2017-01-01

    System-level metabolic network models enable the computation of growth and metabolic phenotypes from an organism’s genome. In particular, flux balance approaches have been used to estimate the contribution of individual metabolic genes to organismal fitness, offering the opportunity to test whether such contributions carry information about the evolutionary pressure on the corresponding genes. Previous failure to identify the expected negative correlation between such computed gene-loss cost and sequence-derived evolutionary rates in Saccharomyces cerevisiae has been ascribed to a real biological gap between a gene’s fitness contribution to an organism “here and now” and the same gene’s historical importance as evidenced by its accumulated mutations over millions of years of evolution. Here we show that this negative correlation does exist, and can be exposed by revisiting a broadly employed assumption of flux balance models. In particular, we introduce a new metric that we call “function-loss cost”, which estimates the cost of a gene loss event as the total potential functional impairment caused by that loss. This new metric displays significant negative correlation with evolutionary rate, across several thousand minimal environments. We demonstrate that the improvement gained using function-loss cost over gene-loss cost is explained by replacing the base assumption that isoenzymes provide unlimited capacity for backup with the assumption that isoenzymes are completely non-redundant. We further show that this change of the assumption regarding isoenzymes increases the recall of epistatic interactions predicted by the flux balance model at the cost of a reduction in the precision of the predictions. In addition to suggesting that the gene-to-reaction mapping in genome-scale flux balance models should be used with caution, our analysis provides new evidence that evolutionary gene importance captures much more than strict essentiality. PMID:28107392

  10. Contribution of Scaffoldins to Biomass Degradation by Clostridium Thermocellum: The Effect of Scaffoldin-Deletions on Expression of Other Genes

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Qi; Podkaminer, Kara; Resch, Michael G.; Donohoe, Bryon; Olson, Daniel G.; Baker, John O.; Klingeman, Dawn M.; Syed, Mustafa; Wilson, Charlotte M.; Brown, Steven D.; Yang, Shihui; Magnusson, Lauren; Maness, Pin-Ching; Decker, Steve R.; Lynd, Lee R.; Bomble, Yannick J.; Himmel, Michael E.

    2014-04-28

    The cellulosome system contributes greatly to the extreme efficiency of C. thermocellum cellulose degradation. In order to further understand the cellulosome working mechanism, we have knocked out C. thermocellum scaffoldin genes to generate a variety of deletion mutants. The knockout most detrimental to enzymatic hydrolysis by the secretome is that of the primary scaffoldin CipA. Deletion of multiple secondary scaffoldins results in secretome activities intermediate between those of the parent strain and the CipA-knockout mutants. The order of relative secretome activities is the same, whether the cellulosic substrate is microcrystalline cellulose (Avicel) or deacetylated acid-pretreated corn stover (DACS), but the relative magnitudes of the deletion effects are strongly substrate-dependent. Similar trends are observed in fermentation studies of the abilities of the parent and knockout strains themselves to utilize Avicel and DACS. Data from transcriptomic and proteomic studies of these strains when grown on both substrates are used to relate the activity and growth effects of the deletions to their effects on the overall expression of lignocellulose-degrading enzymes by C. thermocellum.

  11. Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru.

    Science.gov (United States)

    Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F; Griffing, Sean M; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J; Bacon, David J; Barnwell, John W; Udhayakumar, Venkatachalam

    2013-09-30

    The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times.

  12. HACE1 is a putative tumor suppressor gene in B-cell lymphomagenesis and is down-regulated by both deletion and epigenetic alterations.

    Science.gov (United States)

    Bouzelfen, Abdelilah; Alcantara, Marion; Kora, Hafid; Picquenot, Jean-Michel; Bertrand, Philippe; Cornic, Marie; Mareschal, Sylvain; Bohers, Elodie; Maingonnat, Catherine; Ruminy, Philippe; Adriouch, Sahil; Boyer, Olivier; Dubois, Sydney; Bastard, Christian; Tilly, Hervé; Latouche, Jean-Baptiste; Jardin, Fabrice

    2016-06-01

    HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1, HACE1, located on chromosome 6q, encodes an E3 ubiquitin ligase and is downregulated in many human tumors. Here, we report HACE1 as a candidate tumor suppressor gene down-regulated by a combination of deletion and epigenetic mechanisms. HACE1 deletions were observed in 40% of B-cell lymphoma tumors. Hypermethylation of the HACE1 promoter CpG177 island was found in 60% (68/111) of cases and in all tested B-cell lymphoma lines. Using HDAC inhibitors, we observed predominantly inactive chromatin conformation (methylated H3 histones H3K9me2) in HACE1 gene promoter region. We demonstrated in Ramos and Raji cells that down-regulation of HACE1 expression was associated with a significant decrease in apoptosis and an accumulation of cells in the S and G2/M phases. Our experiments indicate that HACE1 can act as a haploinsufficient tumor suppressor gene in most B-cell lymphomas and can be downregulated by deacetylation of its promoter region chromatin, which makes HACE1 a potential target for HDAC inhibitors.

  13. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Ziyu; Aryal, Uma K.; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D.; Magnuson, Jon K.; Adney, William S.; Beckham, Gregg T.; Brunecky, Roman; Himmel, Michael E.; Decker, Stephen R.; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E.

    2013-12-01

    ALG3 is a Family 58 glycosyltransferase enzyme involved in early N-linked glycan synthesis. Here, we investigated the effect of the alg3 gene disruption on growth, development, metabolism, and protein secretion in Aspergillus niger. The alg3 gene deletion resulted in a significant reduction of growth on complete (CM) and potato dextrose agar (PDA) media and a substantial reduction of spore production on CM. It also delayed spore germination in the liquid cultures of both CM and PDA media, but led to a significant accumulation of red pigment on both CM and liquid modified minimal medium (MM) supplemented with yeast extract. The relative abundance of 55 proteins of the total 190 proteins identified in the secretome was significantly different as a result of alg3 gene deletion. Comparison of a Trichoderma reesei cellobiohydrolase (Cel7A) heterologously expressed in A. niger parental and Δalg3 strains showed that the recombinant Cel7A expressed in the mutant background was smaller in size than that from the parental strains. This study suggests that ALG3 is critical for growth and development, pigment production, and protein secretion in A. niger. Functional analysis of recombinant Cel7A with aberrant glycosylation demonstrates the feasibility of this alternative approach to evaluate the role of N-linked glycosylation in glycoprotein secretion and function.

  14. Targeted deletion of multiple CTCF-binding elements in the human C-MYC gene reveals a requirement for CTCF in C-MYC expression.

    Directory of Open Access Journals (Sweden)

    Wendy M Gombert

    Full Text Available BACKGROUND: Insulators and domain boundaries both shield genes from adjacent enhancers and inhibit intrusion of heterochromatin into transgenes. Previous studies examined the functional mechanism of the MYC insulator element MINE and its CTCF binding sites in the context of transgenes that were randomly inserted into the genome by transfection. However, the contribution of CTCF binding sites to both gene regulation and maintenance of chromatin has not been tested at the endogenous MYC gene. METHODOLOGY/PRINCIPAL FINDINGS: To determine the impact of CTCF binding on MYC expression, a series of mutant human chromosomal alleles was prepared in homologous recombination-efficient DT40 cells and individually transferred by microcell fusion into murine cells. Functional tests reported here reveal that deletion of CTCF binding elements within the MINE does not impact the capacity of this locus to correctly organize an 'accessible' open chromatin domain, suggesting that these sites are not essential for the formation of a competent, transcriptionally active locus. Moreover, deletion of the CTCF site at the MYC P2 promoter reduces transcription but does not affect promoter acetylation or serum-inducible transcription. Importantly, removal of either CTCF site leads to DNA methylation of flanking sequences, thereby contributing to progressive loss of transcriptional activity. CONCLUSIONS: These findings collectively demonstrate that CTCF-binding at the human MYC locus does not repress transcriptional activity but is required for protection from DNA methylation.

  15. Deletion of the homeobox gene PRX-2 affects fetal but not adult fibroblast wound healing responses.

    Science.gov (United States)

    White, Philip; Thomas, David W; Fong, Steven; Stelnicki, Eric; Meijlink, Fritz; Largman, Corey; Stephens, Phil

    2003-01-01

    The phenotype of fibroblasts repopulating experimental wounds in vivo has been shown to influence both wound healing responses and clinical outcome. Recent studies have demonstrated that the human homeobox gene PRX-2 is strongly upregulated in fibroblasts within fetal, but not adult, mesenchymal tissues during healing. Differential homeobox gene expression by fibroblasts may therefore be important in mediating the scarless healing exhibited in early fetal wounds. RNase protection analysis demonstrated that murine Prx-2 expression was involved in fetal but not adult wound healing responses in vitro. Using fibroblasts established from homozygous mutant (Prx-2-/-) and wild-type (Prx-2+/+) murine skin tissues it was demonstrated that Prx-2 affected a number of fetal fibroblastic responses believed to be important in mediating scarless healing in vivo; namely cellular proliferation, extracellular matrix reorganization, and matrix metalloproteinase 2 and hyaluronic acid production. These data demonstrate how Prx-2 may contribute to the regulation of fetal, but not adult, fibroblasts and ultimately the wound healing phenotype. This study provides further evidence for the importance of homeobox transcription factors in the regulation of scarless wound healing. A further understanding of these processes will, it is hoped, enable the targeting of specific therapies in wound healing, both to effect scarless healing and to stimulate healing in chronic, nonhealing wounds such as venous leg ulcers.

  16. Deletion of the Braun lipoprotein-encoding gene and altering the function of lipopolysaccharide attenuate the plague bacterium.

    Science.gov (United States)

    Sha, Jian; Kirtley, Michelle L; van Lier, Christina J; Wang, Shaofei; Erova, Tatiana E; Kozlova, Elena V; Cao, Anthony; Cong, Yingzi; Fitts, Eric C; Rosenzweig, Jason A; Chopra, Ashok K

    2013-03-01

    Braun (murein) lipoprotein (Lpp) and lipopolysaccharide (LPS) are major components of the outer membranes of Enterobacteriaceae family members that are capable of triggering inflammatory immune responses by activating Toll-like receptors 2 and 4, respectively. Expanding on earlier studies that demonstrated a role played by Lpp in Yersinia pestis virulence in mouse models of bubonic and pneumonic plague, we characterized an msbB in-frame deletion mutant incapable of producing an acyltransferase that is responsible for the addition of lauric acid to the lipid A moiety of LPS, as well as a Δlpp ΔmsbB double mutant of the highly virulent Y. pestis CO92 strain. Although the ΔmsbB single mutant was minimally attenuated, the Δlpp single mutant and the Δlpp ΔmsbB double mutant were significantly more attenuated than the isogenic wild-type (WT) bacterium in bubonic and pneumonic animal models (mouse and rat) of plague. These data correlated with greatly reduced survivability of the aforementioned mutants in murine macrophages. Furthermore, the Δlpp ΔmsbB double mutant was grossly compromised in its ability to disseminate to distal organs in mice and in evoking cytokines/chemokines in infected animal tissues. Importantly, mice that survived challenge with the Δlpp ΔmsbB double mutant, but not the Δlpp or ΔmsbB single mutant, in a pneumonic plague model were significantly protected against a subsequent lethal WT CO92 rechallenge. These data were substantiated by the fact that the Δlpp ΔmsbB double mutant maintained an immunogenicity comparable to that of the WT strain and induced long-lasting T-cell responses against heat-killed WT CO92 antigens. Taken together, the data indicate that deletion of the msbB gene augmented the attenuation of the Δlpp mutant by crippling the spread of the double mutant to the peripheral organs of animals and by inducing cytokine/chemokine responses. Thus, the Δlpp ΔmsbB double mutant could provide a new live-attenuated background

  17. Triple immunoglobulin gene knockout transchromosomic cattle: bovine lambda cluster deletion and its effect on fully human polyclonal antibody production.

    Directory of Open Access Journals (Sweden)

    Hiroaki Matsushita

    Full Text Available Towards the goal of producing fully human polyclonal antibodies (hpAbs or hIgGs in transchromosomic (Tc cattle, we previously reported that Tc cattle carrying a human artificial chromosome (HAC comprising the entire unrearranged human immunoglobulin (Ig heavy-chain (hIGH, kappa-chain (hIGK, and lambda-chain (hIGL germline loci produced physiological levels of hIgGs when both of the bovine immunoglobulin mu heavy-chains, bIGHM and bIGHML1, were homozygously inactivated (bIGHM-/-, bIGHML1-/-; double knockouts or DKO. However, because endogenous bovine immunoglobulin light chain loci are still intact, the light chains are produced both from the hIGK and hIGL genomic loci on the HAC and from the endogenous bovine kappa-chain (bIGK and lambda-chain (bIGL genomic loci, resulting in the production of fully hIgGs (both Ig heavy-chains and light-chains are of human origin: hIgG/hIgκ or hIgG/hIgλ and chimeric hIgGs (Ig heavy-chains are of human origin while the Ig light-chains are of bovine origin: hIgG/bIgκ or hIgG/bIgλ. To improve fully hIgG production in Tc cattle, we here report the deletion of the entire bIGL joining (J and constant (C gene cluster (bIGLJ1-IGLC1 to bIGLJ5-IGLC5 by employing Cre/loxP mediated site-specific chromosome recombination and the production of triple knockout (bIGHM-/-, bIGHML1-/- and bIGL-/-; TKO Tc cattle. We further demonstrate that bIGL cluster deletion greatly improves fully hIgGs production in the sera of TKO Tc cattle, with 51.3% fully hIgGs (hIgG/hIgκ plus hIgG/hIgλ.

  18. Unusual presentation of pelizaeus-merzbacher disease: female patient with deletion of the proteolipid protein 1 gene.

    Science.gov (United States)

    Brender, Teva; Wallerstein, Donna; Sum, John; Wallerstein, Robert

    2015-01-01

    Pelizaeus-Merzbacher disease (PMD) is neurodegenerative leukodystrophy caused by dysfunction of the proteolipid protein 1 (PLP1) gene on Xq22, which codes for an essential myelin protein. As an X-linked condition, PMD primarily affects males; however there have been a small number of affected females reported in the medical literature with a variety of different mutations in this gene. No affected females to date have a deletion like our patient. In addition to this, our patient has skewed X chromosome inactivation which adds to her presentation as her unaffected mother also carries the mutation.

  19. Unusual Presentation of Pelizaeus-Merzbacher Disease: Female Patient with Deletion of the Proteolipid Protein 1 Gene

    Directory of Open Access Journals (Sweden)

    Teva Brender

    2015-01-01

    Full Text Available Pelizaeus-Merzbacher disease (PMD is neurodegenerative leukodystrophy caused by dysfunction of the proteolipid protein 1 (PLP1 gene on Xq22, which codes for an essential myelin protein. As an X-linked condition, PMD primarily affects males; however there have been a small number of affected females reported in the medical literature with a variety of different mutations in this gene. No affected females to date have a deletion like our patient. In addition to this, our patient has skewed X chromosome inactivation which adds to her presentation as her unaffected mother also carries the mutation.

  20. Lesch-Nyhan Syndrome in a Family with a Deletion Followed by an Insertion within the HPRT1 Gene.

    Science.gov (United States)

    Nguyen, Khue Vu; Nyhan, William L

    2015-01-01

    Lesch-Nyhan syndrome (LNS) is a rare X-linked inherited neurogenetic disorder of purine metabolism in which the enzyme, hypoxanthine-guanine phosphoribosyltransferase(HGprt) is defective. The authors report a novel mutation which led to LNS in a family with a deletion followed by an insertion (INDELS) via the serial replication slippage mechanism: c.428_432delTGCAGinsAGCAAA, p.Met143Lysfs*12 in exon 6 of HPRT1 gene. Molecular diagnosis discloses the genetic heterogeneity of HPRT1 gene responsible for HGprt deficiency. It allows fast, accurate carrier detection and genetic counseling.

  1. Yeast expression and DNA immunization of hepatitis B virus S gene with second-loop deletion of α determinant region

    Institute of Scientific and Technical Information of China (English)

    Hui Hu; Xiao-Mou Peng; Yang-Su Huang; Lin Gu; Qi-Feng Xie; Zhi-Liang Gao

    2004-01-01

    AIM: Immune escape mutations of HBV often occur in the dominant epitope, the second-loop of the a determinant of hepatitis B surface antigen (HBsAg). To let the hosts respond to the subdominant epitopes in HBsAg may be an effective way to decrease the prevalence of immune escape mutants. For this reason, a man-made clone of HBV S gene with the second-loop deletion was constructed. Its antigenicity was evaluated by yeast expression analysis and DNA immunization in mice.METHODS: HBV S gene with deleted second-loop, amino acids from 139 to 145, was generated using splicing by overlap extension. HBV deleted S gene was then cloned into the yeast expression vector pPIC9 and the mammalian expression vector pcDNA3 to generate pHB-SDY and pHB-SD,respectively. The complete S gene was cloned into the same vectors as controls. The deleted recombinant HBsAg expressed in yeasts was detected using Abbott IMx HBsAg test kits, enzyme-linked immunoadsorbent assay (ELISA)and immune dot blotting to evaluate its antigenicity in vitro.The anti-HBs responses to DNA immunization in BALB/c mice were detected using Abbott IMx AUSAB test kits to evaluate the antigenicity of that recombinant protein in vivo.RESULTS: Both deleted and complete HBsAg were successfully expressed in yeasts. They were intracellular expressions. The deleted HBsAg could not be detected by ELISA, in which the monoclonal anti-HBs against the α determinant was used, but could be detected by Abbott IMx and immune dot blotting, in which multiple monoclonal antiHBs and polyclonal anti-HBs were used, respectively. The activity of the deleted HBsAg detected by Abbott IMx was much lower than that of complete HBsAg (the ratio of sample value/cut off value, 106±26.7 vs1 814.4±776.3, P<0.01,t = 5.02). The anti-HBs response of pHB-SD to DNA immunization was lower than that of complete HBV S gene vector pHB (the positive rate 2/10 vs6/10, 4.56±3.52 mIU/mL vs27.60±17.3 mIU/mL, P= 0.02, t= 2.7).CONCLUSIONS: HBsAg with deleted

  2. A novel deletion mutation in the TUSC3 gene in a consanguineous Pakistani family with autosomal recessive nonsyndromic intellectual disability

    Directory of Open Access Journals (Sweden)

    Ali Nadir

    2011-04-01

    Full Text Available Abstract Background Intellectual disability (ID is a serious disorder of the central nervous system with a prevalence of 1-3% in a general population. In the past decades, the research focus has been predominantly on X-linked ID (68 loci and 19 genes for non syndromic X linked ID while for autosomal recessive nonsyndromic ID (NSID only 30 loci and 6 genes have been reported to date. Methods Genome-wide homozygosity mapping with 500 K Nsp1 array (Affymetrix, CNV analysis, PCR based breakpoint mapping and DNA sequencing was performed to explore the genetic basis of autosomal recessive nonsyndromic ID in a large Pakistani family. Results Data analysis showed linkage at 8p23 locus with common homozygous region between SNPs rs6989820 and rs2237834, spanning a region of 12.494 Mb. The subsequent CNV analysis of the data revealed a homozygous deletion of 170.673 Kb which encompassed the TUSC3 gene. Conclusion We report a novel deletion mutation in TUSC3 gene which is the second gene after TRAPPC9 in which mutation has been identified in more than one family with autosomal recessive NSID. The study will aid in exploring the molecular pathway of cognition.

  3. 1p13.2 deletion displays clinical features overlapping Noonan syndrome, likely related to NRAS gene haploinsufficiency.

    Science.gov (United States)

    Linhares, Natália Duarte; Freire, Maíra Cristina Menezes; Cardenas, Raony Guimarães Corrêa do Carmo Lisboa; Pena, Heloisa Barbosa; Lachlan, Katherine; Dallapiccola, Bruno; Bacino, Carlos; Delobel, Bruno; James, Paul; Thuresson, Ann-Charlotte; Annerén, Göran; Pena, Sérgio D J

    2016-01-01

    Deletion-induced hemizygosity may unmask deleterious autosomal recessive variants and be a cause of the phenotypic variability observed in microdeletion syndromes. We performed complete exome sequencing (WES) analysis to examine this possibility in a patient with 1p13.2 microdeletion. Since the patient displayed clinical features suggestive of Noonan Syndrome (NS), we also used WES to rule out the presence of pathogenic variants in any of the genes associated with the different types of NS. We concluded that the clinical findings could be attributed solely to the 1p13.2 haploinsufficiency. Retrospective analysis of other nine reported patients with 1p13.2 microdeletions showed that six of them also presented some characteristics of NS. In all these cases, the deleted segment included the NRAS gene. Gain-of-function mutations of NRAS gene are causally related to NS type 6. Thus, it is conceivable that NRAS haploinsufficiency and gain-of-function mutations may have similar clinical consequences. The same phenomenon has been described for two other genes belonging to the Ras/MAPK pathway: MAP2K2 and SHOC2. In conclusion, we here report genotype-phenotype correlations in patients with chromosome 1p13.2 microdeletions and we propose that NRAS may be a critical gene for the NS characteristics in the patients.

  4. AVAQ 594-597 deletion of the TfR2 gene in a Japanese family with hemochromatosis.

    Science.gov (United States)

    Hattori, Ai; Wakusawa, Shinnya; Hayashi, Hisao; Harashima, Ai; Sanae, Fujiko; Kawanaka, Miwa; Yamada, Gohtaro; Yano, Motoyashi; Yoshioka, Kenntaro

    2003-06-01

    The majority of Caucasian patients with hemochromatosis are homozygous for C282Y mutation of the HFE gene. In contrast to its high prevalence in Caucasians, hemochromatosis is a rare disorder in Japan. This may be due to the low prevalence of the C282Y mutation of the HFE gene in Japanese. Recent reports suggest that the mutations of transferrin receptor 2 (TfR2) gene may be involved in non-HFE hemochromatosis. Therefore, we investigated the TfR2 gene of 6 sporadic and 5 familiar cases of Japanese hemochromatosis. Three siblings in one family were found to be homozygous for an AVAQ 594-597 deletion. All three had severe iron deposits in the hepatocytes and bile ducts, but none was affected by diabetes mellitus. This mutation was not detected in 100 control individuals. Further study was undertaken to investigate whether the large deletion of the TfR2 gene is the mutation responsible for some of the Japanese hemochromatosis cases.

  5. A novel nine base deletion mutation in NADH-cytochrome b5 reductase gene in an Indian family with recessive congenital methemoglobinemia-type-II

    Directory of Open Access Journals (Sweden)

    Prashant Warang

    2015-12-01

    Full Text Available Recessive hereditary methemoglobinemia (RCM associated with severe neurological abnormalities is a very rare disorder caused by NADH- cytochrome b5 reductase (cb5r deficiency (Type II. We report a case of 11 month old male child who had severe mental retardation, microcephaly and gross global developmental delay with methemoglobin level of 61.1%. The diagnosis of NADH-CYB5R3 deficiency was made by the demonstration of significantly reduced NADH-CYB5R3 activity in the patient and intermediate enzyme activity in both the parents. Mutation analysis of the CYB5R gene revealed a novel nine nucleotide deletion in exon 6 leading to the elimination of 3 amino acid residues (Lys173, Ser174 and Val 175. To confirm that this mutation was not an artifact, we performed PCR-RFLP analysis using the restriction enzyme Drd I. As the normal sequence has a restriction recognition site for Drd I which was eliminated by the deletion, a single band of 603-bp was seen in the presence of the homozygous mutation. Molecular modeling analysis showed a significant effect of these 3 amino acids deletion on the protein structure and stability leading to a severe clinical presentation. A novel homozygous 9 nucleotide deletion (p.K173–p.V175del3 is shown to be segregated with the disease in this family. Knowing the profile of mutations would allow us to offer prenatal diagnosis in families with severe neurological disorders associated with RCM — Type II.

  6. Sensory ataxic neuropathy in golden retriever dogs is caused by a deletion in the mitochondrial tRNATyr gene.

    Directory of Open Access Journals (Sweden)

    Izabella Baranowska

    2009-05-01

    Full Text Available Sensory ataxic neuropathy (SAN is a recently identified neurological disorder in golden retrievers. Pedigree analysis revealed that all affected dogs belong to one maternal lineage, and a statistical analysis showed that the disorder has a mitochondrial origin. A one base pair deletion in the mitochondrial tRNA(Tyr gene was identified at position 5304 in affected dogs after re-sequencing the complete mitochondrial genome of seven individuals. The deletion was not found among dogs representing 18 different breeds or in six wolves, ruling out this as a common polymorphism. The mutation could be traced back to a common ancestor of all affected dogs that lived in the 1970s. We used a quantitative oligonucleotide ligation assay to establish the degree of heteroplasmy in blood and tissue samples from affected dogs and controls. Affected dogs and their first to fourth degree relatives had 0-11% wild-type (wt sequence, while more distant relatives ranged between 5% and 60% wt sequence and all unrelated golden retrievers had 100% wt sequence. Northern blot analysis showed that tRNA(Tyr had a 10-fold lower steady-state level in affected dogs compared with controls. Four out of five affected dogs showed decreases in mitochondrial ATP production rates and respiratory chain enzyme activities together with morphological alterations in muscle tissue, resembling the changes reported in human mitochondrial pathology. Altogether, these results provide conclusive evidence that the deletion in the mitochondrial tRNA(Tyr gene is the causative mutation for SAN.

  7. Deletion analysis of the dystrophin gene in Duchenne and Becker muscular dystrophy patients: Use in carrier diagnosis

    Directory of Open Access Journals (Sweden)

    Kumari D

    2003-04-01

    Full Text Available The dystrophin gene was analyzed in 8 Duchenne muscular dystrophy (DMD and 10 Becker muscular dystrophy (BMD unrelated families (22 subjects: 18 index cases and 4 sibs for the presence of deletions by multiplex polymerase chain reaction (mPCR; 27 exons and Southern hybridization using 8 cDMD probes. Deletions were identified in 5 DMD and 7 BMD patients (6 index cases and 1 sib. The concordance between the clinical phenotype and 'reading frame hypothesis' was observed in 11/12 patients (92%. The female relatives of DMD/BMD patients with identifiable deletions were examined by quantitative mPCR. Carriers were identified in 7 families. We also describe a variation in the HindIII pattern with cDNA probe 8 and 11-14. Molecular characterization of the dystrophin gene in this study has been helpful in advising the patients concerning the inheritance of the condition, and carrier diagnosis of female relatives, and should also prove useful for prenatal diagnosis.

  8. Case report: an unexpected link between partial deletion of the SHANK3 gene and Heller's dementia infantilis, a rare subtype of autism spectrum disorder

    National Research Council Canada - National Science Library

    Philippe, Anne; Craus, Yann; Rio, Marlène; Bahi-Buisson, Nadia; Boddaert, Nathalie; Malan, Valérie; Bonnefont, Jean-Paul; Robel, Laurence

    2015-01-01

    Deletions and mutations involving the SHANK3 gene lead to a nonspecific clinical presentation with moderate to profound intellectual disability, severely delayed or absent speech, and autism spectrum disorders (ASD...

  9. Angiotensin Converting Enzyme Gene Insertion/Deletion Polymorphism and Vesicoureteral Reflux in Children

    Science.gov (United States)

    Ai, Jin-Wei; Liu, Yu; Zeng, Xian-Tao; Lei, Qing; Zou, Li; Pei, Bin

    2015-01-01

    Abstract Vesicoureteral reflux (VUR) is a common and serious urinary disease in children. It usually causes renal scar, urinary tract infection, and chronic renal failure. Previous studies showed the angiotensin converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism might be associated with VUR; however, the conclusions were inconsistent. Therefore we used the meta-analytic approach to clarify the effect of ACE I/D polymorphism on VUR risk. We systematically searched the PubMed, CNKI, and EMBASE databases to identify all the potentially related studies published up to February 4, 2015. Two reviewers independently selected studies and extracted data. The strength of the association was assessed using odd ratio (OR) with its 95% confidence interval (CI) based on fixed or random effects model. The STATA 12.0 software was used for data analysis. A total of 14 case–control studies involving 1197 VUR patients and 1320 healthy controls met the eligibility criteria. Results of meta-analysis showed significant association between ACE I/D polymorphism and VUR risk (D vs. I: OR = 1.28, 95% CI = 1.06–1.54, P = 0.01; DD vs. II: OR = 1.44, 95% CI = 1.12–1.85, P = 0.01; DD vs. DI + II: OR = 1.49, 95% CI = 1.23–1.79, P < 0.01; DD + DI vs. II: OR = 1.20, 95% CI = 0.84–1.72, P = 0.31). Subgroup analyses revealed varied results. In Turkish people, results of all the genetic models other than DI vs. II showed statistical significance; in Caucasians, DD vs. DI + II showed statistical significance; and in Asians, DI versus II showed statistical significance. Our meta-analysis indicated that the ACE I/D polymorphism might be associated with increased risk of VUR in children. However, due to the limitations, we suggest conducting additional studies with larger sample size and adjustment for various risk factors, in the future for further clarification. PMID:26717402

  10. Chemotherapy modulates intestinal immune gene expression including surfactant Protein-D and deleted in malignant brain tumors 1 in piglets

    DEFF Research Database (Denmark)

    Rathe, Mathias; Thomassen, Mads; Shen, René L.

    2016-01-01

    Background: Information about chemotherapy-induced intestinal gene expression may provide insight into the mechanisms underlying gut toxicity and help identify biomarkers and targets for intervention. Methods: We analyzed jejunal tissue from piglets subjected to two different, clinically relevant...... the upregulated genes for both treatments. Conclusion: In the developing intestine, chemotherapy increases the expression of genes related to innate immune functions involved in surveillance, protection, and homeostasis of mucosal surfaces....... the BUCY and DOX piglets. Selected genes of potential biological significance with a similar change in expression across the treatments were controlled by real-time polymerase chain reaction. Key innate defense molecules, including surfactant protein-D and deleted in malignant brain tumors 1, were among...

  11. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC.

  12. Gene deletion of glutathione S-transferase theta: correlation with induced genetic damage and potential role in endogenous mutagenesis.

    Science.gov (United States)

    Wiencke, J K; Pemble, S; Ketterer, B; Kelsey, K T

    1995-01-01

    Genetic traits that confer increased susceptibility to DNA and chromosomal damage from reactive epoxide and peroxides could be important individual risk factors in the development of human cancers. To provide an index of individual sensitivity to expoxides, we previously studied sister chromatid exchange (SCE) induction in peripheral blood lymphocytes and identified a trait involving sensitivity to chromosomal damage by monoepoxybutene and diepoxybutane (DEB), both potential carcinogenic metabolites of 1,3-butadiene. Individuals sensitive to DEB induction of SCEs also had an increased number of background or "spontaneous" SCEs. The present investigation was conducted to test whether a newly described deletion polymorphism in the glutathione S-transferase class theta (GSTT1) was significantly associated with the previously described inherited chromosomal sensitivity to DEB. The background and DEB-induced SCE frequencies in peripheral blood lymphocytes from 78 healthy volunteers were determined with the use of fluorescence plus Giemsa staining. The presence or absence of the homozygous deletion of the GSTT1 gene was determined for each participant using PCR methods. In the present study, we report a close correlation of the DEB sensitivity trait with the novel polymorphism in GSTT1. The GSTT1 polymorphism was also highly associated with the background frequencies of SCE. These studies raise the possibility that DBE is a substrate for GST-theta. Individuals who carry a homozygous deletion of the GSTT1 gene may be at increased risk for genotoxic damage from environmental or occupational 1,3-butadiene exposures. The association of the GSTT1 deletion polymorphism with increases in background SCEs indicates that substrates for this isozyme are encountered commonly in the environment or are endogenous in nature.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. First description of ABCB4 gene deletions in familial low phospholipid-associated cholelithiasis and oral contraceptives-induced cholestasis

    Science.gov (United States)

    Pasmant, Eric; Goussard, Philippe; Baranes, Laetitia; Laurendeau, Ingrid; Quentin, Samuel; Ponsot, Philippe; Consigny, Yann; Farges, Olivier; Condat, Bertrand; Vidaud, Dominique; Vidaud, Michel; Chen, Jian-Min; Parfait, Béatrice

    2012-01-01

    The wide clinical spectrum of the ABCB4 gene (ATP-binding cassette subfamily B member 4) deficiency syndromes in humans includes low phospholipid-associated cholelithiasis (LPAC), intrahepatic cholestasis of pregnancy (ICP), oral contraceptives-induced cholestasis (CIC), and progressive familial intrahepatic cholestasis type 3 (PFIC3). No ABCB4 mutations are found in a significant proportion of patients with these syndromes. In the present study, 102 unrelated adult patients with LPAC (43 patients) or CIC/ICP (59 patients) were screened for ABCB4 mutations using DNA sequencing. Heterozygous ABCB4 point or short insertion/deletion mutations were found in 37% (16/43) of the LPAC patients and in 27% (16/59) of the ICP/CIC patients. High-resolution gene dosage methodologies were used in the 70 negative patients. Here, we describe for the first time ABCB4 partial or complete heterozygous deletions in 7% (3/43) of the LPAC patients, and in 2% (1/59) of the ICP/CIC patients. Our observations urge to systematically test patients with LPAC, ICP/CIC, and also children with PFIC3 for the presence of ABCB4 deletions using molecular tools allowing detection of gross rearrangements. In clinical practice, a comprehensive ABCB4 alteration-screening algorithm will permit the use of ABCB4 genotyping to confirm the diagnosis of LPAC or ICP/CIC, and allow familial testing. An early diagnosis of these biliary diseases may be beneficial because of the preventive effect of ursodeoxycholic acid on biliary complications. Further comparative studies of patients with well-characterized genotypes (including deletions) and phenotypes will help determine whether ABCB4 mutation types influence clinical outcomes. PMID:21989363

  14. Deletion of exon 8 from the EXT1 gene causes multiple osteochondromas (MO) in a family with three affected members.

    Science.gov (United States)

    Zhuang, Lei; Gerber, Simon D; Kuchen, Stefan; Villiger, Peter M; Trueb, Beat

    2016-01-01

    Multiple osteochondromas (also called hereditary multiple exostoses) is an autosomal dominant disorder characterized by multiple cartilaginous tumors, which are caused by mutations in the genes for exostosin-1 (EXT1) and exostosin-2 (EXT2). The goal of this study was to elucidate the genetic alterations in a family with three affected members. Isolation of RNA from the patients' blood followed by reverse transcription and PCR amplification of selected fragments showed that the three patients lack a specific region of 90 bp from their EXT1 mRNA. This region corresponds to the sequence of exon 8 from the EXT1 gene. No splice site mutation was found around exon 8. However, long-range PCR amplification of the region from intron 7 to intron 8 indicated that the three patients contain a deletion of 4318 bp, which includes exon 8 and part of the flanking introns. There is evidence that the deletion was caused by non-homologous end joining because the breakpoints are not located within a repetitive element, but contain multiple copies of the deletion hotspot sequence TGRRKM. Exon 8 encodes part of the active site of the EXT1 enzyme, including the DXD signature of all UDP-sugar glycosyltransferases. It is conceivable that the mutant protein exerts a dominant negative effect on the activity of the EXT glycosyltransferase since it might interact with normal copies of the enzyme to form an inactive hetero-oligomeric complex. We suggest that sequencing of RNA might be superior to exome sequencing to detect short deletions of a single exon.

  15. Detection of deletion and mutation on pig Mx1 gene (gene resistance to influenza virus) with PCR-RFLP Nar I restriction

    OpenAIRE

    Cece Sumantri; T Morzumi; N Hamashima

    2001-01-01

    The study was done to detect the incident of deletion and mutation in exon 14th of Mx1 gene in pig. Six hundred base pairs at the position (1937 to 2537) of the 14th exon of the pig Mx1 gene was amplified by polymerase chain reaction (PCR) from 15 breed of pig DNA sample. The amplified PCR products were digested by Nar I enzyme that called restriction fragment length polymorphism (PCR-RFLP) technique. The results show genetic polymorphism at the 14th exon of pig Mx1 gene. The Nar I digested r...

  16. ET-46ONCOLYTIC VIRAL THERAPY FOR MALIGNANT GLIOMAS USING MYXOMA VIRUS DELETED FOR ANTI-APOPTOTIC M11L GENE

    Science.gov (United States)

    Pisklakova, Alexandra; McKenzie, Brienne; Kenchappa, Rajappa; McFadden, Grant; Forsyth, Peter

    2014-01-01

    Brain Tumour Initiating Cells (BTICs) are stem-like cells hypothesized to mediate recurrence in high-grade gliomas. Myxoma virus (MyxV) is a promising oncolytic virus, which is highly effective in conventional long term resistant glioma cell lines and less effective in BTICs. We hypothesized that one possible factor limiting efficacy in BTICs is that cell death following infection with MyxV is inhibited by virally encoded anti-apoptotic proteins, such as the Bcl-2 structural homologue, M011L. To test this we evaluated and compared the efficacy of wtMYXV versus the viral construct MyxV-M011L-KO (in which the anti-apoptotic protein M11L has been deleted) in BTICs. We found that WT-MyxV does not induce significant level of apoptosis in infected BTICs, but that MyxV-M011L-KO induces dramatically more apoptosisas shown by caspase activation, PARP cleavage, and Cytochrome C release from the mitochondria M11L from the WT-MyxV localized to the mitochondrial membrane and prevented the association of Bax with the mitochondrial membrane. Finally, silencing of Bax using specific siRNAs significantly blocked the induction of apoptosis and cell death that occurs after infection with mutant MyxV-M011L-KO virus. Therefore MyxV-M011L-KO, which is has the anti-apoptotic virally derived gene M11L, dramatically improves the oncolytic efficacy in BTICs and this is dependent on the presence of the pro-apoptotic host protein, Bax. This is the first demonstration, that the MyxV mutant, genetically modified to promote apoptosis in tumor initiating cells, is significantly more efficacious than the wildtype virus. Strategies, such as this one, that promotes apoptosis in tumor initiating cells might be particularly effective.

  17. Identification by gene deletion analysis of a regulator, VmsR, that controls virginiamycin biosynthesis in Streptomyces virginiae.

    Science.gov (United States)

    Kawachi, R; Wangchaisoonthorn, U; Nihira, T; Yamada, Y

    2000-11-01

    Virginiae butanolide (VB)-BarA of Streptomyces virginiae is one of the newly discovered pairs of a butyrolactone autoregulator and a corresponding receptor protein of Streptomyces species and regulates the production of the antibiotic virginiamycin (VM) in S. virginiae. The gene vmsR was found to be situated 4.7 kbp upstream of the barA gene, which encodes the VB-specific receptor. The vmsR product was predicted to be a regulator of VM biosynthesis based on its high homology to some Streptomyces pathway-specific transcriptional regulators for the biosynthetic gene clusters of polyketide antibiotics, such as Streptomyces peucetius DnrI (47.5% identity, 84. 3% similarity), which controls daunorubicin biosynthesis. A vmsR deletion mutant was created by homologous recombination. Neither virginiamycin M(1) nor virginiamycin S was produced in the vmsR mutant, while amounts of VB and BarA similar to those produced in the wild-type strain were detected. Reverse transcription-PCR analyses confirmed that the vmsR deletion had no deleterious effects on the transcription of the vmsR-surrounding genes, indicating that VmsR is a positive regulator of VM biosynthesis in S. virginiae.

  18. A deletion affecting an LRR-RLK gene co-segregates with the fruit flat shape trait in peach.

    Science.gov (United States)

    López-Girona, Elena; Zhang, Yu; Eduardo, Iban; Mora, José Ramón Hernández; Alexiou, Konstantinos G; Arús, Pere; Aranzana, María José

    2017-07-27

    In peach, the flat phenotype is caused by a partially dominant allele in heterozygosis (Ss), fruits from homozygous trees (SS) abort a few weeks after fruit setting. Previous research has identified a SSR marker (UDP98-412) highly associated with the trait, found suitable for marker assisted selection (MAS). Here we report a ∼10 Kb deletion affecting the gene PRUPE.6G281100, 400 Kb upstream of UDP98-412, co-segregating with the trait. This gene is a leucine-rich repeat receptor-like kinase (LRR-RLK) orthologous to the Brassinosteroid insensitive 1-associated receptor kinase 1 (BAK1) group. PCR markers suitable for MAS confirmed its strong association with the trait in a collection of 246 cultivars. They were used to evaluate the DNA from a round fruit derived from a somatic mutation of the flat variety 'UFO-4', revealing that the mutation affected the flat associated allele (S). Protein BLAST alignment identified significant hits with genes involved in different biological processes. Best protein hit occurred with AtRLP12, which may functionally complement CLAVATA2, a key regulator that controls the stem cell population size. RT-PCR analysis revealed the absence of transcription of the partially deleted allele. The data support PRUPE.6G281100 as a candidate gene for flat shape in peach.

  19. The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

    Science.gov (United States)

    Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

    2017-01-01

    Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

  20. Mapping of a Leishmania major gene/locus that confers pentamidine resistance by deletion and insertion of transposable element

    Directory of Open Access Journals (Sweden)

    Coelho Adriano C.

    2004-01-01

    Full Text Available Pentamidine (PEN is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.

  1. Heterozygous deletion of the LRFN2 gene is associated with working memory deficits.

    Science.gov (United States)

    Thevenon, Julien; Souchay, Céline; Seabold, Gail K; Dygai-Cochet, Inna; Callier, Patrick; Gay, Sébastien; Corbin, Lucie; Duplomb, Laurence; Thauvin-Robinet, Christel; Masurel-Paulet, Alice; El Chehadeh, Salima; Avila, Magali; Minot, Delphine; Guedj, Eric; Chancenotte, Sophie; Bonnet, Marlène; Lehalle, Daphne; Wang, Ya-Xian; Kuentz, Paul; Huet, Frédéric; Mosca-Boidron, Anne-Laure; Marle, Nathalie; Petralia, Ronald S; Faivre, Laurence

    2016-06-01

    Learning disabilities (LDs) are a clinically and genetically heterogeneous group of diseases. Array-CGH and high-throughput sequencing have dramatically expanded the number of genes implicated in isolated intellectual disabilities and LDs, highlighting the implication of neuron-specific post-mitotic transcription factors and synaptic proteins as candidate genes. We report a unique family diagnosed with autosomal dominant learning disability and a 6p21 microdeletion segregating in three patients. The 870 kb microdeletion encompassed the brain-expressed gene LRFN2, which encodes for a synaptic cell adhesion molecule. Neuropsychological assessment identified selective working memory deficits, with borderline intellectual functioning. Further investigations identified a defect in executive function, and auditory-verbal processes. These data were consistent with brain MRI and FDG-PET functional brain imaging, which, when compared with controls, revealed abnormal brain volume and hypometabolism of gray matter structures implicated in working memory. We performed electron microscopy immunogold labeling demonstrating the localization of LRFN2 at synapses of cerebellar and hippocampal rat neurons, often associated with the NR1 subunit of N-methyl-D-aspartate receptors (NMDARs). Altogether, the combined approaches imply a role for LRFN2 in LD, specifically for working memory processes and executive function. In conclusion, the identification of familial cases of clinically homogeneous endophenotypes of LD might help in both the management of patients and genetic counseling for families.

  2. Unmarked gene deletion and host-vector system for the hyperthermophilic crenarchaeon Sulfolobus islandicus

    DEFF Research Database (Denmark)

    Deng, Ling; Zhu, Haojun; Chen, Zhengjun

    2009-01-01

    , and unmarked lacS mutants were obtained by each method. A new alternative recombination mechanism, i.e., marker circularization and integration, was shown to operate in the latter method, which did not yield the designed deletion mutation. Subsequently, Sulfolobus-E. coli plasmid shuttle vectors were...

  3. Overexpressing enzymes of the Ehrlich pathway and deleting genes of the competing pathway in Saccharomyces cerevisiae for increasing 2-phenylethanol production from glucose.

    Science.gov (United States)

    Shen, Li; Nishimura, Yuya; Matsuda, Fumio; Ishii, Jun; Kondo, Akihiko

    2016-07-01

    2-Phenylethanol (2-PE) is a higher aromatic alcohol that is used in the cosmetics and food industries. The budding yeast Saccharomyces cerevisiae is considered to be a suitable host for the industrial production of higher alcohols, including 2-PE. To produce 2-PE from glucose in S. cerevisiae, we searched for suitable 2-keto acid decarboxylase (KDC) and alcohol dehydrogenase (ADH) enzymes of the Ehrlich pathway for overexpression in strain YPH499, and found that overexpression of the ARO10 and/or ADH1 genes increased 2-PE production from glucose. Further, we screened ten BY4741 single-deletion mutants of genes involved in the competing pathways for 2-PE production, and found that strains aro8Δ and aat2Δ displayed increased 2-PE production. Based on these results, we engineered a BY4741 strain that overexpressed ARO10 and contained an aro8Δ deletion, and demonstrated that the strain produced 96 mg/L 2-PE from glucose as the sole carbon source. As this engineered S. cerevisiae strain showed a significant increase in 2-PE production from glucose without the addition of an intermediate carbon substrate, it is a promising candidate for the large-scale production of 2-PE.

  4. Scarless deletion of up to seven methyl-accepting chemotaxis genes with an optimized method highlights key function of CheM in Salmonella Typhimurium.

    Science.gov (United States)

    Hoffmann, Stefanie; Schmidt, Christiane; Walter, Steffi; Bender, Jennifer K; Gerlach, Roman G

    2017-01-01

    Site-directed scarless mutagenesis is an essential tool of modern pathogenesis research. We describe an optimized two-step protocol for genome editing in Salmonella enterica serovar Typhimurium to enable multiple sequential mutagenesis steps in a single strain. The system is based on the λ Red recombinase-catalyzed integration of a selectable antibiotics resistance marker followed by replacement of this cassette. Markerless mutants are selected by expressing the meganuclease I-SceI which induces double-strand breaks in bacteria still harboring the resistance locus. Our new dual-functional plasmid pWRG730 allows for heat-inducible expression of the λ Red recombinase and tet-inducible production of I-SceI. Methyl-accepting chemotaxis proteins (MCP) are transmembrane chemoreceptors for a vast set of environmental signals including amino acids, sugars, ions and oxygen. Based on the sensory input of MCPs, chemotaxis is a key component for Salmonella virulence. To determine the contribution of individual MCPs we sequentially deleted seven MCP genes. The individual mutations were validated by PCR and genetic integrity of the final seven MCP mutant WRG279 was confirmed by whole genome sequencing. The successive MCP mutants were functionally tested in a HeLa cell infection model which revealed increased invasion rates for non-chemotactic mutants and strains lacking the MCP CheM (Tar). The phenotype of WRG279 was reversed with plasmid-based expression of CheM. The complemented WRG279 mutant showed also partially restored chemotaxis in swarming assays on semi-solid agar. Our optimized scarless deletion protocol enables efficient and precise manipulation of the Salmonella genome. As demonstrated with whole genome sequencing, multiple subsequent mutagenesis steps can be realized without the introduction of unwanted mutations. The sequential deletion of seven MCP genes revealed a significant role of CheM for the interaction of S. Typhimurium with host cells which might give

  5. Deletion of the Saccharomyces cerevisiae ARO8 gene, encoding an aromatic amino acid transaminase, enhances phenylethanol production from glucose.

    Science.gov (United States)

    Romagnoli, Gabriele; Knijnenburg, Theo A; Liti, Gianni; Louis, Edward J; Pronk, Jack T; Daran, Jean-Marc

    2015-01-01

    Phenylethanol has a characteristic rose-like aroma that makes it a popular ingredient in foods, beverages and cosmetics. Microbial production of phenylethanol currently relies on whole-cell bioconversion of phenylalanine with yeasts that harbour an Ehrlich pathway for phenylalanine catabolism. Complete biosynthesis of phenylethanol from a cheap carbon source, such as glucose, provides an economically attractive alternative for phenylalanine bioconversion. In this study, synthetic genetic array (SGA) screening was applied to identify genes involved in regulation of phenylethanol synthesis in Saccharomyces cerevisiae. The screen focused on transcriptional regulation of ARO10, which encodes the major decarboxylase involved in conversion of phenylpyruvate to phenylethanol. A deletion in ARO8, which encodes an aromatic amino acid transaminase, was found to underlie the transcriptional upregulation of ARO10 during growth, with ammonium sulphate as the sole nitrogen source. Physiological characterization revealed that the aro8Δ mutation led to substantial changes in the absolute and relative intracellular concentrations of amino acids. Moreover, deletion of ARO8 led to de novo production of phenylethanol during growth on a glucose synthetic medium with ammonium as the sole nitrogen source. The aro8Δ mutation also stimulated phenylethanol production when combined with other, previously documented, mutations that deregulate aromatic amino acid biosynthesis in S. cerevisiae. The resulting engineered S. cerevisiae strain produced >3 mm phenylethanol from glucose during growth on a simple synthetic medium. The strong impact of a transaminase deletion on intracellular amino acid concentrations opens new possibilities for yeast-based production of amino acid-derived products.

  6. Generation of diversity in Streptococcus mutans genes demonstrated by MLST.

    Directory of Open Access Journals (Sweden)

    Thuy Do

    Full Text Available Streptococcus mutans, consisting of serotypes c, e, f and k, is an oral aciduric organism associated with the initiation and progression of dental caries. A total of 135 independent Streptococcus mutans strains from caries-free and caries-active subjects isolated from various geographical locations were examined in two versions of an MLST scheme consisting of either 6 housekeeping genes [accC (acetyl-CoA carboxylase biotin carboxylase subunit, gki (glucokinase, lepA (GTP-binding protein, recP (transketolase, sodA (superoxide dismutase, and tyrS (tyrosyl-tRNA synthetase] or the housekeeping genes supplemented with 2 extracellular putative virulence genes [gtfB (glucosyltransferase B and spaP (surface protein antigen I/II] to increase sequence type diversity. The number of alleles found varied between 20 (lepA and 37 (spaP. Overall, 121 sequence types (STs were defined using the housekeeping genes alone and 122 with all genes. However pi, nucleotide diversity per site, was low for all loci being in the range 0.019-0.007. The virulence genes exhibited the greatest nucleotide diversity and the recombination/mutation ratio was 0.67 [95% confidence interval 0.3-1.15] compared to 8.3 [95% confidence interval 5.0-14.5] for the 6 concatenated housekeeping genes alone. The ML trees generated for individual MLST loci were significantly incongruent and not significantly different from random trees. Analysis using ClonalFrame indicated that the majority of isolates were singletons and no evidence for a clonal structure or evidence to support serotype c strains as the ancestral S. mutans strain was apparent. There was also no evidence of a geographical distribution of individual isolates or that particular isolate clusters were associated with caries. The overall low sequence diversity suggests that S. mutans is a newly emerged species which has not accumulated large numbers of mutations but those that have occurred have been shuffled as a consequence of

  7. Generation of diversity in Streptococcus mutans genes demonstrated by MLST.

    Science.gov (United States)

    Do, Thuy; Gilbert, Steven C; Clark, Douglas; Ali, Farida; Fatturi Parolo, Clarissa C; Maltz, Marisa; Russell, Roy R; Holbrook, Peter; Wade, William G; Beighton, David

    2010-02-05

    Streptococcus mutans, consisting of serotypes c, e, f and k, is an oral aciduric organism associated with the initiation and progression of dental caries. A total of 135 independent Streptococcus mutans strains from caries-free and caries-active subjects isolated from various geographical locations were examined in two versions of an MLST scheme consisting of either 6 housekeeping genes [accC (acetyl-CoA carboxylase biotin carboxylase subunit), gki (glucokinase), lepA (GTP-binding protein), recP (transketolase), sodA (superoxide dismutase), and tyrS (tyrosyl-tRNA synthetase)] or the housekeeping genes supplemented with 2 extracellular putative virulence genes [gtfB (glucosyltransferase B) and spaP (surface protein antigen I/II)] to increase sequence type diversity. The number of alleles found varied between 20 (lepA) and 37 (spaP). Overall, 121 sequence types (STs) were defined using the housekeeping genes alone and 122 with all genes. However pi, nucleotide diversity per site, was low for all loci being in the range 0.019-0.007. The virulence genes exhibited the greatest nucleotide diversity and the recombination/mutation ratio was 0.67 [95% confidence interval 0.3-1.15] compared to 8.3 [95% confidence interval 5.0-14.5] for the 6 concatenated housekeeping genes alone. The ML trees generated for individual MLST loci were significantly incongruent and not significantly different from random trees. Analysis using ClonalFrame indicated that the majority of isolates were singletons and no evidence for a clonal structure or evidence to support serotype c strains as the ancestral S. mutans strain was apparent. There was also no evidence of a geographical distribution of individual isolates or that particular isolate clusters were associated with caries. The overall low sequence diversity suggests that S. mutans is a newly emerged species which has not accumulated large numbers of mutations but those that have occurred have been shuffled as a consequence of intra

  8. Deletions within the mouse beta-globin locus control region preferentially reduce beta(min) globin gene expression.

    Science.gov (United States)

    Alami, R; Bender, M A; Feng, Y Q; Fiering, S N; Hug, B A; Ley, T J; Groudine, M; Bouhassira, E E

    2000-02-01

    The mouse beta-globin gene cluster is regulated, at least in part, by a locus control region (LCR) composed of several developmentally stable DNase I hypersensitive sites located upstream of the genes. In this report, we examine the level of expression of the beta(min) and beta(maj) genes in adult mice in which HS2, HS3, or HS5,6 has been either deleted or replaced by a selectable marker via homologous recombination in ES cells. Primer extension analysis of RNA extracted from circulating reticulocytes and HPLC analysis of globin chains from peripheral red blood cells revealed that all mutations that reduce the overall output of the locus preferentially decrease beta(min) expression over beta(maj). The implications of these findings for the mechanism by which the LCR controls expression of the beta(maj) and beta(min) promoters are discussed.

  9. Tph2 gene deletion enhances amphetamine-induced hypermotility: effect of 5-HT restoration and role of striatal noradrenaline release.

    Science.gov (United States)

    Carli, Mirjana; Kostoula, Chrysaugi; Sacchetti, Giuseppina; Mainolfi, Pierangela; Anastasia, Alessia; Villani, Claudia; Invernizzi, Roberto William

    2015-11-01

    Variants of tryptophan hydroxylase-2 (Tph2), the gene encoding enzyme responsible for the synthesis of brain serotonin (5-HT), have been associated with neuropsychiatric disorders, substance abuse and addiction. This study assessed the effect of Tph2 gene deletion on motor behavior and found that motor activity induced by 2.5 and 5 mg/kg amphetamine was enhanced in Tph2(-/-) mice. Using the in vivo microdialysis technique we found that the ability of amphetamine to stimulate noradrenaline (NA) release in the striatum was reduced by about 50% in Tph2(-/-) mice while the release of dopamine (DA) was not affected. Tph2 deletion did not affect the release of NA and DA in the prefrontal cortex. The role of endogenous 5-HT in enhancing the effect of amphetamine was confirmed showing that treatment with the 5-HT precursor 5-hydroxytryptophan (10 mg/kg) restored tissue and extracellular levels of brain 5-HT and the effects of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. Treatment with the NA precursor dihydroxyphenylserine (400 mg/kg) was sufficient to restore the effect of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. These findings indicate that amphetamine-induced hyperactivity is attenuated by endogenous 5-HT through the inhibition of striatal NA release. Tph2(-/-) mice may be a useful preclinical model to assess the role of 5-HT-dependent mechanisms in the action of psychostimulants. Acute sensitivity to the motor effects of amphetamine has been associated to increased risk of psychostimulant abuse. Here, we show that deletion of Tph2, the gene responsible for brain 5-HT synthesis, enhances the motor effect of amphetamine in mice through the inhibition of striatal NA release. This suggests that Tph2(-/-) mice is a useful preclinical model to assess the role of 5-HT-dependent mechanisms in psychostimulants action. Tph2, tryptophan hydroxylase-2.

  10. IL-2R{gamma} gene microdeletion demonstrates that canine X-linked severe combined immunodeficiency is a homologue of the human disease

    Energy Technology Data Exchange (ETDEWEB)

    Henthorn, P.S.; Fimiani, V.M.; Patterson, D.F. [Univ. of Pennsylvania School of Veterinary Medicine, Philadelphia, PA (United States)] [and others

    1994-09-01

    X-linked severe combined immunodeficiency (SCID) is characterized by profound defects in cellular and humoral immunity and, in humans, is associated with mutations in the gene for the {gamma} chain of the IL-2 receptor (IL-2R{gamma}). We have examined this gene in a colony of dogs established from a single X-linked SCID carrier female. Affected dogs have a 4-bp deletion in the first exon of the IL-2R{gamma} gene, which precludes the production of a functional protein, demonstrating that the canine disease is a true homologue of human X-linked SCID. 37 refs., 3 figs.

  11. Mechanistic Evaluation for Mixed-field Agglutination in the K562 Cell Study Model with Exon 3 Deletion of A1 Gene.

    Science.gov (United States)

    Chen, Ding-Ping; Tseng, Ching-Ping; Lin, Chi-Jui; Wang, Wei-Ting; Sun, Chien-Feng

    2015-01-01

    In the case of blood type B3 with typical mixed-field agglutination of RBCs in the presence of anti-B or anti-AB antibody, a number of genetic alternations have been reported. It is well known that the IVS3+5G→A mutation in the B gene destroys the consensus of the splice donor site leading to exon 3 skipping during mRNA splicing. The lack of exon 3 likely causes a short stem region, producing an unstable B3 protein, and is concomitant with a decrease in B3 protein expression. Whether the phenomenon also appears in the type A blood group is of question. In this study, we evaluate whether exon 3 deletion in the blood type A gene also results in mixed-field phenotype. Site-directed mutagenesis was used to generate cDNA encoding A1 gene with exon 3 deletion. The cDNA was stably expressed in K562 cells. The expression of A antigen was compared with expression in parental K562 cells that did not express A antigen and in the stable K562 cell line expressing A(1) cDNA by flow cytometry analyses. The expression of A antigen in A1 stable cells and parental K562 cells was set as 100% and 0%, respectively. The mean relative percentage of A antigen expression for the cells of A1 with exon 3 deletion was 59.9% of A1 stable cells. Consistent with the observations of B3, which is B gene with exon 3 deletion, mixed field agglutination was observed for the cells expressing A1 with exon 3 deletion. Exon 3 deletion results in mixed field phenotype in both type A and B RBCs. However, the degree of antigen expression change for exon 3 deletion in A gene was less severe when compared with the deletion occurred in B gene.

  12. STUDY OF THE DELETION MUTATION OF GLUTATHIONE S TRANSFERASE M1 GENE AND ITS ROLE IN SUSCEPTIBILITY TO HEPATOCELLULAR CARCINOMA

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objection: To investigate the glutathione S transferase M1 (GSTM1) gene inherent deletion and its relation to prevalence of hepatocellular carcinoma (HCC) in Guangxi, China. Methods: The GSTM1 gene polymorphism of 120 HCC patients and 100 healthy subjects both from the same high aflatoxin B1 (AFB1) contaminated area were detected using PCR technique with special primers. Another 40 patients from AFB1 low risk area were also tested. Results: In HCC high risk area, it was found that the frequencies of GSTM1 null genotype in HCC patients and healthy subjects were 59% and 51% respectively, with no significant difference. However, the frequency of GSTM1-null genotype in control group from AFB1 low risk area was lower than those from high risk area (P<0.01). Conclusion: Populations in this HCC endemic region show a higher rate of GSTM1-null genotype, which may be partially responsible for the susceptibility to AFB1 induced HCC. But the detoxification effect of GSTM1 alone is not sufficient to resist the genetic toxicity of AFB1, especially in those people who expose to excess AFB1. The GSTM1 gene deletion would not be suitable as an independent predictor of susceptibility to HCC.

  13. Molecular cloning and chromosomal localization of the human cyclin C (CCNC) and cyclin E (CCNE) genes: Deletion of the CCNC gene in human tumors

    Energy Technology Data Exchange (ETDEWEB)

    Li, Haimin; Lahti, J.M.; Kidd, V.J. [St. Jude Children`s Research Hospital, Memphis, TN (United States)] [and others

    1996-03-01

    The human G1-phase cyclins are important regulators of cell cycle progression that interact with various cyclin-dependent kinases and facilitate entry into S-phase. We have confirmed the localization of the human cyclin C (CCNC) gene to chromosome 6q21 and of human cyclin E (CCNE to 19q12). The CCNC gene structure was also determined, and we have shown that it is deleted in a subset of acute lymphoblastic leukemias, including a patient sample containing a t(2;6)(p21;q15), with no apparent cytogenetic deletion. Single-strand conformational polymorphism analysis of the remaining CCNC allele from patients with a deletion of one allele established that there were no further mutations within the exons or the flanking intronic sequences. These results suggest either that haploinsufficiency of the cyclin C protein is sufficient to promote tumorigenesis or that the important tumor suppressor gene is linked to the CCNC locus. 48 refs., 4 figs., 1 tab.

  14. Deletion of genes implicated in protecting the integrity of male germ cells has differential effects on the incidence of DNA breaks and germ cell loss.

    Directory of Open Access Journals (Sweden)

    Catriona Paul

    Full Text Available BACKGROUND: Infertility affects approximately 20% of couples in Europe and in 50% of cases the problem lies with the male partner. The impact of damaged DNA originating in the male germ line on infertility is poorly understood but may increase miscarriage. Mouse models allow us to investigate how deficiencies in DNA repair/damage response pathways impact on formation and function of male germ cells. We have investigated mice with deletions of ERCC1 (excision repair cross-complementing gene 1, MSH2 (MutS homolog 2, involved in mismatch repair pathway, and p53 (tumour suppressor gene implicated in elimination of germ cells with DNA damage. PRINCIPAL FINDINGS: We demonstrate for the first time that depletion of ERCC1 or p53 from germ cells results in an increased incidence of unrepaired DNA breaks in pachytene spermatocytes and increased numbers of caspase-3 positive (apoptotic germ cells. Sertoli cell-only tubules were detected in testes from mice lacking expression of ERCC1 or MSH2 but not p53. The number of sperm recovered from epididymes was significantly reduced in mice lacking testicular ERCC1 and 40% of sperm contained DNA breaks whereas the numbers of sperm were not different to controls in adult Msh2 -/- or p53 -/- mice nor did they have significantly compromised DNA. CONCLUSIONS: These data have demonstrated that deletion of Ercc1, Msh2 and p53 can have differential but overlapping affects on germ cell function and sperm production. These findings increase our understanding of the ways in which gene mutations can have an impact on male fertility.

  15. Analysis of p16 gene mutation, deletion and methylation in patients with arseniasis produced by indoor unventilated-stove coal usage in Guizhou, China

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, A.H.; Bin, H.H.; Pan, X.L.; Xi, X.G. [Guiyang Medical College, Guiyang (China). School of Public Health

    2007-07-01

    The aim of this study was to determine p16 gene mutation, deletion, and promoter 5' CpG island hypermethylation in peripheral blood mononuclear leukocyte of patients with arseniasis as attributed to exposure to indoor unventilated coal stove. The role of the aberrant change of p16 gene in the induction and development of carcinogenesis in endemic arsenisiasis region in China was also examined. Polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP), multiplex PCR (mPCR), methylation-specific PCR (MSP), and sequencing techniques were performed to detect (1) mutation of the p16 gene exon 2, (2) homozygous deletion of the p16 gene exon 1 and exon 2, and (3) hypermethylation of the promoter CpG island in peripheral blood mononuclear leukocyte of patients with arseniasis. Results showed no mutation was found in exon 2 of p16 gene. The homozygous deletion frequency of p16 gene was 5 and 15% in control and arseniasis patients, respectively. The homozygous deletion occurred mainly in exon 2, with significant deletion frequencies of 9, 13, and 20% in mild, intermediate, and severe arseniasis groups. The significant homozygous deletion frequency was 9 and 39% in noncarcinoma and carcinoma individuals. The positive rate of p16 gene promoter CpG island hyermethylation was 42 and 2% in the exposed group and the control group, respectively. The positive rate was 26, 42, and 50% in mild, intermediate, and severe arseniasis. The marked different positive rate was 22 and 56% in noncarcinoma and carcinoma individuals, respectively. In conclusion, homozygous deletion and hypermethylation of p16 gene may play an important role in the initiation and development of manifestations seen in endemic arseniasis including carcinogenesis.

  16. Detection of deletion in the dystrophin gene of a patient with quadriceps myopathy.

    Directory of Open Access Journals (Sweden)

    Kumari D

    2000-01-01

    Full Text Available A 43 year old male presented with slowly progressive weakness of limbs and hypertrophy of triceps, brachioradialis and calf muscles for four years. There was thinning of quadriceps muscles in both thighs. Histological study was compatible with Becker muscular dystrophy (BMD. Genomic DNA analysis showed a deletion of the Hind III fragments, spanning exons 45-47. A junction fragment of 11.0 kb was observed along with a deletion of a 3.4 kb PstI fragment containing exon 51 in the patient, and in one of his two sisters. The clinical and laboratory characteristics in this patient are in keeping with what has been described ′quadriceps myopathy′ and fall within the phenotypic variants of BMD as has been shown by others.

  17. Truncated photosystem chlorophyll antenna size in the green microalga Chlamydomonas reinhardtii upon deletion of the TLA3-CpSRP43 gene.

    Science.gov (United States)

    Kirst, Henning; Garcia-Cerdan, Jose Gines; Zurbriggen, Andreas; Ruehle, Thilo; Melis, Anastasios

    2012-12-01

    The truncated light-harvesting antenna size3 (tla3) DNA insertional transformant of Chlamydomonas reinhardtii is a chlorophyll-deficient mutant with a lighter green phenotype, a lower chlorophyll (Chl) per cell content, and higher Chl a/b ratio than corresponding wild-type strains. Functional analyses revealed a higher intensity for the saturation of photosynthesis and greater light-saturated photosynthetic activity in the tla3 mutant than in the wild type and a Chl antenna size of the photosystems that was only about 40% of that in the wild type. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western-blot analyses showed that the tla3 strain was deficient in the Chl a/b light-harvesting complex. Molecular and genetic analyses revealed a single plasmid insertion in chromosome 4 of the tla3 nuclear genome, causing deletion of predicted gene g5047 and plasmid insertion within the fourth intron of downstream-predicted gene g5046. Complementation studies defined that gene g5047 alone was necessary and sufficient to rescue the tla3 mutation. Gene g5047 encodes a C. reinhardtii homolog of the chloroplast-localized SRP43 signal recognition particle, whose occurrence and function in green microalgae has not hitherto been investigated. Biochemical analysis showed that the nucleus-encoded and chloroplast-localized CrCpSRP43 protein specifically operates in the assembly of the peripheral components of the Chl a/b light-harvesting antenna. This work demonstrates that cpsrp43 deletion in green microalgae can be employed to generate tla mutants with a substantially diminished Chl antenna size. The latter exhibit improved solar energy conversion efficiency and photosynthetic productivity under mass culture and bright sunlight conditions.

  18. Mice with a targeted deletion of the tetranectin gene exhibit a spinal deformity

    DEFF Research Database (Denmark)

    Iba, K; Durkin, M E; Johnsen, L;

    2001-01-01

    and muscle. To test the functional role of tetranectin directly, we have generated mice with a targeted disruption of the gene. We report that the tetranectin-deficient mice exhibit kyphosis, a type of spinal deformity characterized by an increased curvature of the thoracic spine. The kyphotic angles were...... in the morphology of the vertebrae. Histological analysis of the spines of these mice revealed an apparently asymmetric development of the growth plate and of the intervertebral disks of the vertebrae. In the most advanced cases, the growth plates appeared disorganized and irregular, with the disk material...... protruding through the growth plate. Tetranectin-null mice had a normal peak bone mass density and were not more susceptible to ovariectomy-induced osteoporosis than were their littermates as determined by dual-emission X-ray absorptiometry scanning. These results demonstrate that tetranectin plays a role...

  19. Genetic basis of growth adaptation of Escherichia coli after deletion of pgi, a major metabolic gene.

    Science.gov (United States)

    Charusanti, Pep; Conrad, Tom M; Knight, Eric M; Venkataraman, Karthik; Fong, Nicole L; Xie, Bin; Gao, Yuan; Palsson, Bernhard Ø

    2010-11-04

    Bacterial survival requires adaptation to different environmental perturbations such as exposure to antibiotics, changes in temperature or oxygen levels, DNA damage, and alternative nutrient sources. During adaptation, bacteria often develop beneficial mutations that confer increased fitness in the new environment. Adaptation to the loss of a major non-essential gene product that cripples growth, however, has not been studied at the whole-genome level. We investigated the ability of Escherichia coli K-12 MG1655 to overcome the loss of phosphoglucose isomerase (pgi) by adaptively evolving ten replicates of E. coli lacking pgi for 50 days in glucose M9 minimal medium and by characterizing endpoint clones through whole-genome re-sequencing and phenotype profiling. We found that 1) the growth rates for all ten endpoint clones increased approximately 3-fold over the 50-day period; 2) two to five mutations arose during adaptation, most frequently in the NADH/NADPH transhydrogenases udhA and pntAB and in the stress-associated sigma factor rpoS; and 3) despite similar growth rates, at least three distinct endpoint phenotypes developed as defined by different rates of acetate and formate secretion. These results demonstrate that E. coli can adapt to the loss of a major metabolic gene product with only a handful of mutations and that adaptation can result in multiple, alternative phenotypes.

  20. Prodynorphin gene deletion increased anxiety-like behaviours, impaired the anxiolytic effect of bromazepam and altered GABAA receptor subunits gene expression in the amygdala.

    Science.gov (United States)

    Femenía, Teresa; Pérez-Rial, Sandra; Urigüen, Leyre; Manzanares, Jorge

    2011-01-01

    This study evaluated the role of prodynorphin gene in the regulation of anxiety and associated molecular mechanisms. Emotional responses were assessed using the light-dark test, elevated plus maze and social interaction tests in prodynorphin knockout and wild-type mice. Corticotrophin releasing factor and proopiomelanocortin gene expressions in the hypothalamus were evaluated after restraint stress using in situ hybridization. The anxiolytic efficacy of bromazepam and GABA(A) receptor subunits gene expression in the amygdala were also assessed in both genotypes. The deletion of prodynorphin increased anxiety-like behaviours and proopiomelanocortin gene expression in the arcuate nucleus (two-fold). Moreover, the anxiolytic action of bromazepam was significantly attenuated in the mutant mice. Decreased GABA(A)γ(2) and increased GABA(A)β(2) gene expression receptor subunits were found in the amygdala of prodynorphin knockout mice. These results indicate that deletion of prodynorphin gene is associated with increased anxiety-like behaviours, enhanced sensibility response to stress stimuli, reduced anxiolytic efficacy of bromazepam and altered expression of the GABA(A) receptor subunits.

  1. Generation of Diversity in Streptococcus mutans Genes Demonstrated by MLST

    OpenAIRE

    Thuy Do; Gilbert, Steven C.; Douglas Clark; Farida Ali; Clarissa C Fatturi Parolo; Marisa Maltz; Russell, Roy R.; Peter Holbrook; Wade, William G.; David Beighton

    2010-01-01

    Streptococcus mutans, consisting of serotypes c, e, f and k, is an oral aciduric organism associated with the initiation and progression of dental caries. A total of 135 independent Streptococcus mutans strains from caries-free and caries-active subjects isolated from various geographical locations were examined in two versions of an MLST scheme consisting of either 6 housekeeping genes [accC (acetyl-CoA carboxylase biotin carboxylase subunit), gki (glucokinase), lepA (GTP-binding protein), r...

  2. CNS-restricted Transduction and CRISPR/Cas9-mediated Gene Deletion with an Engineered AAV Vector

    Directory of Open Access Journals (Sweden)

    Giridhar Murlidharan

    2016-01-01

    Full Text Available Gene therapy using recombinant adeno-associated viral (AAV vectors is emerging as a promising approach to treat central nervous system disorders such as Spinal muscular atrophy, Batten, Parkinson and Alzheimer disease amongst others. A critical remaining challenge for central nervous system-targeted gene therapy, silencing or gene editing is to limit potential vector dose-related toxicity in off-target cells and organs. Here, we characterize a lab-derived AAV chimeric (AAV2g9, which displays favorable central nervous system attributes derived from both parental counterparts, AAV2 and AAV9. This synthetic AAV strain displays preferential, robust, and widespread neuronal transduction within the brain and decreased glial tropism. Importantly, we observed minimal systemic leakage, decreased sequestration and gene transfer in off-target organs with AAV2g9, when administered into the cerebrospinal fluid. A single intracranial injection of AAV2g9 vectors encoding guide RNAs targeting the schizophrenia risk gene MIR137 (encoding MIR137 in CRISPR/Cas9 knockin mice resulted in brain-specific gene deletion with no detectable events in the liver. This engineered AAV vector is a promising platform for treating neurological disorders through gene therapy, silencing or editing modalities.

  3. Characterization of 11p14-p12 deletion in WAGR syndrome by array CGH for identifying genes contributing to mental retardation and autism.

    Science.gov (United States)

    Xu, S; Han, J C; Morales, A; Menzie, C M; Williams, K; Fan, Y-S

    2008-01-01

    WAGR (Wilms tumor, Aniridia, Genitourinary malformations and mental Retardation) syndrome is a rare genomic disorder caused by deletion of the 11p14-p12 chromosome region. The majority of WAGR patients have mental retardation and behavioral problems, and more than 20% of the patients also have features of autism. While the Wilms tumor/genitourinary anomalies and aniridia are caused by deletion of WT1 and PAX6 respectively, the genomic cause of mental retardation and autism in WAGR syndrome remains unknown. Using oligonucleotide arrays, we have characterized the 11p14-p12 deletions in 31 patients and identified all the genes involved in each deletion. The deletions had sizes ranging from 4.9 to 23 Mb that encompass 18-62 genes (40 on average). In addition to WT1 and PAX6, all the patients had deletion of PRRG4 (transmembrane gamma-carboxyglutamic acid protein 4). The majority of them had deletion of BDNF (brain-derived neurotrophic factor) and SLC1A2 [solute carrier family 1 (glial high affinity glutamate transporter) member 2]. Deletion of BDNF and SLC1A2 occurred in patients with autism more frequently than in those without autism. Literature review on the functions of the genes suggests that haploinsufficiency of SLC1A2, PRRG4, and BDNF may contribute to mental retardation and behavioral problems. In particular, BDNF may modulate the risk of autism in WAGR patients as suggested by its link with Rett syndrome as a target of MECP2. We observed that all the de novo deletions occurred in the chromosome 11 inherited from the father in the families genotyped, implying a predisposition for de novo mutations occurring in spermatogenesis and possible involvement of imprinting in cognitive impairment in WAGR patients. Copyright 2008 S. Karger AG, Basel.

  4. Role of the RuvAB protein in avoiding spontaneous formation of deletion mutations in the Escherichia coli K-12 endogenous tonB gene.

    Science.gov (United States)

    Mashimo, Kazumi; Nagata, Yuki; Kawata, Masakado; Iwasaki, Hiroshi; Yamamoto, Kazuo

    2004-10-08

    The endogenous tonB gene of Escherichia coli was used as a target for spontaneous deletion mutations which were isolated from ruvAB-, recG-, and ruvC- cells. The rates of tonB mutation were essentially the same in ruv+, ruvAB-, recG-, and ruvC- cells. We analyzed tonB mutants by sequencing. In the ruv+, recG-, and ruvC- strains, the spectra were different from those obtained from the ruvAB- cells, where deletions dominated followed by IS insertions, base substitutions, and frameshifts, in that order. We then analyzed the tonB-trp large deletion, due to simultaneous mutations of the trp operon, and found that the frequency in ruvAB- was higher than those in ruv+, recG-, and ruvC- cells. To characterize deletion formation further, we analyzed all the tonB mutants from one colicin plate. Seven deletions were identified at five sites from the 45 tonB mutants of ruv+ cells and 24 deletions at 11 sites from the 43 tonB mutants of ruvAB- cells. Thus, the ruvAB- strain is a deletion mutator. We discuss the role of RuvAB in avoiding deletions. Copyright 2004 Elsevier Inc.

  5. Screening Duchenne and Becker muscular dystrophy patients for deletions in 30 exons of the dystrophin gene by three-multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Risch, N. (Yale Univ., New Haven, CT (United States))

    1992-09-01

    Deletion mutations of the dystrophin gene may cause either the severe Duchenne muscular dystrophy (DMD) or the milder, allelic Becker muscular dystrophy (BMD) and are clustered in two high-frequency-deletion regions (HFDRs) located, respectively, 500 kb and 1,200 kb downstream from the 5[prime] end of the gene. Three PCR reactions described allowed the analysis of a total of 30 exons and led, to the identification of three additional deletions involving the following exons: (a) 42 only, (b) 28-42, and (c) 16 only, none of which were detected with the two original multiplex reactions. Therefore, the three modified multiplexes detected 95 of the 96 deletions identified among the 152 patients studied so far by using Southern analysis and cDNA probes. The only deletion that remained undetected with this system involves exons 22-25 and generates the junction fragment described elsewhere. The percentage of deletion mutations among DMS/BMD patients amounts to 63%, which is in agreement with similar estimates from other laboratories. When field-inversion gel electrophoresis is coupled to Southern analysis, the detection rate of deletion and duplication mutations reaches 65%.

  6. Both gene deletion and promoter hyper-methylation contribute to the down-regulation of ZAC/PLAGL1 gene in gastric adenocarcinomas: a case control study.

    Science.gov (United States)

    Li, Zhi; Ding, Yi; Zhu, Yunliang; Yin, Mingxing; Le, Xiaoping; Wang, Luo; Yang, Yang; Zhang, Qinxian

    2014-12-01

    Pleiomorphic adenoma gene-like 1 (PLAGL1, also known as LOT1 and ZAC) is a zinc-finger nuclear transcription factor, which possesses antiproliferative effects and is frequently epigenetically silenced during tumorigenesis. PLAGL1 gene is located on 6q24-25, a chromosomal region that is frequently deleted in various kinds of cancers. Both promoter hyper-methylation and loss of heterozygosity may lead to the down-regulation of PLAGL1 in human somatic cancers. Here we aimed to investigate the abnormalities of PLAGL1 in gastric cancers. We collected 153 case-matched gastric adenocarcinoma (GAC) cases. Quantitative real-time PCR method was applied to evaluate the expression levels as well as gene copy numbers of PLAGL1 in the collected samples. Methylation-specific PCR (MSP) assay was performed to analyze the methylation status of PLAGL1 P1 promoter. Decreased expression of PLAGL1 mRNA was observed in GAC tissues, especially in advanced GACs. Copy number decrease of PLAGL1 gene in GACs was observed in 9.15% (19 out of 153) of the GAC samples and was closely correlated with gene expression. Methylation status of PLAGL1 promoter in GAC tissues was higher than in normal controls, which was inversely correlated with the expression levels of PLAGL1 mRNA. DNA deletion and promoter hyper-methylation both contribute to the down-regulation of PLAGL1 in GACs. Copyright © 2013. Published by Elsevier Masson SAS.

  7. Relationship between gastric disease and deletion of cag pathogenicity island genes of Helicobacter pylori in gastric juice.

    Science.gov (United States)

    Kawamura, Osamu; Murakami, Masami; Araki, Osamu; Yamada, Takuro; Tomizawa, Sayaka; Shimoyama, Yasuyuki; Minashi, Keiko; Maeda, Masaki; Kusano, Motoyasu; Mori, Masatomo

    2003-01-01

    The cag pathogenicity island genes of Helicobacter pylori (ie, cag1, cag5, cagT, cagE, and cagA) were detected by PCR in DNA extracted from endoscopically collected gastric juice, and the relationship between these genes and gastric disease was studied in 25 patients with early gastric cancer, 9 patients with gastric ulcer, and 15 patients with chronic active gastritis. In three patients with early gastric cancer and one patient with gastric ulcer, cag pathogenicity island genes were amplified although H. pylori was not detected by conventional methods. Compared with conventional methods, the sensitivity of detection of cag genes was 92.3% (36/39) and the specificity was 60% (6/10). Among the patients with cagA amplification, only cagE was not amplified in one case each with early cancer and chronic active gastritis. In addition, none of cag1, cag5, cagT, and cagE were amplified in spite of cagA amplification in one patient with gastric ulcer. This method is a simple procedure, has a high sensitivity, and appears to be useful for accurate assessment of infection with cagA-positive strains. Because deletion of cag PAI genes was found in the patients with all three gastric diseases that we studied, it was suggested that the pathogenicity of H. pylori might not be determined by cag PAI genes in those cases.

  8. Variations in angiotensin-converting enzyme gene insertion/deletion polymorphism in Indian populations of different ethnic origins

    Indian Academy of Sciences (India)

    M A Qadar Pasha; Amjad P Khan; Ratan Kumar; Rekh B Ram; Surinder K Grover; Kaushal K Srivastava; William Selvamurthy; Samir K Brahmachari

    2002-02-01

    The pattern of angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism in the Indian population is poorly known. In order to determine the status of the polymorphism, young unrelated male army recruits were screened. The population had cultural and linguistic differences and lived in an environment that varied significantly from one region to another. Analysis of the genotype, showed higher frequency of the insertion allele in four of the five groups i.e. I allele frequency was significantly higher ( < 0.05) in Dogras, Assamese and Kumaonese. The deletion allele frequency was comparatively higher in the fifth group that belonged to Punjab. A correlation was observed between the genotype and enzyme activity. Involvement of a single D allele in the genotype enhanced the activity up to 37.56 ± 3.13%. The results suggested ethnic heterogeneity with a significant gene cline with higher insertion allele frequency. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics.

  9. Enhanced freeze tolerance of baker's yeast by overexpressed trehalose-6-phosphate synthase gene (TPS1) and deleted trehalase genes in frozen dough.

    Science.gov (United States)

    Tan, Haigang; Dong, Jian; Wang, Guanglu; Xu, Haiyan; Zhang, Cuiying; Xiao, Dongguang

    2014-08-01

    Several recombinant strains with overexpressed trehalose-6-phosphate synthase gene (TPS1) and/or deleted trehalase genes were obtained to elucidate the relationships between TPS1, trehalase genes, content of intracellular trehalose and freeze tolerance of baker's yeast, as well as improve the fermentation properties of lean dough after freezing. In this study, strain TL301(TPS1) overexpressing TPS1 showed 62.92 % higher trehalose-6-phosphate synthase (Tps1) activity and enhanced the content of intracellular trehalose than the parental strain. Deleting ATH1 exerted a significant effect on trehalase activities and the degradation amount of intracellular trehalose during the first 30 min of prefermentation. This finding indicates that acid trehalase (Ath1) plays a role in intracellular trehalose degradation. NTH2 encodes a functional neutral trehalase (Nth2) that was significantly involved in intracellular trehalose degradation in the absence of the NTH1 and/or ATH1 gene. The survival ratio, freeze-tolerance ratio and relative fermentation ability of strain TL301(TPS1) were approximately twice as high as those of the parental strain (BY6-9α). The increase in freeze tolerance of strain TL301(TPS1) was accompanied by relatively low trehalase activity, high Tps1 activity and high residual content of intracellular trehalose. Our results suggest that overexpressing TPS1 and deleting trehalase genes are sufficient to improve the freeze tolerance of baker's yeast in frozen dough. The present study provides guidance for the commercial baking industry as well as the research on the intracellular trehalose mobilization and freeze tolerance of baker's yeast.

  10. Novel deletion encompassing exons 5-12 of the UBE3A gene in a girl with Angelman syndrome.

    Science.gov (United States)

    Beleza-Meireles, Ana; Cerqueira, Rita; Sousa, Sérgio B; Palmeiro, Aida; Ramos, Lina

    2011-01-01

    Angelman syndrome (AS) is characterised by severe developmental delay, severe speech impairment, gait ataxia and/or limb tremor and a unique behavioural phenotype. The diagnosis of AS is based on a combination of clinical features and molecular genetic testing. Currently, molecular genetic testing (methylation analysis and UBE3A sequence analysis) identifies anomalies in about 90% of individuals. The aetiology of the remaining 10% is still unknown. We report a novel deletion encompassing the exons 5-12 of the UBE3A gene in a girl with AS, identified by MLPA (Multiplex Ligation-dependent Probe Amplification), which was not detected by the conventional diagnostic protocol. We propose that copy number analysis of the UBE3A gene should be considered in individuals whose clinical examination is strongly suggestive of AS, after more common mechanisms have been excluded. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  11. Frequent intragenic deletion of the P gene in Tanzanian patients with Type II oculocutaneous albinism (OCA2)

    Energy Technology Data Exchange (ETDEWEB)

    Spritz, R.; Fukai, K.; Holmes, S.A. [Univ. of Wisconsin, Madison, WI (United States)] [and others

    1995-06-01

    Type II oculocutaneous albinism (OCA2) is an autosomal recessive disorder in which the biosynthesis of melanin pigment is reduced in the skin, hair, and eyes. OCA2, which results from mutations of the P gene, is the most frequent type of albinism in African and African-American patients. OCA2 is especially frequent in Tanzania, where it occurs with an incidence of {approximately}1/1,400. We have identified abnormalities of the P gene in each of 13 unrelated patients with OCA2 from Tanzania. One of these, a deletion of exon 7, is strongly predominant, accounting for {approximately}77% of mutant alleles in this group of patients. 20 refs., 2 figs.

  12. A novel and de novo deletion in the OCRL1 gene associated with a severe form of Lowe syndrome.

    Science.gov (United States)

    Peces, Ramón; Peces, Carlos; de Sousa, Erika; Vega, Cristina; Selgas, Rafael; Nevado, Julián

    2013-12-01

    The oculocerebrorenal syndrome of Lowe (OCRL) is an X-linked disorder. The mutation of the gene OCRL1 localized at Xq26.1, coding for the enzyme phosphatidylinositol (4,5) bisphosphate (PIP2P) 5-phosphatase, is responsible for the phenotypic characteristics of the disease. We report a 22-year-old male with a severe form of OCRL syndrome, diagnosed on the basis of congenital cataracts, severe psychomotor and cognitive deficits, and renal tubular dysfunction without Fanconi syndrome. The patient presented low molecular weight proteinuria, nephrocalcinosis, nephrolithiasis, rickets, and growth retardation and developed progressive renal failure. Genetic analysis showed a novel and de novo deletion of exons 10-13 in the OCRL1 gene.

  13. Episodic Ataxia Type 2 due to a Deletion Mutation in the CACNA1A Gene in a Korean Family

    Science.gov (United States)

    Kim, Jeong-Min; Kim, Ji Soo; Ki, Chang-Seok

    2006-01-01

    Episodic ataxia type 2 (EA-2) is an inherited disorder that is characterized by intermittent vertigo, ataxia, and interictal gaze-evoked nystagmus. Although abnormalities associated with this disorder have been found in the CACNA1A gene encoding the alpha1A (Cav2.1) subunit of the P/Q-type calcium channel, there are few reports of genetically confirmed EA-2 in Korea. In 1998, a Korean family with acetazolamide-responsive hereditary paroxysmal ataxia was reported, but the genetic background was not defined at that time. In the present study we performed direct sequencing of the entire exons and their flanking intronic sequences of the CACNA1A gene and found a deletion mutation (c.2042_2043delAG). PMID:20396531

  14. Complete androgen insensitivity syndrome due to a new frameshift deletion in exon 4 of the androgen receptor gene: Functional analysis of the mutant receptor

    OpenAIRE

    Lobaccaro, J.M.; Lumbroso, S.; Poujol, Nicolas; Georget, V.; Brinkmann, Albert; Malpuech, Georges; Sultan, C.

    1995-01-01

    textabstractWe studied the androgen receptor gene in a large kindred with complete androgen insensitivity syndrome and negative receptor-binding activity, single-strand conformation polymorphism (SSCP) analysis and sequencing identified a 13 base pair deletion within exon 4. This was responsible for a predictive frameshift in the open reading frame and introduction of a premature stop codon at position 783 instead of 919. The deletion was reproduced in androgen receptor wildtype cDNA and tran...

  15. Delineation of a contiguous gene syndrome with multiple exostoses, enlarged parietal foramina, craniofacial dysostosis, and mental retardation, caused by deletions on the short arm of chromosome 11

    Energy Technology Data Exchange (ETDEWEB)

    Bartsch, O.; Werner, W.; Hinkel, G.K. [Univ. Hospital Dresden (Germany); Van Hul, W.; Willems, P.J. [Univ. of Antwerp (Belgium)] [and others

    1996-04-01

    A contiguous gene syndrome due to deletions of the proximal short arm of chromosome 11 is described in eight patients belonging to four families. The main clinical features are multiple exostoses, enlarged parietal foramina, craniofacial dysostosis, and mental retardation. The patients have cytogenetic and/or molecular deletions of chromosome 11p11-p13. These deletions are located between the centromere and D11S914 in a region of {approximately}20 cM. The present study confirms the presence of a multiple exostoses gene on chromosome 11p. Furthermore, it suggests that the gene for isolated foramina parietalia permagna and genes associated with craniofacial dysostosis and mental retardation reside in the same chromosomal region. 31 refs., 5 figs., 1 tab.

  16. Deletion of mouse FXR gene disturbs multiple neurotransmitter systems and alters neurobehavior.

    Science.gov (United States)

    Huang, Fei; Wang, Tingting; Lan, Yunyi; Yang, Li; Pan, Weihong; Zhu, Yonghui; Lv, Boyang; Wei, Yuting; Shi, Hailian; Wu, Hui; Zhang, Beibei; Wang, Jie; Duan, Xiaofeng; Hu, Zhibi; Wu, Xiaojun

    2015-01-01

    Farnesoid X receptor (FXR) is a nuclear hormone receptor involved in bile acid synthesis and homeostasis. Dysfunction of FXR is involved in cholestasis and atherosclerosis. FXR is prevalent in liver, gallbladder, and intestine, but it is not yet clear whether it modulates neurobehavior. In the current study, we tested the hypothesis that mouse FXR deficiency affects a specific subset of neurotransmitters and results in an unique behavioral phenotype. The FXR knockout mice showed less depressive-like and anxiety-related behavior, but increased motor activity. They had impaired memory and reduced motor coordination. There were changes of glutamatergic, GABAergic, serotoninergic, and norepinephrinergic neurotransmission in either hippocampus or cerebellum. FXR deletion decreased the amount of the GABA synthesis enzyme GAD65 in hippocampus but increased GABA transporter GAT1 in cerebral cortex. FXR deletion increased serum concentrations of many bile acids, including taurodehydrocholic acid, taurocholic acid, deoxycholic acid (DCA), glycocholic acid (GCA), tauro-α-muricholic acid, tauro-ω-muricholic acid, and hyodeoxycholic acid (HDCA). There were also changes in brain concentrations of taurocholic acid, taurodehydrocholic acid, tauro-ω-muricholic acid, tauro-β-muricholic acid, deoxycholic acid, and lithocholic acid (LCA). Taken together, the results from studies with FXR knockout mice suggest that FXR contributes to the homeostasis of multiple neurotransmitter systems in different brain regions and modulates neurobehavior. The effect appears to be at least partially mediated by bile acids that are known to cross the blood-brain barrier (BBB) inducing potential neurotoxicity.

  17. Effects of deletion of the prolactin receptor on ovarian gene expression

    Directory of Open Access Journals (Sweden)

    Kelly Paul A

    2003-02-01

    Full Text Available Abstract Prolactin (PRL exerts pleiotropic physiological effects in various cells and tissues, and is mainly considered as a regulator of reproduction and cell growth. Null mutation of the PRL receptor (R gene leads to female sterility due to a complete failure of embryo implantation. Pre-implantatory egg development, implantation and decidualization in the mouse appear to be dependent on ovarian rather than uterine PRLR expression, since progesterone replacement permits the rescue of normal implantation and early pregnancy. To better understand PRL receptor deficiency, we analyzed in detail ovarian and corpora lutea development of PRLR-/- females. The present study demonstrates that the ovulation rate is not different between PRLR+/+ and PRLR-/- mice. The corpus luteum is formed but an elevated level of apoptosis and extensive inhibition of angiogenesis occur during the luteal transition in the absence of prolactin signaling. These modifications lead to the decrease of LH receptor expression and consequently to a loss of the enzymatic cascades necessary to produce adequate levels of progesterone which are required for the maintenance of pregnancy.

  18. Deletion of the msdS/AfmsdC gene induces abnormal polarity and septation in Aspergillus fumigatus.

    Science.gov (United States)

    Li, Yanjie; Zhang, Lei; Wang, Depeng; Zhou, Hui; Ouyang, Haomiao; Ming, Jia; Jin, Cheng

    2008-07-01

    alpha-Mannosidases play an important role in the processing of mannose-containing glycans in eukaryotes. A deficiency in alpha-mannosidase is lethal in humans and cattle. In contrast to mammals, Saccharomyces cerevisiae does not require the endoplasmic reticulum alpha-mannosidase gene for growth. However, little is known of the consequence of loss of function of class I alpha-mannosidases in filamentous fungi. In this study, the msdS/AfmsdC gene was identified to encode 1,2-alpha-mannosidase MsdS in Aspergillus fumigatus. Soluble MsdS expressed in Escherichia coli was characterized as a typical class I alpha-mannosidase. The msdS gene was deleted by replacement of the msdS gene with a pyrG gene. Although the mutant showed a defect in N-glycan processing, as well as a reduction of cell wall components and a reduced ability of conidiation, it appeared that the rate of hyphal growth was not affected. Morphology analysis revealed abnormal polarity and septation at the stages of germination, hyphal growth and conidiation. Although the mechanism by which the N-glycan processing affects polarity and septation is unclear, our results show that msdS is involved in polarity and septation in A. fumigatus.

  19. Co-inheritance of --MED double gene deletion and αααAnti3.7 triplication on α-globin gene in Mazandaran at 2016

    Directory of Open Access Journals (Sweden)

    Hossein Jalali

    2017-02-01

    Full Text Available Alpha Thalassemia is one of the most prevalent disorders worldwide with a [T1] high carrier rate in Mazandaran province (north of Iran. Carriers of --MED double gene deletion are at risk of having a child with hemoglobin  haemoglobin[T2]  H (HbH disease, if they marry a silent carrier. Co-inheritance of αααAnti3.7 triplication that cannot be detected using hematological indices and β-globin gene mutations, in heterozygote states, leads to intermediate form of thalassemia. Using precise molecular analysis, the mutations that do not change the hematological parameters can be identified.  The diagnosis of these mutations is important in screening programs.   Multiplex Gap-PCR and reverse hybridization assay analysis were applied for the detection of mutations on α and β-globin genes in a patient with abnormal hematological[T3]  indices from Sari at 2016. A rare co-inheritance of --MED double gene deletion and αααAnti3.7 triplication was identified. The presented case can be at risk of having a child with HbH disease and thalassemia intermedia. So, the presented case shows the [T4] importance of precise molecular analysis in premarital screening in order to prevent having a child with thalassemia.

  20. Global transcription regulation by DNA topoisomerase I in exponentially growing Saccharomyces cerevisiae cells: activation of telomere-proximal genes by TOP1 deletion.

    Science.gov (United States)

    Lotito, Luca; Russo, Alessandra; Chillemi, Giovanni; Bueno, Susana; Cavalieri, Duccio; Capranico, Giovanni

    2008-03-21

    To establish the cellular functions of DNA topoisomerase I-B (Top1p) at a global level, we have determined the expression profiles and histone modification patterns affected by TOP1 gene deletion (DeltaTOP1) in Saccharomyces cerevisiae. In exponentially growing cells, DeltaTOP1 specifically increases transcription of telomere-proximal genes and decreases glucose utilization and energy production pathways. Immunoprecipitation data demonstrate that Top1p can bind to and is catalytically active at telomeric DNA repeats, and that both DeltaTOP1 and an inactive Y727F Top1p mutant increase H4 histone acetylation at telomere-proximal regions. Interestingly, while the Y727F mutation has no influence on enzyme recruitment to chromatin sites, it has a marked effect on H4 K16 acetylation at subtelomeric regions. The Top1p mutation also increases H3 histone K4 dimethylation, which has been associated with gene transcription, at 3' termini of subtelomeric genes. No major effect of DeltaTOP1 or mutation was detected on Sir3p recruitment; however, DeltaTOP1 has an effect on transcript levels of genes known to regulate telomeric silencing. Thus, the findings indicate that Top1p activity can favor both a repressed chromatin organization and a reduced gene expression level at telomere-proximal regions in yeast. As telomere-proximal regions are known to be enriched for stress-activated genes, our findings show that Top1p can optimize transcript levels for cell growth in exponentially growing cells under a synthetic medium with glucose.

  1. Real-time PCR based on SYBR-Green I fluorescence: An alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions

    Directory of Open Access Journals (Sweden)

    Puisieux Alain

    2003-10-01

    Full Text Available Abstract Background Real-time PCR is increasingly being adopted for RNA quantification and genetic analysis. At present the most popular real-time PCR assay is based on the hybridisation of a dual-labelled probe to the PCR product, and the development of a signal by loss of fluorescence quenching as PCR degrades the probe. Though this so-called 'TaqMan' approach has proved easy to optimise in practice, the dual-labelled probes are relatively expensive. Results We have designed a new assay based on SYBR-Green I binding that is quick, reliable, easily optimised and compares well with the published assay. Here we demonstrate its general applicability by measuring copy number in three different genetic contexts; the quantification of a gene rearrangement (T-cell receptor excision circles (TREC in peripheral blood mononuclear cells; the detection and quantification of GLI, MYC-C and MYC-N gene amplification in cell lines and cancer biopsies; and detection of deletions in the OPA1 gene in dominant optic atrophy. Conclusion Our assay has important clinical applications, providing accurate diagnostic results in less time, from less biopsy material and at less cost than assays currently employed such as FISH or Southern blotting.

  2. Identification of two novel deletion mutations within the Gs alpha gene (GNAS1) in Albright hereditary osteodystrophy.

    Science.gov (United States)

    Yu, D; Yu, S; Schuster, V; Kruse, K; Clericuzio, C L; Weinstein, L S

    1999-09-01

    Albright hereditary osteodystrophy (AHO) is a genetic disorder characterized by short stature, skeletal defects, and obesity. Within AHO kindreds, some affected family members have only the somatic features of AHO [pseudopseudohypoparathyroidism (PPHP)], whereas others have these features in association with resistance to multiple hormones that stimulate adenylyl cyclase within their target tissues [pseudohypoparathyroidism type Ia (PHP Ia)]. Affected members of most AHO kindreds (both those with PPHP and those with PHP Ia) have a partial deficiency of Gs alpha, the alpha-subunit of the G protein that couples receptors to adenylyl cyclase stimulation, and in a number of cases heterozygous loss of function mutations within the Gs alpha gene (GNAS1) have been identified. Using PCR with the attachment of a high melting domain (GC-clamp) and temperature gradient gel electrophoresis, two novel heterozygous frameshift mutations within GNAS1 were found in two AHO kindreds. In one kindred all affected members (both PHP Ia and PPHP) had a heterozygous 2-bp deletion in exon 8, whereas in the second kindred a heterozygous 2-bp deletion in exon 4 was identified in all affected members examined. In both cases the frameshift encoded a premature termination codon several codons downstream of the deletion. In the latter kindred affected members were previously shown to have decreased levels of GNAS1 messenger ribonucleic acid expression. These results further underscore the genetic heterogeneity of AHO and provides further evidence that PHP Ia and PPHP are two clinical presentations of a common genetic defect. Serial measurements of thyroid function in members of kindred 1 indicate that TSH resistance progresses with age and becomes more evident after the first year of life.

  3. Schizophrenia and chromosomal deletions

    Energy Technology Data Exchange (ETDEWEB)

    Lindsay, E.A.; Baldini, A. [Baylor College of Medicine, Houston, TX (United States); Morris, M. A. [Univ. of Geneva School of Medicine, NY (United States)] [and others

    1995-06-01

    Recent genetic linkage analysis studies have suggested the presence of a schizophrenia locus on the chromosomal region 22q11-q13. Schizophrenia has also been frequently observed in patients affected with velo-cardio-facial syndrome (VCFS), a disorder frequently associated with deletions within 22q11.1. It has been hypothesized that psychosis in VCFS may be due to deletion of the catechol-o-methyl transferase gene. Prompted by these observations, we screened for 22q11 deletions in a population of 100 schizophrenics selected from the Maryland Epidemiological Sample. Our results show that there are schizophrenic patients carrying a deletion of 22q11.1 and a mild VCFS phenotype that might remain unrecognized. These findings should encourage a search for a schizophrenia-susceptibility gene within the deleted region and alert those in clinical practice to the possible presence of a mild VCFS phenotype associated with schizophrenia. 9 refs.

  4. Genetic Deletion of the NOS3 Gene in CAV1-/- Mice Restores Aqueous Humor Outflow Function.

    Science.gov (United States)

    Song, Maomao; Wu, Jihong; Lei, Yuan; Sun, Xinghuai

    2017-10-01

    The purpose of this study was to investigate the impact of genetic deletion of NOS3 in CAV1-/- mice on aqueous humor outflow function using a mouse genetic double knockout model (DKO, NOS3-/- CAV1-/-). IOP was measured in DKO, NOS3 KO, CAV1 KO, and wild-type (WT) mice by rebound tonometry. Outflow facility was measured by perfusing enucleated mouse eyes at multiple pressure steps. Sodium nitroprusside (SNP) and L-NG-nitroarginine methyl ester (L-NAME) was administered topically, whereas the contralateral eyes served as vehicle controls. IOP was measured in both eyes before drug treatment and 1 hour after the last drug treatment. Mock aqueous humor ± the nitric oxide (NO) donor SNP or NOS inhibitor L-NAME was perfused into enucleated eyes. IOP was 11 ± 0.23 mm Hg in DKO mice, which was similar to WT mice and significantly lower than CAV1 KO mice (n = 18, P > 0.05). NOS3 deletion in CAV1-/- mice resulted in a 1.9-fold increase in conventional outflow facility (Ccon) compared with CAV1 KO mice (n = 7, P 0.05) or Ccon in DKO mice (SNP, n = 20; vehicle, n = 11, P > 0.05). Topical application of L-NAME significantly increased IOP in WT, DKO, and CAV1 mice by reducing Ccon. Nitrotyrosine and PKG levels of DKO mice were similar to, whereas sGC was lower than, WT mice (P NOS3 in CAV1-deficient mice restored IOP and conventional aqueous humor drainage to WT level. NOS3 and CAV1 interaction is important to IOP regulation.

  5. The effect of waaL genes deletion from Yersinia enterocolitica O:3 genome on bacteria LPS’ phenotype

    Directory of Open Access Journals (Sweden)

    Shevchenko J. I.

    2014-11-01

    Full Text Available Aim. To estimate WaaL ligase contribution in the lipopolysaccharide (LPS phenotype profile formation of Y. enterocolitica O:3 (YeO3 bacteria. Methods. The waaL-knock-out mutants were created by an allelic exchange strategy. The LPS phenotypes of created mutants were visualized by silver-stained DOC-PAGE and immunoblotting with specific outer core (core oligosaccharide, hexasaccharide, OC and O-polysaccharide (OPS or O-Ag monoclonal antibodies. Results. Deletion of waaLOS gene from YeO3 genome has a marked effect on OC ligation in either single or double mutants. The waaLPS deletion has an opposite effect on the OPS ligation – barely detected increasing of OPS bands. Conclusions. The LPS ligases of YeO3 exhibit relaxed donor substrate specificity. Under given conditions the effect of WaaLOS ligase is more significant for OC and OPS ligation onto lipid A than that of WaaLPS.

  6. Macrophage inhibitory cytokine-1 (MIC-1/GDF15 gene deletion promotes cancer growth in TRAMP prostate cancer prone mice.

    Directory of Open Access Journals (Sweden)

    Yasmin Husaini

    Full Text Available The divergent TGF-β superfamily member, macrophage inhibitory cytokine-1 (MIC-1/GDF15, is overexpressed by most cancers, including prostate cancer (PCa. Whilst its circulating levels are linked to cancer outcome, the role MIC-1/GDF15 plays in cancer development and progression is incompletely understood. To investigate its effect on PCa development and spread, we have used TRAMP prostate cancer prone mice bearing a germline deletion of MIC-1/GDF15 (TRAMPMIC-/-. On average TRAMPMIC-/- mice died about 5 weeks earlier and had larger prostatic tumors compared with TRAMP mice that were wild type for MIC-1/GDF15 (TRAMPMIC+/+. Additionally, at the time of death or ethical end point, even when adjusted for lifespan, there were no significant differences in the number of mice with metastases between the TRAMPMIC+/+ and TRAMPMIC-/- groups. However, consistent with our previous data, more than twice as many TRAMP mice overexpressing MIC-1/GDF15 (TRAMPfmsmic-1 had metastases than TRAMPMIC+/+ mice (p<0.0001. We conclude that germ line gene deletion of MIC-1/GDF15 leads to increased local tumor growth resulting in decreased survival consistent with an overall protective role for MIC-1/GDF15 in early primary tumor development. However, in advancing disease, as we have previously noted, MIC-1/GDF15 overexpression may promote local invasion and metastatic spread.

  7. Cell-type specific oxytocin gene expression from AAV delivered promoter deletion constructs into the rat supraoptic nucleus in vivo.

    Directory of Open Access Journals (Sweden)

    Raymond L Fields

    Full Text Available The magnocellular neurons (MCNs in the hypothalamus selectively express either oxytocin (OXT or vasopressin (AVP neuropeptide genes, a property that defines their phenotypes. Here we examine the molecular basis of this selectivity in the OXT MCNs by stereotaxic microinjections of adeno-associated virus (AAV vectors that contain various OXT gene promoter deletion constructs using EGFP as the reporter into the rat supraoptic nucleus (SON. Two weeks following injection of the AAVs, immunohistochemical assays of EGFP expression from these constructs were done to determine whether the EGFP reporter co-localizes with either the OXT- or AVP-immunoreactivity in the MCNs. The results show that the key elements in the OT gene promoter that regulate the cell-type specific expression the SON are located -216 to -100 bp upstream of the transcription start site. We hypothesize that within this 116 bp domain a repressor exists that inhibits expression specifically in AVP MCNs, thereby leading to the cell-type specific expression of the OXT gene only in the OXT MCNs.

  8. Unacylated ghrelin rapidly modulates lipogenic and insulin signaling pathway gene expression in metabolically active tissues of GHSR deleted mice.

    Directory of Open Access Journals (Sweden)

    Patric J D Delhanty

    Full Text Available BACKGROUND: There is increasing evidence that unacylated ghrelin (UAG improves insulin sensitivity and glucose homeostasis; however, the mechanism for this activity is not fully understood since a UAG receptor has not been discovered. METHODOLOGY/PRINCIPAL FINDINGS: To assess potential mechanisms of UAG action in vivo, we examined rapid effects of UAG on genome-wide expression patterns in fat, muscle and liver of growth hormone secretagogue receptor (GHSR-ablated mice using microarrays. Expression data were analyzed using Ingenuity Pathways Analysis and Gene Set Enrichment Analysis. Regulation of subsets of these genes was verified by quantitative PCR in an independent experiment. UAG acutely regulated clusters of genes involved in glucose and lipid metabolism in all three tissues, consistent with enhancement of insulin sensitivity. CONCLUSIONS/SIGNIFICANCE: Fat, muscle and liver are central to the control of lipid and glucose homeostasis. UAG rapidly modulates the expression of metabolically important genes in these tissues in GHSR-deleted mice indicating a direct, GHSR-independent, action of UAG to improve insulin sensitivity and metabolic profile.

  9. A novel deletion and two recurrent substitutions on type VII collagen gene in seven Iranian patients with epidermolysis bullosa.

    Science.gov (United States)

    Hamidi, Armita Kakavand; Moghaddam, Mohammad; Hatamnejadian, Nasim; Ebrahimi, Ahmad

    2016-08-01

    Epidermolysis bullosa is one of the most important series of mechano-bullous heritable skin disorders which is categorized into four major types according to the layer that bullae forms within basement membrane zone. In dystrophic form of the disease, blisters are made in the sublamina densa zone, at the level of type VII collagen protein which produce anchoring fibrils. Type VII collagen gene is the only responsible gene for this form. The aim of this study was to survey causative mutations of type VII collagen gene among Iranian patients with epidermolysis bullosa. For this purpose, exons 73-75 were investigated by polymerase chain reaction followed by direct sequencing. In current study, we found three different point mutations in type VII collagen alleles in 7 out of 50 patients. Four patients were homozygous for a new deletion which resulted in frame shift (p.Pro2089fs). Two patients were homozygous for a recurrent glycine substitution (p.G2031S) and one patient was detected with an allele carrying a substitution (p.R2069C). The results emphasized heterogeneity in the type VII collagen gene and will provide a sign for early diagnosis and future study of the disease pathogenesis.

  10. Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria.

    Science.gov (United States)

    Spelbrink, J N; Li, F Y; Tiranti, V; Nikali, K; Yuan, Q P; Tariq, M; Wanrooij, S; Garrido, N; Comi, G; Morandi, L; Santoro, L; Toscano, A; Fabrizi, G M; Somer, H; Croxen, R; Beeson, D; Poulton, J; Suomalainen, A; Jacobs, H T; Zeviani, M; Larsson, C

    2001-07-01

    The gene products involved in mammalian mitochondrial DNA (mtDNA) maintenance and organization remain largely unknown. We report here a novel mitochondrial protein, Twinkle, with structural similarity to phage T7 gene 4 primase/helicase and other hexameric ring helicases. Twinkle colocalizes with mtDNA in mitochondrial nucleoids. Screening of the gene encoding Twinkle in individuals with autosomal dominant progressive external ophthalmoplegia (adPEO), associated with multiple mtDNA deletions, identified 11 different coding-region mutations co-segregating with the disorder in 12 adPEO pedigrees of various ethnic origins. The mutations cluster in a region of the protein proposed to be involved in subunit interactions. The function of Twinkle is inferred to be critical for lifetime maintenance of human mtDNA integrity.

  11. A novel deletion mutation of ATP7A gene in a Chinese family with Menkes disease

    Institute of Scientific and Technical Information of China (English)

    ZHANG Li-ping; L(U) Jun-lan; WANG Xiao-hui; ZOU Li-ping

    2008-01-01

    @@ Menkes disease is a rare X-linked recessive hereditary disorder first described bv Menkes et al in 1962.1The gene mutation results in clinical features including pili torti, unusual facies, mental/growth retardation and metabolic dysfunction.The Dathogenic gene ATP7A was identified in 1993.

  12. Detection of deletion and mutation on pig Mx1 gene (gene resistance to influenza virus with PCR-RFLP Nar I restriction

    Directory of Open Access Journals (Sweden)

    Cece Sumantri

    2001-03-01

    Full Text Available The study was done to detect the incident of deletion and mutation in exon 14th of Mx1 gene in pig. Six hundred base pairs at the position (1937 to 2537 of the 14th exon of the pig Mx1 gene was amplified by polymerase chain reaction (PCR from 15 breed of pig DNA sample. The amplified PCR products were digested by Nar I enzyme that called restriction fragment length polymorphism (PCR-RFLP technique. The results show genetic polymorphism at the 14th exon of pig Mx1 gene. The Nar I digested revealed three phenotyphic variation (C/C, C/N and N/N, designated for Nar I cut homozygote, heterozygote and for Nar I no cut homozygote, respectively. The Nar I (N/N or C/N type is corresponding to (1 the deletion 11 bp at the position 2064 to 2075. This type was observed in Landrace breed. (2 the incidence of two point mutation at the position 2065 Guanine (G change to Thymine (T and at the position 2124 Guanine (G change to Adenine (A.This type was observed in Chinese native pig (Meishan and Vietnamese native pig.

  13. Association between the SMN2 gene copy number and clinical characteristics of patients with spinal muscular atrophy with homozygous deletion of exon 7 of the SMN1 gene

    Directory of Open Access Journals (Sweden)

    Žarkov Marija

    2015-01-01

    Full Text Available Background/Aim. Spinal muscular atrophy (SMA is an autosomal recessive disease characterized by degeneration of alpha motor neurons in the spinal cord and the medulla oblongata, causing progressive muscle weakness and atrophy. The aim of this study was to determine association between the SMN2 gene copy number and disease phenotype in Serbian patients with SMA with homozygous deletion of exon 7 of the SMN1 gene. Methods. The patients were identified using regional Serbian hospital databases. Investigated clinical characteristics of the disease were: patients’ gender, age at disease onset, achieved and current developmental milestones, disease duration, current age, and the presence of the spinal deformities and joint contractures. The number of SMN1 and SMN2 gene copies was determined using real-time polymerase chain reaction (PCR. Results. Among 43 identified patients, 37 (86.0% showed homozygous deletion of SMN1 exon 7. One (2.7% of 37 patients had SMA type I with 3 SMN2 copies, 11 (29.7% patients had SMA type II with 3.1 ± 0.7 copies, 17 (45.9% patients had SMA type III with 3.7 ± 0.9 copies, while 8 (21.6% patients had SMA type IV with 4.2 ± 0.9 copies. There was a progressive increase in the SMN2 gene copy number from type II towards type IV (p < 0.05. A higher SMN2 gene copy number was associated with better current motor performance (p < 0.05. Conclusion. In the Serbian patients with SMA, a higher SMN2 gene copy number correlated with less severe disease phenotype. A possible effect of other phenotype modifiers should not be neglected.

  14. Altered intestinal epithelial homeostasis in mice with intestine-specific deletion of the Krüppel-like factor 4 gene.

    Science.gov (United States)

    Ghaleb, Amr M; McConnell, Beth B; Kaestner, Klaus H; Yang, Vincent W

    2011-01-15

    The zinc finger transcription factor, Krüppel-like factor 4 (KLF4), is expressed in the post-mitotic, differentiated epithelial cells lining the intestinal tract and exhibits a tumor suppressive effect on intestinal tumorigenesis. Here we report a role for KLF4 in maintaining homeostasis of intestinal epithelial cells. Mice with conditional ablation of the Klf4 gene from the intestinal epithelium were viable. However, both the rates of proliferation and migration of epithelial cells were increased in the small intestine of mutant mice. In addition, the brush-border alkaline phosphatase was reduced as was expression of ephrine-B1 in the small intestine, resulting in mispositioning of Paneth cells to the upper crypt region. In the colon of mutant mice, there was a reduction of the differentiation marker, carbonic anhydrase-1, and failure of differentiation of goblet cells. Mechanistically, deletion of Klf4 from the intestine resulted in activation of genes in the Wnt pathway and reduction in expression of genes encoding regulators of differentiation. Taken together, these data provide new insights into the function of KLF4 in regulating postnatal proliferation, migration, differentiation, and positioning of intestinal epithelial cells and demonstrate an essential role for KLF4 in maintaining normal intestinal epithelial homeostasis in vivo. Copyright © 2010 Elsevier Inc. All rights reserved.

  15. Deletion of the NSm virulence gene of Rift Valley fever virus inhibits virus replication in and dissemination from the midgut of Aedes aegypti mosquitoes.

    Directory of Open Access Journals (Sweden)

    Rebekah C Kading

    2014-02-01

    Full Text Available BACKGROUND: Previously, we investigated the role of the Rift Valley fever virus (RVFV virulence genes NSs and NSm in mosquitoes and demonstrated that deletion of NSm significantly reduced the infection, dissemination, and transmission rates of RVFV in Aedes aegypti mosquitoes. The specific aim of this study was to further characterize midgut infection and escape barriers of RVFV in Ae. aegypti infected with reverse genetics-generated wild type RVFV (rRVF-wt or RVFV lacking the NSm virulence gene (rRVF-ΔNSm by examining sagittal sections of infected mosquitoes for viral antigen at various time points post-infection. METHODOLOGY AND PRINCIPAL FINDINGS: Ae. aegypti mosquitoes were fed an infectious blood meal containing either rRVF-wt or rRVF-ΔNSm. On days 0, 1, 2, 3, 4, 6, 8, 10, 12, and 14 post-infection, mosquitoes from each experimental group were fixed in 4% paraformaldehyde, paraffin-embedded, sectioned, and examined for RVFV antigen by immunofluorescence assay. Remaining mosquitoes at day 14 were assayed for infection, dissemination, and transmission. Disseminated infections were observed in mosquitoes as early as three days post infection for both virus strains. However, infection rates for rRVF-ΔNSm were statistically significantly less than for rRVF-wt. Posterior midgut infections in mosquitoes infected with rRVF-wt were extensive, whereas midgut infections of mosquitoes infected with rRVF-ΔNSm were confined to one or a few small foci. CONCLUSIONS/SIGNIFICANCE: Deletion of NSm resulted in the reduced ability of RVFV to enter, replicate, and disseminate from the midgut epithelial cells. NSm appears to have a functional role in the vector competence of mosquitoes for RVFV at the level of the midgut barrier.

  16. Deletion of the NSm virulence gene of Rift Valley fever virus inhibits virus replication in and dissemination from the midgut of Aedes aegypti mosquitoes.

    Science.gov (United States)

    Kading, Rebekah C; Crabtree, Mary B; Bird, Brian H; Nichol, Stuart T; Erickson, Bobbie Rae; Horiuchi, Kalanthe; Biggerstaff, Brad J; Miller, Barry R

    2014-02-01

    Previously, we investigated the role of the Rift Valley fever virus (RVFV) virulence genes NSs and NSm in mosquitoes and demonstrated that deletion of NSm significantly reduced the infection, dissemination, and transmission rates of RVFV in Aedes aegypti mosquitoes. The specific aim of this study was to further characterize midgut infection and escape barriers of RVFV in Ae. aegypti infected with reverse genetics-generated wild type RVFV (rRVF-wt) or RVFV lacking the NSm virulence gene (rRVF-ΔNSm) by examining sagittal sections of infected mosquitoes for viral antigen at various time points post-infection. Ae. aegypti mosquitoes were fed an infectious blood meal containing either rRVF-wt or rRVF-ΔNSm. On days 0, 1, 2, 3, 4, 6, 8, 10, 12, and 14 post-infection, mosquitoes from each experimental group were fixed in 4% paraformaldehyde, paraffin-embedded, sectioned, and examined for RVFV antigen by immunofluorescence assay. Remaining mosquitoes at day 14 were assayed for infection, dissemination, and transmission. Disseminated infections were observed in mosquitoes as early as three days post infection for both virus strains. However, infection rates for rRVF-ΔNSm were statistically significantly less than for rRVF-wt. Posterior midgut infections in mosquitoes infected with rRVF-wt were extensive, whereas midgut infections of mosquitoes infected with rRVF-ΔNSm were confined to one or a few small foci. Deletion of NSm resulted in the reduced ability of RVFV to enter, replicate, and disseminate from the midgut epithelial cells. NSm appears to have a functional role in the vector competence of mosquitoes for RVFV at the level of the midgut barrier.

  17. Deletion of Braun lipoprotein and plasminogen-activating protease-encoding genes attenuates Yersinia pestis in mouse models of bubonic and pneumonic plague.

    Science.gov (United States)

    van Lier, Christina J; Sha, Jian; Kirtley, Michelle L; Cao, Anthony; Tiner, Bethany L; Erova, Tatiana E; Cong, Yingzi; Kozlova, Elena V; Popov, Vsevolod L; Baze, Wallace B; Chopra, Ashok K

    2014-06-01

    Currently, there is no FDA-approved vaccine against Yersinia pestis, the causative agent of bubonic and pneumonic plague. Since both humoral immunity and cell-mediated immunity are essential in providing the host with protection against plague, we developed a live-attenuated vaccine strain by deleting the Braun lipoprotein (lpp) and plasminogen-activating protease (pla) genes from Y. pestis CO92. The Δlpp Δpla double isogenic mutant was highly attenuated in evoking both bubonic and pneumonic plague in a mouse model. Further, animals immunized with the mutant by either the intranasal or the subcutaneous route were significantly protected from developing subsequent pneumonic plague. In mice, the mutant poorly disseminated to peripheral organs and the production of proinflammatory cytokines concurrently decreased. Histopathologically, reduced damage to the lungs and livers of mice infected with the Δlpp Δpla double mutant compared to the level of damage in wild-type (WT) CO92-challenged animals was observed. The Δlpp Δpla mutant-immunized mice elicited a humoral immune response to the WT bacterium, as well as to CO92-specific antigens. Moreover, T cells from mutant-immunized animals exhibited significantly higher proliferative responses, when stimulated ex vivo with heat-killed WT CO92 antigens, than mice immunized with the same sublethal dose of WT CO92. Likewise, T cells from the mutant-immunized mice produced more gamma interferon (IFN-γ) and interleukin-4. These animals had an increasing number of tumor necrosis factor alpha (TNF-α)-producing CD4(+) and CD8(+) T cells than WT CO92-infected mice. These data emphasize the role of TNF-α and IFN-γ in protecting mice against pneumonic plague. Overall, our studies provide evidence that deletion of the lpp and pla genes acts synergistically in protecting animals against pneumonic plague, and we have demonstrated an immunological basis for this protection.

  18. Deletion of virulence associated genes from attenuated African swine fever virus isolate OUR T88/3 decreases its ability to protect against challenge with virulent virus ☆

    OpenAIRE

    Abrams, Charles C.; Goatley, Lynnette; Fishbourne, Emma; CHAPMAN, DAVID; Cooke, Lyndsay; Oura, Christopher A.; Netherton, Christopher L.; Takamatsu, Haru-Hisa; Dixon, Linda K.

    2013-01-01

    African swine fever virus (ASFV) causes an acute haemorrhagic disease of domestic pigs against which there is no effective vaccine. The attenuated ASFV strain OUR T88/3 has been shown previously to protect vaccinated pigs against challenge with some virulent strains including OUR T88/1. Two genes, DP71L and DP96R were deleted from the OUR T88/3 genome to create recombinant virus OUR T88/3ΔDP2. Deletion of these genes from virulent viruses has previously been shown to reduce ASFV virulence in ...

  19. Transcriptome analysis of acetic-acid-treated yeast cells identifies a large set of genes whose overexpression or deletion enhances acetic acid tolerance.

    Science.gov (United States)

    Lee, Yeji; Nasution, Olviyani; Choi, Eunyong; Choi, In-Geol; Kim, Wankee; Choi, Wonja

    2015-08-01

    Acetic acid inhibits the metabolic activities of Saccharomyces cerevisiae. Therefore, a better understanding of how S. cerevisiae cells acquire the tolerance to acetic acid is of importance to develop robust yeast strains to be used in industry. To do this, we examined the transcriptional changes that occur at 12 h post-exposure to acetic acid, revealing that 56 and 58 genes were upregulated and downregulated, respectively. Functional categorization of them revealed that 22 protein synthesis genes and 14 stress response genes constituted the largest portion of the upregulated and downregulated genes, respectively. To evaluate the association of the regulated genes with acetic acid tolerance, 3 upregulated genes (DBP2, ASC1, and GND1) were selected among 34 non-protein synthesis genes, and 54 viable mutants individually deleted for the downregulated genes were retrieved from the non-essential haploid deletion library. Strains overexpressing ASC1 and GND1 displayed enhanced tolerance to acetic acid, whereas a strain overexpressing DBP2 was sensitive. Fifty of 54 deletion mutants displayed enhanced acetic acid tolerance. Three chosen deletion mutants (hsps82Δ, ato2Δ, and ssa3Δ) were also tolerant to benzoic acid but not propionic and sorbic acids. Moreover, all those five (two overexpressing and three deleted) strains were more efficient in proton efflux and lower in membrane permeability and internal hydrogen peroxide content than controls. Individually or in combination, those physiological changes are likely to contribute at least in part to enhanced acetic acid tolerance. Overall, information of our transcriptional profile was very useful to identify molecular factors associated with acetic acid tolerance.

  20. Deletion of Genes Encoding Arginase Improves Use of "Heavy" Isotope-Labeled Arginine for Mass Spectrometry in Fission Yeast.

    Directory of Open Access Journals (Sweden)

    Weronika E Borek

    Full Text Available The use of "heavy" isotope-labeled arginine for stable isotope labeling by amino acids in cell culture (SILAC mass spectrometry in the fission yeast Schizosaccharomyces pombe is hindered by the fact that under normal conditions, arginine is extensively catabolized in vivo, resulting in the appearance of "heavy"-isotope label in several other amino acids, most notably proline, but also glutamate, glutamine and lysine. This "arginine conversion problem" significantly impairs quantification of mass spectra. Previously, we developed a method to prevent arginine conversion in fission yeast SILAC, based on deletion of genes involved in arginine catabolism. Here we show that although this method is indeed successful when (13C6-arginine (Arg-6 is used for labeling, it is less successful when (13C6(15N4-arginine (Arg-10, a theoretically preferable label, is used. In particular, we find that with this method, "heavy"-isotope label derived from Arg-10 is observed in amino acids other than arginine, indicating metabolic conversion of Arg-10. Arg-10 conversion, which severely complicates both MS and MS/MS analysis, is further confirmed by the presence of (13C5(15N2-arginine (Arg-7 in arginine-containing peptides from Arg-10-labeled cells. We describe how all of the problems associated with the use of Arg-10 can be overcome by a simple modification of our original method. We show that simultaneous deletion of the fission yeast arginase genes car1+ and aru1+ prevents virtually all of the arginine conversion that would otherwise result from the use of Arg-10. This solution should enable a wider use of heavy isotope-labeled amino acids in fission yeast SILAC.

  1. Interleukin-18 gene deletion protects against sepsis-induced cardiac dysfunction by inhibiting PP2A activity.

    Science.gov (United States)

    Okuhara, Yoshitaka; Yokoe, Shunichi; Iwasaku, Toshihiro; Eguchi, Akiyo; Nishimura, Koichi; Li, Wen; Oboshi, Makiko; Naito, Yoshiro; Mano, Toshiaki; Asahi, Michio; Okamura, Haruki; Masuyama, Tohru; Hirotani, Shinichi

    2017-09-15

    Interleukin-18 (IL-18) neutralization protects against lipopolysaccharide (LPS)-induced injuries, including myocardial dysfunction. However, the mechanism is yet to be fully elucidated. The aim of the present study was to determine whether IL-18 gene deletion prevents sepsis-induced cardiac dysfunction and to elucidate the potential mechanisms underlying IL-18-mediated cardiotoxicity by LPS. Ten-week-old male wild-type (WT) and IL-18 knockout (IL-18 KO) mice were intraperitoneally administered LPS. Serial echocardiography showed better systolic pump function and less left ventricular (LV) dilatation in LPS-treated IL-18 KO mice compared with those in LPS-treated WT mice. LPS treatment significantly decreased the levels of phospholamban (PLN) and Akt phosphorylation in WT mice compared with those in saline-treated WT mice, while the LPS-induced decrease in the phosphorylation levels was attenuated in IL-18 KO mice compared with that in WT mice. IL-18 gene deletion also attenuated an LPS-induced increase of type 2 protein phosphatase 2A (PP2A) activity, a molecule that dephosphorylates PLN and Akt. There was no difference in type 1 protein phosphatase (PP1) activity. To address whether IL-18 affects PLN and Akt phosphorylation via PP2A activation in cardiomyocytes, rat neonatal cardiac myocytes were cultured and stimulated using 100ng/ml of recombinant rat IL-18. Exogenous IL-18 decreased the level of PLN and Akt phosphorylation in cardiomyocytes. PP2A activity but not PP1 activity was increased by IL-18 stimulation in cardiomyocytes. IL-18 plays a pivotal role in advancing sepsis-induced cardiac dysfunction, and the mechanisms underlying IL-18-mediated cardiotoxicity potentially involve the regulation of PLN and Akt phosphorylation through PP2A activity. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies.

    Science.gov (United States)

    Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D; Damkier, Helle H

    2013-10-22

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells with an unsurpassed transepithelial water and solute transport rate. Several members of the slc4a family of bicarbonate transporters are expressed in the CPE. In the basolateral membrane the electroneutral Na(+) dependent Cl(-)/HCO3 (-) exchanger, NCBE (slc4a10) is expressed. In the luminal membrane, the electrogenic Na(+):HCO3 (-) cotransporter, NBCe2 (slc4a5) is expressed. The electroneutral Na(+):HCO3 (-) cotransporter, NBCn1 (slc4a7), has been located in both membranes. In addition to the bicarbonate transporters, the Na(+)/H(+) exchanger, NHE1 (slc9a1), is located in the luminal membrane of the CPE. Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular pH regulation (slc4a7 and slc4a10). In some instances, removal of the proteins from the CPE (slc4a5, 7, and 10) causes changes in abundance and localization of non-target transporters known to be involved in pH regulation and CSF secretion. The focus of this review is to combine the insights gathered from these knockout mice to highlight the impact of slc4 gene deletion on the CSF production and intracellular pH regulation resulting from the deletion of slc4a5, 7 and 10, and slc9a1. Furthermore, the review contains a comparison of the described human mutations of these genes to the findings in the knockout studies. Finally, the future perspective of utilizing these proteins as potential targets for the treatment of CSF disorders will be discussed.

  3. Deletion of virulence associated genes from attenuated African swine fever virus isolate OUR T88/3 decreases its ability to protect against challenge with virulent virus.

    Science.gov (United States)

    Abrams, Charles C; Goatley, Lynnette; Fishbourne, Emma; Chapman, David; Cooke, Lyndsay; Oura, Christopher A; Netherton, Christopher L; Takamatsu, Haru-Hisa; Dixon, Linda K

    2013-08-15

    African swine fever virus (ASFV) causes an acute haemorrhagic disease of domestic pigs against which there is no effective vaccine. The attenuated ASFV strain OUR T88/3 has been shown previously to protect vaccinated pigs against challenge with some virulent strains including OUR T88/1. Two genes, DP71L and DP96R were deleted from the OUR T88/3 genome to create recombinant virus OUR T88/3ΔDP2. Deletion of these genes from virulent viruses has previously been shown to reduce ASFV virulence in domestic pigs. Groups of 6 pigs were immunised with deletion virus OUR T88/3ΔDP2 or parental virus OUR T88/3 and challenged with virulent OUR T88/1 virus. Four pigs (66%) were protected by inoculation with the deletion virus OUR T88/3ΔDP2 compared to 100% protection with the parental virus OUR T88/3. Thus the deletion of the two genes DP71L and DP96R from OUR T88/3 strain reduced its ability to protect pigs against challenge with virulent virus.

  4. Hemizygous deletion and hypermethylation of RUNX3 gene in hepatocellular carcinoma

    Institute of Scientific and Technical Information of China (English)

    Wen-Hua Xiao; Wei-Wen Liu

    2004-01-01

    AIM: To analyze the genetic and epigenetic alterations of RUNX3 gene, a potential putative tumor suppressor gene,in hepatocellular carcinoma (HCC).METRODS: PCR-based loss of heterozygosity (LOH)detection, analysis of mutation with PCR-single strand conformational polymorphism (SSCP) and sequencing, and methylation study with methylation specific PCR (MSP) were performed on RUNX3 gene in a series of 62 HCCs along with their matched normal tissues.RESULTS: Mutation of RUNX3 gene was not found, but one single nucleotide pelymorphism with T to A transvesion at the second nucleotide of the 18th condon was found.Nine of 26 informative cases (34.6%) showed allelic loss on the polymorphic site and 30 cases (48.4%) revealed hypermethylation of RUNX3 gene in promoter CpG islands.Furthermore, of the 9 cases with LOH, 8 (88.9%) also had hypermethylation.CONCLUSION: Our findings indicate that inactivation of RUNX3 gene through allelic loss and promoter hypermethylation might be one of the major mechanisms in hepatocellualr carcinogenesis.

  5. The BCG Moreau RD16 deletion inactivates a repressor reshaping transcription of an adjacent gene.

    Science.gov (United States)

    Galvão, Teca Calcagno; Lima, Cristiane Rodrigues; Gomes, Leonardo Henrique Ferreira; Pagani, Talita Duarte; Ferreira, Marcelo Alves; Gonçalves, Antonio S; Correa, Paloma Rezende; Degrave, Wim Maurits; Mendonça-Lima, Leila

    2014-01-01

    The Brazilian anti-tuberculosis vaccine strain Mycobacterium bovis bacillus Calmette-Guérin (BCG) BCG Moreau is unique in having a deletion of 7608 bp (RD16) that results in the truncation of a putative TetR transcriptional regulator, the ortholog of Mycobacterium tuberculosis rv3405c, BCG_M3439c. We investigated the effect of this truncation on the expression of the rv3406 ortholog (BCG_M3440), lying 81 bp downstream in the opposite orientation. RT-PCR and western blot experiments show that rv3406 mRNA and Rv3406 accumulate in BCG Moreau but not in BCG Pasteur (strain that bears an intact rv3405c), suggesting this to be a result of rv3405c truncation. Recombinant Rv3405c forms a complex with the rv3405c-rv3406 intergenic region, which contains a characteristic transcription factor binding site, showing it to have DNA binding activity. Complementation of M. bovis BCG Moreau with an intact copy of rv3405c abolishes Rv3406 accumulation. These results show that Rv3405c is a DNA binding protein that acts as a transcriptional repressor of rv3406.

  6. Angiotensin-converting enzyme gene insertion/deletion polymorphism in migraine patients

    Directory of Open Access Journals (Sweden)

    White Linda R

    2008-03-01

    Full Text Available Abstract Background The main objective of this study was to investigate the angiotensin converting enzyme (ACE genotype as a possible risk factor for migraine (both with and without aura compared to controls. We also wanted to examine whether a clinical response to an ACE inhibitor, lisinopril, or an angiotensin II receptor blocker, candesartan, in migraine prophylaxis was related to ACE genotype. Methods 347 migraine patients aged 18–68 (155 migraine without aura (MoA, 187 migraine with aura (MwA and 5 missing aura subgroup data and 403 healthy non-migrainous controls > 40 years of age were included in the study. A polymerase chain reaction (PCR was performed on the genomic DNA samples to obtain the ACE insertion (I/deletion(D polymorphisms. Results No significant differences between migraine patients and controls were found with regard to ACE genotype and allele distributions. Furthermore, there was no significant difference between the controls and the MwA or MoA subgroups. Conclusion In our sample there is no association between ACE genotype or allele frequency and migraine. In addition, ACE genotype in our experience did not predict the clinical response to lisinopril or candesartan used as migraine prophylactics.

  7. T lymphocytes and dendritic cells are activated by the deletion of peroxiredoxin II (Prx II) gene.

    Science.gov (United States)

    Moon, Eun-Yi; Noh, Young-Wook; Han, Ying-Hao; Kim, Sun-Uk; Kim, Jin-Man; Yu, Dae-Yeul; Lim, Jong-Seok

    2006-02-15

    Peroxiredoxin II (Prx II) is a member of antioxidant enzyme family and it plays a protective role against oxidative damage. Constitutive production of endogenous reactive oxygen species was detected in spleen and bone marrow cells lacking Prx II. Here, we investigated the role of Prx II in immune responses. The total number of splenocytes (especially, the population of S-phase cells and CD3(+) T cells) was significantly higher in Prx II(-/-) mice than in wild type. Number of peripheral blood mononuclear cells (PBMCs) in Prx II(-/-) mice was also higher than wild type. Differentiation of Prx II(-/-) mouse bone marrow cells into CD11c-positive dendritic cells was greater than that of wild type. Transplantation of Prx II(-/-) bone marrow cells into wild type mice increased PBMCs in blood and bone marrow-derived dendritic cells. Prx II deletion enhances concanavalin A (ConA)-induced splenocyte proliferation and mixed lymphocyte reaction (MLR) activity of bone marrow-derived CD11c-positive dendritic cells to stimulate recipient splenocytes. Collectively, these data suggest that Prx II inhibits the immune cell responsiveness, which may be regulated by scavenging the low amount of reactive oxygen species (ROS).

  8. Otitis media in a new mouse model for CHARGE syndrome with a deletion in the Chd7 gene.

    Directory of Open Access Journals (Sweden)

    Cong Tian

    Full Text Available Otitis media is a middle ear disease common in children under three years old. Otitis media can occur in normal individuals with no other symptoms or syndromes, but it is often seen in individuals clinically diagnosed with genetic diseases such as CHARGE syndrome, a complex genetic disease caused by mutation in the Chd7 gene and characterized by multiple birth defects. Although otitis media is common in human CHARGE syndrome patients, it has not been reported in mouse models of CHARGE syndrome. In this study, we report a mouse model with a spontaneous deletion mutation in the Chd7 gene and with chronic otitis media of early onset age accompanied by hearing loss. These mice also exhibit morphological alteration in the Eustachian tubes, dysregulation of epithelial proliferation, and decreased density of middle ear cilia. Gene expression profiling revealed up-regulation of Muc5ac, Muc5b and Tgf-β1 transcripts, the products of which are involved in mucin production and TGF pathway regulation. This is the first mouse model of CHARGE syndrome reported to show otitis media with effusion and it will be valuable for studying the etiology of otitis media and other symptoms in CHARGE syndrome.

  9. Deletion of genes involved in glutamate metabolism to improve poly-gamma-glutamic acid production in B. amyloliquefaciens LL3.

    Science.gov (United States)

    Zhang, Wei; He, Yulian; Gao, Weixia; Feng, Jun; Cao, Mingfeng; Yang, Chao; Song, Cunjiang; Wang, Shufang

    2015-02-01

    Here, we attempted to elevate poly-gamma-glutamic acid (γ-PGA) production by modifying genes involved in glutamate metabolism in Bacillus amyloliquefaciens LL3. Products of rocR, rocG and gudB facilitate the conversion from glutamate to 2-oxoglutarate in Bacillus subtillis. The gene odhA is responsible for the synthesis of a component of the 2-oxoglutarate dehydrogenase complex that catalyzes the oxidative decarboxylation of 2-oxoglutarate to succinyl coenzyme A. In-frame deletions of these four genes were performed. In shake flask experiments the gudB/rocG double mutant presented enhanced production of γ-PGA, a 38 % increase compared with wild type. When fermented in a 5-L fermenter with pH control, the γ-PGA yield of the rocR mutant was increased to 5.83 g/L from 4.55 g/L for shake flask experiments. The gudB/rocG double mutant produced 5.68 g/L γ-PGA compared with that of 4.03 g/L for the wild type, a 40 % increase. Those results indicated the possibility of improving γ-PGA production by modifying glutamate metabolism, and identified potential genetic targets to improve γ-PGA production.

  10. Spontaneous asj-2J mutant mouse as a model for generalized arterial calcification of infancy: a large deletion/insertion mutation in the Enpp1 gene.

    Directory of Open Access Journals (Sweden)

    Qiaoli Li

    Full Text Available Generalized arterial calcification of infancy (GACI, an autosomal recessive disorder caused by mutations in the ENPP1 gene, manifests with extensive mineralization of the cardiovascular system. The affected individuals in most cases die within the first year of life, and there is currently no effective treatment for this disorder. In this study, we characterized a spontaneous mutant mouse, asj-2J, as a model for GACI. These mice were identified as part of a phenotypic deviant search in a large-scale production colony of BALB/cJ mice at The Jackson Laboratory. They demonstrated a characteristic gait due to stiffening of the joints, with phenotypic similarity to a previously characterized asj ("ages with stiffened joints" mouse, caused by a missense mutation in the Enpp1 gene. Complementation testing indicated that asj-2J and asj were allelic. PCR-based mutation detection strategy revealed in asj-2J mice a large, 40,035 bp, deletion spanning from intron 1 to the 3'-untranslated region of the Enpp1 gene, coupled with a 74 bp insertion. This was accompanied with a significant reduction in the plasma PPi concentration and reduced PPi/Pi ratio. As a consequence, extensive aberrant mineralization affecting the arterial vasculature, a number of internal organs, and the dermal sheath of vibrissae, a progressive biomarker of the ectopic mineralization process, was demonstrated by a combination of micro computed tomography, histopathology with calcium-specific stains, and direct chemical assay of calcium. Comparison of the asj and asj-2J mice demonstrated that the latter ones, particularly when placed on an acceleration diet high in phosphate and low in magnesium, had more extensive mineralization. Thus, the asj-2J mouse serves as a novel model for GACI, a currently intractable disorder.

  11. Genomic Deletions Correlate with Underexpression of Novel Candidate Genes at Six Loci in Pediatric Pilocytic Astrocytoma

    Directory of Open Access Journals (Sweden)

    Nicola Potter

    2008-08-01

    Full Text Available The molecular pathogenesis of pediatric pilocytic astrocytoma (PA is not well defined. Previous cytogenetic and molecular studies have not identified nonrandom genetic aberrations. To correlate differential gene expression and genomic copy number aberrations (CNAs in PA, we have used Affymetrix GeneChip HG_U133A to generate gene expression profiles of 19 pediatric patients and the SpectralChip 2600 to investigate CNAs in 11 of these tumors. Hierarchical clustering according to expression profile similarity grouped tumors and controls separately. We identified 1844 genes that showed significant differential expression between tumor and normal controls, with a large number clearly influencing phosphatidylinositol and mitogen-activated protein kinase signaling in PA. Most CNAs identified in this study were single-clone alterations. However, a small region of loss involving up to seven adjacent clones at 7q11.23 was observed in seven tumors and correlated with the underexpression of BCL7B. Loss of four individual clones was also associated with reduced gene expression including SH3GL2 at 9p21.2-p23, BCL7A (which shares 90% sequence homology with BCL7B at 12q24.33, DRD1IP at 10q26.3, and TUBG2 and CNTNAP1 at 17q21.31. Moreover, the down-regulation of FOXG1B at 14q12 correlated with loss within the gene promoter region in most tumors. This is the first study to correlate differential gene expression with CNAs in PA.

  12. Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia.

    Science.gov (United States)

    Rachid Viana, Giselle Maria; Akinyi Okoth, Sheila; Silva-Flannery, Luciana; Lima Barbosa, Danielle Regina; Macedo de Oliveira, Alexandre; Goldman, Ira F; Morton, Lindsay C; Huber, Curtis; Anez, Arletta; Dantas Machado, Ricardo Luiz; Aranha Camargo, Luís Marcelo; Costa Negreiros do Valle, Suiane; Marins Póvoa, Marinete; Udhayakumar, Venkatachalam; Barnwell, John W

    2017-01-01

    More than 80% of available malaria rapid diagnostic tests (RDTs) are based on the detection of histidine-rich protein-2 (PfHRP2) for diagnosis of Plasmodium falciparum malaria. Recent studies have shown the genes that code for this protein and its paralog, histidine-rich protein-3 (PfHRP3), are absent in parasites from the Peruvian Amazon Basin. Lack of PfHRP2 protein through deletion of the pfhrp2 gene leads to false-negative RDT results for P. falciparum. We have evaluated the extent of pfhrp2 and pfhrp3 gene deletions in a convenience sample of 198 isolates from six sites in three states across the Brazilian Amazon Basin (Acre, Rondonia and Para) and 25 isolates from two sites in Bolivia collected at different times between 2010 and 2012. Pfhrp2 and pfhrp3 gene and their flanking genes on chromosomes 7 and 13, respectively, were amplified from 198 blood specimens collected in Brazil. In Brazil, the isolates collected in Acre state, located in the western part of the Brazilian Amazon, had the highest percentage of deletions for pfhrp2 25 (31.2%) of 79, while among those collected in Rondonia, the prevalence of pfhrp2 gene deletion was only 3.3% (2 out of 60 patients). In isolates from Para state, all parasites were pfhrp2-positive. In contrast, we detected high proportions of isolates from all 3 states that were pfhrp3-negative ranging from 18.3% (11 out of 60 samples) to 50.9% (30 out of 59 samples). In Bolivia, only one of 25 samples (4%) tested had deleted pfhrp2 gene, while 68% (17 out of 25 samples) were pfhrp3-negative. Among the isolates tested, P. falciparum pfhrp2 gene deletions were present mainly in those from Acre State in the Brazilian Amazon. These results indicate it is important to reconsider the use of PfHRP2-based RDTs in the western region of the Brazilian Amazon and to implement appropriate surveillance systems to monitor pfhrp2 gene deletions in this and other parts of the Amazon region.

  13. NFKBIA Deletion in Glioblastomas

    Science.gov (United States)

    Bredel, Markus; Scholtens, Denise M.; Yadav, Ajay K.; Alvarez, Angel A.; Renfrow, Jaclyn J.; Chandler, James P.; Yu, Irene L.Y.; Carro, Maria S.; Dai, Fangping; Tagge, Michael J.; Ferrarese, Roberto; Bredel, Claudia; Phillips, Heidi S.; Lukac, Paul J.; Robe, Pierre A.; Weyerbrock, Astrid; Vogel, Hannes; Dubner, Steven; Mobley, Bret; He, Xiaolin; Scheck, Adrienne C.; Sikic, Branimir I.; Aldape, Kenneth D.; Chakravarti, Arnab; Harsh, Griffith R.

    2013-01-01

    BACKGROUND Amplification and activating mutations of the epidermal growth factor receptor (EGFR) oncogene are molecular hallmarks of glioblastomas. We hypothesized that deletion of NFKBIA (encoding nuclear factor of κ-light polypeptide gene enhancer in B-cells inhibitor-α), an inhibitor of the EGFR-signaling pathway, promotes tumorigenesis in glioblastomas that do not have alterations of EGFR. METHODS We analyzed 790 human glioblastomas for deletions, mutations, or expression of NFKBIA and EGFR. We studied the tumor-suppressor activity of NFKBIA in tumor-cell culture. We compared the molecular results with the outcome of glioblastoma in 570 affected persons. RESULTS NFKBIA is often deleted but not mutated in glioblastomas; most deletions occur in nonclassical subtypes of the disease. Deletion of NFKBIA and amplification of EGFR show a pattern of mutual exclusivity. Restoration of the expression of NFKBIA attenuated the malignant phenotype and increased the vulnerability to chemotherapy of cells cultured from tumors with NFKBIA deletion; it also reduced the viability of cells with EGFR amplification but not of cells with normal gene dosages of both NFKBIA and EGFR. Deletion and low expression of NFKBIA were associated with unfavorable outcomes. Patients who had tumors with NFKBIA deletion had outcomes that were similar to those in patients with tumors harboring EGFR amplification. These outcomes were poor as compared with the outcomes in patients with tumors that had normal gene dosages of NFKBIA and EGFR. A two-gene model that was based on expression of NFKBIA and O6-methylguanine DNA methyltransferase was strongly associated with the clinical course of the disease. CONCLUSIONS Deletion of NFKBIA has an effect that is similar to the effect of EGFR amplification in the pathogenesis of glioblastoma and is associated with comparatively short survival. PMID:21175304

  14. STUDY OF THE DELETION MUTATION OF GLUTATHIONE S TRANSFERASE M1 GENE AND ITS ROLE IN SUSCEPTIBILITY TO HEPATOCELLULAR CARCINOMA

    Institute of Scientific and Technical Information of China (English)

    MA; Yun

    2001-01-01

    [1]Guengerich FP, Shimada T, Raney KD, et al. Elucidation of catalytic specificities of human cytochrome P450 and glutathione S-transferase enzymes and relevance to molecular epidemiology [J]. Envir Health Perspectives 1992; 98:75.[2]Salagoric J, Kalina I, Stubna J, et al. Genetic polymorphism of glutathione S-transferases M1 and T1 as a risk factor in lung and bladder cancers [J]. Neoplasma 1998; 45:312.[3]Comstock KE, Sanderson BJ.S, Claflin SG, et al. GST1 gene deletion determined by polymerase chain reaction [J]. Nucleic Acids Research 1990; 18:3670.[4]Ma Yun, Deng Zhuolin, Le Chenyi, et al. The comparative study on mutational hot spot of p53 gene in hepatocellular carcinoma from AFB1 high and low risk area in Guangxi [J]. J Clin Exp Pthol 1997; 13:302.[5]McGlyNN KA, Rosvold EA, Lustbader ED, et al. Susceptibility to hepatocellular carcinoma is associated with genetic variation in the enzymatic detoxification of aflatoxin B1 [J]. Proc Natl Acad Sci USA 1995; 92:2384..[6]Chen CJ, Yu MW, Liaw YF. Epidemiological characteristics and factors of hepatocellular carcinoma [J]. J Gastroenterol Hepatol 1997; 12:294.[7]Hu Ying, Shen Fumin. Association between GSTM1 gene polymorphism of primary hepatocellular carcinoma and mutation of p53 codon 249 [J]. Chin J Med Genet 1997; 14:76.[8]Hsieh LL, Huang RC, Yu MW, et al. L-myc, GSTM1 genetic polymorphism and hepatocellular carcinoma risk among hepatitis B carriers [J]. Cancer Lett 1996; 103:171.[9]Dong Chuanhui, Zi Xiaolin, Yu Shunzhang, et al. Relationship between deletion of glutathione S-transferase gene and susceptibility to primary hepatocellular carcinoma [J]. Chin J Public Health 1997; 16:141.[10]Chomarat P, Rice JM, Slagle BL, et al. Hepatitis B virus induced liver injury and altered expression of carcinogen metabolising enzymes: the role of the HBx protein [J]. Toxicol Lett 1998; 28:595.

  15. Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens

    Directory of Open Access Journals (Sweden)

    Lin Shumao

    2012-07-01

    Full Text Available Abstract Background A deletion mutation in the growth hormone receptor (GHR gene results in the inhibition of skeletal muscle growth and fat deposition in dwarf chickens. We used microarray techniques to determine microRNA (miRNA and mRNA expression profiles of GHR in the skeletal muscles of 14-day-old embryos as well as 7-week-old deletion-type dwarf and normal-type chickens. Our aim was to elucidate the miRNA regulation of GHR expression with respect to growth inhibition and fat deposition. Results At the same developmental stages, different expression profiles in skeletal muscles of dwarf and normal chickens occurred for four miRNAs (miR-1623, miR-181b, let-7b, and miR-128. At different developmental stages, there was a significant difference in the expression profiles of a greater number of miRNAs. Eleven miRNAs were up-regulated and 18 down-regulated in the 7-week-old dwarf chickens when compared with profiles in 14-day-old embryos. In 7-week-old normal chickens, seven miRNAs were up-regulated and nine down-regulated compared with those in 14-day-old embryos. In skeletal muscles, 22 genes were up-regulated and 33 down-regulated in 14-day-old embryos compared with 7-week-old dwarf chickens. Sixty-five mRNAs were up-regulated and 108 down-regulated in 14-day-old embryos as compared with 7-week-old normal chickens. Thirty-four differentially expressed miRNAs were grouped into 18 categories based on overlapping seed and target sequences. Only let-7b was found to be complementary to its target in the 3′ untranslated region of GHR, and was able to inhibit its expression. Kyoto Encyclopedia of Genes and Genomes pathway analysis and quantitative polymerase chain reactions indicated there were three main signaling pathways regulating skeletal muscle growth and fat deposition of chickens. These were influenced by let-7b-regulated GHR. Suppression of the cytokine signaling 3 (SOCS3 gene was found to be involved in the signaling pathway of

  16. Detection of large scale 3' deletions in the PMS2 gene amongst Colon-CFR participants: have we been missing anything?

    Science.gov (United States)

    Clendenning, Mark; Walsh, Michael D; Gelpi, Judith Balmana; Thibodeau, Stephen N; Lindor, Noralane; Potter, John D; Newcomb, Polly; LeMarchand, Loic; Haile, Robert; Gallinger, Steve; Hopper, John L; Jenkins, Mark A; Rosty, Christophe; Young, Joanne P; Buchanan, Daniel D

    2013-09-01

    Current screening practices have been able to identify PMS2 mutations in 78 % of cases of colorectal cancer from the Colorectal Cancer Family Registry (Colon CFR) which showed solitary loss of the PMS2 protein. However the detection of large-scale deletions in the 3' end of the PMS2 gene has not been possible due to technical difficulties associated with pseudogene sequences. Here, we utilised a recently described MLPA/long-range PCR-based approach to screen the remaining 22 % (n = 16) of CRC-affected probands for mutations in the 3' end of the PMS2 gene. No deletions encompassing any or all of exons 12 through 15 were identified; therefore, our results suggest that 3' deletions in PMS2 are not a frequent occurrence in such families.

  17. Deletion of Helicobacter pylorivacuolating cytotoxin gene by introduction of directed mutagenesis

    Institute of Scientific and Technical Information of China (English)

    Jian-Ping Yuan; Tao Li; Xiao-Dong Shi; Bao-Yu Hu; Gui-Zhen Yang; Shan-Qing Tong; Xiao-Kui Guo

    2003-01-01

    AIM: To construct a vacA-knockout Helicobacter pylori mutant strain, whose only difference from the wild strain is its disrupted vacA gene.METHODS AND RESULTS: A clone containing kanamycin resistance gene used for homologous recombination was constructed in a directional cloning procedure into pBluescript ⅡSK, and then transformed into vacA+ H pylori by electroporation.Colonies growing on the selective media containing kanamycin were harvested for chromosomal DNA extraction,and the allelic exchange was determined by polymerase chain reactions and sequencing. Loss of vacuolating activity of the vaci-knockout strain was confirmed by examining the gastric cells co-cultured with cell-free supernatants from H pylori wild strain or the mutant.CONCLUSION: We constructed a vacA-knockout strain of H pylori through direct mutagenesis, which creates an important precondition for the future research on virulence comparison with gene expression analysis.

  18. Conditional gene deletion reveals functional redundancy of GABAB receptors in peripheral nociceptors in vivo

    Directory of Open Access Journals (Sweden)

    Bettler Bernhard

    2009-11-01

    changed upon a specific deletion of GABAB receptors from peripheral nociceptive neurons in vivo. This lets us conclude that GABAB receptors in the peripheral nervous system play a less important role than those in the central nervous system in the regulation of pain.

  19. Programmed cell death in Saccharomyces cerevisiae is hampered by the deletion of GUP1 gene

    Directory of Open Access Journals (Sweden)

    Tulha Joana

    2012-05-01

    Full Text Available Abstract Background During the past years, yeast has been successfully established as a model to study mechanisms of programmed cell death regulation. Saccharomyces cerevisiae commits to cell death showing typical hallmarks of metazoan apoptosis, in response to different stimuli. Gup1p, an O-acyltransferase, is required for several cellular processes that are related to apoptosis development, such as rafts integrity and stability, lipid metabolism including GPI anchor correct remodeling, proper mitochondrial and vacuole function, bud site selection and actin dynamics. Therefore, we hypothesize that apoptotic process would be affected by GUP1 deletion. Results In the present work we used two known apoptosis inducing conditions, chronological aging and acetic acid, to assess several apoptotic markers in gup1∆ mutant strain. We found that this mutant presents a significantly reduced chronological lifespan as compared to Wt and it is also highly sensitive to acetic acid treatment. In addition, it presents extremely high levels of ROS. There were notorious differences on apoptotic markers between Wt and gup1∆ mutant strains, namely on the maintenance of plasma membrane integrity, on the phosphatidylserine externalization, on the depolarization of mitochondrial membrane and on the chromatin condensation. Those suggested that the mutant, under either condition, probably dies of necrosis and not from apoptosis. Conclusions To Gup1p has been assigned an important function on lipid rafts assembly/integrity, lipid metabolism and GPI anchor remodeling. Our results provide, for the first time, the connection of the integrity of yeast lipid rafts and apoptosis induction and/or signaling, giving new insights into the molecular mechanisms underlying this process in yeast.

  20. ANALYSIS OF ANGIOTENSIN CONVERTING ENZYME (ACE GENE INSERTION/DELETION(I/DPOLYMORPHISM IN MIGRAINE

    Directory of Open Access Journals (Sweden)

    Saime Sezer

    2013-03-01

    In patient groups DD genotype frequency was 35.0%, ID genotype frequency was 45.5% and II genotype frequency 19.5% (0.322. Allelic frequencies was detected 57.75% for D allele, 42.25% for I allele in patients. There were no significant differences in genotype/allele frequencies of angiotensin converting enzyme gene polymorphism between patients with migraine and controls (p=0.474. Our results show that I/D polymorphism of angiotensin converting enzyme gene is not a risk factor for migraine. [J Contemp Med 2013; 3(1.000: 7-11

  1. Repair or Violation Detection? Pre-Attentive Processing Strategies of Phonotactic Illegality Demonstrated on the Constraint of g-Deletion in German

    Science.gov (United States)

    Steinberg, Johanna; Jacobsen, Thomas Konstantin; Jacobsen, Thomas

    2016-01-01

    Purpose: Effects of categorical phonotactic knowledge on pre-attentive speech processing were investigated by presenting illegal speech input that violated a phonotactic constraint in German called "g-deletion." The present study aimed to extend previous findings of automatic processing of phonotactic violations and to investigate the…

  2. Germline deletions in the tumour suppressor gene FOCAD are associated with polyposis and colorectal cancer development

    NARCIS (Netherlands)

    Weren, Robbert DA; Venkatachalam, Ramprasath; Cazier, Jean-Baptiste; Farin, Henner F; Kets, C Marleen; de Voer, Richarda M; Vreede, Lilian; Verwiel, Eugène Tp; van Asseldonk, Monique; Kamping, Eveline J; Kiemeney, Lambertus A; Neveling, Kornelia; Aben, Katja Kh; Carvajal-Carmona, Luis; Nagtegaal, Iris D; Schackert, Hans K; Clevers, Hans; van de Wetering, Marc; Tomlinson, Ian P; Ligtenberg, Marjolijn Jl; Hoogerbrugge, Nicoline; Geurts van Kessel, Ad; Kuiper, Roland P

    2015-01-01

    Heritable genetic variants can significantly affect the lifetime risk of developing cancer, including polyposis and colorectal cancer (CRC). Variants in genes currently known to be associated with a high risk for polyposis or CRC, however, explain only a limited number of hereditary cases. The ident

  3. Deletion of cdvB paralogous genes of Sulfolobus acidocaldarius impairs cell division

    NARCIS (Netherlands)

    Yang, Nuan; Driessen, Arnold J.M.

    2014-01-01

    The majority of Crenarchaeota utilize the cell division system (Cdv) to divide. This system consists of three highly conserved genes, cdvA, cdvB and cdvC that are organized in an operon. CdvC is homologous to the AAA-type ATPase Vps4, involved in multivesicular body biogenesis in eukaryotes. CdvA is

  4. Deletion of cdvB paralogous genes of Sulfolobus acidocaldarius impairs cell division

    NARCIS (Netherlands)

    Yang, Nuan; Driessen, Arnold J.M.

    2014-01-01

    The majority of Crenarchaeota utilize the cell division system (Cdv) to divide. This system consists of three highly conserved genes, cdvA, cdvB and cdvC that are organized in an operon. CdvC is homologous to the AAA-type ATPase Vps4, involved in multivesicular body biogenesis in eukaryotes. CdvA is

  5. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg;

    Filamentous fungi possess an advanced secondary metabolism that is regulated and coordinated in a complex manner depending on environmental challenges. The number of known and putative polyketide synthase genes greatly exceeds the number of polyketides (PKs) that these fungi are known to produce....

  6. Otx2 gene deletion in adult mouse retina induces rapid RPE dystrophy and slow photoreceptor degeneration.

    Directory of Open Access Journals (Sweden)

    Francis Béby

    Full Text Available BACKGROUND: Many developmental genes are still active in specific tissues after development is completed. This is the case for the homeobox gene Otx2, an essential actor of forebrain and head development. In adult mouse, Otx2 is strongly expressed in the retina. Mutations of this gene in humans have been linked to severe ocular malformation and retinal diseases. It is, therefore, important to explore its post-developmental functions. In the mature retina, Otx2 is expressed in three cell types: bipolar and photoreceptor cells that belong to the neural retina and retinal pigment epithelium (RPE, a neighbour structure that forms a tightly interdependent functional unit together with photoreceptor cells. METHODOLOGY/PRINCIPAL FINDINGS: Conditional self-knockout was used to address the late functions of Otx2 gene in adult mice. This strategy is based on the combination of a knock-in CreERT2 allele and a floxed allele at the Otx2 locus. Time-controlled injection of tamoxifen activates the recombinase only in Otx2 expressing cells, resulting in selective ablation of the gene in its entire domain of expression. In the adult retina, loss of Otx2 protein causes slow degeneration of photoreceptor cells. By contrast, dramatic changes of RPE activity rapidly occur, which may represent a primary cause of photoreceptor disease. CONCLUSIONS: Our novel mouse model uncovers new Otx2 functions in adult retina. We show that this transcription factor is necessary for long-term maintenance of photoreceptors, likely through the control of specific activities of the RPE.

  7. The deletion of TonB-dependent receptor genes is part of the genome reduction process that occurs during adaptation of Pseudomonas aeruginosa to the cystic fibrosis lung.

    Science.gov (United States)

    Dingemans, Jozef; Ye, Lumeng; Hildebrand, Falk; Tontodonati, Francesca; Craggs, Michael; Bilocq, Florence; De Vos, Daniel; Crabbé, Aurélie; Van Houdt, Rob; Malfroot, Anne; Cornelis, Pierre

    2014-06-01

    Chronic Pseudomonas aeruginosa infections are the main cause of morbidity among patients with cystic fibrosis (CF) due to persistent lung inflammation caused by interaction between this bacterium and the immune system. Longitudinal studies of clonally related isolates of a dominant CF clone have indicated that genome reduction frequently occurs during adaptation of P. aeruginosa in the CF lung. In this study, we have evaluated the P. aeruginosa population structure of patients attending the Universitair Ziekenhuis Brussel (UZ Brussel) CF reference center using a combination of genotyping methods. Although the UZ Brussel P. aeruginosa CF population is characterized by the absence of a dominant CF clone, some potential interpatient transmissions could be detected. Interestingly, one of these clones showed deletion of the alternative type I ferripyoverdine receptor gene fpvB. Furthermore, we found that several other TonB-dependent receptors are deleted as well. The genome of one potentially transmissible CF clone was sequenced, revealing large deleted regions including all type III secretion system genes and several virulence genes. Remarkably, a large number of deleted genes are shared between the P. aeruginosa CF clone described in this study and isolates belonging to the dominant Copenhagen CF DK2 clone, suggesting parallel evolution. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  8. Complete androgen insensitivity syndrome due to a new frameshift deletion in exon 4 of the androgen receptor gene: Functional analysis of the mutant receptor

    NARCIS (Netherlands)

    J.M. Lobaccaro; S. Lumbroso; N. Poujol (Nicolas); V. Georget; A.O. Brinkmann (Albert); G. Malpuech (Georges); C. Sultan

    1995-01-01

    textabstractWe studied the androgen receptor gene in a large kindred with complete androgen insensitivity syndrome and negative receptor-binding activity, single-strand conformation polymorphism (SSCP) analysis and sequencing identified a 13 base pair deletion within exon 4. This was responsible for

  9. Virulence Associated Genes-Deleted Salmonella Montevideo Is Attenuated, Highly Immunogenic and Confers Protection against Virulent Challenge in Chickens

    Science.gov (United States)

    Lalsiamthara, Jonathan; Lee, John H.

    2016-01-01

    To construct a novel live vaccine against Salmonella enterica serovar Montevideo (SM) infection in chickens, two important bacterial regulatory genes, lon and cpxR, which are associated with invasion and virulence, were deleted from the wild type SM genome. Attenuated strains, JOL1625 (Δlon), JOL1597 (ΔcpxR), and JOL1599 (ΔlonΔcpxR) were thereby generated. Observations with scanning electron microscopy suggested that JOL1625 and JOL1599 cells showed increased ruffled surface which may be related to abundant extracellular polysaccharide (EPS) production. JOL1597 depicted milder ruffled surface but showed increased surface corrugation. ConA affinity-based fluorometric quantification and fluorescence microscopy revealed significant increases in EPS production in JOL1625 and JOL1599. Four weeks old chickens were used for safety and immunological studies. The mutants were not observed in feces beyond day 3 nor in spleen and cecum beyond day 7, whereas wild type SM was detected for at least 2 weeks in spleen and cecum. JOL1599 was further evaluated as a vaccine candidate. Chickens immunized with JOL1599 showed strong humoral responses, as indicated by systemic IgG and secretory IgA levels, as well as strong cell-mediated immune response, as indicated by increased lymphocyte proliferation. JOL1599-immunized groups also showed significant degree of protection against wild type challenge. Our results indicate that Δlon- and/or ΔcpxR-deleted SM exhibited EPS-enhanced immunogenicity and attenuation via reduced bacterial cell intracellular replication, conferred increased protection, and possess safety qualities favorable for effective vaccine development against virulent SM infections. PMID:27785128

  10. Monoallelic deletion of the microRNA biogenesis gene Dgcr8 produces deficits in the development of excitatory synaptic transmission in the prefrontal cortex

    Directory of Open Access Journals (Sweden)

    Barker Alison J

    2011-04-01

    Full Text Available Abstract Background Neuronal phenotypes associated with hemizygosity of individual genes within the 22q11.2 deletion syndrome locus hold potential towards understanding the pathogenesis of schizophrenia and autism. Included among these genes is Dgcr8, which encodes an RNA-binding protein required for microRNA biogenesis. Dgcr8 haploinsufficient mice (Dgcr8+/- have reduced expression of microRNAs in brain and display cognitive deficits, but how microRNA deficiency affects the development and function of neurons in the cerebral cortex is not fully understood. Results In this study, we show that Dgcr8+/- mice display reduced expression of a subset of microRNAs in the prefrontal cortex, a deficit that emerges over postnatal development. Layer V pyramidal neurons in the medial prefrontal cortex of Dgcr8+/- mice have altered electrical properties, decreased complexity of basal dendrites, and reduced excitatory synaptic transmission. Conclusions These findings demonstrate that precise microRNA expression is critical for the postnatal development of prefrontal cortical circuitry. Similar defects in neuronal maturation resulting from microRNA deficiency could represent endophenotypes of certain neuropsychiatric diseases of developmental onset.

  11. Association of DD Genotype of Insertion/Deletion Polymorphism of Angiotensin-Converting Enzyme Gene with Systemic Lupus Erythematosus and Lupus Nephropathy

    Directory of Open Access Journals (Sweden)

    Saeedeh Salimi

    2013-10-01

    Full Text Available Background: Systemic lupus erythematosus (SLE is a multisystem disease with unknown etiology. We hypothesized that insertion/deletion (I/D polymorphism of angiotensin-converting enzyme (ACE gene may influence the development and/or progression of SLE and lupus nephritis. Materials and Methods: In a crass sectional case-control study, genomic DNA from 106 SLE patients and 103 healthy controls matched for sex, age, and ethnicity, were genotyped for the (I/D polymorphism of ACE gene by polymerase chain reaction (PCR. Comparison of quantitative variants between two groups was assessed by student t-test and association between qualitative variables was analyzed by the chi-square or Fisher exact tests. Results: The frequency of DD genotype in SLE patients was significantly higher than control group (25.5 % vs. 14 %, and the risk of SLE was 2.2 times greater in subjects with DD genotype than the individual by DI and II genotypes (OR, 2.2 [95% CI, 1.1 to 4.4]; p=0.023. The distribution of D allele in SLE patients was significantly higher (p=0.021 compare to controls (47 and 36.4, respectively. The Risk of nephropathy in SLE patients with DD genotype was three times more than other genotypes (OR, 3 [95% CI, 1.1 to 8]; p=0.027].Conclusion: This study demonstrated that ACE DD genotype acts as a risk factor on SLE and Lupus nephropathy in an Iranian population.

  12. Systematic gene deletions evidences that laccases are involved in several stages of wood degradation in the filamentous fungus Podospora anserina.

    Science.gov (United States)

    Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël

    2014-01-01

    Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis.

  13. Multiplex ligation-dependent probe amplification for rapid detection of deletions and duplications in the dystrophin gene

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objective:Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are X-linked disorders caused by mutations in the dystrophin gene. The majority of recognized mutations are copy number changes of individual exons. The objective of the present study was to assess the multiplex ligation-dependent probe amplification (MLPA) effects of detection of gene mutations. Methods: Samples of 20 control males and 80 males and their mothers referred to our diagnostic facility on the clinical suspicion of DMD or BMD were tested by MLPA and multiplex PCR. Results: The mean DQs for all peak of 20 control male samples was 1.02 (range from 0.83 to 1.21) by MLPA. Deletions or duplications were identified in 6 out of 31 families that had been previously tested as negative by multiplex PCR. One case of complex rearrangement involving a duplication of two regions: dupEX3-9 and dupEX 17-41 were found by MLPA. Conclusions: MLPA is a highly sensitive method and rapid alternative to multiplex PCR for detection of DMD and BMD.

  14. X chromosome-linked Kallmann syndrome: clinical heterogeneity in three siblings carrying an intragenic deletion of the KAL-1 gene.

    Science.gov (United States)

    Massin, Nathalie; Pêcheux, Christophe; Eloit, Corinne; Bensimon, Jean-Louis; Galey, Julie; Kuttenn, Frédérique; Hardelin, Jean-Pierre; Dodé, Catherine; Touraine, Philippe

    2003-05-01

    Kallmann syndrome (KS) is characterized by the association of hypogonadotropic hypogonadism and anosmia. The gene underlying the X chromosome-linked form of the disease, KAL-1, consists of 14 coding exons. It encodes a glycoprotein, anosmin-1, which is involved in the embryonic migration of GnRH-synthesizing neurons and the differentiation of the olfactory bulbs. We describe herein the clinical heterogeneity in three affected brothers who carry a large deletion (exons 3-13) in KAL-1. All three had a history of hypogonadotropic hypogonadism with delayed puberty. Although brain magnetic resonance imaging showed hypoplastic olfactory bulbs in the three siblings, variable degrees of anosmia/hyposmia were shown by olfactometry. In addition, these brothers had different phenotypic anomalies, i.e. unilateral renal aplasia (siblings B and C), high-arched palate (sibling A), brachymetacarpia (sibling A), mirror movements (siblings A and B), and abnormal eye movements (sibling C). Last but not least, sibling A suffered from a severe congenital hearing impairment, a feature that had been reported in KS but had not yet been ascribed unambiguously to the X-linked form of the disease. The variable phenotype, both qualitatively and quantitatively, in this family further emphasizes the role of putative modifier genes, and/or epigenetic factors, in the expressivity of the X-linked KS.

  15. Altered Murine Tissue Colonization by Borrelia burgdorferi following Targeted Deletion of Linear Plasmid 17-Carried Genes

    OpenAIRE

    Casselli, Timothy; Tourand, Yvonne; Bankhead, Troy

    2012-01-01

    The causative agent of Lyme disease, Borrelia burgdorferi, possesses a segmented genome comprised of a single linear chromosome and upwards of 23 linear and circular plasmids. Much of what is known about plasmid-borne genes comes from studying laboratory clones that have spontaneously lost one or more plasmids during in vitro passage. Some plasmids, including the linear plasmid lp17, are never or rarely reported to be lost during routine culture; therefore, little is known about the requireme...

  16. Novel Mutations and Deletions of the KIT (Steel Factor Receptor) Gene in Human Piebaldism

    OpenAIRE

    Ezoe, Kazuhiko; Holmes, Stuart A.; Ho, Lingling; Bennett, Christopher P.; Bolognia, Jean L.; Brueton, Louise; Burn, John; Falabella, Rafael; Gatto, Emilia M.; Ishii, Norihisa; Moss, Celia; Pittelkow, Mark R.; Thompson, Elizabeth; Ward, K. Anne; Spritz, Richard A.

    1995-01-01

    Piebaldism is an autosomal dominant genetic disorder of pigmentation characterized by white patches of skin and hair. Melanocytes are lacking in these hypopigmented regions, the result of mutations of the KIT gene, which encodes the cell surface receptor for steel factor (SLF). We describe the analysis of 26 unrelated patients with piebaldism-like hypopigmentation—17 typical patients, 5 with atypical clinical features or family histories, and 4 with other disorders that involve white spotting...

  17. Nonrecurrent PMP22-RAI1 contiguous gene deletions arise from replication-based mechanisms and result in Smith-Magenis syndrome with evident peripheral neuropathy.

    Science.gov (United States)

    Yuan, Bo; Neira, Juanita; Gu, Shen; Harel, Tamar; Liu, Pengfei; Briceño, Ignacio; Elsea, Sarah H; Gómez, Alberto; Potocki, Lorraine; Lupski, James R

    2016-10-01

    Hereditary neuropathy with liability to pressure palsies (HNPP) and Smith-Magenis syndrome (SMS) are genomic disorders associated with deletion copy number variants involving chromosome 17p12 and 17p11.2, respectively. Nonallelic homologous recombination (NAHR)-mediated recurrent deletions are responsible for the majority of HNPP and SMS cases; the rearrangement products encompass the key dosage-sensitive genes PMP22 and RAI1, respectively, and result in haploinsufficiency for these genes. Less frequently, nonrecurrent genomic rearrangements occur at this locus. Contiguous gene duplications encompassing both PMP22 and RAI1, i.e., PMP22-RAI1 duplications, have been investigated, and replication-based mechanisms rather than NAHR have been proposed for these rearrangements. In the current study, we report molecular and clinical characterizations of six subjects with the reciprocal phenomenon of deletions spanning both genes, i.e., PMP22-RAI1 deletions. Molecular studies utilizing high-resolution array comparative genomic hybridization and breakpoint junction sequencing identified mutational signatures that were suggestive of replication-based mechanisms. Systematic clinical studies revealed features consistent with SMS, including features of intellectual disability, speech and gross motor delays, behavioral problems and ocular abnormalities. Five out of six subjects presented clinical signs and/or objective electrophysiologic studies of peripheral neuropathy. Clinical profiling may improve the clinical management of this unique group of subjects, as the peripheral neuropathy can be more severe or of earlier onset as compared to SMS patients having the common recurrent deletion. Moreover, the current study, in combination with the previous report of PMP22-RAI1 duplications, contributes to the understanding of rare complex phenotypes involving multiple dosage-sensitive genes from a genetic mechanistic standpoint.

  18. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-03-01

    Background: Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multi-gene family. Although the function of the members of the PE_PGRS multi-gene family is not yet known, it is hypothesized that the PE_PGRS genes may be associated with genetic variability. Material and methods: Whole genome sequencing analysis was performed on (n= 37) extensively drug resistant (XDR) MTB strains from Pakistan which included Central Asian (n= 23), East African Indian (n= 2), X3 (n= 1), T group (n= 3) and Orphan (n= 8) MTB strains. Results: By analyzing 42 PE_PGRS genes, 111 SNPs were identified, of which 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in the PE_PGRS genes were as follows: 6, 9, 10 and 55 present in each of the CAS, EAI, Orphan, T1 and X3 XDR MTB strains studied. Deletions in PE_PGRS genes: 19, 21 and 23 were observed in 7 (35.0%) CAS1 and 3 (37.5%) in Orphan XDR MTB strains, while deletions in the PE_PGRS genes: 49 and 50 were observed in 36 (95.0%) CAS1 and all CAS, CAS2 and Orphan XDR MTB strains. An insertion in PE_PGRS6 gene was observed in all CAS, EAI3 and Orphan, while insertions in the PE_PGRS genes 19 and 33 were observed in 19 (95%) CAS1 and all CAS, CAS2, EAI3 and Orphan XDR MTB strains. Conclusion: Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs, Insertions and Deletions in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  19. Varied manifestations of persistent hyperplastic primary vitreous with graded somatic mosaic deletion of a single gene

    Science.gov (United States)

    Mary-Sinclair, Michelle N.; Wang, XiaoFei; Swanson, Douglas J.; Sung, Caroline Y.; Mendonca, Eneida A.; Wroblewski, Kristen; Baumer, Shannon H.; Goldowitz, Dan; Jablonski, Monica M.

    2014-01-01

    Purpose Persistent hyperplastic primary vitreous (PHPV) represents a developmental eye disease known to have diverse manifestations ranging from a trivial remnant of hyaloid vessels to a dense fibrovascular mass causing lens opacity and retinal detachment. PHPV can be modeled in mice lacking individual genes, but certain features of such models differ from the clinical realm. For example, mice lacking the Arf gene have uniformly severe disease with consistent autosomal recessive disease penetrance. We tested whether the graded somatic loss of Arf in a subset of cells in chimeric mice mimics the range of disease in a non-heritable manner. Methods Wild type ↔ Arf −/− mouse chimeras were generated by morulae fusion, and when the mice were 10 weeks old, fundoscopic, slit-lamp, and histological evaluations were performed. The relative fraction of cells of the Arf −/− lineage was assessed with visual, molecular genetic, and histological analysis. Objective quantification of various aspects of the phenotype was correlated with the genotype. Results Sixteen chimeras were generated and shown to have low, medium, and high contributions of Arf −/− cells to tail DNA, the cornea, and the retinal pigment epithelium (RPE), with excellent correlation between chimerism in the tail DNA and the RPE. Phenotypic differences (coat color and severity of eye disease) were evident, objectively quantified, and found to correlate with the contribution of Arf −/− cells to the RPE and tail-derived DNA, but not the cornea. Conclusions Generating animals composed of different numbers of Arf −/− cells mimicked the range of disease severity observed in patients with PHPV. This establishes the potential for full manifestations of PHPV to be caused by somatic mutations of a single gene during development. PMID:24623965

  20. Cloning of a cDNA for steroid sulfatase: frequent occurrence of gene deletions in patients with recessive X chromosome-linked ichthyosis

    Energy Technology Data Exchange (ETDEWEB)

    Bonifas, J.M.; Morley, B.J.; Oakey, R.E.; Kan, Y.W.; Epstein, E.J. Jr.

    1987-12-01

    A human steroid sulfatase cDNA 2.4 kilobases long was isolated from a human placental lambda gt11 cDNA expression library. The library was screened with monospecific rabbit antibodies elicited by injection of steroid sulfatase protein purified from human placentas. Hybridization of the cDNA with EcoRI-digested genomic DNA indicated that patients from 14 of 15 apparently unrelated families have gross deletions of the gene for steroid sulfatase. One patient had genomic DNA fragments that were identical to those from normal individuals, indicating the absence of any major deletions as the cause of his lack of steroid sulfatase enzyme activity.

  1. Molecular characterization of a deletion in the HPRT1 gene in a patient with Lesch-Nyhan syndrome.

    Science.gov (United States)

    Taniguchi, A; Yamada, Y; Hakoda, M; Sekita, C; Kawamoto, M; Kaneko, H; Yamanaka, H

    2011-12-01

    Lesch-Nyhan syndrome is caused by a deficiency of hypoxanthine phosphoribosyltransferase (HPRT) encoded by HPRT1. About 20% of patients have a deletion of HPRT1 and large deletions of HPRT1 are not always fully characterized at the molecular level. Here, we report on a case of Lesch-Nyhan syndrome with a 33-kb deletion involving exon 1 of HPRT1. This novel mutation is caused by a nonhomologous recombination between different classes of interspersed repetitive DNA.

  2. Bmp2 deletion causes an amelogenesis imperfecta phenotype via regulating enamel gene expression.

    Science.gov (United States)

    Guo, Feng; Feng, Junsheng; Wang, Feng; Li, Wentong; Gao, Qingping; Chen, Zhuo; Shoff, Lisa; Donly, Kevin J; Gluhak-Heinrich, Jelica; Chun, Yong Hee Patricia; Harris, Stephen E; MacDougall, Mary; Chen, Shuo

    2015-08-01

    Although Bmp2 is essential for tooth formation, the role of Bmp2 during enamel formation remains unknown in vivo. In this study, the role of Bmp2 in regulation of enamel formation was investigated by the Bmp2 conditional knock out (Bmp2 cKO) mice. Teeth of Bmp2 cKO mice displayed severe and profound phenotypes with asymmetric and misshaped incisors as well as abrasion of incisors and molars. Scanning electron microscopy analysis showed that the enamel layer was hypoplastic and enamel lacked a typical prismatic pattern. Teeth from null mice were much more brittle as tested by shear and compressive moduli. Expression of enamel matrix protein genes, amelogenin, enamelin, and enamel-processing proteases, Mmp-20 and Klk4 was reduced in the Bmp2 cKO teeth as reflected in a reduced enamel formation. Exogenous Bmp2 up-regulated those gene expressions in mouse enamel organ epithelial cells. This result for the first time indicates Bmp2 signaling is essential for proper enamel development and mineralization in vivo.

  3. Deletion of the Men1 Gene Prevents Streptozotocin-Induced Hyperglycemia in Mice

    Directory of Open Access Journals (Sweden)

    Yuqing Yang

    2010-01-01

    Full Text Available Diabetes ultimately results from an inadequate number of functional beta cells in the islets of Langerhans. Enhancing proliferation of functional endogenous beta cells to treat diabetes remains underexplored. Here, we report that excision of the Men1 gene, whose loss-of-function mutation leads to inherited multiple endocrine neoplasia type 1 (MEN1, rendered resistant to streptozotocin-induced hyperglycemia in a tamoxifen-inducible and temporally controlled Men1 excision mouse model as well as in a tissue-specific Men1 excision mouse model. Men1 excision prevented mice from streptozotocin-induced hyperglycemia mainly through increasing the number of functional beta cells. BrdU incorporation by beta cells, islet size, and circulating insulin levels were significantly increased in Men1-excised mice. Membrane localization of glucose transporter 2 was largely preserved in Men1-excised beta cells, but not in Men1-expressing beta cells. Our findings suggest that repression of menin, a protein encoded by the Men1 gene, might be a valuable means to maintain or increase the number of functional endogenous beta cells to prevent or ameliorate diabetes.

  4. Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

    Science.gov (United States)

    Li, Jie; Zhu, Xichun; Ma, Lin; Xu, Hongwei; Cao, Xin; Luo, Renyun; Chen, Hong; Sun, Xiuzhu; Cai, Yong; Lan, Xianyong

    2017-03-31

    Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the mutation polymorphism of the PRND has been highly concerned recently, including the single nucleiotide polymorphism and insertion/deletion (indel). Therefore, the objective of present study was to examine this novel indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing four diversity sheep breeds. The results showed that three genotypes were detected and the minor allelic frequency was 0.008 (Lanzhou Fat-Tail sheep), 0.084 (Small Tail Han sheep), 0.021(Tong sheep) and 0.083 (Hu sheep), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus were significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the 20-bp indel of sheep PRND gene by ME strategy, which may provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

  5. Correlation between the Insertion/Deletion Mutations of Prion Protein Gene and BSE Susceptibility and Milk Performance in Dairy Cows

    Institute of Scientific and Technical Information of China (English)

    2013-01-01

    Objective To investigate the 23 bp and 12 bp insertion/deletion (indel) mutations within the bovine prion protein (PRNP) gene in Chinese dairy cows, and to detect the associations of two indel mutations with BSE susceptibility and milk performance. Methods Based on bovine PRNP gene sequence, two pairs of primers for testing the 23 bp and 12 bp indel mutations were designed. The PCR ampliifcation and agarose electrophoresis were carried out to distinguish the different genotypes within the mutations. Moreover, based on previous data from other cattle breeds and present genotypic and allelic frequencies of two indels mutations in this study, the corrections between the two indel mutations and BSE susceptibility were tested, as well as the relationships between the mutations and milk performance traits were analyzed in this study based on the statistical analyses. Results In the analyzed Chinese Holstein population, the frequencies of two“del”alleles in 23 bp and 12 bp indel muations were more frequent. The frequency of haplotype of 23del-12del was higher than those of 23del-12ins and 23ins-12del. From the estimated r2 and D’ values, two indel polymorphisms were linked strongly in the Holstein population (D’=57.5%, r2=0.257). Compared with the BSE-affected cattle populations from the reported data, the signiifcant differences of genotypic and allelic frequencies were found among present Holstein and some BSE-affected populations (P0.05). Conclusions These observations revealed that the inlfuence of two indel mutations within the bovine PRNP gene on BSE depended on the breed and they did not affect the milk production traits, which layed the foundation for future selection of resistant animals, and for improving health conditions for dairy breeding against BSE in China.

  6. Collecting duct carcinoma of the kidney is associated with CDKN2A deletion and SLC family gene up-regulation

    Science.gov (United States)

    Wei, Lei; Liu, Biao; Hu, Qiang; Miles, Kiersten Marie; Conroy, Jeffrey M.; Glenn, Sean T.; Costantini, Manuela; Magi-Galluzzi, Cristina; Signoretti, Sabina; Choueiri, Toni; Gallucci, Michele; Sentinelli, Steno; Fazio, Vito M.; Poeta, Maria Luana; Liu, Song; Morrison, Carl; Pili, Roberto

    2016-01-01

    The genetic landscape and molecular features of collecting duct carcinoma (CDC) of the kidney remain largely unknown. Herein, we performed whole exome sequencing (WES) and transcriptome sequencing (RNASeq) on 7 CDC samples (CDC1 −7). Among the 7 samples, 4 samples with matched non-tumor tissue were used for copy number analysis by SNP array data. No recurrent somatic SNVs were observed except for MLL, which was found to be mutated (p.V297I and p.F407C) in 2 samples. We identified somatic SNVs in 14 other cancer census genes including: ATM, CREBBP, PRDM1, CBFB, FBXW7, IKZF1, KDR, KRAS, NACA, NF2, NUP98, SS18, TP53, and ZNF521. SNP array data identified a CDKN2A homozygous deletion in 3 samples and SNV analysis showed a non-sense mutation of the CDKN2A gene with unknown somatic status. To estimate the recurrent rate of CDKN2A abnormalities, we performed FISH screening of additional samples and confirmed the frequent loss (62.5%) of CDKN2A expression. Since cisplatin based therapy is the common treatment option for CDC, we investigated the expression of solute carrier (SLC) family transporters and found 45% alteration. In addition, SLC7A11 (cystine transporter, xCT), a cisplatin resistance associated gene, was found to be overexpressed in 4 out of 5 (80%) cases of CDC tumors tested, as compared to matched non-tumor tissue. In summary, our study provides a comprehensive genomic analysis of CDC and identifies potential pathways suitable for targeted therapies. PMID:27144525

  7. Intragenic deletion in the Desmoglein 4 gene underlies the skin phenotype in the Iffa Credo "hairless" rat.

    Science.gov (United States)

    Bazzi, Hisham; Kljuic, Ana; Christiano, Angela M; Christiano, Angela M; Panteleyev, Andrey A

    2004-10-01

    The Iffa Credo (IC) "hairless" rat is an autosomal recessive hypotrichotic animal model actively used in pharmacological and dermatological studies. Although the molecular basis of the IC rat phenotype was never defined, the designation "hr/hr" (hairless) has been used for this rat mutation. Despite the observation that IC rats share many phenotypic similarities with Charles River (CR) 'hairless rats', crossbreeding between CR and IC rats indicated that these mutations are not allelic, and moreover, genetic analysis of both CR and IC hairless mutant rats showed no mutations in the hr gene. Here, we present a detailed analysis of the skin phenotype in the IC rat. While the initial stages of hair follicle (HF) morphogenesis reveal no significant abnormalities, the subsequent processes of inner root sheath and hair shaft formation are severely disturbed due to impaired proliferation in the hair matrix and abnormal differentiation in the precortex zone. This results in significant reduction of hair bulb volume, and the formation of dysmorphic "blebbed" hair shafts lacking medullar structure and resembling "lanceolate" hairs. Based on the presence of lance-head hairs typical of rodent lanceolate mutants, we performed molecular analysis of the desmoglein 4 gene and found a large intragenic deletion encompassing nine exons of the gene. This finding, together with specific morphological features of skin and hairs, confirms that the IC rat is allelic with the lanceolate hair (lah) mutations in mice and rats. Our results elucidate the genetic and morphological basis of the IC rat mutation, thus providing a new model to study molecular mechanisms of hair growth control.

  8. Partial protoporphyrinogen oxidase (PPOX gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    Directory of Open Access Journals (Sweden)

    Barbaro Michela

    2013-01-01

    Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.

  9. Construction of brewing-wine Aspergillus oryzae pyrG- mutant by pyrG gene deletion and its application in homology transformation.

    Science.gov (United States)

    Du, Yu; Xie, Guizhen; Yang, Chunfa; Fang, Baishan; Chen, Hongwen

    2014-06-01

    pyrG(-) host cells are indispensable for pyrG(-) based transformation system. Isolations of pyrG(-) host cells by random mutations are limited by time-consuming, unclear genetic background and potential interferences of homogenous recombination. The purpose of this study was to construct brewing-wine Aspergillus oryzae pyrG(-) mutant by site-directed mutation of pyrG gene deletion which would be used as a host for further transformation. pMD-pyrGAB, a vector carrying pyrG deletion cassette, was used to construct pyrG(-) mutant of A. oryzae. Three stable pyrG deletion mutants of A. oryzae were isolated by resistant to 5-fluoroorotic acid and confirmed by polymerase chain reaction analysis, indicating that pyrG was completely excised. The ΔpyrG mutants were applied as pyrG(-) host cells to disrupt xdh gene encoding xylitol dehydrogenase, which involves in xylitol production of A. oryzae. The xdh disruption mutants were efficiently constructed by transforming a pMD-pyrG-xdh disruption plasmid carrying pyrG, and the produced xylitol concentration of the Δxdh mutant was three times as much as that of the ΔpyrG recipient. Site-directed pyrG gene deletion is thus an effective way for the isolation of pyrG(-) host cells, and the established host-vector system could be applied in further functional genomics analysis and molecular breeding of A. oryzae.

  10. IFN-beta gene deletion leads to augmented and chronic demyelinating experimental autoimmune encephalomyelitis

    DEFF Research Database (Denmark)

    Teige, Ingrid; Treschow, Alexandra; Teige, Anna;

    2003-01-01

    Since the basic mechanisms behind the beneficial effects of IFN-beta in multiple sclerosis (MS) patients are still obscure, here we have investigated the effects of IFN-beta gene disruption on the commonly used animal model for MS, experimental autoimmune encephalomyelitis (EAE). We show that IFN......-beta knockout (KO) mice are more susceptible to EAE than their wild-type (wt) littermates; they develop more severe and chronic neurological symptoms with more extensive CNS inflammation and demyelination. However, there was no discrepancy observed between wt and KO mice regarding the capacity of T cells...... to proliferate or produce IFN-gamma in response to recall Ag. Consequently, we addressed the effect of IFN-beta on encephalitogenic T cell development and the disease initiation phase by passive transfer of autoreactive T cells from KO or wt littermates to both groups of mice. Interestingly, IFN-beta KO mice...

  11. Diminished thrombogenic responses by deletion of the Podocalyxin Gene in mouse megakaryocytes.

    Directory of Open Access Journals (Sweden)

    Miguel Pericacho

    Full Text Available Podocalyxin (Podxl is a type I membrane sialoprotein of the CD34 family, originally described in the epithelial glomerular cells of the kidney (podocytes in which it plays an important function. Podxl can also be found in megakaryocytes and platelets among other extrarenal places. The surface exposure of Podxl upon platelet activation suggested it could play some physiological role. To elucidate the function of Podxl in platelets, we generated mice with restricted ablation of the podxl gene in megakaryocytes using the Cre-LoxP gene targeting methodology. Mice with Podxl-null megakaryocytes did not show any apparent phenotypical change and their rates of growth, life span and fertility did not differ from the floxed controls. However, Podxl-null mice showed prolonged bleeding time and decreased platelet aggregation in response to physiological agonists. The number, size-distribution and polyploidy of Podxl-null megakaryocytes were similar to the floxed controls. Podxl-null platelets showed normal content of surface receptors and normal activation by agonists. However, the mice bearing Podxl-null platelets showed a significant retardation in the ferric chloride-induced occlusion of the carotid artery. Moreover, acute thrombosis induced by the i.v. injection of sublethal doses of collagen and phenylephrine produced a smaller fall in the number of circulating platelets in Podxl-null mice than in control mice. In addition, perfusion of uncoagulated blood from Podxl-null mice in parallel flow chamber showed reduced adhesion of platelets and formation of aggregates under high shear stress. It is concluded that platelet Podxl is involved in the control of hemostasis acting as a platelet co-stimulator, likely due to its pro-adhesive properties.

  12. Conditional Deletion of the Retinoblastoma (Rb) Gene in Ovarian Granulosa Cells Leads to Premature Ovarian Failure

    Science.gov (United States)

    Andreu-Vieyra, Claudia; Chen, Ruihong; Matzuk, Martin M.

    2008-01-01

    The retinoblastoma protein (RB) regulates cell proliferation and survival by binding to the E2F family of transcription factors. Recent studies suggest that RB also regulates differentiation in a variety of cell types, including myocytes, neurons, adipocytes, and chondrocytes. Rb mutations have been found in ovarian cancer; however, the role of RB in normal and abnormal ovarian function remains unclear. To test the hypothesis that loss of Rb induces ovarian tumorigenesis, we generated an ovarian granulosa cell conditional knockout of Rb (Rb cKO) using the Cre/lox recombination system. Rb cKO females showed 100% survival and no ovarian tumor formation through 9 months of age, but they developed progressive infertility. Prepubertal Rb cKO females showed increased ovulation rates compared with controls, correlating with increased follicle recruitment, higher Fshr and Kitl mRNA levels, and lower anti-Müllerian hormone levels. In contrast, the ovulation rate of 6-wk-old females was similar to that of controls. Morphometric analysis of Rb cKO ovaries from 6-wk-old and older females showed increased follicular atresia and apoptosis. Rb cKO ovaries and preantral follicles had abnormal levels of known direct and indirect target genes of RB, including Rbl2/p130, E2f1, Ccne2, Myc, Fos, and Tgfb2. In addition, preantral follicles showed increased expression of the granulosa cell differentiation marker Inha, decreased levels of Foxl2 and Cyp19a1 aromatase, and abnormal expression of the nuclear receptors Nr5a1, Nr5a2, and Nr0b1. Taken together, our results suggest that RB is required for the temporal-specific pattern of expression of key genes involved in follicular development. PMID:18599617

  13. Variation in Plasmodium falciparum Histidine-Rich Protein 2 (Pfhrp2) and Plasmodium falciparum Histidine-Rich Protein 3 (Pfhrp3) Gene Deletions in Guyana and Suriname.

    Science.gov (United States)

    Akinyi Okoth, Sheila; Abdallah, Joseph F; Ceron, Nicolas; Adhin, Malti R; Chandrabose, Javin; Krishnalall, Karanchand; Huber, Curtis S; Goldman, Ira F; Macedo de Oliveira, Alexandre; Barnwell, John W; Udhayakumar, Venkatachalam

    2015-01-01

    Guyana and Suriname have made important progress in reducing the burden of malaria. While both countries use microscopy as the primary tool for clinical diagnosis, malaria rapid diagnostic tests (RDTs) are useful in remote areas of the interior where laboratory support may be limited or unavailable. Recent reports indicate that histidine-rich protein 2 (PfHRP2)-based diagnostic tests specific for detection of P. falciparum may provide false negative results in some parts of South America due to the emergence of P. falciparum parasites that lack the pfhrp2 gene, and thus produce no PfHRP2 antigen. Pfhrp2 and pfhrp3 genes were amplified in parasite isolates collected from Guyana and Suriname to determine if there were circulating isolates with deletions in these genes. Pfhrp3 deletions were monitored because some monoclonal antibodies utilized in PfHRP2-based RDTs cross-react with the PfHRP3 protein. We found that all 97 isolates from Guyana that met the inclusion criteria were both pfhrp2- and pfhrp3-positive. In Suriname (N = 78), 14% of the samples tested were pfhrp2-negative while 4% were pfhrp3-negative. Furthermore, analysis of the genomic region proximal to pfhrp2 and pfhrp3 revealed that genomic deletions extended to the flanking genes. We also investigated the population substructure of the isolates collected to determine if the parasites that had deletions of pfhrp2 and pfhrp3 belonged to any genetic subtypes. Cluster analysis revealed that there was no predominant P. falciparum population substructure among the isolates from either country, an indication of genetic admixture among the parasite populations. Furthermore, the pfhrp2-deleted parasites from Suriname did not appear to share a single, unique genetic background.

  14. Comparative analysis of Phytophthora genes encoding secreted proteins reveals conserved synteny and lineage-specific gene duplications and deletions

    NARCIS (Netherlands)

    Jiang, R.H.Y.; Tyler, B.M.; Govers, F.

    2006-01-01

    Comparative analysis of two Phytophthora genomes revealed overall colinearity in four genomic regions consisting of a 1.5-Mb sequence of Phytophthora sojae and a 0.9-Mb sequence of R ramorum. In these regions with conserved synteny, the gene order is largely similar; however, genome rearrangements a

  15. Williams综合征临床诊断和基因缺失的研究%Clinical features and gene deletions of Williams syndrome

    Institute of Scientific and Technical Information of China (English)

    梁瑛; 周爱卿; 王世雄; 胡琴

    2001-01-01

    Objective Supravalvular aortic stenosis (SVAS) is a type of leftventricular outflow obstruction. It occurs in three settings: Williams syndrome (WS), autosomal dominant familial cases, and sporadic cases. Most patients with SVAS have WS. WS is a developmental disorder affecting multiple organ systems, involving the vascular, connective tissue, and central nervous systems. This study aimed at discussing the criteria of WS in China by evaluating the clinical features and detecting gene deletions in children clinically diagnosed to have SVAS. Method Twenty-six children (17 males and 9 females) with SVAS who presented to the Xinhua Hospital affiliated to Shanghai Second Medical University and Shanghai Children′s Medical Center between November 1997 and December 1999 were enrolled. These children were followed-up for a median duration of 6.3 (range 1.1 to 19.5) years. Diagnosis of SVAS and non-SVAS congenital heart diseases was based on physical examination, echocardiography, cardiac catheterization and angiography. Mostly the clinical features of WS in these children were assessed according to Lowery′s WS phenotype scoring system, which included typical facial features, mental retardation /developmental delay, SVAS, non-SVAS congenital heart disease, inguinal hernia, and hypercalcemia. All the children also underwent an evaluation of minor medical problems of WS, involving WS personality, weight, head circumference, voice, and ocular, auditory, gastrointestinal, genitourinary, and musculoskeletal organ systems. Fluorescent in situ hybridizations (FISH) were used to detect the microdeletions of elastin (ELN) gene and LIM kinase 1 (LIMK1) gene in all the children. Result Nineteen children, whose WS phenotype scoring was more than 4, showed the gene microdeletions. Children whose scoring was equal to 4 (n=3) or less than 4 (n=4) did not demonstrate deletions. Conclusion These data indicated that WS could be diagnosed in children with SVAS whose Lowery′s scoring was

  16. The ACE Gene Insertion/Deletion Polymorphism and Cerebrovascular Diseases in Uzbek Patients with Arterial Hypertension

    Directory of Open Access Journals (Sweden)

    Nargiza U. Makhkamova

    2016-09-01

    Full Text Available The aim of the present study was to investigate the association between the ACE gene I/D polymorphism and the development of hypertensive encephalopathy (HE in Uzbek patients with hypertension (HT. Materials and methods: The study included 91 male patients aged from 32 to 74 years (mean age 52.5±9.2 with HT Grade 1, 2 and 3 (ESH/ESC, 2013 [4] and presence of HE. All patients were checked on office BP using Korotkov’s method and ambulatory blood pressure monitoring (ABPM. Intima-media thickness (IMT of the carotid artery was measured by a 7.5MHz high-resolution ultrasound. Genomic DNA was isolated from peripheral blood using the DiatomTM DNA Prep 200 Kit according to the manufacturer's protocol. ACE gene I/D polymorphism genotypes were determined by PCR. Results: Among HT patients with HE, we have identified a statistically significant predominance of ID genotype carriers (65.9% against carriers of the II genotype (18.75 and DD genotype (15.4% (P=0.000; the frequency of I and D alleles was 51.6% and 48.4%, respectively (P>0.05. Comparative analysis showed a possible association between the ID genotype/D allele and HE development in HT patients, according to the general model (OR = 6.36; 95% CI 3.04 -13.31; p=0.000 and multiplicative model (OR = 2.02; 95% CI 1.25 -3.27; p=0.004 of inheritance. High grades of HT were predominant in carriers of the DD genotype. IMT was significantly higher in carriers of the DD genotype than in carriers of the II and ID genotypes. The carriage of D allele was associated with the highest levels of TC, TG, and VLDL-C. Carriers of the DD genotype were characterized by higher values of daytime SBP, nighttime SBP variability and nighttime SBP load.

  17. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    Energy Technology Data Exchange (ETDEWEB)

    Solera, J. (Unidades de Genetica Molecular, Madrid (Spain)); Magallon, M.; Martin-Villar, J. (Hemofilia Hospital, Madrid (Spain)); Coloma, A. (Departamento deBioquimica de la Facultad de Medicina de la Universidad Autonoma, Madrid (Spain))

    1992-02-01

    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment.

  18. Deletion of JAM-C, a candidate gene for heart defects in Jacobsen syndrome, results in a normal cardiac phenotype in mice.

    Science.gov (United States)

    Ye, Maoqing; Hamzeh, Rabih; Geddis, Amy; Varki, Nissi; Perryman, M Benjamin; Grossfeld, Paul

    2009-07-01

    The 11q terminal deletion disorder (11q-) is a rare chromosomal disorder caused by a deletion in distal 11q. Fifty-six percent of patients have clinically significant congenital heart defects. A cardiac "critical region" has been identified in distal 11q that contains over 40 annotated genes. In this study, we identify the distal breakpoint of a patient with a paracentric inversion in distal 11q who had hypoplastic left heart and congenital thrombocytopenia. The distal breakpoint mapped to JAM-3, a gene previously identified as a candidate gene for causing HLHS in 11q-. To determine the role of JAM-3 in cardiac development, we performed a comprehensive cardiac phenotypic assessment in which the mouse homolog for JAM-3, JAM-C, has been deleted. These mice have normal cardiac structure and function, indicating that haplo-insufficiency of JAM-3 is unlikely to cause the congenital heart defects that occur in 11q- patients. Notably, we identified a previously undescribed phenotype, jitteriness, in most of the sick or dying adult JAM-C knockout mice. These data provide further insights into the identification of the putative disease-causing cardiac gene(s) in distal 11q, as well as the functions of JAM-C in normal organ development.

  19. The refinement of the critical region for the 2q31.2q32.3 deletion syndrome indicates candidate genes for mental retardation and speech impairment.

    Science.gov (United States)

    Cocchella, Alessandro; Malacarne, Michela; Forzano, Francesca; Marciano, Carmela; Pierluigi, Mauro; Perroni, Lucia; Faravelli, Francesca; Di Maria, Emilio

    2010-10-05

    Current literature provides more than 30 patients with interstitial deletions in chromosome 2q31q33. Only a few of them were studied using high-resolution methods. Among these, two patients had presented with a particular consistence of some clinical features associated to a deletion between bands q31.2 and q32.3 of chromosome 2. This clinical pattern, labeled as "2q31.2q32.3 syndrome," consists of multiple dysmorphisms, developmental delay, mental retardation and behavioural disturbances. We report an adult female patient with a 4.4 Mb deletion in the 2q31.2q32.3 region, showing facial dysmorphisms, mental retardation and absence of speech. The region overlaps with the deletion found in the two cases previously reported. The critical region points to a few genes, namely NEUROD1, ZNF804A, PDE1A, and ITGA4, which are good candidates to explain the cognitive and behavioural phenotype, as well as the severe speech impairment associated with the 2q31.2q32.3 deletion.

  20. Lethality of mice bearing a knockout of the Ngly1-gene is partially rescued by the additional deletion of the Engase gene.

    Directory of Open Access Journals (Sweden)

    Haruhiko Fujihira

    2017-04-01

    Full Text Available The cytoplasmic peptide:N-glycanase (Ngly1 in mammals is a de-N-glycosylating enzyme that is highly conserved among eukaryotes. It was recently reported that subjects harboring mutations in the NGLY1 gene exhibited severe systemic symptoms (NGLY1-deficiency. While the enzyme obviously has a critical role in mammals, its precise function remains unclear. In this study, we analyzed Ngly1-deficient mice and found that they are embryonic lethal in C57BL/6 background. Surprisingly, the additional deletion of the gene encoding endo-β-N-acetylglucosaminidase (Engase, which is another de-N-glycosylating enzyme but leaves a single GlcNAc at glycosylated Asn residues, resulted in the partial rescue of the lethality of the Ngly1-deficient mice. Additionally, we also found that a change in the genetic background of C57BL/6 mice, produced by crossing the mice with an outbred mouse strain (ICR could partially rescue the embryonic lethality of Ngly1-deficient mice. Viable Ngly1-deficient mice in a C57BL/6 and ICR mixed background, however, showed a very severe phenotype reminiscent of the symptoms of NGLY1-deficiency subjects. Again, many of those defects were strongly suppressed by the additional deletion of Engase in the C57BL/6 and ICR mixed background. The defects observed in Ngly1/Engase-deficient mice (C57BL/6 background and Ngly1-deficient mice (C57BL/6 and ICR mixed background closely resembled some of the symptoms of patients with an NGLY1-deficiency. These observations strongly suggest that the Ngly1- or Ngly1/Engase-deficient mice could serve as a valuable animal model for studies related to the pathogenesis of the NGLY1-deficiency, and that cytoplasmic ENGase represents one of the potential therapeutic targets for this genetic disorder.

  1. The deletion polymorphism of the angiotensin-converting enzyme gene is related to phenotypic differences in human arteries

    NARCIS (Netherlands)

    Buikema, H; Pinto, YM; Rooks, G; Grandjean, JG; Schunkert, H; vanGilst, WH

    We hypothesized that angiotensin-converting enzyme (ACE) insertion/deletion polymorphism may be related to arterial phenotypic differences that could explain the adverse effects of deletion polymorphism. Accordingly, contractile responses to angiotensin I and II (0.1 nmol.l(-1)-1 mu mol.l(-1)),

  2. EAAC1 Gene Deletion Increases Neuronal Death and Blood Brain Barrier Disruption after Transient Cerebral Ischemia in Female Mice

    Directory of Open Access Journals (Sweden)

    Bo Young Choi

    2014-10-01

    Full Text Available EAAC1 is important in modulating brain ischemic tolerance. Mice lacking EAAC1 exhibit increased susceptibility to neuronal oxidative stress in mice after transient cerebral ischemia. EAAC1 was first described as a glutamate transporter but later recognized to also function as a cysteine transporter in neurons. EAAC1-mediated transport of cysteine into neurons contributes to neuronal antioxidant function by providing cysteine substrates for glutathione synthesis. Here we evaluated the effects of EAAC1 gene deletion on hippocampal blood vessel disorganization after transient cerebral ischemia. EAAC1−/− female mice subjected to transient cerebral ischemia by common carotid artery occlusion for 30 min exhibited twice as much hippocampal neuronal death compared to wild-type female mice as well as increased reduction of neuronal glutathione, blood–brain barrier (BBB disruption and vessel disorganization. Pre-treatment of N-acetyl cysteine, a membrane-permeant cysteine prodrug, increased basal glutathione levels in the EAAC1−/− female mice and reduced ischemic neuronal death, BBB disruption and vessel disorganization. These findings suggest that cysteine uptake by EAAC1 is important for neuronal antioxidant function under ischemic conditions.

  3. Screening of ARHSP-TCC patients expands the spectrum of SPG11 mutations and includes a large scale gene deletion.

    Science.gov (United States)

    Denora, Paola S; Schlesinger, David; Casali, Carlo; Kok, Fernando; Tessa, Alessandra; Boukhris, Amir; Azzedine, Hamid; Dotti, Maria Teresa; Bruno, Claudio; Truchetto, Jeremy; Biancheri, Roberta; Fedirko, Estelle; Di Rocco, Maja; Bueno, Clarissa; Malandrini, Alessandro; Battini, Roberta; Sickl, Elisabeth; de Leva, Maria Fulvia; Boespflug-Tanguy, Odile; Silvestri, Gabriella; Simonati, Alessandro; Said, Edith; Ferbert, Andreas; Criscuolo, Chiara; Heinimann, Karl; Modoni, Anna; Weber, Peter; Palmeri, Silvia; Plasilova, Martina; Pauri, Flavia; Cassandrini, Denise; Battisti, Carla; Pini, Antonella; Tosetti, Michela; Hauser, Erwin; Masciullo, Marcella; Di Fabio, Roberto; Piccolo, Francesca; Denis, Elodie; Cioni, Giovanni; Massa, Roberto; Della Giustina, Elvio; Calabrese, Olga; Melone, Marina A B; De Michele, Giuseppe; Federico, Antonio; Bertini, Enrico; Durr, Alexandra; Brockmann, Knut; van der Knaap, Marjo S; Zatz, Mayana; Filla, Alessandro; Brice, Alexis; Stevanin, Giovanni; Santorelli, Filippo M

    2009-03-01

    Autosomal recessive spastic paraplegia with thinning of corpus callosum (ARHSP-TCC) is a complex form of HSP initially described in Japan but subsequently reported to have a worldwide distribution with a particular high frequency in multiple families from the Mediterranean basin. We recently showed that ARHSP-TCC is commonly associated with mutations in SPG11/KIAA1840 on chromosome 15q. We have now screened a collection of new patients mainly originating from Italy and Brazil, in order to further ascertain the spectrum of mutations in SPG11, enlarge the ethnic origin of SPG11 patients, determine the relative frequency at the level of single Countries (i.e., Italy), and establish whether there is one or more common mutation. In 25 index cases we identified 32 mutations; 22 are novel, including 9 nonsense, 3 small deletions, 4 insertions, 1 in/del, 1 small duplication, 1 missense, 2 splice-site, and for the first time a large genomic rearrangement. This brings the total number of SPG11 mutated patients in the SPATAX collection to 111 cases in 44 families and in 17 isolated cases, from 16 Countries, all assessed using homogeneous clinical criteria. While expanding the spectrum of mutations in SPG11, this larger series also corroborated the notion that even within apparently homogeneous population a molecular diagnosis cannot be achieved without full gene sequencing.

  4. DNA Fragmentation Factor 45 (DFF45 Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line

    Directory of Open Access Journals (Sweden)

    Hong Wei Yang

    2001-01-01

    Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.

  5. Potentially harmful advantage to athletes: a putative connection between UGT2B17 gene deletion polymorphism and renal disorders with prolonged use of anabolic androgenic steroids

    Directory of Open Access Journals (Sweden)

    Barker James

    2010-04-01

    Full Text Available Abstract Background and objective With prolonged use of anabolic androgenic steroids (AAS, occasional incidents of renal disorders have been observed. Independently, it has also been established that there are considerable inter-individual and inter-ethnic differences, in particular with reference to the uridine diphosphate-glucuronosyltransferase 2B17 (UGT2B17 gene, in metabolising these compounds. This report postulates the association of deletion polymorphism in the UGT2B17 gene with the occurrence of renal disorders on chronic exposure to AAS. Presentation of the hypothesis The major deactivation and elimination pathway of AASs is through glucuronide conjugation, chiefly catalyzed by the UGT2B17 enzyme, followed by excretion in urine. Excretion of steroids is affected in individuals with a deletion mutation in the UGT2B17 gene. We hypothesize that UGT2B17 deficient individuals are more vulnerable to developing renal disorders with prolonged use of AAS owing to increases in body mass index and possible direct toxic effects of steroids on the kidneys. Elevated serum levels of biologically active steroids due to inadequate elimination can lead to prolonged muscle build up. An increase in body mass index may cause renal injuries due to sustained elevated glomerular pressure and flow rate. Testing the hypothesis In the absence of controlled clinical trials in humans, observational studies can be carried out. Real time PCR with allelic discrimination should be employed to examine the prevalence of different UGT2B17 genotypes in patients with impaired renal function and AAS abuse. In individuals with the UGT2B17 deletion polymorphism, blood tests, biofluid analyses, urinalysis, and hair analyses following the administration of an anabolic steroid can be used to determine the fate of the substance once in the body. Implications of the hypothesis If the hypothesis is upheld, anabolic steroid users with a deletion mutation in the UGT2B17 gene may be

  6. Characterization of a genetically engineered mouse model of hemophilia A with complete deletion of the F8 gene.

    Science.gov (United States)

    Chao, B N; Baldwin, W H; Healey, J F; Parker, E T; Shafer-Weaver, K; Cox, C; Jiang, P; Kanellopoulou, C; Lollar, P; Meeks, S L; Lenardo, M J

    2016-02-01

    ESSENTIALS: Anti-factor VIII (FVIII) inhibitory antibody formation is a severe complication in hemophilia A therapy. We genetically engineered and characterized a mouse model with complete deletion of the F8 coding region. F8(TKO) mice exhibit severe hemophilia, express no detectable F8 mRNA, and produce FVIII inhibitors. The defined background and lack of FVIII in F8(TKO) mice will aid in studying FVIII inhibitor formation. The most important complication in hemophilia A treatment is the development of inhibitory anti-Factor VIII (FVIII) antibodies in patients after FVIII therapy. Patients with severe hemophilia who express no endogenous FVIII (i.e. cross-reacting material, CRM) have the greatest incidence of inhibitor formation. However, current mouse models of severe hemophilia A produce low levels of truncated FVIII. The lack of a corresponding mouse model hampers the study of inhibitor formation in the complete absence of FVIII protein. We aimed to generate and characterize a novel mouse model of severe hemophilia A (designated the F8(TKO) strain) lacking the complete coding sequence of F8 and any FVIII CRM. Mice were created on a C57BL/6 background using Cre-Lox recombination and characterized using in vivo bleeding assays, measurement of FVIII activity by coagulation and chromogenic assays, and anti-FVIII antibody production using ELISA. All F8 exonic coding regions were deleted from the genome and no F8 mRNA was detected in F8(TKO) mice. The bleeding phenotype of F8(TKO) mice was comparable to E16 mice by measurements of factor activity and tail snip assay. Similar levels of anti-FVIII antibody titers after recombinant FVIII injections were observed between F8(TKO) and E16 mice. We describe a new C57BL/6 mouse model for severe hemophilia A patients lacking CRM. These mice can be directly bred to the many C57BL/6 strains of genetically engineered mice, which is valuable for studying the impact of a wide variety of genes on FVIII inhibitor formation on a

  7. Deletion of the Novel Oocyte-Enriched Gene, Gpr149, Leads to Increased Fertility in Mice

    Science.gov (United States)

    Edson, Mark A.; Lin, Yi-Nan; Matzuk, Martin M.

    2010-01-01

    Through in silico subtraction and microarray analysis, we identified mouse Gpr149, a novel, oocyte-enriched transcript that encodes a predicted orphan G-protein-coupled receptor (GPR). Phylogenetic analysis of GPR149 from fish to mammals suggests that it is widely conserved in vertebrates. By multitissue RT-PCR analysis, we found that Gpr149 is highly expressed in the ovary and also in the brain and the digestive tract at low levels. Gpr149 levels are low in newborn ovaries but increase throughout folliculogenesis. In the ovary, we found that granulosa cells did not express Gpr149, whereas germinal vesicle and meiosis II stage oocytes showed high levels of Gpr149 expression. After fertilization, Gpr149 expression declined, becoming undetectable by the two-cell stage. To study the function of GPR149 in oocyte growth and maturation, we generated Gpr149 null mice. Surprisingly, Gpr149 null mice are viable and have normal folliculogenesis, but demonstrate increased fertility, enhanced ovulation, increased oocyte Gdf9 mRNA levels, and increased levels of FSH receptor and cyclin D2 mRNA levels in granulosa cells. Thus, Gpr149 null mice are one of the few models with enhanced fertility, and GPR149 could be a target for small molecules to enhance fertility in the assisted reproductive technology clinic. PMID:19887567

  8. Apparent Homozygosity of p.Phe508del in CFTR due to a Large Gene Deletion of Exons 4–11

    Directory of Open Access Journals (Sweden)

    Vassos Neocleous

    2014-01-01

    Full Text Available We report a classic cystic fibrosis (CF boy with a large deletion of exons 4–11 in the cystic fibrosis transmembrane conductance regulator (CFTR gene on one allele and p.Phe508del in exon 10 on the second allele. Both parents of Georgian and Ukrainian background had no personal or family history of the disease. The initial molecular diagnostic investigation identified the patient as homozygous for the p.Phe508del and not compatible with his parent’s genetic status. The possibility of nonpaternity or uniparental disomy (UPD7 was investigated and excluded using microsatellite analysis of highly polymorphic markers on chromosome 7. Array-CGH was also performed on the patient and revealed a male profile with a subtle deletion within the CFTR gene on the long arm (q-arm of chromosome 7 (7q31.2. The deletion was confirmed by MLPA extending from probe L02380 to probe L14978 (28.7 kb and that was inherited from his father, while p.PheF508del was inherited from his mother. These data highlight the need for additional testing for large deletions in patients with apparent homozygosity for a mutated CFTR allele that do not match the carrier status of the parents. Not testing can lead to misdiagnosis and misinterpretation of mutation carrier status and the expected penetrance of the disorder.

  9. The ARC1 E3 ligase gene is frequently deleted in self-compatible Brassicaceae species and has a conserved role in Arabidopsis lyrata self-pollen rejection.

    Science.gov (United States)

    Indriolo, Emily; Tharmapalan, Pirashaanthy; Wright, Stephen I; Goring, Daphne R

    2012-11-01

    Self-pollen rejection is an important reproductive regulator in flowering plants, and several different intercellular signaling systems have evolved to elicit this response. In the Brassicaceae, the self-incompatibility system is mediated by the pollen S-locus Cys-Rich/S-locus Protein11 (SCR/SP11) ligand and the pistil S Receptor Kinase (SRK). While the SCR/SP11-SRK recognition system has been identified in several species across the Brassicaceae, less is known about the conservation of the SRK-activated cellular responses in the stigma, following self-pollen contact. The ARM Repeat Containing1 (ARC1) E3 ubiquitin ligase functions downstream of SRK for the self-incompatibility response in Brassica, but it has been suggested that ARC1 is not required in Arabidopsis species. Here, we surveyed the presence of ARC1 orthologs in several recently sequenced genomes from Brassicaceae species that had diversified ∼20 to 40 million years ago. Surprisingly, the ARC1 gene was deleted in several species that had lost the self-incompatibility trait, suggesting that ARC1 may lose functionality in the transition to self-mating. To test the requirement of ARC1 in a self-incompatible Arabidopsis species, transgenic ARC1 RNA interference Arabidopsis lyrata plants were generated, and they exhibited reduced self-incompatibility responses resulting in successful fertilization. Thus, this study demonstrates a conserved role for ARC1 in the self-pollen rejection response within the Brassicaceae.

  10. A novel single gene deletion (-αMAL3.5 giving rise to silent α thalassemia carrier removing the entire HBA2 gene observed in two Chinese patients with Hb H disease: case report of two probands

    Directory of Open Access Journals (Sweden)

    Faidatul Syazlin Abdul Hamid

    2015-07-01

    Full Text Available We report a novel deletion at the HBA2 presented with Hb H disease in two Malaysian- Chinese patients. The two unrelated probands were diagnosed with Hb H disease in a primary hematological screening for thalassemia. Results from routine molecular analysis with gap-polymerase chain reaction (PCR method revealed a genotype asynchrony with the observed clinical presentation. Subsequent DNA analysis using a battery of molecular methods such as gap-PCR, multiplex ligation dependent probe amplification, DNA sequencing, confirmed the presence of a novel deletion in both the index cases removing the entire α2 globin gene. We have designated the deletion as (‒αMAL3.5. Hematological indices and clinical findings suggest that the deletion has an α+ phenotype. The molecular process of this deletion is the result from misalignment and unequal crossover event between the duplicated homologous Y-boxes within the α globin gene cluster. Uncharacterized deletions, single nucleotide polymorphism and other nucleotide indels at the primer binding sites may impede the optimum condition for its annealing and extension and therefore may invalidate the gap-PCR obscuring the real genotype.

  11. Effect of the deletion of genes encoding proteins of the extracellular virion form of vaccinia virus on vaccine immunogenicity and protective effectiveness in the mouse model.

    Directory of Open Access Journals (Sweden)

    Clement A Meseda

    Full Text Available Antibodies to both infectious forms of vaccinia virus, the mature virion (MV and the enveloped virion (EV, as well as cell-mediated immune response appear to be important for protection against smallpox. EV virus particles, although more labile and less numerous than MV, are important for dissemination and spread of virus in infected hosts and thus important in virus pathogenesis. The importance of the EV A33 and B5 proteins for vaccine induced immunity and protection in a murine intranasal challenge model was evaluated by deletion of both the A33R and B5R genes in a vaccine-derived strain of vaccinia virus. Deletion of either A33R or B5R resulted in viruses with a small plaque phenotype and reduced virus yields, as reported previously, whereas deletion of both EV protein-encoding genes resulted in a virus that formed small infection foci that were detectable and quantifiable only by immunostaining and an even more dramatic decrease in total virus yield in cell culture. Deletion of B5R, either as a single gene knockout or in the double EV gene knockout virus, resulted in a loss of EV neutralizing activity, but all EV gene knockout viruses still induced a robust neutralizing activity against the vaccinia MV form of the virus. The effect of elimination of A33 and/or B5 on the protection afforded by vaccination was evaluated by intranasal challenge with a lethal dose of either vaccinia virus WR or IHD-J, a strain of vaccinia virus that produces relatively higher amounts of EV virus. The results from multiple experiments, using a range of vaccination doses and virus challenge doses, and using mortality, morbidity, and virus dissemination as endpoints, indicate that the absence of A33 and B5 have little effect on the ability of a vaccinia vaccine virus to provide protection against a lethal intranasal challenge in a mouse model.

  12. [THE EFFECT OF waaL LIGASE GENES DELETION ON MOTILITY AND STRESS ADAPTATION REACTIONS OF YERSINIA ENTEROCOLITICA 6471/76].

    Science.gov (United States)

    Shevchenko, J I; Shilina, J V; Pozur, V K; Skurnik, M

    2015-01-01

    The aim of current study was to estimate the influence of waaL(OS) and waaL(PS) genes deletion on lipopolysaccharide (LPS) synthesis, bacterial motility and stress resistance of bacteria Yersinia enterocolitica 6471/76. Single and double waaL mutants were created by replacing the wild-type alleles in bacterial chromosome for mutant ones. The phenotypes of mutants were visualized by DOC-PAGE gels stained with silver and immunoblot with specific to O-polysaccharide and outer core monoclonal antibodies. Bacterial motility was evaluated by the diameter of the migration zone. Wild type bacteria and mutants were analyzed by bacterial growth curves in a hypertonic medium. Participation of WaaL ligases in resistance to osmotic pressure was found only in case of both ligese genes deletion. Also the YeO3_os_ps mutants showed motility decreasing, which recovered after adding a functionally active gene. Thus, deletion of both waaL ligase genes lead to a drastic reduction in bacterial motility and increase their sensitivity to hypertonic medium that can indirectly characterize biological role of WaaL ligases.

  13. Effects of the deletion and over-expression of Fusarium graminearum gene FgHal2 on host response to mycovirus Fusarium graminearum virus 1.

    Science.gov (United States)

    Yu, Jisuk; Lee, Kyung-Mi; Son, Moonil; Kim, Kook-Hyung

    2015-09-01

    The mycovirus Fusarium graminearum virus 1 (FgV1) is associated with reduced virulence (hypovirulence) of Fusarium graminearum. Transcriptomic and proteomic expression profiling have shown that many F. graminearum genes are differentially expressed as a consequence of FgV1 infection. Several of these genes may be related to the maintenance of the virus life cycle. The host gene, FgHal2, which has a highly conserved 3'-phosphoadenosine 5'-phosphatase (PAP phosphatase-like) domain or inositol monophosphatase (IMPase) superfamily domain, shows reduced expression in response to FgV1 infection. We generated targeted gene deletion and over-expression mutants to clarify the possible function(s) of FgHal2 and its relationship to FgV1. The gene deletion mutant showed retarded growth, reduced aerial mycelia formation and reduced pigmentation, whereas over-expression mutants were morphologically similar to the wild-type (WT). Furthermore, compared with the WT, the gene deletion mutant produced fewer conidia and these showed abnormal morphology. The FgHal2 expression level was decreased by FgV1 infection at 120 h post-inoculation (hpi), whereas the levels were nine-fold greater for both the virus-free and virus-infected over-expression mutant than for the WT. FgV1 RNA accumulation was decreased in the deletion mutant at 48, 72 and 120 hpi. FgV1 RNA accumulation in the over-expression mutant was reduced relative to that of the WT at 48 and 120 hpi, but was similar to that of the WT at 72 hpi. The vertical transmission rate of FgV1 in the gene deletion mutant was low, suggesting that FgHal2 may be required for the maintenance of FgV1 in the host cell. Together, these results indicate that the putative 3'(2'),5'-bisphosphate nucleotidase gene, FgHal2, has diverse biological functions in the host fungus and may affect the viral RNA accumulation and transmission of FgV1.

  14. Uniform deletion junctions of complete azoospermia factor region c deletion in infertile men in Taiwan

    Institute of Scientific and Technical Information of China (English)

    Chao-Chin Hsu; Pao-Lin Kuo; Louise Chuang; Ying-Hung Lin; Yen-Ni Teng; Yung-Ming Lin

    2006-01-01

    Aim: To determine the deletion junctions of infertile men in Taiwan with azoospermia factor region c (AZFc) deletions and to evaluate the genotype/phenotype correlation. Methods: Genomic DNAs from 460 infertile men were examined. Bacterial artificial chromosome clones were used to verify the accuracy of polymerase chain reaction.Deletion junctions of the AZFc region were determined by analysis of sequence-tagged sites and gene-specific markers.Results: Complete AZFc deletions, including BPY2, CDY1 and DAZ genes, were identified in 24 men. The proximal breakpoints were clustered between sY1197 and sY1192, and the distal breakpoints were clustered between sY1054and sY1125 in all but one of the 24 men. The testicular phenotypes of men with complete AZFc deletion varied from oligozoospermia, to hypospermatogenesis, to maturation arrest. Conclusion: We identified a group of infertile men with uniform deletion junctions of AZFc in the Taiwan population. Despite this homogeneous genetic defect in the AZFc region, no clear genotype/phenotype correlation could be demonstrated.

  15. Lack of evidence for mutations or deletions in the CDKN2A/p16 and CDKN2B/p15 genes of Brazilian neuroblastoma patients

    Directory of Open Access Journals (Sweden)

    Bassi C.L.

    2004-01-01

    Full Text Available Neuroblastoma, the most common extracranial tumor in childhood, has a wide spectrum of clinical and biological features. The loss of heterozygosity within the 9p21 region has been reported as a prognostic factor. Two tumor suppressor genes located in this region, the CDKN2B/p15 and CDKN2A/p16 (cyclin-dependent kinase inhibitors 2B and 2A, respectively genes, play a critical role in cell cycle progression and are considered to be targets for tumor inactivation. We analyzed CDKN2B/p15 and CDKN2A/p16 gene alterations in 11 patients, who ranged in age from 4 months to 13 years (male/female ratio was 1.2:1. The most frequent stage of the tumor was stage IV (50%, followed by stages II and III (20% and stage I (10%. The samples were submitted to the multiplex PCR technique for homozygous deletion analysis and to single-strand conformation polymorphism and nucleotide sequencing for mutation analysis. All exons of both genes were analyzed, but no deletion was detected. One sample exhibited shift mobility specific for exon 2 in the CDKN2B/p15 gene, not confirmed by DNA sequencing. Homozygous deletions and mutations are not involved in the inactivation mechanism of the CDKN2B/p15 and CDKN2A/p16 genes in neuroblastoma; however, these two abnormalities do not exclude other inactivation pathways. Recent evidence has shown that the expression of these genes is altered in this disease. Therefore, other mechanisms of inactivation, such as methylation of promoter region and unproperly function of proteins, may be considered in order to estimate the real contribution of these genes to neuroblastoma genesis or disease progression.

  16. Organization and evolution of a gene-rich region of the mouse genome: a 12.7-Mb region deleted in the Del(13)Svea36H mouse.

    Science.gov (United States)

    Mallon, Ann-Marie; Wilming, Laurens; Weekes, Joseph; Gilbert, James G R; Ashurst, Jennifer; Peyrefitte, Sandrine; Matthews, Lucy; Cadman, Matthew; McKeone, Richard; Sellick, Chris A; Arkell, Ruth; Botcherby, Marc R M; Strivens, Mark A; Campbell, R Duncan; Gregory, Simon; Denny, Paul; Hancock, John M; Rogers, Jane; Brown, Steve D M

    2004-10-01

    Del(13)Svea36H (Del36H) is a deletion of approximately 20% of mouse chromosome 13 showing conserved synteny with human chromosome 6p22.1-6p22.3/6p25. The human region is lost in some deletion syndromes and is the site of several disease loci. Heterozygous Del36H mice show numerous phenotypes and may model aspects of human genetic disease. We describe 12.7 Mb of finished, annotated sequence from Del36H. Del36H has a higher gene density than the draft mouse genome, reflecting high local densities of three gene families (vomeronasal receptors, serpins, and prolactins) which are greatly expanded relative to human. Transposable elements are concentrated near these gene families. We therefore suggest that their neighborhoods are gene factories, regions of frequent recombination in which gene duplication is more frequent. The gene families show different proportions of pseudogenes, likely reflecting different strengths of purifying selection and/or gene conversion. They are also associated with relatively low simple sequence concentrations, which vary across the region with a periodicity of approximately 5 Mb. Del36H contains numerous evolutionarily conserved regions (ECRs). Many lie in noncoding regions, are detectable in species as distant as Ciona intestinalis, and therefore are candidate regulatory sequences. This analysis will facilitate functional genomic analysis of Del36H and provides insights into mouse genome evolution.

  17. Ranking of persister genes in the same Escherichia coli genetic background demonstrates varying importance of individual persister genes in tolerance to different antibiotics

    Directory of Open Access Journals (Sweden)

    Nan eWu

    2015-09-01

    Full Text Available Despite the identification of many genes and pathways involved in the persistence phenomenon of bacteria, the relative importance of these genes in a single organism remains unclear. Here, using Escherichia coli as a model, we generated mutants of 21 known candidate persister genes and compared the relative importance of these mutants in persistence to various antibiotics (ampicillin, gentamicin, norfloxacin, and trimethoprim at different times. We found that oxyR, dnaK, sucB, relA, rpoS, clpB, mqsR, and recA were prominent persister genes involved in persistence to multiple antibiotics. These genes map to the following pathways: antioxidative defense pathway (oxyR, global regulators (dnaK, clpB, and rpoS, energy production (sucB, stringent response (relA, toxin–antitoxin (TA module (mqsR, and SOS response (recA. Among the TA modules, the ranking order was mqsR, lon, relE, tisAB, hipA, and dinJ. Intriguingly, rpoS deletion caused a defect in persistence to gentamicin but increased persistence to ampicillin and norfloxacin. Mutants demonstrated dramatic differences in persistence to different antibiotics at different time points: some mutants (oxyR, dnaK, phoU, lon, recA, mqsR, and tisAB displayed defect in persistence from early time points, while other mutants (relE, smpB, glpD, umuD, and tnaA showed defect only at later time points. These results indicate that varying hierarchy and importance of persister genes exist and that persister genes can be divided into those involved in shallow persistence and those involved in deep persistence. Our findings suggest that the persistence phenomenon is a dynamic process with different persister genes playing roles of variable significance at different times. These findings have implications for improved understanding of persistence phenomenon and developing new drugs targeting persisters for more effective cure of persistent infections.

  18. Non-pungent Capsicum contains a deletion in the capsaicinoid synthetase gene, which allows early detection of pungency with SCAR markers.

    Science.gov (United States)

    Lee, Choong-Jae; Yoo, Eunyoung; Shin, Juhyun; Shin, Joo Hyun; Lee, Jemin; Hwang, Hee-Sook; Kim, Byung-Dong

    2005-04-30

    The capsaicinoid synthetase (CS) gene cosegregated perfectly with the C locus, which controls the presence of pungency, in 121 F2 individuals from a cross between 'ECW123R' and 'CM334', both of Capsicum annuum. We concluded that CS and C are tightly linked. Sequence analysis of the genes of four pungent and four non-pungent pepper lines showed that the non-pungent peppers had a 2,529 bp-deletion in the 5' upstream region of CS. We have developed molecular markers of the C locus to detect pungency at the seedling stage. Based on the deleted sequence, we developed five SCAR markers, two of them being codominant. These SCAR markers will be useful for easy, accurate, and early detection of non-pungent individuals in breeding programs.

  19. A large deletion/insertion-induced frameshift mutation of the androgen receptor gene in a family with a familial complete androgen insensitivity syndrome.

    Science.gov (United States)

    Cong, Peikuan; Ye, Yinghui; Wang, Yue; Lu, Lingping; Yong, Jing; Yu, Ping; Joseph, Kimani Kagunda; Jin, Fan; Qi, Ming

    2012-06-01

    Androgen insensitivity syndrome (AIS) is an X-linked recessive genetic disorder with a normal 46, XY karyotype caused by abnormality of the androgen receptor (AR) gene. One Chinese family consisting of the proband and 5 other members with complete androgen insensitivity syndrome (CAIS) was investigated. Mutation analysis by DNA sequencing on all 8 exons and flanking intron regions of the AR gene revealed a unique large deletion/insertion mutation in the family. A 287 bp deletion and 77 bp insertion (c.933_1219delins77) mutation at codon 312 resulted in a frameshift which caused a premature stop (p.Phe312Aspfs*7) of polypeptide formation. The proband's mother and grandmother were heterozygous for the mutant allele. The proband's father, uncle and grandfather have the normal allele. From the pedigree constructed from mutational analysis of the family, it is revealed that the probably pathogenic mutation comes from the maternal side.

  20. Feline infectious peritonitis virus with a large deletion in the 5'-terminal region of the spike gene retains its virulence for cats.

    Science.gov (United States)

    Terada, Yutaka; Shiozaki, Yuto; Shimoda, Hiroshi; Mahmoud, Hassan Youssef Abdel Hamid; Noguchi, Keita; Nagao, Yumiko; Shimojima, Masayuki; Iwata, Hiroyuki; Mizuno, Takuya; Okuda, Masaru; Morimoto, Masahiro; Hayashi, Toshiharu; Tanaka, Yoshikazu; Mochizuki, Masami; Maeda, Ken

    2012-09-01

    In this study, the Japanese strain of type I feline infectious peritonitis virus (FIPV), C3663, was found to have a large deletion of 735 bp within the gene encoding the spike (S) protein, with a deduced loss of 245 aa of the N-terminal region of the S protein. This deletion is similar to that observed in porcine respiratory coronavirus (PRCoV) when compared to transmissible gastroenteritis virus, which correlates with reduced virulence. By analogy to PRCoV, we expected that the pathogenicity of C3663 may be attenuated in cats. However, two of four cats inoculated with C3663 died of FIP, and a third C3663-inoculated cat showed FIP lesions at 91 days after challenge. These results indicate that the 5'-terminal region of the S gene is not essential for the development of FIP.

  1. The physiological effects of deleting the mouse SLC30A8 gene encoding zinc transporter-8 are influenced by gender and genetic background.

    Directory of Open Access Journals (Sweden)

    Lynley D Pound

    Full Text Available The SLC30A8 gene encodes the islet-specific transporter ZnT-8, which is hypothesized to provide zinc for insulin-crystal formation. A polymorphic variant in SLC30A8 is associated with altered susceptibility to type 2 diabetes. Several groups have examined the effect of global Slc30a8 gene deletion but the results have been highly variable, perhaps due to the mixed 129SvEv/C57BL/6J genetic background of the mice studied. We therefore sought to remove the conflicting effect of 129SvEv-specific modifier genes.The impact of Slc30a8 deletion was examined in the context of the pure C57BL/6J genetic background.Male C57BL/6J Slc30a8 knockout (KO mice had normal fasting insulin levels and no change in glucose-stimulated insulin secretion (GSIS from isolated islets in marked contrast to the ∼50% and ∼35% decrease, respectively, in both parameters observed in male mixed genetic background Slc30a8 KO mice. This observation suggests that 129SvEv-specific modifier genes modulate the impact of Slc30a8 deletion. In contrast, female C57BL/6J Slc30a8 KO mice had reduced (∼20% fasting insulin levels, though this was not associated with a change in fasting blood glucose (FBG, or GSIS from isolated islets. This observation indicates that gender also modulates the impact of Slc30a8 deletion, though the physiological explanation as to why impaired insulin secretion is not accompanied by elevated FBG is unclear. Neither male nor female C57BL/6J Slc30a8 KO mice showed impaired glucose tolerance.Our data suggest that, despite a marked reduction in islet zinc content, the absence of ZnT-8 does not have a substantial impact on mouse physiology.

  2. Microcephaly, Intellectual Impairment, Bilateral Vesicoureteral Reflux, Distichiasis and Glomuvenous Malformations Associated with a 16q24.3 Contiguous Gene Deletion and a Glomulin Mutation

    Science.gov (United States)

    Butler, Matthew G.; Dagenais, Susan L.; Garcia-Perez, José L.; Brouillard, Pascal; Vikkula, Miikka; Strouse, Peter; Innis, Jeffrey W.; Glover, Thomas W.

    2012-01-01

    Two hereditary syndromes, lymphedema-distichiasis syndrome (LD) and blepharo-chelio-dontic (BCD) syndrome include the aberrant growth of eyelashes from the meibomian glands, known as distichiasis. LD is an autosomal dominant syndrome primarily characterized by distichiasis and the onset of lymphedema usually during puberty. Mutations in the forkhead transcription factor FOXC2 are the only known cause of LD. BCD syndrome consists of autosomal dominant abnormalities of the eyelid, lip, and teeth, and the etiology remains unknown. In this report, we describe a proband that presented with distichiasis, microcephaly, bilateral grade IV vesicoureteral reflux requiring ureteral re-implantation, mild intellectual impairment and apparent glomuvenous malformations. Distichiasis was present in three generations of the proband’s maternal side of the family. The glomuvenous malformations were severe in the proband, and maternal family members exhibited lower extremity varicosities of variable degree. A GLMN (glomulin) gene mutation was identified in the proband that accounts for the observed glomuvenous malformations; no other family member could be tested. TIE2 sequencing revealed no mutations. In the proband, an additional submicroscopic 265 kb contiguous gene deletion was identified in 16q24.3, located 609 kb distal to the FOXC2 locus, which was inherited from the proband’s mother. The deletion includes the C16ORF95, FBXO31, MAP1LC3B, and ZCCHC14 loci and 115 kb of a gene desert distal to FOXC2 and FOXL1. Thus, it is likely that the microcephaly, distichiasis, vesicoureteral and intellectual impairment in this family may be caused by the deletion of one or more of these genes and/or deletion of distant cis-regulatory elements of FOXC2 expression. PMID:22407726

  3. 不同基因缺失型酵母对全氟辛酸的灵敏性%Sensitivity of different gene deletion yeast to perfluorooctanoic acid

    Institute of Scientific and Technical Information of China (English)

    金士威; 程巧红; 戴和平

    2012-01-01

    针对全氟化合物这类新型的有机污染物,在环境中具有持久性,生物累积性和毒性的问题,以全氟辛酸为模型化合物,以真核生物酵母以及4基因缺失型酵母突变体和5基因缺失型酵母突变体为模式生物,开发便捷、灵敏的毒理学评价方法,探究全氟辛酸对不同基因缺失型酵母的毒性效应,以期建立以酵母为平台的环境污染物快速筛选系统.研究结果表明,5基因缺失型酵母突变体对全氟辛酸较为敏感,可以作为建立环境污染物快速筛选系统的细胞模型.%Perfluorinated compounds ( PFCs) are a class of emerging organic contaminants with persistent stability, strong bioaccumulation and high toxicity. To develop a convenient, sensitive toxicological evaluation method, perfluorooctanoic acid ( PFOA) was used as a model compound and eukaryotic yeast and its 4 genes deletion yeast mutant and 5 genes deletion yeast mutant were used as model organisms. The toxic effects of PFOA on different gene deletion yeast were studied. The results show that 5 genes deletion yeast mutant is more sensitive to PFOA, which can be used as a cell model to establish rapid screening system of environmental pollutants.

  4. Multi-species sequence comparison reveals dynamic evolution of the elastin gene that has involved purifying selection and lineage-specific insertions/deletions

    Directory of Open Access Journals (Sweden)

    Green Eric D

    2004-05-01

    Full Text Available Abstract Background The elastin gene (ELN is implicated as a factor in both supravalvular aortic stenosis (SVAS and Williams Beuren Syndrome (WBS, two diseases involving pronounced complications in mental or physical development. Although the complete spectrum of functional roles of the processed gene product remains to be established, these roles are inferred to be analogous in human and mouse. This view is supported by genomic sequence comparison, in which there are no large-scale differences in the ~1.8 Mb sequence block encompassing the common region deleted in WBS, with the exception of an overall reversed physical orientation between human and mouse. Results Conserved synteny around ELN does not translate to a high level of conservation in the gene itself. In fact, ELN orthologs in mammals show more sequence divergence than expected for a gene with a critical role in development. The pattern of divergence is non-conventional due to an unusually high ratio of gaps to substitutions. Specifically, multi-sequence alignments of eight mammalian sequences reveal numerous non-aligning regions caused by species-specific insertions and deletions, in spite of the fact that the vast majority of aligning sites appear to be conserved and undergoing purifying selection. Conclusions The pattern of lineage-specific, in-frame insertions/deletions in the coding exons of ELN orthologous genes is unusual and has led to unique features of the gene in each lineage. These differences may indicate that the gene has a slightly different functional mechanism in mammalian lineages, or that the corresponding regions are functionally inert. Identified regions that undergo purifying selection reflect a functional importance associated with evolutionary pressure to retain those features.

  5. Effect of deletion of the lpxM gene on virulence and vaccine potential of Yersinia pestis in mice.

    Science.gov (United States)

    Anisimov, Andrey P; Shaikhutdinova, Rima Z; Pan'kina, Lyudmila N; Feodorova, Valentina A; Savostina, Elena P; Bystrova, Ol'ga V; Lindner, Buko; Mokrievich, Aleksandr N; Bakhteeva, Irina V; Titareva, Galina M; Dentovskaya, Svetlana V; Kocharova, Nina A; Senchenkova, Sof'ya N; Holst, Otto; Devdariani, Zurab L; Popov, Yuriy A; Pier, Gerald B; Knirel, Yuriy A

    2007-04-01

    Yersinia pestis undergoes an obligate flea-rodent-flea enzootic life cycle. The rapidly fatal properties of Y. pestis are responsible for the organism's sustained survival in natural plague foci. Lipopolysaccharide (LPS) plays several roles in Y. pestis pathogenesis, prominent among them being resistance to host immune effectors and induction of a septic-shock state during the terminal phases of infection. LPS is acylated with 4-6 fatty acids, the number varying with growth temperature and affecting the molecule's toxic properties. Y. pestis mutants were constructed with a deletion insertion in the lpxM gene in both virulent and attenuated strains, preventing the organisms from synthesizing the most toxic hexa-acylated lipid A molecule when grown at 25 degrees C. The virulence and/or protective potency of pathogenic and attenuated Y. pestis DeltalpxM mutants were then examined in a mouse model. The DeltalpxM mutation in a virulent strain led to no change in the LD(50) value compared to that of the parental strain, while the DeltalpxM mutation in attenuated strains led to a modest 2.5-16-fold reduction in virulence. LPS preparations containing fully hexa-acylated lipid A were ten times more toxic in actinomycin D-treated mice then preparations lacking this lipid A isoform, although this was not significant (P>0.05). The DeltalpxM mutation in vaccine strain EV caused a significant increase in its protective potency. These studies suggest there is little impact from lipid A modifications on the virulence of Y. pestis strains but there are potential improvements in the protective properties in attenuated vaccine strains.

  6. Angiotensin-Converting Enzyme Gene Insertion/Deletion Polymorphism and Small Vessel Cerebral Stroke in Indian Population

    Directory of Open Access Journals (Sweden)

    Puttachandra Prabhakar

    2014-01-01

    Full Text Available Background. Hypertension is an established risk factor for small-vessel cerebral stroke and the renin-angiotensin system plays an important role in the maintenance of blood pressure. We aimed at evaluating the contribution of the angiotensin-converting enzyme (ACE gene insertion/deletion (I/D polymorphism to the risk of small-vessel stroke in south Indian population. Materials and Methods. We investigated 128 patients diagnosed with small-vessel stroke and 236 age, and gender-matched healthy controls. ACE I/D polymorphism was detected by polymerase chain reaction. Results. Hypertension was significantly more prevalent in the patient group and was associated with 6-fold increase in risk for stroke. ACE genotypes were in Hardy-Weinberg equilibrium in both patients and controls. Prevalence of DD, ID, and II genotypes in cases (34.4%, 43.7%, and 28% did not differ significantly from controls (31.8%, 43.2%, and 25%. The polymorphism was not associated with small-vessel stroke (OR: 1.34; 95% CI: 0.52–1.55. However, diastolic blood pressure was associated with the ACE I/D genotypes in the patients. (DD; 90.2±14.2> ID; 86.2±11.9> II; 82.3±7.8 mm Hg,  P=0.047. Conclusion. Our study showed that hypertension, but not ACE I/D polymorphism, increased the risk of small-vessel stroke.

  7. Gene deleted live attenuated Leishmania vaccine candidates against visceral leishmaniasis elicit pro-inflammatory cytokines response in human PBMCs

    Science.gov (United States)

    Avishek, Kumar; Kaushal, Himanshu; Ga